DOCSLIB.ORG

Barnase and Binase: Twins with Distinct Fates Vera Ulyanova, Valentina Vershinina and Olga Ilinskaya

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Barnase and Binase: Twins with Distinct Fates Vera Ulyanova, Valentina Vershinina and Olga Ilinskaya REVIEW ARTICLE Barnase and binase: twins with distinct fates Vera Ulyanova, Valentina Vershinina and Olga Ilinskaya Department of Microbiology, Kazan (Volga Region) Federal University, Kazan, Russia Keywords RNases are enzymes that cleave RNAs, resulting in remarkably diverse Bacillus; bacterial RNases; barnase; binase; biological consequences. Many RNases are cytotoxic. In some cases, they biosynthesis; cancer therapy; cytotoxicity; attack selectively malignant cells triggering an apoptotic response. A num- physiological role; practical application; ber of eukaryotic and bacterial RNase-based strategies are being developed RNase inhibitor for use in anticancer and antiviral therapy. However, the physiological Correspondence functions of these RNases are often poorly understood. This review focuses O. Ilinskaya, Department of Microbiology, on the properties of the extracellular RNases from Bacillus amyloliquefac- Kazan (Volga Region) Federal University, iens (barnase) and Bacillus intermedius (binase), the characteristics of their 18 Kremlyovskaya Street, Kazan 420008, biosynthesis regulation and their physiological role, with an emphasis on Russia the similarities and differences. Barnase and binase can be regarded as Fax: +7843 292 7418 molecular twins according to their highly similar structure, physical–chemi- Tel: +7843 233 7855 E-mail: [email protected] cal and catalytic properties. Nevertheless, the ‘life paths’ of these enzymes are not the same, as their expression in bacteria is controlled by diverse sig- (Received 3 March 2011, revised 29 July nals. Binase is predominantly synthesized under phosphate starvation, 2011, accepted 4 August 2011) whereas barnase production is strictly dependent on the multifunctional Spo0A regulator controlling sporulation, biofilm formation and cannibal- doi:10.1111/j.1742-4658.2011.08294.x ism. Barnase and binase also have some distinctions in practical applica- tions. Barnase was initially suggested to be useful in research and biotechnology as a tool for studying protein–protein interactions, for RNA elimination from biological samples, for affinity purification of RNase fusion proteins, for the development of cloning vectors and for sterility acquisition by transgenic plants. Binase, as later barnase, was tested for antiviral, antitumour and immunogenic effects. Both RNases have found their own niche in cancer research as a result of success in targeted delivery and selectivity towards tumour cells. Introduction In addition to their basic functions in RNA metabo- inhibition of tumour cell growth has been established lism, RNases are involved in the control of gene for close analogues of onconase from Rana catesbiana expression, cell growth and differentiation, host defence and Rana japonica oocytes [9], bull semen RNase [10], and physiological cell death pathways [1–4]. Many precursor of human eosinophil-derived neurotoxin [11] RNases show potent antineoplastic activity, but do not and human eosinophil cationic protein [12]. Although exhibit appreciable immunogenicity or nonspecific tox- the first paper demonstrating the antitumour activity of icity [5–7]. RNases are potential antitumour drugs bacterial nuclease from Serratia marcescens appeared because of their selective cytotoxicity. Their therapeutic in 1964 [13], the development of bacterial RNases into value has been demonstrated by an RNase derived antitumour drugs has remained almost uncharted terri- from the frog Rana pipiens, onconase (Alfacell, Inc., tory for many years. Recently, microbial RNases have Monmouth Junction, NJ, USA), which has advanced stepped out of the shadow of their well-known animal to phase IIIb confirmatory clinical trials for the treat- relatives, demonstrating different biological activities ment of unresectable malignant mesothelioma [8]. The suitable for practical applications. FEBS Journal 278 (2011) 3633–3643 ª 2011 The Authors Journal compilation ª 2011 FEBS 3633 Barnase and binase V. Ulyanova et al. The superfamily of microbial N1 ⁄ T1 RNases physical–chemical and catalytic properties of binase and (EC 3.1.27.3) consists of about 25 members of fungal ⁄ barnase should be very similar. bacterial a + b proteins that share sequence and tertiary Indeed, both barnase and binase are cationic pro- structural similarities [14]. They are small extracellular teins with isoelectric points of 9.2 and 9.5, respectively. enzymes that catalyse the overall hydrolysis of single- The enzymes are highly thermostable over a broad pH stranded RNA preferentially at guanylyl residues, range (pH 3–9). They cleave RNA molecules predomi- yielding new guanosine 3¢-phosphate and 5¢-OH ends. nantly after purine (guanine) residues with the forma- This occurs in a two-step process with cleavage of the tion of 3¢-mononucleotides and 3¢-dinucleotides as the RNA chain by transesterification of a 5¢-phosphoester final products. The optimum temperature for hydroly- bond to form a guanosine 2¢,3¢-cyclic phosphate termi- sis is 37 °C and the optimum pH value is pH 8.5. The nus in the first step, followed by its hydrolysis to a enzymes do not require any cofactors for activity. 3¢-phosphate product in the second independent step. Inside the cell, barnase is specifically inhibited by The best known member of this family is RNase T1, barstar, a small protein of 89 amino acids [23,24]. an extremely well-characterized fungal RNase from Barnase and barstar form a noncovalent one-to-one Aspergillus oryzae. Here, we introduce its bacterial rel- complex (Fig. 1B), which is one of the tightest known atives, ‘molecular twins’ barnase (Bacillus amylolique- and fastest forming [25]. The shape and charge of the faciens RNase) and binase (Bacillus intermedius interacting surfaces are highly complementary [26]. RNase) (Figs 1A and S1A). According to recent geno- Barstar inhibits barnase activity by sterically blocking typic identification, the strain known as B. intermedius its active site with an a-helix and adjacent loop. The belongs to the species of B. pumilus and is renamed association is stabilized by charge interaction involving appropriately (GenBank Accession No. HQ650161.1). the positively charged amino acid residues Lys27, However, given the historical preference, we address Arg59, Arg83 and Arg87 of barnase and the negatively the guanyl-preferring RNase as binase. Binase and charged Asp35, Asp39 and Glu76 of barstar [25,27]. barnase are unrelated to any mammalian RNases, and Binase has also been shown to be blocked by barstar therefore are not susceptible to omnipresent eukaryotic in vitro, but with much lower affinity [28,29]. Neverthe- RNase inhibitor [16]. As a consequence, they are more less, all attempts to purify a physiological inhibitor of toxic towards mammalian tumour cells than are RNas- binase have failed. es belonging to the pancreatic RNase A superfamily. Thus, binase and barnase can be regarded as molec- This makes bacterial RNases favourable for the devel- ular twins sharing the same phenotypic traits. The opment of new antitumour drugs. question is whether the ‘life paths’ of the RNases are Here, we summarize our current knowledge on the similar. To obtain a better understanding of their properties of binase and barnase, as well as their bio- physiological roles, one has to explore their origins. synthesis regulation, with an emphasis on the similari- ties and differences. We also discuss possible Two branches of the genealogical tree: physiological reasons for their production by bacteria, the basis of similarity and recent advances in the application of these toxic RNases. The Bacillus genus is a large group including 244 val- idly described species to date (http://www.bacte- rio.cict.fr/b/bacillus.html). The genus is phenotypically Two peas in a pod: phenotypic and genotypically heterogeneous, and researchers con- similarity tinue to separate new genera from it. Although B. am- Both barnase and binase are small, single-domain pro- yloliquefaciens and B. pumilus do not belong to the teins consisting of 110 and 109 amino acid residues with same phylogenetic cluster generally referred to as the molecular masses of 12 382 and 12 213 Da, respectively ‘Bacillus subtilis group’, their ‘branches’ on the phylo- [17,18]. Their primary structures share 85% identity. genetic tree of Bacillus species are adjacent (Fig. S1B Their secondary and tertiary NMR [19,20] and X-ray [15]). The physiology of the two species is quite [21,22] structures are almost superimposable (Fig. 1A). similar. The main habitat is soil, from which bacteria All functionally important amino acids incorporated are spread to other areas. Both B. amyloliquefaciens into the active centre, the substrate binding site and the and B. pumilus are often found in the rhizosphere. hydrophobic core are conserved among these two They are able to promote plant growth and suppress enzymes; substitutions are confined to the surface resi- plant pathogens [30]. Thus, B. amyloliquefaciens and dues only. The number of charged amino acids differs B. pumilus constitute closely related species that by just one additional Asp in barnase. Therefore, the occupy the same ecological niches. 3634 FEBS Journal 278 (2011) 3633–3643 ª 2011 The Authors Journal compilation ª 2011 FEBS V. Ulyanova et al. Barnase and binase A B C D Barnase -146 CGGAAGAACGCCGAAAAACCTTACTAAGGAATTTCAATAAGAAGAAAAATCCCGGTTGGTTCACCGGGGTTTATTTTTCGCTAGATAAAAAGT -10 +1 RBS fMet -53 ACTATTTTTAAATTCTTTCTATTCCTTTCTTTCGTTGCTGATACAATGAAAAGGAATCAGCTTCACATGATGAAAATGGGAGGTATTGCTTTG Binase -122 GACGCAGGATTCGGAGCTGCGTCTTTTTATTTATTTCATCAGAAGGTTATCAGTGAAAAAGCCTCATTTTAGCAAAGAACCTGTTTCTTTACA
Load more

Recommended publications
  • Backbone Dynamics of Free Barnase and Its Complex with Barstar Determined by 15N NMR Relaxation Study
    Journal of Biomolecular NMR, 18: 107–118, 2000. KLUWER/ESCOM 107 © 2000 Kluwer Academic Publishers. Printed in the Netherlands. Backbone dynamics of free barnase and its complex with barstar determined by 15N NMR relaxation study Sarata C. Sahua, Abani K. Bhuyanb, Jayant B. Udgaonkarb & R.V. Hosura;∗ aDepartment of Chemical Sciences, Tata Institute of Fundamental Research, Homi Bhabha Road, Mumbai 400005, India; bNational Centre for Biological Sciences, Tata Institute of Fundamental Research, University of Agricultural Sciences (UAS) - Gandhi Krishi Vigyan Kendra (GKVK) Campus, Bangalore 560 065, India Received 18 April 2000; Accepted 7 July 2000 Key words: backbone dynamics, barnase, barstar, complex, 15N NMR relaxation, protein–protein interactions Abstract Backbone dynamics of uniformly 15N-labeled free barnase and its complex with unlabelled barstar have been studied at 40 ◦C, pH 6.6, using 15N relaxation data obtained from proton-detected 2D {1H}-15N NMR spec- 15 troscopy. N spin-lattice relaxation rate constants (R1), spin-spin relaxation rate constants (R2), and steady-state heteronuclear {1H}-15N NOEs have been measured at a magnetic field strength of 14.1 Tesla for 91 residues of free barnase and for 90 residues out of a total of 106 in the complex (excluding three prolines and the N- terminal residue) backbone amide 15N sites of barnase. The primary relaxation data for both the cases have been analyzed in the framework of the model-free formalism using both isotropic and axially symmetric models of the rotational diffusion tensor. As per the latter, the overall rotational correlation times (τm) are 5.0 and 9.5 ns for the free and complexed barnase, respectively.
    [Show full text]
  • Characterization of in Vitro Oxidized Barstar
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Elsevier - Publisher Connector FEBS 15911 FEBS Letters 370 (1995) 273-277 Characterization of in vitro oxidized barstar C. Frisch, G. Schreiber, A.R. Fersht* Cambridge Centre for Protein Engineering, Medical Research Council Centre, Hills Road, Cambridge, CB2 2QH, UK Received 13 July 1995 mutant which has been solved independently by Guillet et al. Abstract The polypeptide inhibitor of the ribonuclease barnase, [8] to 2.6 A resolution and by Buckle et al. [4] to 2.0/k resolu- barstar, has two cysteine residues in positions 40 and 82. These tion. The distance between the s-carbon atoms of the alanines have been proposed to form a disulfide bridge leading to an in position 40 and 82 in the two crystal structures of the barstar increase in stability without changing the inhibitory activity of the protein. Barstar and a mutant (E80A) were oxidized in vitro and (C40A/C82A) double mutant is 11.4 A [8] and 11.7 A [4], re- the biochemical and physico-chemical properties of the oxidized spectively. In the solution structure of barstar that was deter- monomers were analysed. The oxidized proteins show no inhibi- mined by NMR [7] (Fig. 1), the distance between the s-carbon tion of barnase using a plate assay and are significantly destabi- atoms of the cysteines is 11.5 h. These s-carbon distances are lized. CD spectra indicate a loss of secondary structure. The outside the normal range for a disulfide bond, which is usually amino acid substitution E80 --~ A stabilizes the oxidized barstar from 4.4 to 6.8 A [9].
    [Show full text]
  • The Folding of Groel-Bound Barnase As a Model for Chaperonin-Mediated Protein Folding (Chaperone/Protein Engineering)
    Proc. Natl. Acad. Sci. USA Vol. 92, pp. 5326-5330, June 1995 Biochemistry The folding of GroEL-bound barnase as a model for chaperonin-mediated protein folding (chaperone/protein engineering) FERNANDO J. CORRALES AND ALAN R. FERSHT* Medical Research Council Unit for Protein Function and Design and Cambridge Centre for Protein Engineering, Department of Chemistry, University of Cambridge, Lensfield Road, Cambridge, CB2 lEW, United Kingdom Contributed by Alan R. Fersht, March 3, 1995 ABSTRACT We have analyzed the pathway of folding of solution, then the rate of folding should fall to zero when all barnase bound to GroEL to resolve the controversy ofwhether the barnase becomes bound at saturating concentrations of proteins can fold while bound to chaperonins (GroEL or GroEL. Cpn6O) or fold only after their release into solution. Four We now analyze the folding pathway in detail by stopped- phases in the folding were detected by rapid-reaction kinetic flow monitoring the change of tryptophan fluorescence of measurements of the intrinsic fluorescence of both wild type barnase, GroEL not having tryptophan residues. Unfortu- and barnase mutants. The phases were assigned from their nately, the fluorescence of denatured barnase when bound to rate laws, sensitivity to mutations, and correspondence to GroEL is so close to that of fully folded barnase that it is regain ofcatalytic activity. At high ratios ofdenatured barnase difficult to monitor the folding by using conventional stopped- to GroEL, 4 mol ofbarnase rapidly bind per 14-mer of GroEL. flow fluorimeters. We have now overcome these difficulties by At high ratios of GroEL to barnase, 1 mol of barnase binds replacing Trp-94 by tyrosine (mutant W94Y), which removes with a rate constant of 3.5 x 107 s-1 M-1.
    [Show full text]
  • Investigating the Structural Determinants of Electrostatic Binding Among Protein-Protein Complexes: a Systematic, Large-Scale Computational Study
    Investigating the Structural Determinants of Electrostatic Binding among Protein-protein Complexes: A Systematic, Large-scale Computational Study Emma Nechamkin April 2012 Wellesley College Wellesley, MA Submitted in Partial Fulfillment of the Prerequisites for Honors in Chemistry Acknowledgements Writing my senior thesis has been a wonderful experience, and there are many people to whom I owe thanks for support and guidance. First and foremost, my brilliant advisor Mala Radhakrishnan has been incredibly supportive and understanding. In dorkier terms, her advising style is incredibly close to the hypothetical optimum. Without her constant guidance, motivation, and feed- back, my thesis simply would not exist. I am truly grateful to be a student in her lab. Second, the faculty on my thesis committee, David Haines and Don Elmore of the Chemistry Department, and YuJin Ko of the English Department, have dedicated significant time to my thesis. In particular, the chemistry faculty on my committee have provided insight on much of my work and offered much needed encouragement. Third, I would like to thank the entire Wellesley College Chemistry Department. Clearly the best department on campus, the chemistry department has an unparal- leled involvement with and dedication to its students. At a sometimes stressful and overwhelming school like Wellesley, I am glad to have found my niche. Fourth, each member of the Radhakrishnan Lab over my time here has taught me something about research and listened to at least one incredibly long story I have shared. For the group's helpfulness, reassurance, and companionship, I am deeply grateful. In particular, Ying Yi Zhang has shared some wonderful code with me.
    [Show full text]
  • FOR Environmental Release of Genetically Engineered Mustard
    Assessment of Food and Environmental Safety of GE mustard ASSESSMENT OF FOOD AND ENVIRONMENTAL SAFETY (AFES) FOR Environmental release of Genetically Engineered Mustard (Brassica juncea) hybrid DMH-11 and use of parental events (Varuna bn3.6 and EH2 modbs2.99) for development of new generation hybrids Application submitted by Centre for Genetic Manipulation of Crop Plants (CGMCP), University of Delhi South Campus, New Delhi 2016 1 Assessment of Food and Environmental Safety of GE mustard 2 Assessment of Food and Environmental Safety of GE mustard Table of Contents 1 CHAPTER 1: INTRODUCTION 5 1.1 The Application 6 1.2 Global status of hybrid seed production technology in Brassica napus using MS-RF system deploying the genes used for B. juncea 8 2 CHAPTER 2: BIOLOGY OF INDIAN MUSTARD 11 2.1 Origin and domestication of Brassica juncea 11 2.2 Brassica species present in India and their distribution 12 2.3 Cultivation of B. juncea: soil and climate requirement 14 2.4 Standard agriculture practices for growing B. juncea 14 2.5 Weeds, Major pest and disease 15 2.6 Zonalization of varietal testing 15 3 CHAPTER 3: INDIAN BIOSAFETY REGULATORY FRAMEWORK 17 3.1 Introduction 17 3.2 Step by step process to be followed by the applicant 22 3.3 Step by step regulatory compliance and data generation in the case of GE mustard parental lines and hybrid DMH-11 24 3.4 Assessment of Food/feed and Environmental Safety (AFES) - Risk Assessment Process 25 4 CHAPTER 4: MOLECULAR CHARACTERIZATION OF GE MUSTARD HYBRID DMH-11 AND ITS PARENTAL LINES 33 4.1 Introduction 33 4.2 The male sterility- fertility restorer technology 34 4.3 Gene constructs 35 4.4 Method of genetic transformation of B.
    [Show full text]
  • A General Approach for the Generation of Orthogonal Trnas
    Chemistry & Biology 8 (2001) 883^890 www.elsevier.com/locate/chembiol Research Paper A general approach for the generation of orthogonal tRNAs Lei Wang a; 1, Peter G. Schultz b; * aDepartment of Chemistry, University of California at Berkeley, Berkeley, CA 94720, USA bDepartment of Chemistry, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037, USA Received 26 March 2001; accepted 29 May 2001 First published online 27 July 2001 Abstract Background: The addition of new amino acids to the genetic cognate M. jannaschii tyrosyl-tRNA synthetase (TyrRS). Four code of Escherichia coli requires an orthogonal suppressor tRNA mutant suppressor tRNAs were selected that are poorer substrates Tyr that is uniquely acylated with a desired unnatural amino acid by for E. coli synthetases than M. jannaschii tRNACUA, but still can Tyr an orthogonal aminoacyl-tRNA synthetase. A tRNACUA^tyrosyl- be charged efficiently by M. jannaschii TyrRS. Tyr tRNA synthetase pair imported from Methanococcus jannaschii Conclusions: The mutant suppressor tRNACUA together with can be used to generate such a pair. In vivo selections have been the M. jannaschii TyrRS is an excellent orthogonal tRNA^ developed for selecting mutant suppressor tRNAs with enhanced synthetase pair for the in vivo incorporation of unnatural amino orthogonality, which can be used to site-specifically incorporate acids into proteins. This general approach may be expanded to unnatural amino acids into proteins in E. coli. generate additional orthogonal tRNA^synthetase pairs as well as Results: A library of amber suppressor tRNAs derived from M. probe the interactions between tRNAs and their cognate Tyr Tyr jannaschii tRNA was generated.
    [Show full text]
  • Part II – Summary
    Bayer CropScience AG EFSA-GMO-BE-2010-81 Page 1 of 22 15 September 2011 Part II – Summary PART II Request for Authorization of Glufosinate Ammonium-Tolerant Genetically Modified Oilseed Rape MS8, RF3 and MS8xRF3 in accordance with article 5 of Regulation (EC) N° 1829/2003 A. GENERAL INFORMATION 1. Details of application a) Member State of application: Belgium b) Application number: EFSA-GMO-BE-2010-81 c) Name of the product (commercial and other names): Glufosinate ammonium-tolerant genetically modified MS8, RF3 and MS8xRF3 oilseed rape. The unique identifiers assigned to MS8/RF31 oilseed rape are: MS8: ACS-BNØØ5-8 RF3: ACS-BNØØ3-6 MS8xRF3: ACS-BNØØ5-8xACS-BNØØ3-6 d) Date of acknowledgement of valid application: Not available at the date of application 2. Applicant a) Name of applicant: This is an application submitted by Bayer CropScience AG. b) Address of applicant: Bayer CropScience AG represented by Bayer BioScience NV Alfred-Nobel-Strasse 50 Technologiepark 38 D - 40789 Monheim am Rhein B-9052 Gent Germany Belgium c) Name and address of the person established in the Community who is responsible for the placing on the market, whether it be the manufacturer, the importer or the distributor, if different from the applicant (Commission Decision 2004/204/EC Art 3(a)(ii)): MS8/RF3 oilseed rape will be imported and processed in the EU by the same groups who currently import, 1 The designation “MS8/RF3” is used to refer to “MS8, RF3 and MS8xRF3”. Bayer CropScience AG EFSA-GMO-BE-2010-81 Page 2 of 22 15 September 2011 Part II – Summary process and distribute commodity oilseed rape.
    [Show full text]
  • Identification and Characterization of Protein Folding Intermediates Stefano Gianni, Ylva Ivarsson, Per Jemth, Maurizio Brunori, Carlo Travaglini-Allocatelli
    Identification and characterization of protein folding intermediates Stefano Gianni, Ylva Ivarsson, Per Jemth, Maurizio Brunori, Carlo Travaglini-Allocatelli To cite this version: Stefano Gianni, Ylva Ivarsson, Per Jemth, Maurizio Brunori, Carlo Travaglini-Allocatelli. Identifica- tion and characterization of protein folding intermediates. Biophysical Chemistry, Elsevier, 2007, 128 (2-3), pp.105. 10.1016/j.bpc.2007.04.008. hal-00501662 HAL Id: hal-00501662 https://hal.archives-ouvertes.fr/hal-00501662 Submitted on 12 Jul 2010 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. ÔØ ÅÒÙ×Ö ÔØ Identification and characterization of protein folding intermediates Stefano Gianni, Ylva Ivarsson, Per Jemth, Maurizio Brunori, Carlo Travaglini- Allocatelli PII: S0301-4622(07)00087-7 DOI: doi: 10.1016/j.bpc.2007.04.008 Reference: BIOCHE 4952 To appear in: Biophysical Chemistry Received date: 29 March 2007 Revised date: 16 April 2007 Accepted date: 16 April 2007 Please cite this article as: Stefano Gianni, Ylva Ivarsson, Per Jemth, Maurizio Brunori, Carlo Travaglini-Allocatelli, Identification and characterization of protein folding inter- mediates, Biophysical Chemistry (2007), doi: 10.1016/j.bpc.2007.04.008 This is a PDF file of an unedited manuscript that has been accepted for publication.
    [Show full text]
  • Spectrin SH3 Domain Xavier Periole,1* Michele Vendruscolo,2 and Alan E
    proteins STRUCTURE O FUNCTION O BIOINFORMATICS Molecular dynamics simulations from putative transition states of a-spectrin SH3 domain Xavier Periole,1* Michele Vendruscolo,2 and Alan E. Mark1,3,4* 1 Department of Biophysical Chemistry, Groningen Biomolecular Sciences and Biotechnology Institute (GBB), University of Groningen, 9747 AG Groningen, The Netherlands 2 Department of Chemistry, University of Cambridge, Cambridge CB2 1EW, United Kingdom 3 School of Molecular and Microbial Sciences, University of Queensland, St Lucia, 4072, Queensland, Australia 4 Institute for Molecular Biosciences, University of Queensland, St Lucia, 4072, Queensland, Australia INTRODUCTION ABSTRACT Understanding of the process of protein folding is one of the grand challenges in A series of molecular dynam- molecular biology. Ever since it was shown that the information contained in the ics simulations in explicit sol- sequence of amino acids is sufficient for a protein to find the structure of its native vent were started from nine state,1 experimentalists and theoreticians have tried to understand the mechanisms of structural models of the tran- this important biological process.2–5 sition state of the SH3 do- 5 main of a-spectrin, which Much effort has been focused on proteins that undergo two-state folding. The pri- were generated by Lindorff- mary advantage of two-state proteins is the lack of detectable intermediate states, so Larsen et al. (Nat Struct Mol their folding process can be considered as involving a transition from a broad ensem- Biol 2004;11:443–449) using ble of configurations representing the unfolded state to a narrow ensemble of configu- molecular dynamics simula- rations making up the native state, via a specific transition state.
    [Show full text]
  • Recombinant Expression of Barnase in Escherichia Coli and Its
    Shankar et al. Microb Cell Fact (2021) 20:171 https://doi.org/10.1186/s12934-021-01642-y Microbial Cell Factories RESEARCH Open Access Recombinant expression of Barnase in Escherichia coli and its application in plasmid purifcation Ram Shankar1* , Nina Schäfer1, Marco Schmeer1, Joe Max Risse2, Karl Friehs2 and Martin Schleef1,2,3* Abstract Background: The use of bovine-origin ribonucleases has been part of the standard protocol for plasmid DNA purif- cation. As the feld of gene therapy now enters the clinical stage, such enzymes need to be phased out or alternative purifcation protocols need to be developed to ensure product safety and regulatory compliance. The recombinant expression of bacterial RNase is fraught with toxicity problems making it a challenging enzyme to express. The current study describes a plasmid construct that allowed expression of barnase in Escherichia coli under co-expression of its native inhibitor barstar. Results: The pure enzyme without the inhibitor barstar was exported to the extracellular space through the peri- plasm and then purifed from the cell-free supernatant. Cation exchange chromatography was employed as a primary purifcation step. This was followed by hydrophobic interaction chromatography which resulted in a concentrated fraction of active enzyme. Although current levels of volumetric activity achieved are quite meagre (4 Kunitz units 1 mL− ), in principle its application to plasmid DNA purifcation could be proved. Currently, this is capable of processing small amounts (13 g) of bacterial biomass for plasmid production. Conclusions: The current work focusses on the downstream purifcation strategies for a recombinant RNase and sets a framework for higher scale production if specifc productivity is increased by optimal hosts and/or re-engineered plasmids.
    [Show full text]
  • Molecular Constructor on the Basis of Barnase–Barstar Module
    ISSN 1068-1620, Russian Journal of Bioorganic Chemistry, 2009, Vol. 35, No. 6, pp. 685–701. © Pleiades Publishing, Ltd., 2009. Original Russian Text © S.M. Deev, E.N. Lebedenko, 2009, published in Bioorganicheskaya Khimiya, 2009, Vol. 35, No. 6, pp. 761–778. Antibody Engineering: Molecular Constructor on the basis of Barnase–Barstar Module S. M. Deev1 and E. N. Lebedenko Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, ul. Miklukho-Maklaya 16/10, Moscow, 117997 Russia Received May 19, 2009; in final form, May 29, 2009 Abstract—Today, antibody engineering for clinical applications is a rapidly progressing field of science and a big business. The basic functions of an antibody can be spatially differentiated and attributed to various struc- tural domains of a molecule. Therefore, each of them may be an object for engineering with the aim of using a definite antibody function. In this sense, the potential of antibodies is unique. In this article, recent achieve- ments and current problems of antibody engineering are briefly reviewed. The main attention is focused on a molecular constructor that allows for obtaining, with the help of a versatile barnase–barstar module, mono- and multivalent miniantibodies and their derivatives with outlined properties. Key words: single chain antibodies, multivalency, bispecificity, targeted delivery, barnase–barstar module DOI: 10.1134/S1068162009060041 INTRODUCTION mAbs), active or diagnostic agents, for instance, cytok- ines, protein toxins and radioisotopes, enzymes, fluo- Currently, antibodies have the second largest pro- rescent proteins, etc. duction value in the pharmaceutical market after vac- cines. More than 85% of antibodies permitted for clin- The current review will focus on a molecular con- ical use are products of antibody engineering.
    [Show full text]
  • Adaptation of E. Coli Towards Tryptophan Analog Usage
    Adaptation of E. coli towards Tryptophan analog usage vorgelegt von Master of Science in Chemie Stefan Oehm aus Neumarkt i.d.OPf. von der Fakultät II - Mathematik und Naturwissenschaften der Technischen Universität Berlin zur Erlangung des akademischen Grades Doktor der Naturwissenschaften Dr. rer. nat. genehmigte Dissertation Promotionsausschuss Vorsitzende: Prof. Dr. rer. nat. Maria Andrea Mroginski Gutachter: Prof. Dr. rer. nat. Nediljko Budisa Gutachter: Prof. Dr. rer. nat. Rupert Mutzel Tag der wissenschaftlichen Aussprache: 11.07.2016 Berlin 2016 Look what I have found A seashell in a sea of shells I’m good at planting my own seeds To sprout endless hell It’s dark like Poe Dredg - Planting Seeds Parts of this work were published as listed below Oehm, S., Hösl, M., Peil, L. , Semmler, T., Rappsilber, J., Budisa, N. Mechanisms of an adap- tive evolution experiment towards non-canonical amino acid usage manuscript in preparation Hösl, M. G., Oehm, S., Durkin, P., Peil, L., Rappsilber, J., Rinehart, J., Darmon, E., Leach, D., Söll, D., Budisa, N., Chemical Evolution of a Bacterium’s Proteome Angewandte Chemie - International Edition, 2015, 54(34), 10030-34 Parts of this work were presented as listed below Poster presentation at the Protein Synthesis Meeting, St. Augustine, USA – June 2015 Project talk at the GRK Fluorine graduate school, Berlin, Deutschland – May 2015 Project talk at the COST CM1004 Spring Meeting, Berlin, Deutschland – April 2013 Contents Summary I Zusammenfassung III Abbreviations V List of Figures IX List of Tables XI 1 Introduction 1 1.1 The Genetic Code . 1 1.2 Genetic code engineering . 5 1.2.1 Ambiguous decoding .
    [Show full text]