TRANSCRIPTIONAL CONTROL OF GAMMA SYNTHESIS BY

NATURAL KILLER CELLS

DISSERTATION

Presented in Partial Fulfillment of the Requirements for The Degree Doctor of

Philosophy in the Graduate School of The Ohio State University

By

Michael Brian Becknell, B.A.

*****

The Ohio State University

2006

Dissertation Committee:

Michael A. Caligiuri, M.D., Adviser

Denis Guttridge, Ph.D. Approved by

Danilo Perrotti, M.D., Ph.D. ______

Saïd Sif, Ph.D. Adviser Integrated Biomedical Sciences Graduate Program

ABSTRACT

Natural killer (NK) cells fill an critical niche in the mammalian immune system.

In addition to deleting compromised host cells through a variety of cytolytic mechanisms,

NK cells orchestrate the innate and adaptive immune response via the production of a set of protein factors called . In particular, NK cells elaborate

(IFN-γ) in response to a variety of pathologic stimuli, both extrinsic and intrinsic to the host. The importance of NK-derived IFN-γ is tragically illustrated by rare cases of pediatric immune deficiency, in which children lacking NK cells and/or a functional IFN-

γ signaling pathway succumb to microbial infection early in life. Despite the clear importance of IFN-γ in host defense against intracellular pathogens and tumorigenesis, it is equally apparent that excessive IFN-γ production contributes to the etiology of pro- inflammatory disease states, including but not limited to the generalized Shwartzman reaction, inflammatory bowel disease, and graft versus host disease. A better understanding of the regulation of IFN-γ by NK cells may facilitate the manipulation of this process in patients whose disease is due to too much or too little IFN-γ production.

With this goal in mind, this study has focused on the regulation of IFN-γ messenger RNA

(mRNA) synthesis in NK cells. In the work summarized herein, we developed the methodology to retrovirally transduce primary NK cells and NK-derived cell lines with

-ii - transcription factors and determined their role in IFN-γ transcription. We applied this methodology to the study of two candidate regulators of IFN-γ transcription, T-bet and

Hlx. Whereas T-bet is required for optimal IFN-γ synthesis by NK cells, we found that

Hlx is a novel inhibitor of IFN-γ transcription in NK cells, and that this regulatory role is

achieved through both direct and indirect mechanisms. These studies – when integrated

with parallel work conducted in our laboratory and by many other talented laboratories

worldwide – enable us to begin to comprehend the network of positive and negative

regulatory events that ultimately dictate the outcome of transcriptional activity at the

IFN-γ promoter.

-iii -

To Debbie and Sophia.

-iv -

ACKNOWLEDGMENTS

I wish to especially thank my wife, Debbie: for her unflagging love and support; for her encouragement; and for her honesty. For all these things, I am forever grateful.

Thank you next to my parents, Jerry and Eileen Becknell, for believing in me and for your unconditional love.

I want to express my most sincere gratitude to my mentor, Dr. Michael Caligiuri,

who has always been a source of wisdom, both about NK cell biology and about life.

Mike, I am constantly in awe of the way in which you inspire me and the people around

you. You truly bring out the best in a person. I am deeply honored to have worked with

you for this long.

To my colleagues in the Caligiuri Lab: you are my dear friends. Thank you for

your support, your criticism (scientific and otherwise), and the comic relief you have

provided (consciously or otherwise) over the years. In particular, I wish to acknowledge

the tremendous effort of Tiffany Hughes in contributing to this work.

I want to thank my thesis committee, Dr. Denis Guttridge, Dr. Danilo Perrotti, and

Dr. Saïd Sif. Each of you has provided valuable scientific instruction over the years. I

respect you deeply and thank you for the time you have spent on my behalf.

- v - I also thank Dr. Sif and Sharmistha Pal, his talented graduate student, who taught me a great deal during my time in the Sif laboratory in 2004.

I thank Dr. Allan Yates for his enormous investment of time and talent in creating the Integrated Biomedical Science Program at OSU, as well as his resuscitation of the

Medical Scientist Program.

I wish to acknowledge the following sources of financial support over the course of my tenure as a graduate student: the NSF Predoctoral Fellowship, the Dean's

Distinguished University Fellowship, the Bennett Fellowship, and the Medical Scientist

Program.

- vi -

VITA

July 16, 1974 ……………………………………………Born, Clarksville, Tennessee

1997 ……………………………………………………..B.A., Kenyon College, Magna cum Laude, with Distinction and Highest Honors in Molecular Biology

1997-1999 ……………………………………………..Ph.D. student, Molecular and Cellular Biology Program, Washington University in St. Louis

1999-present…………………………………………….M.D. Student, The Ohio State University

PUBLICATIONS

Peer-Reviewed Research Articles

1. Yu J, Wei M, Becknell B, Trotta R, Liu S, Boyd Z, Jaung MS, Blaser BW, Sun J, Benson DM Jr, Mao H, Yokohama A, Bhatt D, Shen L, Davuluri R, Weinstein M, Marcucci G, Caligiuri MA. Pro- and Antiinflammatory Signaling: Reciprocal Antagonism Regulates Interferon-gamma Production by Human Natural Killer Cells. Immunity 2006 May; 24(5): 575-90.

2. Freud AG, Yokohama A, Becknell B, Lee MT, Mao HC, Ferketich AK, Caligiuri MA. Evidence for discrete stages of human natural killer cell differentiation in vivo. Journal of Experimental Medicine 2006 April 17; 203(4): 1033-43.

3. Vandeusen JB, Shah MH, Becknell B, Blaser BW, Ferketich AK, Nuovo GJ, Ahmer BM, Durbin J, Caligiuri MA. STAT-1-mediated repression of

- vii - -10 gene expression in vivo. European Journal of Immunology 2006 Feb 15; 36(3): 623-30.

4. Mikhalkevich N, Becknell B, Caligiuri MA, Bates MD, Harvey R, Zheng WP. Responsiveness of naive CD4 T cells to polarizing cytokine determines the ratio of Th1 and Th2 cell differentiation. Journal of Immunology 2006 Feb 1; 176(3): 1553-60.

5. Freud AG, Becknell B, Roychowdhury S, Mao HC, Ferketich AK, Nuovo GJ, Hughes TL, Marburger TB, Sung J, Baiocchi RA, Guimond M, Caligiuri MA. A human CD34(+) subset resides in lymph nodes and differentiates into CD56bright natural killer cells. Immunity 2005 March; 22(3): 295-304.

6. Whitman SP, Liu S, Vukosavljevic T, Rush LJ, Yu L, Liu C, Klisovic MI, Maharry K, Guimond M, Strout MP, Becknell B, Dorrance A, Klisovic RB, Plass C, Bloomfield CD, Marcucci G, Caligiuri MA. The MLL partial tandem duplication: evidence for recessive gain-of-function in acute myeloid leukemia identifies a novel patient subgroup for molecular-targeted therapy. Blood 2005 July 1; 106(1): 345-52.

7. Liu S, Shen T, Huynh L, Klisovic MI, Rush LJ, Ford JL, Yu J, Becknell B, Li Y, Liu C, Vukosavljevic T, Whitman SP, Chang KS, Byrd JC, Perrotti D, Plass C, Marcucci G. Interplay of RUNX1/MTG8 and DNA methyltransferase 1 in acute myeloid leukemia. Cancer Research 2005 February 15; 65(4): 1277-84.

8. Yu L, Liu C, Vandeusen J, Becknell B, Dai Z, Wu YZ, Raval A, Liu TH, Ding W, Mao C, Liu S, Smith LT, Lee S, Rassenti L, Marcucci G, Byrd J, Caligiuri MA, Plass C. Global assessment of promoter methylation in a mouse model of cancer identifies ID4 as a putative tumor-suppressor gene in human leukemia. Nature Genetics 2005 March; 37(3): 265-74.

9. Becknell B, Trotta R, Yu J, Ding W, Mao HC, Hughes T, Marburger T, Caligiuri MA. Efficient infection of human natural killer cells with an EBV/retroviral hybrid vector. Journal of Immunological Methods 2005 January; 296(1-2): 115-23.

10. Trotta R, Parihar R, Yu J, Becknell B, Allard J 2nd, Wen J, Ding W, Mao H, Tridandapani S, Carson WE, Caligiuri MA. Differential expression of SHIP1 in CD56bright and CD56dim NK cells provides a molecular basis for distinct functional responses to monokine costimulation. Blood 2005 April 15; 105(8): 3011-8.

11. Yu L, Liu C, Bennett K, Wu YZ, Dai Z, Vandeusen J, Opavsky R, Raval A, Trikha P, Rodriguez B, Becknell B, Mao C, Lee S, Davuluri RV, Leone G, Van den Veyver IB, Caligiuri MA, Plass C. A NotI-EcoRV promoter library for studies of genetic and epigenetic alterations in mouse models of human malignancies. Genomics 2004 October; 84(4):647-60.

- viii - 12. Igarashi T, Wynberg J, Srinivasan R, Becknell B, McCoy JP Jr, Takahashi Y, Suffredini DA, Linehan WM, Caligiuri MA, Childs RW. Enhanced cytotoxicity of allogeneic NK cells with killer immunoglobulin-like receptor ligand incompatibility against melanoma and renal cell carcinoma cells. Blood 2004 July 1; 104(1):170-7.

13. Becknell B, Shen T, Maghraby E, Taya S, Kaibuchi K, Caligiuri MA, Marcucci G. Characterization of leukemia-associated Rho guanine nucleotide exchange factor (LARG) expression during murine development. Cell and Tissue Research 2003 December; 314(3): 361-6.

14. Lesinski GB, Anghelina M, Zimmerer J, Bakalakos T, Badgwell B, Parihar R, Hu Y, Becknell B, Abood G, Chaudhury AR, Magro C, Durbin J, Carson WE 3rd. The antitumor effects of IFN-alpha are abrogated in a STAT1-deficient mouse. Journal of Clinical Investigation 2003 July; 112(2): 170-80.

15. Farag SS, George SL, Lee EJ, Baer M, Dodge RK, Becknell B, Fehniger TA, Silverman LR, Crawford J, Bloomfield CD, Larson RA, Schiffer CA, Caligiuri MA. Postremission therapy with low-dose with or without intermediate pulse dose interleukin 2 therapy is well tolerated in elderly patients with acute myeloid leukemia: Cancer and Leukemia Group B study 9420. Clinical Cancer Research 2002 September; 8(9): 2812-9.

16. Whitman SP, Archer KJ, Feng L, Baldus C, Becknell B, Carlson BD, Carroll AJ, Mrozek K, Vardiman JW, George SL, Kolitz JE, Larson RA, Bloomfield CD, Caligiuri MA. Absence of the wild-type allele predicts poor prognosis in adult de novo acute myeloid leukemia with normal cytogenetics and the internal tandem duplication of FLT3: a cancer and leukemia group B study. Cancer Research 2001 October 1; 61(19): 7233- 9.

17. Reuther GW, Lambert QT, Booden MA, Wennerberg K, Becknell B, Marcucci G, Sondek J, Caligiuri MA, Der CJ. Leukemia-associated Rho guanine nucleotide exchange factor, a Dbl family protein found mutated in leukemia, causes transformation by activation of RhoA. Journal of Biological Chemistry 2001 July 20; 276(29): 27145- 51.

18. Kourlas PJ, Strout MP, Becknell B, Veronese ML, Croce CM, Theil KS, Krahe R, Ruutu T, Knuutila S, Bloomfield CD, Caligiuri MA. Identification of a gene at 11q23 encoding a guanine nucleotide exchange factor: evidence for its fusion with MLL in acute myeloid leukemia. Proceedings of the National Academy of Sciences 2000 February 29; 97(5): 2145-50.

19. Harada H, Becknell B, Wilm M, Mann M, Huang LJ, Taylor SS, Scott JD, Korsmeyer SJ. Phosphorylation and inactivation of BAD by mitochondria-anchored protein kinase A. Molecular Cell 1999 April; 3(4): 413-22.

- ix -

Invited Reviews

19. Becknell B, Caligiuri MA. Interleukin-2, interleukin-15, and their roles in human natural killer cells” Advances in Immunology 2005; 86: 209-39.

20. Becknell B, Caligiuri MA. Cancer T cell therapy expands. Nature Medicine 2003 March; 9(3): 257-8.

21. Farag SS, Fehniger TA, Becknell B, Blaser BW, Caligiuri MA. New directions in natural killer cell-based immunotherapy of human cancer. Expert Opinion on Biological Therapy 2003 April; 3(2): 237-50.

FIELDS OF STUDY

Major Field: Integrated Biomedical Sciences Graduate Program

- x -

TABLE OF CONTENTS

Page Abstract...... ii

Dedication...... iv

Acknowledgments...... v

Vita...... vii

Table of Contents...... xi

List of Figures...... xiii

List of Tables...... xv

List of Abbreviations...... xvi

Chapters

1. Role of IFN-γ Production by NK Cells in the Immune Response...... 1 1.1. NK cells and the Innate Immune Response...... 1 1.2. Role of NK Derived IFN-γ in the Innate Immune Response...... 2 1.3. Role of NK Derived IFN-γ in the Adaptive Immune Response...... 3 1.4. The CD56bright NK Cell Subset is the Principal Source of NK Derived IFN-γ in Human Peripheral Blood and SLT...... 4 1.5. Expression of IFN-γ by Immune Cells Can Be Detrimental to the Host...... 5 1.6. IFN-γ Synthesis is Subject to Stringent Regulation by Multiple Mechanisms in NK Cells...... 6

2. Transcriptional Regulation of IFN-γ in NK cells...... 16 2.1. Introduction…………………………………………………...... 16 2.2. Chromatin Remodeling at the IFN-γ Locus in NK Cells...... 17 2.3. Proposed Models of Transcriptional Activation of the IFN-γ Promoter Following Monokine Co-stimulation…………………….19 - xi - 2.4. Role of T-bet and Hlx in IFN-γ Transcription...... 21 2.5. Role of TGF-β in the Negative Regulation of IFN-γ Transcription………………………………………………………..23

3. Efficient Infection of Human NK Cells with an EBV / Retroviral Hybrid Vector....29 3.1. Introduction...... 29 3.2. Methods...... 31 3.3. Results...... 35 3.4. Discussion...... 38

4. The Homeobox Transcription Factor, Hlx, is a Negative Regulator of IFN-γ Production in NK Cells...... 51 4.1. Introduction...... 51 4.2. Methods...... 53 4.3. Results...... 63 4.4. Discussion...... 70

5. Synthesis and Conclusion...... 101

Literature Cited...... 103

- xii -

LIST OF FIGURES

Figure Page

Figure 1. Role of NK cell derived IFN-γ in the innate immune response...... 8

Figure 2. Role of NK cell derived IFN-γ in the adaptive immune response...... 10

Figure 3. The CD56bright NK subset is the principal source of IFN-γ among human NK cells...... 12

Figure 4. IFN-γ synthesis is regulated at multiple steps in NK cells...... 14

Figure 5. Infection of primary NK cells with PINCO...... 40 . Figure 6. Infection of NK-92 cells with PINCO...... 42

Figure 7. Infection of NK-92 cells with PINCO8...... 44

Figure 8. Infected primary NK and NK-92 cells retain NK effector functions...... 46

Figure 9. T-bet is required for optimal IFN-γ synthesis by NK-92 cells...... 48

Figure 10. Hlx is induced by monokine co-stimulation in CD56bright NK cells, and its expression is delayed with respect to IFN-γ...... 80

Figure 11. Hlx inhibits IFN-γ production by primary CD56bright NK...... 82

Figure 12. Hlx inhibits IFN-γ mRNA and protein expression in NK-92 cells...... 84

Figure 13. Increased expression of IFN-γ mRNA and protein by Hlx deficient NK cells...... 86

Figure 14. Hlx decreases expression of active, Y693 pSTAT4 protein in a proteasome dependent manner...... 88

- xiii - Figure 15. Hlx regulates Y693 pSTAT4 levels independently of new protein synthesis...... 90

Figure 16. Hlx represses IFN-γ promoter activity in NK cells...... 92

Figure 17. Potential role for Groucho/TLE co-repressors in Hlx repression of IFN-γ promoter activity...... 94

Figure 18. Hlx associates with INI1, an essential component of the SWI/SNF chromatin remodeling complexes, in vitro...... 96

- xiv -

LIST OF TABLES

Table Pages

Table 1. Trans-Acting Factors Implicated in the Control of IFN-γ Transcription in NK cells ...... 26

Table 2. Potential Protein Binding Partners of Hlx Identified by Yeast 2-Hybrid Screening...... 98

- xv -

LIST OF ABBREVIATIONS

AIDS...... Acquired Immune Deficiency Syndrome AP-1...... Activation Protein-1 cDNA...... complementary DNA DC...... Dendritic Cell DNA...... Deoxyribonucleic Acid dnT-bet……………………………………………………………dominant negative T-bet EGFP…………………………………………………Enhancer Green Fluorescent Protein EnR……………………………………………………………………Engrailed Repressor Hlx...... H2.0-like homeobox IFN-γ...... Interferon gamma IL...... Interleukin JAK...... Janus family protein-tyrosine Kinase JNK...... c-Jun N-terminal Kinase LN...... Lymph Node LPS...... Lipopolysaccharide mRNA ...... messenger RNA NK...... Natural Killer PB...... Peripheral Blood PCR...... Polymerase Chain Reaction RNA...... Ribonucleic Acid RNAP...... RNA Polymerase RT-PCR...... Reverse Trancription PCR SCID...... Severe Combined Immunodeficiency s.e.m...... standard error of the mean - xvi - SLT...... Secondary Lymphoid Tissue STAT...... Signal Transducer and Activator of Transcription pSTAT...... phosphorylated STAT T-bet...... T-box expressed in T cells TF...... Transcription Factor TGF-β...... Transforming -β

TH………………………………………………………………………………….T Helper UTR...... Untranslated Region

- xvii -

CHAPTER 1

Introduction

1.1 NK Cells and the Innate Immune Response

The innate immune system represents the human body's essential first line of defense against cancer as well as infectious disease. Innate immunity serves two critical roles: (1) to rapidly restrict the dissemination of disease; and (2) to trigger the adaptive, or antigen-specific, immune system. In human beings, NK cells are CD56(+)CD3(-) large granular lymphocytes that constitute one component of the innate immune system.

In addition to their potent cytolytic activity, NK cells elaborate a host of immunoregulatory cytokines and (1), which play a crucial role in pathogen clearance. In particular, NK cells produce IFN-γ, a critical cytokine for the clearance of infectious pathogens as well as for tumor surveillance. In rodent models, NK cells are essential for the clearance of certain tumors, as well as bacterial, fungal, viral, and parasitic infections(2, 3). Furthermore, in rare cases of human congenital immune deficiencies, the absence of NK cells produces a clinical scenario that parallels classical severe combined immunodeficiency (SCID) syndromes(4). The importance of NK cells is magnified in a host of clinical settings in which the adaptive immune system is

- 1 - compromised. These states include primary immune disorders; iatrogenic immune suppression following organ transplantation; and the Acquired Immune Deficiency

Syndrome (AIDS). NK cells represent an attractive target for therapeutic manipulation to

fight the rampant opportunistic infections and virus-induced cancers that arise in

immunocompromised individuals. This is the rationale underlying ultra low-dose

interleukin-2 therapy to heighten IFN-γ production and potentiate the anti-tumor effects

of NK cells in patients with AIDS-associated malignancies(5). This approach is further

substantiated by recent advances in bone marrow transplantation, in which donor-derived

NK cells have been shown to mediate a potent graft versus tumor effect in acute myeloid

leukemia(6). Based on these advances, it is anticipated that a greater mechanistic

understanding of NK cells and the innate immune system will provide new means to

enhance the function of these cells for the benefit of the immunocompromised patient.

1.2 Role of NK derived IFN-γ in the Innate Immune Response

NK cells produce IFN-γ in response to a wide variety of stimuli, including soluble

factors as well as cellular interactions. Septic shock offers a relevant clinical example of

NK-mediated IFN-γ production in response to monokines, as well as a classical example

of the innate immune response (Figure 1). In vitro and in vivo evidence demonstrates

that dendritic cells (DC) and stimulated with bacterial cell wall components

release monokines - such as interleukin (IL)-12, IL-15, and IL-18 - which stimulate the

rapid, robust production of IFN-γ by NK cells(7). IFN-γ signals via a heterodimeric

transmembrane receptor, leading to the activation of Janus family protein-tyrosine kinase - 2 - (JAK)-1 and JAK-2, which phosphorylate and thereby activate the Signal Transducer and

Activator of Transcription 1 (STAT1) protein to promote the maturation and activation of monocytes and DC. This leads to improved antigen presentation and – in the case of monocytes - the establishment of effector functions such as phagocytosis, nitric oxide production, and the generation of reactive oxygen species(8).

The importance of IFN-γ is illustrated by naturally-occurring mutations in both

IFN-γ receptor subunits and STAT1 in humans, who are highly susceptible to systemic

disease following mycobacterial infection or vaccination with bacillus Calmette-

Guerin(9). In addition, mice lacking IFN-γ responsiveness are susceptible to infection with a broad range of microbial pathogens and interestingly exhibit increased incidence of tumors(2, 3). This attests to the role of IFN-γ in tumor surveillance by immune cells(10).

1.3 Role of NK derived IFN-γ in the Adaptive Immune Response

More recently, NK cells have been shown to reside in secondary lymphoid tissues

(SLT), such as lymph nodes (LN) and tonsils, where they colocalize with T cells and

DC(11-13). This suggests that NK cell derived IFN-γ may serve a different role, namely,

to stimulate the CD4(+) T cell response to antigen presented by DC. Experiments with

these purified cell populations indicate that T cell derived IL-2 - as well as DC derived

IL-2, IL-12, and IL-18 - all stimulate IFN-γ production by NK cells(12, 14, 15). IFN-γ

production in SLT may serve a different function than in the periphery, namely to

influence the adaptive immune response. In support of this concept, a recent report - 3 - demonstrates that NK cells migrate to the LN during murine cytomegalovirus infection, and that NK-derived IFN-γ is required to trigger the proliferation as well as the production of IFN-γ by antigen-specific CD4(+) T cells(16). Thus, production of IFN-γ by NK cells during the initial immune response plays a qualitative role in shaping adaptive immunity (Figure 2).

1.4 The CD56bright NK cell subset is the principal source of NK-derived IFN-γ in

human peripheral blood and SLT

Over 15 years ago, studies in human peripheral blood (PB) documented the existence of two distinct NK populations based upon cell surface density of the CD56 antigen(17). The majority (90-98%) of PB NK cells are CD56dim, and most of these NK cells express high levels of the Fc gamma receptor IIIA (i.e., are CD16bright). The remaining 2-10% of PB NK cells are CD56brightCD16dim/neg. At the time of their discovery, it was appreciated that CD56bright NK cells respond to picomolar concentrations of IL-2, a finding later attributed to the unique expression of the high- affinity IL-2 receptor by this population(18). In response to administration of low-dose

IL-2 to cancer patients, CD56bright NK cells are expanded in vivo and demonstrate

increased cytolytic and cytokine producing activities ex vivo (5). While these clinical

gains were significant in improving patient care, the functional significance of the

CD56bright NK subset remained an enigma until, in 1999, our laboratory published the observation that PB CD56bright NK produce significantly more IFN-γ than CD56dim NK in response to stimulation with two monokines, IL-12 and IL-18(19). This finding, which - 4 - was later recapitulated using a variety of monokines alone or in combination, or alternatively by stimulating with phorbol ester and ionomycin, led to the hypothesis that the CD56bright NK subset may possess an intrinsically heightened capacity for cytokine

production(20). This difference in IFN-γ production between subsets is preserved at the

mRNA level (Figure 3), suggesting that the mechanisms responsible for this difference

may be explained at least in part through transcriptional control(19, 20). Interestingly,

CD56bright NK cells are enriched in human SLT, where they are located in T cell-rich zones, often juxtaposed with DC(11, 12). This climate is particularly well-suited for

IFN-γ production, since T cell derived IL-2, in the presence of DC derived IL-12 or IL-

18(12, 15), can co-stimulate IFN-γ synthesis via the high-affinity IL-2 receptor on the

CD56bright NK cells(11).

1.5 Expression of IFN-γ by Immune Cells Can Be Detrimental to the Host

Whereas the beneficial roles of IFN-γ are unquestionable, it is equally apparent

that expression of IFN-γ by immune cells can be detrimental to the host. Indeed, IFN-γ is a potent pro-, and is therefore implicated in the etiology of multiple pathologic processes – including graft versus host disease (GVHD)(21); inflammatory bowel disease (IBD)(22); and the generalized Shwartzman reaction(23).

While the specific contribution of IFN-γ is difficult to dissect given the multifactorial nature of these disease states, over-expression of IFN-γ is generally associated with adverse outcome, and disease is ameliorated or even prevented when IFN-γ levels are

- 5 - lowered through the use of neutralizing antibodies and/or gene-deficient mice.

Furthermore, transgenic mice over-expressing IFN-γ experience a disruption in normal hematopoiesis, due to enhanced apoptosis of hematopoietic stem cells(24). By depleting this essential stem cell population, IFN-γ may contribute to the etiology of so-called bone marrow failure syndromes, including aplastic anemia(25).

1.6 IFN-γ Synthesis is Subject to Stringent Regulation by Multiple Mechanisms in NK Cells

Given the profound contribution of IFN-γ to human health and disease, it is not surprising that the synthesis of this cytokine is subject to stringent control in vivo.

Indeed, it is important to emphasize that NK and other immune cells do not constitutively produce IFN-γ. Rather, the synthesis of IFN-γ is elicited in NK cells through the action of multiple cytokines, and as well as in response to a variety of soluble factors and direct interactions with other cell types. Monokines such as IL-12, IL-15, and IL-18 are the best-studied elicitors of IFN-γ synthesis by NK cells, both in terms of physiologic relevance in vivo and the intracellular signaling cascades they trigger in pure populations of NK cells in vitro. Monokines regulate IFN-γ production by NK cells at multiple steps of cytokine synthesis, including transcriptional control at the IFN-γ locus(26), as well as post-transcriptionally via intron splicing, nuclear export, and cytoplasmic stabilization of the mature IFN-γ transcript(27, 28). Among these regulatory mechanisms in NK cells, summarized in Figure 4, the transcriptional control of IFN-γ has been studied in the greatest detail. In particular, numerous trans-acting factors have been implicated as - 6 - positive regulators of IFN-γ transcription by NK cells. In contrast, the negative regulation of this process is clearly just as vital to the host and far less appreciably understood at a molecular level. In the next chapter, we will review what is known about

IFN-γ transcription in NK cells. This will serve as a context within which to consider

the data presented in the subsequent chapters.

- 7 - Figure 1. Role of NK cell derived IFN-γ in the innate immune response. Microbial products, such as the gram negative bacterial cell wall component, lipopolysaccharide

(LPS), are detected by innate immune cells such as the monocyte shown here via pattern recognition receptors, exemplified here by the LPS receptor, Toll-like receptor 4 (TLR4), and its co-receptor, CD14. The resulting signaling cascade culminates in the production of multiple monokines (IL-12, IL-15, IL-18, IL-1β), which act in synergy to co-stimulate

IFN-γ synthesis by NK cells. IFN-γ, in turn, promotes monocyte effector functions, including: phagocytosis, productive of reactive oxygen and nitrogen species, antigen presentation, and further monokine secretion. If this process occurs locally, it serves to prevent disseminated bacterial infection. Howver, systemic exposure to LPS results in dangerous levels of IFN-γ and monokine production, which can lead in the worst case scenario to an irreversible loss of blood pressure and multi-organ failure, a condition known as septic shock.

- 8 -

IL-12, IL-15,

IL-18, IL-1β

LPS T L R 4

4 1 D C Mφ NK

• ROS generation IFN-γ

• Antigen presentation

• Phagocytosis

Figure 1.

- 9 - Figure 2. Role of NK cell derived IFN-γ in the adaptive immune response. Upon engulfment of foreign material in peripheral tissues, DC migrate to draining lymph nodes

(LN), where they present antigen to naïve CD4(+) T cells. DC secrete chemokines which promote the trafficking of PB NK cells into the node in a manner dependent on

NK cell expression of the receptor CXCR3 and L-selectin (CD62L)(16). NK cells converge with DC in T cell rich zones of LN. In this microenvironment, NK cells provide an early source of IFN-γ that is essential for the T helper 1 (TH1) polarization and proliferation of antigen-specific CD4(+) T cells.

- 10 -

naïve CD4(+) T cell DC IFN- γ TH1

8 -1 IL , bright 5 CD56 -1 IL , 2 IFN-γ NK -1 C L X I L C -s R e 3 le c t in

Figure 2.

- 11 - Figure 3. The CD56bright NK subset is the principal source of IFN-γ among human

NK cells. (A) Left: Surface expression of CD56 and CD16 defines distinct NK cell

bright neg/dim dim bright bright subsets in human PB, CD56 CD16 and CD56 CD16 ; Right: CD56 NK cells produce higher levels of IFN-γ than CD56dim NK cells, as determined by intracellular staining with an APC-conjugated anti-IFN-γ monoclonal antibody following co-stimulation of each FACS-isolated NK subset with IL-12 and IL-18 for 24 hours. (B)

CD56bright NK cells express higher levels of IFN-γ mRNA than CD56dim NK cells following monokine co-stimulation, as measured by quantitative reverse-transcription polymerase chain reaction (RT-PCR).

- 12 -

A 104 95.8% MFI=662

103 Bright 102

1 E E CD56bright 10 E E P P - - P IL-12 + IL-18 P - - 6 6 100 101 102 103 104 6 6 5 5 dim CD56 104 5 24 hr 5 48.1% MFI=223 CD CD 103 CD CD

2 Dim 10 101 CD16-FITC B 100 101 102 103 104 10000 IFN-γ APC Bright 8000 Dim

6000 mRNA mRNA γ γ 4000

2000 IFN- IFN- 0 12+15 12+18 15+18

Figure 3.

- 13 - Figure 4. IFN-γ synthesis is regulated at multiple steps in NK cells. Experimental evidence implicates multiple regulatory steps in the synthesis of IFN-γ by NK cells, many of which are regulated by monokines to increase the amplitude and duration of IFN-γ production. In the nucleus, monokines increase IFN-γ transcription via mechanisms labeled in red: (1) the inducible recruitment of transcriptional activators, depicted generically in this case, to the IFN-γ promoter; (2) increased rate of transcription by RNA polymerase (RNAP) II; and (3) increased histone acetylation at the IFN-γ locus. In addition to transcription, monokines also promote IFN-γ synthesis through multiple post- transcriptional mechanisms, labeled in blue: (1) IL-2 (and - by inference - IL-15, given the shared signaling mechanism of these cytokines) promotes IFN-γ RNA stability through intron splicing, polyadenylation, and increased nuclear export of the mature message(27); (2) IL-12 and IL-18 stabilize the IFN-γ mRNA in a manner dependent on the p38 mitogen-activated protein kinase and the 3' untranslated region of the IFN-γ transcript, which contains multiple AU-rich elements that otherwise promote mRNA degradation in the absence of monokine co-stimulation(28). This is likely due to the monokine-dependent association of stabilizing proteins with the 3' untranslated region

(UTR), as described recently in the case of HuR(29).

- 14 -

increased rate of transcription histone RNAP acetylation RNA 1 IFNG

TF recruitment intron spl icing, polyadenylation

mature IFN-γ mRNA NUCLEUS

CYTOPLASM nuclear export

mRNA stabilization increased AAAA translation

Figure 4.

- 15 -

CHAPTER 2

Transcriptional Regulation of IFN-γ in NK cells

2.1. Introduction

Just as with any biological process, the amplitude and duration of IFN-γ transcription by NK cells in vivo reflects the net impact of individual positive and negative signaling events, which ultimately must converge at the IFN-γ promoter. Gene targeting experiments in mice have generated a number of "knockout" strains in which

NK cells exhibit deficient IFN-γ production following monokine stimulation in vitro or microbial infection in vivo. In this way, multiple transcription factors (TFs) have been implicated in the regulation of IFN-γ mRNA synthesis (Table 1). In certain cases, further work has determined that a particular TF associates with the IFN-γ promoter in NK cells and regulates transcriptional activity. These mechanistic studies are essential to distinguish direct versus indirect control of IFN-γ transcription; yet, limitations in cell numbers, transduction of genetic material, and cost almost invariably require in vitro studies and the use of NK-derived cell lines, rather than primary NK cells. Furthermore, the in vivo contribution of any given TF to IFN-γ transcription is frequently obscured by an overlapping physiologic role for the same TF in the development, proliferation, and/or

- 16 - survival of NK cells. With these caveats in mind, this chapter will discuss what is known regarding the regulation of IFN-γ transcription by specific TFs in NK cells.

2.2. Chromatin Remodeling at the IFN-γ Locus in NK Cells

In eukaryotes, it is abundantly clear that local chromatin structure plays an essential role in determining the transcriptional state at any given locus. Indeed, the association between chromatin structure and transcription at the IFN-γ locus was recognized over twenty years ago in a study that identified a DNAse I hypersensitive region in the first intron that exclusively exists in a T cell line capable of transcription(30). This study provided the first experimental evidence that the IFN-γ gene structure was distinct in transcriptionally active cells. Subsequent studies in primary T cells confirmed this finding and demonstrated gradually acquisition of DNAse

I hypersensitivity in CD4(+) T cells differentiated under conditions permissive for IFN-γ

transcription (so-called T helper 1 or TH1 cells), whereas T helper 2 (TH2) cells that are incapable of IFN-γ transcription do not exhibit DNAse I hypersensitivity at the IFN-γ locus(31). Groundbreaking work from the laboratory of Steven Reiner established that changes in DNAse I hypersensitivity at the IFN-γ intronic site required cell division, due to alterations in DNA methylation at CpG dinucleotide repeats(32). In addition to physico-chemical changes in the DNA itself, post-translational modifications occur in the

N-terminal tails of histone octamers associated with the IFN-γ locus during TH1 differentiation, i.e., increased acetylation of histones H3 and H4, as well as increased

- 17 - methylation of H3 lysine 4 (H3K4)(33, 34). The importance of CpG demethylation at the

DNA level and histone acetylation in activating IFN-γ transcription is illustrated by the use of pharmacological inhibitors of DNA methyltransferase and histone deacetylase

(HDAC), respectively. Indeed, application of these drugs – particularly in combination – reverses the otherwise repressive activities of their target enzymes, leading to enhanced

IFN-γ transcription by CD4(+) T cells(32, 35). Therefore, chromatin remodeling occurs upon transcriptional activation of the IFN-γ gene in TH1 cells, and maintenance of DNA

methylation – in all likelihood together with post-translational modifications at histone

tails that confer a state of transcriptional repression - is required for transcriptional

silencing in TH2 cells.

Recently, several laboratories have attempted to apply lessons learned from

TH1/TH2 paradigm to IFN-γ production by NK cells. In one study, performed using purified splenic NK cells from mice, the authors tested DNAse I hypersensitivity and

CpG methylation of the IFN-γ intron one element(36). In contrast to TH1 cells, the

authors found that this region was constitutively hypomethylated and hypersensitive to

DNAse I in NK cells, leading them to conclude that IFN-γ production by NK cells is

independent of "epigenetic changes" at the IFN-γ promoter. This conclusion, which is

consistent with the fact that NK cells – unlike T cells – can transcribe IFN-γ within

minutes of stimulation and in a manner independent of cell division, reflects the notion

that cells must undergo DNA replication in order to alter any CpG methylation at the

DNA level. However, the authors of this study did not rule out the possibility that

chromatin remodeling might occur in NK cells in a manner independent of DNA

- 18 - methylation. Indeed, subsequent work from Howard Young's laboratory established the existence of an enhancer element 3.5-4.0 kB upstream of the IFN-γ transcriptional start site in resting human NK cells, which undergoes chromatin remodeling – as evidenced by increased DNase I hypersensitivity and histone acetylation - upon stimulation with IL-2 and/or IL-12(37). A parallel study in the mouse identified wide-spread constitutive histone acetylation across the IFN-γ locus in NK cells, stretching >60 kB in either direction from the transcriptional start site. However, constitutive acetylation is conspicuously absent at certain enhancer elements previously implicated in IFN-γ transcription. Interestingly, upon monokine stimulation with IL-12 and IL-18, increased histone acetylation was observed at a distal enhancer as well as in the intron one enhancer of the IFN-γ gene(35). At this point in time, the preponderance of data suggest that the chromatin context of the IFN-γ promoter is permissive for rapid transcription, but chromatin remodeling - as measured by alterations in DNAse I hypersensitivity and histone acetylation - does indeed occur upon NK stimulation with the monokines, IL-12

and IL-18. Whether this monokine-inducible chromatin remodeling contributes

substantially to IFN-γ transcription remains a contested issue, and it is likely that this

debate will remain unresolved until it is possible to selectively disrupt this remodeling -

either in cis or in trans – and investigate the consequence, if any, on IFN-γ promoter activity.

- 19 -

2.3. Proposed Models of Transcriptional Activation of the IFN-γ Promoter

Following Monokine Co-Stimulation

NK cells increase IFN-γ transcription in response to stimulation with monokines -

such as IL-12, IL-15, and IL-18 - derived principally from monocytes and DC. In

particular, exposure of purified NK cells to monokine combinations results in synergistic

increases in IFN-γ mRNA, a phenomenon we have called "monokine co-

stimulation"(19). The molecular basis of monokine co-stimulation has not been

completely elucidated, although it is abundantly clear that no single mechanism accounts

for the synergistic increase in IFN-γ mRNA levels, which can be many orders of

magnitude beyond that observed with individual monokines(19). Ultimately, these

mechanisms of synergy must ultimately converge in the form of TFs and associated

proteins at the level of the IFN-γ promoter.

Two major models have been proposed to explain the synergistic effect of

monokine co-stimulation on IFN-γ promoter activity, and they are by no means mutually

exclusive. A simple, "quantitative" model to explain monokine co-stimulation is offered

by the observation that each individual monokine is capable of uniquely activating certain

TFs, each of which increases IFN-γ transcription. For example, IL-12 stimulates tyrosine

phosphorylation of STAT4 (pSTAT4), leading to its nuclear translocation and association

- 20 - with multiple sites in the IFN-γ promoter(38). In contrast, IL-15 stimulates

phosphorylation of STAT5, which associates with an enhancer region –3.6 kB upstream

of the transcriptional start site(37). IL-18 stimulates the c-Jun N-terminal kinase (JNK),

which phosphorylates c-Jun, permiting its association with an Activation Protein-1 (AP-

1) motif in the proximal IFN-γ promoter(39). According to this quantitative model, stimulation with more monokines leads to increased numbers of TFs that associate with their cognate cis-regulatory elements, leading to higher levels of IFN-γ mRNA

production.

While this quantitative model likely contributes to monokine co-stimulation, it

does not account completely for the observed levels of synergy between monokines in

eliciting IFN-γ production. Instead, several studies favor a "qualitative model" of

monokine co-stimulation. In one such study, monokine co-stimulation results in unique

protein-protein interactions between TFs activated by each individual monokine,

resulting in increased IFN-γ transcription(39). Following IL-12 and IL-18 stimulation,

pSTAT4 associates with phosphorylated c-Jun, in a manner dependent on DNA binding

by c-Jun but independent of DNA binding by pSTAT4. This is formally demonstrated in

reporter assays, in which the IFN-γ promoter derived AP-1 element, but not the STAT4

element, is sufficient to confer synergy in response to IL-12 and IL-18 stimulation. In

another example, monokine co-stimulation results in increased expression of a TF, called

T-bet, which associates with the IFN-γ promoter and is required for synergistic

transcription following IL-12 and IL-18 stimulation(40). Thus, the molecular basis for

monokine co-stimulation is incompletely known, but the body of evidence implicates a

- 21 - combination of qualitative and quantitative changes in the nature and number of protein- protein and protein-DNA interactions at the IFN-γ promoter, respectively.

2.4. Role of T-bet and Hlx in IFN-γ Transcription

T-bet (T-box expressed in T cells, Tbx21) was first identified by Laurie

Glimcher's laboratory in 2000 as a positive regulator of IFN-γ expression in CD4(+) TH1 cells(41). In NK cells, potent T-bet induction occurs following monokine co- stimulation(40), consistent with the hypothesis that T-bet plays an important role in IFN-γ transcription in this population. Indeed, NK cells from T-bet deficient mice exhibit a cell-intrinsic defect in their ability to produce IFN-γ following monokine co-stimulation in vitro or viral infection in vivo (40). Exactly how does T-bet promote IFN-γ production by immune cells? While this question has not been addressed experimentally in NK cells, work in T cells has generated at least four models of T-bet action, and they are by no means mutually exclusive: (1) Studies in T cells argue that T-bet directly activates IFN-γ transcription through its direct association with T-box elements in the proximal promoter(41, 42). (2) Alternatively, experiments comparing wildtype and T-bet deficient CD4(+) T cells (or wildtype cells transduced with a dominant negative T-bet retrovirus) establish an essential role for T-bet in the reduced CpG methylation, increased

DNAse I hypersensitivity, and increased histone acetylation that occur during TH1 polarization(33, 35, 43). According to this model, T-bet achieves its effects through chromatin remodeling, not transcriptional activation. (3) A third model posits an indirect mechanism for T-bet, and it is based on the observation that T-bet increases the - 22 - expression of the high-affinity β2 subunit of the IL-12 receptor, resulting in heightened responsiveness of T and NK cells to IL-12 and, hence, to increased IFN-γ production(44).

(4) The final model suggests that T-bet induces another, TF, Hlx (H2.0-like homeobox,

HB24, Hlx1), and that T-bet and Hlx synergistically promote IFN-γ transcription(43, 45).

The genetic relationship between T-bet and Hlx has been demonstrated in gain and loss of function experiments in CD4(+) T cells, i.e., decreased Hlx mRNA levels are observed in T-bet deficient CD4(+) T cells, whereas increased Hlx mRNA levels are found upon retroviral over-expression of T-bet (43, 45). In further support of this model, T-bet and

Hlx have been shown to synergistically promote IFN-γ production when both proteins are over-expressed under TH2 polarizing conditions (43, 45).

The role of Hlx itself in IFN-γ production by CD4(+)T cells has been insufficiently explored. The most compelling experimental data, based on gain and loss of function evidence, argue that Hlx may modulate IFN-g levels indirectly by acting as a repressor of IL-4 receptor alpha expression during early TH polarization(46). By

decreasing the responsiveness of naive CD4(+) T cells to IL-4 - a dominant TH2 polarizing cytokine - Hlx may "tip the balance" toward TH1 polarization, especially in the presence of T-bet, and therefore indirectly function to promote IFN-γ production.

Significantly, no evidence has been presented to suggest a direct role for Hlx in IFN-γ production in CD4(+) T cells, and the function of Hlx in NK cells has not been explored.

Hlx encodes a putative DNA binding protein and is a member of the homeobox family of

TFs, by virtue of its evolutionarily conserved homeodomain(47). In Chapter 4, the role of Hlx in IFN-γ production by NK cells will be explored.

- 23 -

2.5. Role of TGF-β in the Negative Regulation of IFN-γ Transcription

Transforming growth factor-beta (TGF-β) is an anti-inflammatory cytokine that serves, among other roles, to counterbalance the activity of pro-inflammatory monokines during the immune response(48). The potency of TGF-β as a negative regulator of inflammation is illustrated by its profoud ability to extinguish IFN-γ transcription by lymphocytes, first observed nearly twenty years ago(49). There are at least four proposed mechanisms by which TGF-β inhibits IFN-γ transcription. First, TGF-β rapidly inhibits

JAK activity through an unknown process, resulting in reduced STAT4 phosphorylation and, hence, decreased pSTAT4 association with the IFN-γ promoter(50). Second, TGF-β inhibits the expression of STAT4 mRNA and protein, through an unknown mechanism(51). Third, TGF-β decreases T-bet expression levels, an effect attributed to transcriptional repression, although the specific mechanism still remains unclear(51-53).

Finally, recent work from our laboratory has established a direct and profound effect of

TGF-β inducible TFs as transcriptional repressors at the IFN-γ proximal promoter (Yu et al., accepted for publication in Immunity). Thus, the sum effect of TGF-β on IFN-γ transcription is achieved through the regulation of signaling events both proximal to and distal from monokine receptors.

- 24 - The in vivo significance of TGF-β was elegantly demonstrated in a recent paper from the Flavell laboratory(54). Through the generation of transgenic mice with NK- specific expression of a dominant negative TGF-β receptor II subunit, this group specifically rendered NK cells unresponsive to TGF-β. These cells produce increased amounts of IFN-γ following infection with Leishmania major, leading to increased TH1 polarization of CD4(+) T cells and protection from this parasitic agent. Interestingly, these animals also experienced an expansion of their NK cell numbers, an observation attributed to the antagonism that normally occurs between TGF-β and IL-15, an important regulator of NK cell proliferation and survival. Based on the favorable response of these TGF-β unresponsive mice to microbial infection, one may inquire why

NK cells have evolved their high susceptibility to TGF-β regulation in the first place.

The answer is provided by a recent study in our laboratory, demonstrating that decreased

TGF-β responsiveness – in this case, due to genetic deficiency in SMAD3, a key transducer of TGF-β signaling - results in hypersusceptibility to bacterial endotoxin in a septic shock model (Yu et al., accepted for publication in Immunity). Thus, the ability of

TGF-β to antagonize monokine-inducible IFN-γ production by NK cells is a necessary homeostatic relationship that is required for the safe resolution of pro-inflammatory reactions in the host.

- 25 - Table 1. Trans-acting factors implicated in the control of IFN-γ transcription in NK cells. Genetic and biochemical studies have implicated multiple TFs in the regulation of

IFN-γ transcription by NK cells. These TFs are detailed in alphabetical order here, along

with their net positive or negative effect on IFN-γ synthesis, as well as the available

genetic and biochemical evidence in support of each factor's role in IFN-γ regulation.

Genetic studies mostly entail global loss of function studies in gene-deficient mice, and

therefore the attendant caveats apply. For example, in many cases the contribution of

cell-intrinsic versus environmental effects of a particular TF's deficiency to detected

alterations in IFN-γ production has not been addressed. Recently, the advent of retroviral

gene transfer methodology for TF over-expression in primary NK cells, including that

described in Chapters 3 and 4 of this thesis, has facilitated the means to perform the

critical gain of function experiments required to establish which of these TFs are in fact

sufficient to modulate IFN-γ transcription in their own right, and to determine if their

mechanisms of action at the IFN-γ promoter are direct, indirect, or both. In certain cases,

such as STAT4, genetic and biochemical evidence strongly argue the case for a TF's

relevance to IFN-γ transcription in NK cells, while in other instances the global role for a

particular TF (such as STAT5) in NK cell ontogeny and homeostasis makes a genetic

experiment especially prohibitive, and only biochemical evidence is available to argue the point. In most cases, the TFs listed here promote IFN-γ transcription, although several recent studies – including one described in great detail in Chapter 4 of this thesis

– have begun to implicate certain TFs as transcriptional repressors of IFN-γ

- 26 - TF Regulation Genetic Evidence Biochemical Evidence C/EBPγ + C/EBPG knockout NK cells Not available produce less IFN-γ following IL- 12 and IL-18 treatment (55) Hlx − Hlx knockout NK cells produce Hlx promotes degradation of increased IFN-γ when stimulated STAT4, an essential TF for IFN- with IL-12 and IL-15; Hlx over- γ transcription in reponse to IL- expression in human NK cells 12; Hlx may repress results in decreased IFN-γ transcription independently of its mRNA and protein following effect on STAT4 (see Chapter 4 co-stimulation with IL-12 and of this thesis) IL-18 (see Chapter 4 of this thesis) MEF + MEF knockout NK cells produce Not available less IFN-γ following poly I:C treatment in vitro (56) p50 NFkB − p50 knockout NK cells produce IL-15 and especially IL-18 more IFN-γ in vitro and in vivo induce p50/p65 NFkB following T. gondii infection association at –700 site in IFN-γ (57) promoter in primary human NK cells. p50 NFkB is constitutively bound to the IFN- γ promoter in resting NK cells (57) RelA (p65 + Not available IL-15 and especially IL-18 NFkB) induce p50/p65 NFkB association at -700 site in IFN-γ promoter in primary human NK cells (58, 59) RelB + RelB knockout NK cells produce Not available decreased IFN-γ in a murine model of toxoplasmosis(60) c-Rel + c-Rel deficient NK cells produce Bound to intron one enhancer of less IFN-γ in vitro and in vivo IFN-γ gene(61) following T. gondii infection (57)

Continued

Table 1. Trans-acting factors implicated in the control of IFN-γ transcription in NK cells.

- 27 - Table 1 continued

TF Regulation Genetic Evidence Biochemical Evidence Smad 3 − Smad3 deficient murine NK Smad3 associates with the cells produce increased levels of proximal IFN-γ promoter both in IFN-γ in response to monokine vitro (EMSA) and in vivo stimulation in vitro and in vivo; (chromatin Smad3 over-expression immunoprecipitation; ChIP) and decreases IFN-γ production in represses promoter activity in primary human NK cells (J. Yu NK cells in a TGF-β dependent et al., accepted for publication in fashion (J. Yu et al., accepted Immunity) for publication in Immunity)

STAT4 + STAT4 deficient NK cells STAT4 associates with the IFN- express substantially less IFN-γ γ proximal promoter and intron mRNA in response to IL-12 one element both in vitro (DNA stimulation (62, 63) footprinting, EMSA) and in vivo (35, 38, 64) STAT5 + Not available STAT5 associates with a DNase I hypersensitivity site in the 3.6 kB upstream of the human IFN-γ transcriptional start site and is required for IL-2/15 increased IFN-γ transcription in reporter assays (37) T-bet + T-bet knockout NK cells T-bet associates with multiple T- produce less IFN-γ following co- box elements throughout the stimulation with IL-12 and IL-18 IFN- γ promoter and promotes at late time-points following histone acetylation at the IFN- γ stimulation(40) locus (33, 35, 40)

- 28 -

CHAPTER 3

Efficient Infection of Human NK Cells with an EBV / Retroviral Hybrid Vector

3.1. Introduction

The innate immune system represents the human body's essential first line of defense against cancer as well as infectious disease. NK cells are CD56(+)CD3(-) large granular lymphocytes that constitute one component of the innate immune system. In addition to their potent cytolytic activity, NK cells elaborate a host of immunoregulatory cytokines and chemokines, which play a crucial role in the clearance of infectious pathogens as well as and tumor surveillance (2, 7). The importance of NK cells is magnified in a host of clinical scenarios in which the adaptive immune system is compromised - including congenital immune disorders; iatrogenic immune suppression following organ transplantation; and the Acquired Immune Deficiency Syndrome

(AIDS)(65). NK cells represent an attractive target for therapeutic manipulation to fight opportunistic infections and virus-induced cancers that arise under these states of immunodeficiency. Indeed, this is the rationale underlying ultra low-dose interleukin-2 therapy to heighten cytokine production and potentiate the anti-tumor effects of NK cells

- 29 - in AIDS-associated malignancies(5). The therapeutic value of NK cells is further substantiated by recent advances in bone marrow transplantation, in which donor-derived

NK have been shown to mediate a potent graft versus tumor effect in patients with acute myeloid leukemia(6). Based on these advances, it is anticipated that a greater mechanistic understanding of NK cells and the innate immune system will provide new means to enhance the function of these cells for the benefit of the immunocompromised patient.

In order to fully comprehend the mechanisms underlying human NK function, it is essential to genetically manipulate this cell type. It is only through such experimentation that one can discern the role of specific gene products in the signal transduction pathways that govern NK cell behavior. Up to this point, the transduction of genetic material into human NK cells has presented a major technical hurdle. While considerable success has been obtained with vaccinia vectors, this technique is limited to short-term experiments, given the transient nature of poxviral infections(66). More recently, chimeric adenoviral vectors have been described for transient transduction of primary NK cells(67). In addition, the refinement of plasmid electroporation of NK cells has offered an alternative to viral vectors (68, 69). Retroviral vectors offer a potential complementary strategy to these existing methods, vis-a-vis their ability to integrate into the host genome and mediate long-term, stable gene expression(70). In particular, hybrid

EBV/retroviral vectors transduce viral packaging lines with high efficiency, leading to high viral titers(71).

In this study, we have developed a facile, efficient method for retroviral infection of human primary NK cells and NK-derived cell lines using the PINCO hybrid

EBV/retroviral transfer vector(72). We have been able to validate the expression of

- 30 - multiple cDNAs while simultaneously expressing the enhancecd green fluorescent protein (EGFP) as a marker of infection. In addition, this approach permits the transduction of the CD56dim NK subset that predominates in human peripheral blood. We demonstrate that retrovirally transduced NK cells retain their innate immune functions of

MHC unrestricted killing and cytokine production. Furthermore, we apply this methodology to address a relevant biological question, namely, the role of T-bet in IFN-γ production by NK cells following monokine co-stimulation. We believe that retroviral transduction with PINCO will offer a useful complementary approach to existing methods for genetic manipulation of NK cells, particularly for investigators interested in the long-term effects of stable gene expression.

3.2. Methods

Generation of PINCO Retrovirus

The PINCO retroviral transfer plasmid was a kind gift of Dr. Martin Sattler (Dana

Farber Cancer Institute, MA). This retroviral vector permits the expression of a gene of interest from the 5' long term repeat (LTR) as well as EGFP from an internal cytomegalovirus (CMV) immediate early promoter. Complementary DNA (cDNA) encoding genes of interest (T-bet, TSC-22R, LDB1, dominant negative T-bet, or the

Drosophila Engrailed repression domain) was cloned into the BamHI and/or EcoRI sites of PINCO. Alternatively, a truncated murine CD8 cDNA was prepared as described and cloned into the HindIII and NotI sites of PINCO, substituting for the EGFP cDNA(73).

- 31 - This construct was termed PINCO8. Following confirmation of cloning by DNA sequencing, each construct was prepared for virus production by endotoxin-free maxiprep

(Qiagen, Carlsbad, CA). An expression plasmid encoding the VSV-G protein (pVSV-G) was similarly prepared.

VSV-G pseudotyped retroviral particles were generated by transient transfection of the Phoenix-Ampho packaging line (a kind gift of Dr. Gary Nolan, Stanford U., CA).

Early passage Phoenix cells were cultured (37°C / 5% CO2) on T75 flasks in high glucose

Dulbecco's Modified Eagle Medium (DMEM) supplented with GlutaMAX, antibiotic/antimycotic, and 10% fetal bovine serum (Invitrogen, Carlsbad, CA), hereafter

denoted D-10. Phoenix cells were transfected at approximately 80% confluence, after

having replaced the medium with D-10 containing chloroquine (Sigma, St. Louis, MO) at

25 µM final concentration. Twenty micrograms (µg) of PINCO and 0.9 µg of pVSV-G

were cotransfected into Phoenix cells using the ProFection® Mammalian Transfection

System—Calcium Phosphate (Promega, Madison, WI). Transfected cells were cultured

for 12-16 hours at 37°C / 5% CO2. Thereafter, the medium was replaced with RPMI supplemented with GlutaMAX, antibiotic/antimycotic, and 20% fetal bovine serum,

hereafter denoted RPMI-20. Cells were returned to 37°C / 5% CO2 for another 24 hours.

Then, virus-containing supernatant was aseptically filtered through 0.45-µm cellulose acetate, and used immediately or aliquoted and frozen at -80°C.

- 32 - Transduction of primary human NK cells

Human peripheral blood leukocytes were obtained as discarded buffy coats from the American Red Cross. NK cells were enriched by rossetting (Stem Cell Technologies,

Vancouver, CA) and Ficoll-Hypaque density centrifugation. Following removal of residual monocytes by plastic adherence, the preparation contains 2.5 x 107 to 1 x 108 peripheral blood mononuclear cells (PBMC), of which approximately 80% are NK as revealed by flow cytometric analysis. This enriched NK (eNK) preparation was cultured for 48 hours at 37°C / 5% CO2 in RPMI-20 supplemented with recombinant human

interleukin-2 (IL-2, Roche) at a final concentration of 900 international units (IU) / ml.

Infections were performed using standard methods(74). Between 2-3 x 106 eNK were harvested by centrifugation, resuspended in 2 ml viral supernatant supplemented with IL-

2 (900 IU/ml) and polybrene (Sigma, 8 ug/ml), and placed in one well of a 6-well tissue- cultured treated plate. The plate was centrifuged in a microcarrier bucket at 1800 rpm for

45 minutes at 32°C. Following a 2 hour incubation at 32°C / 5% CO2, medium was gently removed by pipetting and replaced with an additional 2 ml of viral supernatant, supplemented as described. The plate was re-centrifuged and returned to 32°C / 5% CO2 for another 4 hours. Next, the medium was gently removed and replaced with RPMI-20 containing IL-2 (900 IU/ml), and cells were incubated overnight at 37°C / 5% CO2. The following day, medium was gently removed and replaced with 4 ml of viral supernatant, supplemented as described. The plate was centrifuged a third time and returned to 32°C /

5% CO2 for 5 hours. Finally, the medium was gently removed and replaced with RPMI-

- 33 - 20 containing IL-2 (150 IU/ml), and cells were cultured from this point onwards at 37°C /

5% CO2.

Transduction of NK-derived cell lines

The NK-92 cell line was a kind gift of Dr. Hans Klingemann (Rush Medical

Center). The NKL cell line was obtained from Drs. Michael Robertson (Indiana

University) and Jerome Ritz (Harvard University). Both lines were cultured in RPMI-20

supplemented with IL-2 (150 IU/ml) at 37°C / 5% CO2. On the day before infection, IL-

2 concentration was adjusted to 900 IU/ml. The infections were performed as described for primary NK. Following the final round of infection, the IL-2 concentration was returned to 150 IU/ml.

Analysis of transduced NK

To visualize infected NK, cells were stained with APC-conjugated CD56 (mIgG1,

Coulter, Fullerton, CA) and evaluated by flow cytometry using a BD FACSCalibur instrument (BD Biosciences, San Jose, CA) on the day following the third round of infections. Infected cells were detected based on EGFP fluorescence, relative to uninfected controls. Alternatively, for cells transduced with PINCO8, infected cells were detected based on positive staining with PE-conjugated anti-mouse CD8 (BD

Biosciences, San Jose, CA). CD8(+) cells were magnetically selected using anti-PE microbeads (Miltenyi Biotech). For functional studies, CD56(+)EGFP(+) cells were - 34 - isolated to ≥95% purity by fluorescence activated cell sorting (FACS) on a BD

FACSVantage instrument. Expression of TSC-22R was detected by RT-PCR using

AmpliTaq Gold (Applied Biosystems), forward (5’ ACC AGC TGC ACA ATT TCT CC

3’), reverse (5’ TAC ACC GCA GAA CCA CCA G 3’), and the following conditions:

94ºC 10 minutes; followed by 25 cycles of 94ºC 30 sec, 60ºC 30 sec, 72ºC 1 min.

Parallel reactions were performed using primers to the housekeeping gene, β-actin: forward (5’GGGAAATCGTGCGTGACATTAAG 3’) and reverse (5’

TGTGTTGGCGTACAGGTCTTTG 3’). Expression of proteins of interest was confirmed by immunoblotting for a C-terminal MYC epitope () as described (75). Subsequent functional analysis of cytokine production (ELISA, intracellular staining) and cytotoxicity (51Cr-release) were performed exactly as previously described (20, 76), except C7M3 LCL were used as targets in cytolytic assays.

3.3. Results

To determine if PINCO could infect primary NK cells, we performed multiple

infections of enriched NK preparations from human peripheral blood with vector alone or

vector bearing various genes of interest (TSC-22R, LDB1, T-bet) over a 48 hour period.

The results of these infections were visualized cytometrically by EGFP fluorescence,

compared to mock-infected controls. Figure 5A illustrates the PINCO retroviral vectors

used in this study. As shown with TSC-22R in Figure 5B, PINCO is capable of

transducing both CD56bright and CD56dim subsets. In addition, the over-expression of

TSC-22R mRNA is evident by RT-PCR analysis compared to vector-only and mock- - 35 - infected controls (Figure 5C). Thus, PINCO is capable of delivering multiple genes (i.e.,

EGFP and TSC-22R) to primary human NK cells. Following NK cell infections, the

CD56(+)EGFP(+) cells were routinely enriched to >90% purity by FACS.

The human cell line, NK-92, serves as an excellent model for the CD56bright NK

subset, as NK-92 cells are capable of robust IFN-γ production upon stimulation with

combinations of monokines, such as IL-12, IL-15, and IL-18(58). Thus, we sought to

determine if PINCO is capable of infecting NK-92 cells. As shown for T-bet and LDB1

in Figure 6A, we have successfully infected the NK-92 line with PINCO bearing multiple

genes of interest. EGFP(+) NK-92 cells have been isolated to ≥99% purity by FACS and

maintained in culture for over 3 months, with no appreciable reduction in EGFP

fluorescence (B. Becknell, unpublished observations). To confirm the expression of

proteins of interest in NK-92 cells, we performed immunoblotting to detect a C-terminal

MYC epitope (Figure 6B). In addition to the NK-92 line, we also observed identical

results in the human NK-L line (data not shown), consistent with a previous report(77).

In order to increase the versatility of this vector, we next modified PINCO to

express a cytoplasmically truncated murine CD8 molecule in place of EGFP(73). The

resulting vector, shown in Figure 7A, is termed PINCO8. As an alternative to

purification of transduced NK populations by FACS, we stained PINCO8 transduced

NK-92 with anti-mouse CD8 PE followed by anti-PE magnetic beads. After one round

of magnetic selection, we routinely observe a ≥95% pure population of CD8(+) cells

(Figure 7B). We next infected NK-92 cells simultaneously with PINCO and PINCO8.

This revealed an EGFP(+)CD8(+) population on subsequent cytometric analysis (Figure

- 36 - 7C). Thus, NK-92 cells can be infected with multiple PINCO retroviruses, each carrying unique genetic material.

In anticipation of future functional studies, we wished to determine if retrovirally transduced cells maintain the NK effector functions of cytokine production and cytolytic activity. After FACS purification, PINCO infected primary NK cells are capable of IFN-γ production in response to monokine stimulation, as shown by ELISA (Figure 8A).

Similarly, retrovirally infected NK-92 cells produce high levels of IFN-γ in response to monokine treatment, as shown both by intracellular staining (Figure 8B) and ELISA (data not shown). Virally transduced NK-92 cells also exhibit cytolytic activity in 51Cr-release assays (Figure 8C). In sum, transduction of NK and/or NK-92 cells with PINCO retrovirus preserves cellular functions, including cytolysis and cytokine elaboration.

Finally, we wished to apply this methodology to a question that is relevant to the biology of NK cells, namely, the transcriptional control of IFN-γ. T-box expressed in T

cells (T-bet) is a transcription factor implicated as a master regulator of IFN-γ mRNA

synthesis in T lymphocytes(41, 43). However, the role of T-bet in IFN-γ production by

human NK cells has remained unclear. Dominant negative T-box transcription factors

have been described in the literature, based on the substitution of the repression domain

of Drosophila Engrailed protein (EnR) for the transactivation domain at the N-terminus of protein(43). Based on this strategy, we generated a putative dominant negative T-bet

(dnT-bet) in PINCO (Figure 9A), generated virus, and transduced NK-92 cells. In

parallel, control infections were performed with empty PINCO and the EnR domain

alone. After FACS purification, expression of dnT-bet protein was confirmed by

immunoblotting for a C-terminal MYC epitope (Figure 9B). Next, cells were subject to - 37 - monokine co-stimulation using IL-12 in combination with IL-15 or IL-18, and IFN-γ protein was measured by ELISA (Figure 9C). We found that dnT-bet specifically suppressed IFN-γ production by NK-92 cells in response to either stimulation, compared to EnR and vector only controls. Similar results were observed by intracellular staining for IFN-γ (Figure 9D). Therefore, we conclude that T-bet is required for optimal IFN-γ synthesis by NK-92 cells.

3.4. Discussion

In this study, we have demonstrated that PINCO is capable of transducing primary NK cells. There are two other reports documenting retroviral transduction of primary NK cells in the scientific literature, using MSCV-based retrovirus (78) and HIV- based lentivirus(79). Unlike these previous reports, we have observed that PINCO is broadly applicable for the infection of all NK cells: CD56bright as well as CD56dim NK.

To the best of our knowledge, this report is the first demonstration of CD56dim infection with retrovirus. One potential shortcoming of this technique lies in the low number of infected primary cells recovered after FACS purification. However, we have successfully expanded PINCO infected primary NK in the presence of IL-2 and feeder cells as described (80)(B. Becknell, unpublished observations). Another potential limitation of this technique is its reliance on high doses of IL-2 for NK cell transduction, thus placing the cells in an activated state. This limitation can be overcome, at least in part, by resting cells in the absence of IL-2 (our unpublished observations).

- 38 - In addition to infecting primary NK, we found that PINCO infects the NK-92 and

NK-L cell lines. This is consistent with reports from three other laboratories (77, 78, 81).

We have isolated infected NK-92 by FACS (based on EGFP fluorescence) or magnetic selection (based on surface expression of a truncated murine CD8 marker) and maintained these cells in long-term culture (up to 3 months) without appreciable silencing of these markers’ expression. Importantly, we have shown that the viral LTR is capable of driving ectopic expression of genes undergoing studying in our laboratory in NK-92 cells at the protein level and in primary NK at the mRNA level. To the best of our knowledge, this is the first report of PINCO's use as a gene delivery vector for NK-92.

In anticipation of using PINCO to functionally dissect genetic pathways in NK cells, we demonstrated that PINCO infected primary NK cells retain their ability to produce IFN-γ in response to monokine stimulation. We have obtained similar results in

NK-92 and NK-L. In addition, we have found that NK-92 and NK-L cells retain cytolytic activity after infection with PINCO and FACS purification. Finally, we applied

PINCO-directed gene transfer to the study of T-bet, a proposed master regulator of IFN-γ production by immune cells(41, 43). Indeed, we observed that inhibition of T-bet activity resulted in decreased production of IFN-γ by NK-92 cells following monokine co- stimulation.

Thus, we have identified the PINCO retrovirus as a novel tool for the stable genetic manipulation of primary human NK cells – including the CD56dim NK subset - and the NK-92 cell line. It is anticipated that the use of PINCO, together with the ongoing application of existing retroviral and episomal vectors, will contribute to the elucidation of the novel signal transduction pathways that govern human NK cell - 39 - function. With the advent of NK cell transplantation in cancer therapy for patients with

acute myeloid leukemia, the genetic manipulation of NK cell populations prior to

administration may conceivably provide a therapeutic benefit for the patient - by

enhancing NK cell survival, cytolytic function, cytokine production, and/or tumor

specific killing.

- 40 - Figure 5. Infection of primary NK cells with PINCO. (A) PINCO vectors used in this study; (B) Infection of human peripheral blood NK subsets with PINCO. The numbers in the upper right-hand corners of each histogam refer to the percent positive cells per quadrant, after first gating on viable cells. (C) RT-PCR for TSC-22R in primary NK transduced with this gene, compared to mock and vector only controls, compared to β- actin control reactions.

- 41 -

LTR CMV EGFP LTR PINCO A LTR TSC-22R MYC CMV EGFP LTR TSC-22R

LTR MYC T-bet CMV EGFP LTR T-bet LTR dnT-bet MYC CMV EGFP LTR dnT-bet

LTR LDB1 MYC CMV EGFP LTR LDB1

B Uninfected PI NCO PINCO TSC-22R

86 0 70 8 60 17 C C C C 14 0 21 1 20 3 P P P P bright

56 A 56 A 56 A 56 A dim D D D D C C C C

EGFP R R 2 2 o C o c c ck ck C-2 C-2 Water Water TS TS Mo Mo Pin Pin TSC-2 2R

β-actin

Figure 5.

- 42 -

Figure 6. Infection of NK-92 cells with PINCO. (A) NK-92 cells infected with T-bet,

LDB1, and empty PINCO virus; (B) Retrovirus-mediated protein expression revealed by

Western blotting for a MYC epitope. Filters were reprobed for β-actin or Grb2 to demonstrate equal loading.

- 43 -

PINCO T-BET A Uninfected Uninfected Infected Infected

Events Events

EGFP EGFP

LDB1

Uninfected Infected

Events EGFP

B

dnT-BET PINCO PINCO LDB1 α-MYC α-MYC

α-Grb2 α-Actin

Figure 6.

- 44 - Figure 7. Infection of NK-92 cells with PINCO8. (A) Substitution of a truncated

murine CD8 cDNA for EGFP yields the PINCO8 construct; (B) Magnetic selection of

PINCO8 infected NK-92 cells. (C) Simultaneous transduction of NK-92 cells with

PINCO and PINCO8, as revealed by CD8(+)EGFP(+) cells on cytometric analysis.

- 45 -

A LTR CMV EGFP LTR PINCO

LTR CMV CD8 LTR PINCO8

Pre-selection Post-selection

B ts 37% 95% n

Eve CD 8 PE

C 60 37

CD8 APC 1 2

EGFP

Figure 7.

- 46 -

Figure 8. Infected primary NK and NK-92 cells retain NK effector functions. (A)

Intracellular staining for IFN-γ production by FACS sorted, PINCO infected NK-92 in response to IL-12 plus IL-18 stimulation, compared to isotype control. (B) FACS purified, infected primary NK cells are capable of IFN-γ production in response to monokine stimulation as revealed by ELISA. (C) Upon FACS purification, infected NK-

92 cells exhibit cytolytic activity toward C7M3 targets in a 51Cr release assay.

- 47 -

A B 43 57 ) ) 120000 00 ml ml 100000 / / 80000 APC APC (pg (pg γ 60000 γ - - γ γ - - 40000 IFN 20000 IFN IFN IFN 0 None IL-12 + IL+18 IL-12 + IL-15 EGFP C Stimulus

30

20

10

0 % Specific Lysis % Specific Lysis 20 10 5 2.5 NK:Target cell ratio

Figure 8.

- 48 -

Figure 9. T-bet is required for optimal IFN-γ synthesis by NK-92 cells. (A)

Substitution of the putative transactivation domain of T-bet with EnR yields the dominant negative T-bet (dnT-bet) protein. (B) dnT-bet protein expression in retrovirally transduced NK-92 cellls after FACS purification, as revealed by immunoblotting for the

MYC-epitope at its C terminus. Vector (PINCO) infected cells are depicted for comparison. (C) ELISA reveals inhibition of IFN-γ production by dnT-bet expressing

NK-92 upon 24 hour stimulation with IL-12 + IL-15/IL-18, relative to negative controls

(EnR domain, vector only). (D) Intracellular staining in dnT-BET (green) versus vector

(gray) infected cells after 24 hours stimulation with IL-12 + IL-18 demonstrates inhibition of IFN-γ production by dnT-bet.

- 49 -

O

B C A PIN dnTBET α-MYC T-BET T-BOX T-A -Grb2 dnT-BET MYC α T-BOX EnR C

400000 D 350000 ) l

m 300000 g/

p 250000 12+15

a ( 200000 m 12+18 m 150000 ga -

100000 Events

N F I 50000 0 PINCO EnR dnTBET IFN-γ APC

Figure 9.

- 50 -

CHAPTER 4

The Homeobox Transcription Factor, Hlx, is a Negative Regulator of IFN-γ

Production in NK Cells.

4.1. Introduction

Innate immunity is characterized by the ability of immune cells to rapidly detect

an invading pathogen and restrict its dissemination while targeting compromised host

cells for elimination. This complex task is achieved in part through the production of

soluble cytokines and chemokines by NK cells(1). NK cells elaborate IFN-γ in response to stimulation with monokines – particularly IL-12 in combination with IL-15, IL-18, or

IL-1β(20). IFN-γ signals via a heterodimeric receptor and STAT1 to promote the

maturation and activation of monocytes, leading to improved antigen presentation and the

establishment of macrophage effector functions(8).

The importance of IFN-γ is illustrated by naturally-occurring mutations in IFN-γ

receptor subunits and STAT1 in humans, who are highly susceptible to systemic disease

following mycobacterial infection or vaccination with bacillus Calmette-Guerin(9). In

addition, mice lacking IFN-γ responsiveness exhibit increased incidence of tumors,

consistent with a role for IFN-γ in tumor surveillance by immune cells(10). Whereas the - 51 - beneficial roles of IFN-γ are unquestionable, excessive IFN-γ can be detrimental to the host. For example, IFN-γ is implicated in the etiology of inflammatory bowel disease(22). In addition, unabated IFN-γ production leads to enhanced apoptosis of hematopoietic stem cells and impaired NK cell development(24). Thus, it is not surprising that IFN-γ synthesis is subject to stringent control in vivo, with multiple checkpoints including transcriptional control(26). Numerous trans-acting factors have been implicated as positive regulators of IFN-γ transcription (Table 1); however, the negative regulation of this process is far less appreciably understood at a molecular level.

H2.0-like homeo box 1 (HLX1, HB24, Hlx) encodes a putative homeobox transcription factor that is highly conserved among vertebrates(47). Experiments in murine CD4(+) T cells identified Hlx as a transcriptional target of the TH1 transcription

factor, T-bet(43, 45). Furthermore, over-expression of Hlx during TH2 differentiation results in increased levels of IFN-γ mRNA and protein production(43, 45, 82). The function of Hlx in NK cells has not been investigated. In this study, we have sought to establish the role of Hlx in IFN-γ production by human and murine NK cells.

Interestingly, our data indicate that Hlx is a negative regulator of IFN-γ production by

NK cells, and that its inhibitory function is achieved in part through proteasomal degradation of STAT4, a key transcription factor for IFN-γ mRNA synthesis(62, 63).

- 52 -

4.2. Methods

Human NK cell isolation

Human peripheral blood source leukocytes were obtained from healthy individuals (American Red Cross, Columbus, OH) in accordance with The Ohio State

University Institutional Review Board. NK cells were enriched by depletion of T, B, and monocyte lineages (Rosette-Sep, Stem Cell Technologies, Vancouver, CA) and Ficoll-

Hypaque density centrifugation (Amersham Biosciences, Piscataway, NJ). For total NK isolation, this enriched NK preparation was stained with CD56 microbeads and isolated by positive selection on LS magnetic columns (Miltenyi Biotech, Auburn, CA). The purity was always >98%, as determined by direct immunofluorescence using an anti-

CD56 phycoerythrin (PE)-conjugated monoclonal antibody (mAb, Beckman Coulter,

Miami, FL) and a FACSCalibur instrument (BD Biosciences, San Jose, CA). For NK

subset isolation, total CD56(+) NK were stained with anti-CD56 PE, and CD56bright and

CD56dim subsets were isolated to >99% purity by fluorescence activated cell sorting

(FACS) on a FACSVantage instrument (BD Biosciences). Cytometric data were analyzed

with CellQuest (BD Biosciences) or WinMDI (J. Trotter, Scripps Institute, La Jolla, CA) software.

- 53 - Cell lines

NK-92 cells were maintained in RPMI 1640 medium (Invitrogen, Carlsbad, CA) containing glutamine, 20% fetal bovine serum (FBS, Invitrogen), antibiotic / antimycotic

(Invitrogen), and recombinant human IL-2 (150 IU/ml, Hoffman-LaRoche, Nutley, NJ) at

37ºC, in an atmosphere of 5% CO2. Phoenix-Ampho cells were maintained in high glucose Dulbecco modified Eagle medium (DMEM, Invitrogen) containing 10% FBS and transfected at 80% confluence by calcium phosphate-DNA precipitation (ProFection,

Promega, Madison, WI). AFT024 cells were maintained on 0.1% gelatin-coated plates in low glucose DMEM containing 20% FBS.

Murine NK cell culture

Hlx+/– mice (83) were bred onto an FVB/N genetic background for >10

generations and maintained in a pathogen-free barrier facility. All animal work was

approved by The Ohio State University Animal Care and Use Committee, and mice were

treated in accordance with institutional protocols. Dams from heterozygous

interbreedings were sacrificed at 13.5 days post coitum (E13.5) and fetal livers were

obtained from each embryo by blunt dissection. Genomic DNA was isolated from

extrahepatic tissue (Extract-N-Amp Tissue PCR Rapid Genotyping Kit, Sigma, St. Louis,

MO) for genotyping by PCR as described(83). Fetal liver cells were repeatedly drawn

through a 21 gauge needle to establish a single-cell suspension. Cells were cultured at a

density of 10,000 cells/well in 96 well round bottom plates in DMEM supplemented

- 54 - with: 10% FBS, antibiotic / antimycotic, glutamine, PEGylated rat (100 ng/ml, Amgen, Thousand Oaks, CA), murine IL-7 (10 ng/ml, Peprotech, Rocky Hill, NJ), human Flt-3 ligand (100 ng/ml, Amgen), and human IL-2 (1000 IU/ml, Hofman-

LaRoche). Half the medium was replaced every 3-4 days with 2x cytokines. After 14 days, a homogenous population of NK cells was confirmed by flow cytometry using a panel of lineage markers (BD, Santa Monica, CA): allophycocyanin (APC) conjugated

NK1.1 and DX5 PE, CD19-biotin, CD14-biotin, CD3-biotin, and Ter119-biotin, followed

by PerCP-Cy5.5 conjugated streptavidin.

Hlx cDNA cloning, virus production, and infection of primary NK and NK-92 cells

The entire Hlx open reading frame, containing its native start and stop codons,

was amplified from human peripheral blood leukocyte cDNA and introduced into the

TA-cloning vector, pCR2.1-TOPO (Invitrogen). Forward and reverse primers for PCR

amplication were modified at their 5’ ends with BamHI and EcoRI sites, respectively.

After bidirectional sequencing, the Hlx cDNA was mobilized to the PINCO retroviral transfer vector as a BamHI-EcoRI fragment. Alternatively, for in vitro translation and

IFN-γ reporter assays, Hlx was subcloned into pcDNA3.1 (Invitrogen). For all plasmids, large-scale plasmid purification of was achieved with the Qiaprep Maxi Kit (Qiagen,

Carlsbad, CA). PINCO retrovirus was produced by transient transfection of Phoenix-

Ampho cells as described (84). Virus containing supernatant was harvested 48 hours after transfection, filtered through 0.45 microns, and frozen at –80ºC until use. NK-92 and primary human NK cells were transduced with PINCO or PINCO-Hlx retrovirus by

- 55 - three cycles of infection, exactly as described (84). Virally infected NK-92 cells were sorted to >99% purity based on EGFP fluorescence.

Monokine stimulation of NK cells

Human NK cells were stimulated at 2 million/ml in RPMI medium containing

10% FBS and: IL-12 (10 ng/ml, Genetics Institute); IL-15 (100 ng/ml, Amgen); and/or

IL-18 (50 ng/ml, R&D Systems). Prior to stimulation at 1 million/ml, NK-92 cells were washed extensively with PBS and rested for 24 hours in RPMI containing 10% FBS in the absence of IL-2. Murine NK cells were stimulated at 2 million/ml in DMEM containing 10% FBS with the following cytokines: murine IL-12 (10 ng/ml, Genetics

Institute); human IL-15 (3 ug/ml, Amgen); murine IL-18 (10 ng/ml, R&D Systems); and/or human IL-2 (1000 IU/ml, Roche).

For proteasomal inhibition, MG-132 (Calbiochem), epoxomicin (Sigma), and lactacystin (Sigma) were reconstituted according to the manufacturer and incubated with rested PINCO-Hlx infected NK-92 cells for 30 minutes at 37ºC before addition of IL-12 and IL-18 for the indicated times. For inhibition of new protein synthesis, cycloheximide

(CHX; Sigma) was reconstituteed in ethanol and used at a final concentration of 20 µg/ml as described. Cells were pre-treated with CHX for 30 minutes at 37ºC before the addition of monokines.

- 56 - Intracellular staining for IFN-γ and Y693 pSTAT4

To detect IFN-γ, brefeldin A (BD) was added to monokine stimulated human or murine NK cells for the final 6 hours prior to harvest. Cells were stained with lineage- specific surface antigens (CD56 APC or NK1.1 APC for human or mouse NK, respectively), washed extensively, and permeabilized with Cytofix/Cytoperm reagent

(BD) for 20 minutes on ice. Next, cells were washed twice with 1x Perm/Wash (BD) and stained with Phycoerythrin-Cy7 (PE-Cy7) conjugated mouse anti-human IFN-γ or mouse

IgG1 isotype control mAb (BD) for 30 minutes on ice. Alternatively, murine cells were stained with allophycocyanin (APC) conjugated rat anti-mouse IFN-γ or rat IgG1 isotype

control mAb (BD). Cells were washed twice with 1x Perm/Wash, fixed in 1% formalin,

and analyzed immediately.

Alternatively, to detect Y693 pSTAT4, retrovirally infected human cells were fixed and permeabilized by incubation in Reagent A (CALTAG Laboratories,

Burlingame, CA) followed by methanol according to a published protocol (85). After extensive washing, cells were resuspended in Reagent B (CALTAG) and stained for 30 minutes on ice with AlexaFluor 647 conjugated mouse anti-human Y693 pSTAT4 or

IgG2b isotype control mAb (BD), along with CD56 PE. Cells were washed extensively, fixed in 1% formalin, and analyzed immediately.

- 57 - Detection of IFN-γ protein by ELISA

Human IFN-γ protein was detected in cell-free supernatants by sandwich ELISA using commercial mAb (Endogen, Woburn, MA). The detection limit was 10-30 pg/ml.

Results are the mean of triplicate wells ± standard deviation. Murine IFN-γ protein was analyzed using a commercial ELISA (R&D Systems, Minneapolis, MN).

Comparative gene expression analyses

Total RNA was extracted from 0.5-2x105 human NK, sorted NK subsets, NK-92

cells, and fetal liver derived NK by using the RNeasy® Mini (Qiagen). RNA samples

were reverse transcribed with MMLV reverse transcriptase (Invitrogen) and random

hexamers according to the manufacturer's instructions. For QRT-PCR, all primers and

probes were designed using Primer Express software (Applied Biosystems, Foster City,

CA) and the sequences are as follows: human Hlx: forward 5’-

CCCAAGAAATTCAGTTCAGCATC-3’, reverse 5’-TGCGGCATGGTGTCCTT-3’,

probe 5’-FAM-CCAAGACACGTTTCCAGGT-CCCTATGC-Tamra-3’; human IFNG:

forward 5’-GAAAAGCTGACTAATTATTCGGTA ACTG-3’, reverse 5’-

GTTCAGCCA-TCACTTGGATGAG-3’, probe 5’-FAM-CTTGAATGT

CCAACGCAAAGC-AATACATGA-Tamra-3’; human STAT4: forward 5’-

GCTGAGAGCTG-TAGTGTTTACCGA-3’, reverse 5’-

AATAAAGGCCGGTTGTCTGCT-3’, probe 5’-FAM-

AGTCTCGCAGGATGTCAGCGA-ATGG-Tamra-3’; mouse Ifng: forward 5’- - 58 - AGCAACAGC-AAGGCGAAAA-3’, reverse 5’-CTGGACCTGTGGGTTGTTGA-3’, probe 5’-FAM-CCTCAAACTTGGCAATACTCATGAA-TGCATCC-Tamra-3’. Each

QRT-PCR reaction consisted of a 25 µl total volume containing cDNA, gene-specific primers and probes at pre-optimized concentrations, and 1× PCR master mix (Applied

Biosystems). Reactions were performed in an ABI prism 7700 sequence detector

(Applied Biosystems) using the following conditions: First step: 50ºC for 2 min; second step: 95ºC for 10 min; third step: 45 cycles of 95ºC for 15 sec and 60ºC for 1 min. Data were analyzed with the Sequence Detector version 1.6 software to establish the PCR

cycle at which fluorescence exceeded a set threshold, CT, for each sample. Relative levels of these mRNAs were computed after normalizing to internal 18S control reactions by the 2-∆∆Ct method(19). Results – expressed as the mean ± SEM of triplicate wells - are the n-fold difference of transcript levels in an 18S-normalized sample compared to calibrator cDNA. Calibrator cDNA was: Unstimulated NK (Figure 1a), unstimulated

CD56dim NK (Figure 1c), unstimulated PINCO NK-92 (Figure 3b and 3c), or IL-12 and

IL-15 stimulated wildtype or heterozygous NK (Figure 4c).

Detection of Hlx protein and immunoblotting

Hlx protein was detected using affinity-purified rabbit antisera raised against a bacterially expressed GST-Hlx fusion protein (Abgent, San Diego, CA). To construct the

GST-Hlx fusion protein, a human Hlx cDNA fragment corresponding to amino acids

333-488 was PCR amplified as a BamHI-EcoRI fragment and cloned into the pGEX-6P-1

- 59 - plasmid (Amersham Biosciences). Affinity-purified Hlx antisera was used at 1:1000

dilution.

For immunoblotting, cells were harvested, washed once with ice-cold phosphate-

buffered saline (PBS), and lysed as described(86). Alternatively, crude

nucleocytoplasmic fractionation was performed as described (87). Proteins were resolved

on 7.5% gels by SDS-PAGE (BIO-RAD Laboratories, Hercules, CA), and Western

blotting was performed under reducing conditions. Antibody-reactive proteins were

detected with horseradish peroxidase conjugated anti-rabbit, anti-mouse, or anti-goat

antisera and enhanced chemiluminescence (Amersham Biosciences). The following

commercial primary antibodies were used for immunoblotting: anti-pSTAT4 Y693

(mouse IgG2b monoclonal from BD, 1:5,000); anti-total STAT4 (rabbit polyclonal from

Santa Cruz, 1:1000); anti-beta actin (goat polyclonal from Santa Cruz, 1:1000); anti-

Ku70 (rabbit polyclonal from Santa Cruz, 1:1000). Rabbit anti-Brg1 antisera, a kind gift

of Dr. Saïd Sif (Ohio State University), was used at 1:1000.

Reporter assays

DERL-7 cells were maintained in 20% RPMI supplemented with IL-2 (150

U/ml). Prior to each experiment, cells were washed extensively with PBS and starved

with 10% RPMI in the absence of IL-2 for 24 hours. DERL-7 were transfected by

electroporation using an Amaxa Nucleofection Device (Amaxa, Cologne, Germany). For

each transfection, 5 million cells were resuspended in 100 ul Amaxa Solution V along

with DNA as follows: 5 ug of promoter-free pGL3-Basic (Promega) or the IFN-γ firefly

- 60 - luciferase vector depicted in Figure 18B (a kind gift of Howard Young, National Cancer

Institute; (37)); 5 ug of pcDNA3.1-Hlx or empty pcDNA3.1 vector (Invitrogen); and 50 ng of CMV-renilla luciferase vector (Promega); and electroporated using Program O-17.

Following electroporation, cells were immediately placed in 10% RPMI in the presence or absence of monokines, as indicated, and incubated for 6 hours at 37C. Cells were subsequently washed with ice-cold PBS, lysed in 140 ul 1x passive lysis buffer

(Promega), and placed at –80C for at least 24 hours before luminescence detection by the dual-luciferase reporter system (Promega). Alternatively, 293T cells were seeded in 24 well plates on the afternoon prior to transfection at 300,000 cells/well in 10% DMEM.

Cells were tranfected in triplicate the following morning using Lipofectamine 2000 and

Plus Reagent according to the manufacturer (Invitrogen). 1 ug of pGL3-Basic or IFN-γ

reporter was used, along with 1 ug of Hlx or empty pcDNA3.1 expression plasmid, and 5

ng of pRL-TK (Promega) as an internal control for transfection efficiency. Luciferase

activity was measured 48 hours after transfection via the dual luciferase reporter assay

(Promega).

In vitro translation of Hlx and GST-INI1 pulldown experiment

Hlx was synthesized in vitro by incubating 1 µg of pcDNA3.1-Hlx with 25 µl of

TNT-coupled rabbit reticulocyte lysate in the presence of [35S]methionine and cysteine

(NEN) according to the manufacturer's instructions (Promega). Plasmids for bacterial expression of glutathione S-transferase (GST) fusion proteins (PAH2 domain of mSin3a,

INI1, and empty pGEX2TK vector) were provided by Dr. Saïd Sif(88). GST fusion

- 61 - proteins were expressed in E. coli according to a standard protocol(89). To immobilize

GST fusion proteins, 500 µg of bacterial extract was incubated with 50 µl of GST beads on ice for 30 min. Bound proteins were washed with buffer STE-500 (20 mM Tris-HCl

[pH 7.6], 5 mM MgCl2, 500 mM NaCl, 1 mM EDTA) supplemented with: 0.5% Nestlé

Carnation milk, 1% BSA, 0.25 mM DTT, and 0.5 mM PMSF. Washed beads were then blocked in 250 µl of buffer STE-100 containing 1 mg of uninduced bacterial extract per ml, 1% BSA, 0.5% Nestlé Carnation milk, and 100 µg of ethidium bromide per ml.

Approximately 8 x 104 cpm of in vitro-translated, 35S-labeled Hlx was added to immobilized GST fusion proteins and incubated at 4°C for 12 to 16 h. Beads were washed two times with 300 µl of STE-100 containing 1% BSA and 0.5% Carnation milk, then three times with 300 ul of STE-100 alone, and the retained protein was resolved by

SDS-PAGE. The dried gel was subject to autoradiography.

Statistical analysis

Data were analyzed using a Student 2-tailed t test. p < 0.05 was considered statistically significant.

- 62 -

4.3. Results

Hlx is induced by monokine co-stimulation of CD56bright NK cells, but its expression is delayed with respect to IFN-γ

Hlx is a regulator of IFN-γ transcription in T lymphocytes(43, 45, 82). Therefore, we investigated the relationship between Hlx protein and IFN-γ mRNA levels in primary human NK cells over time following treatment with IL-12 and IL-18. Hlx protein induction peaked at 72 hours and was maintained after 96 hours of stimulation, whereas

IFN-γ mRNA production peaked at 24 hours and subsequently declined (Figure 10A); similar kinetics of Hlx protein expression were observed in the NK-92 cell line (data not shown). Maximal induction of Hlx protein required monokine combinations (e.g., IL-12 and IL-18) that synergistically promote IFN-γ production(20), whereas treatment with

individual monokines led to modest or undetectable changes in Hlx (Figure 10B).

CD56bright NK produce substantially higher levels of IFN-γ than CD56dim NK cells in response to monokine treatment(19, 20). We therefore sought to determine whether expression of Hlx was restricted to either CD56 subset. The levels of Hlx transcript and protein were quite comparable in resting NK subsets (Figure 10C). However, induction of Hlx mRNA and protein occurred preferentially in CD56bright NK following treatment

with IL-12 in combination with IL-18 or IL-15 (Figure 10C). Taken together, these - 63 - experiments indicated that Hlx expression was induced by monokine co-stimulation and enhanced within the CD56bright NK subset, but that Hlx protein expression was delayed

with respect to peak IFN-γ mRNA synthesis.

Ectopic Hlx expression inhibits IFN-γ production by CD56bright NK and NK-92 cells

Based on the kinetics of Hlx expression relative to IFN-γ transcription, we

hypothesized that Hlx may negatively regulate IFN-γ production in CD56bright NK cells.

To directly test this hypothesis, we retrovirally expressed Hlx in primary human

CD56bright NK cells and the NK-92 cell line. The Hlx open reading frame was cloned into the retroviral vector, PINCO, in which an enhanced green fluorescent protein (EGFP) marker is expressed from an internal cytomegalovirus promoter(72). Following infection with Hlx or empty vector, primary human NK cells were stimulated with IL-12 and IL-

18, and IFN-γ production in CD56brightEGFP(+) and CD56dimEGFP(+) NK cells was measured by intracellular staining (Figure 11). We observed a significant decrease in the mean fluorescence of IFN-γ(+) CD56bright cells infected with PINCO-Hlx compared to

PINCO vector alone (p < 0.001; n = 4 experiments), whereas no significant effect of Hlx was observed in the CD56dim NK subset.

Since cell numbers of primary infected CD56bright NK were limited, we performed

parallel experiments in the CD56bright NK-92 cell line to address the mechanism of Hlx action. NK-92 cells infected with Hlx or empty vector were sorted to purity based on

EGFP fluorescence, and Hlx over-expression was confirmed by immunoblotting nuclear

and cytosolic protein from these cells (Figure 12A). In response to IL-12 and IL-18 - 64 - stimulation, we observed that over-expression of Hlx reproducibly inhibited IFN-γ expression at the mRNA and protein level (Figure 12B). In addition, time-course

experiments demonstrated that unstimulated Hlx and vector infected cells express

identical amounts of IFN-γ message and initially exhibit similar kinetics of mRNA induction following stimulation. However, beginning at 6 hours, the two populations drastically diverge (Figure 12C). Thus, ectopic expression of Hlx in primary CD56bright

NK and NK-92 cells led to inhibition of IFN-γ production in response to monokine co-

stimulation, and this inhibition occurred at the level of IFN-γ mRNA.

Elevated IFN-γ production by Hlx deficient NK

To determine whether endogenous Hlx is required to limit IFN-γ production in

response to monokine stimulation, we performed experiments with murine NK cells

deficient in Hlx. Hlx–/– animals die in utero due to a defect in liver and gut development, but heterozygous animals develop normally(83). We therefore obtained fetal liver cells from heterozygous matings at embryonic day 13.5 (E13.5) and derived NK cells in vitro.

These cells were uniformly NK1.1(+)DX5(+)CD3(–) (Figure 13A). We stimulated NK cells of each Hlx genotype with IL-12 and IL-15 and measured IFN-γ production by intracellular staining (Figure 13B). Loss of both Hlx alleles results in a significantly increased proportion of IFN-γ(+) NK cells compared to wildtype and heterozygous cells

(Figure 13B; p = 0.0003 for Hlx+/+ versus Hlx–/–; p = 0.0048 for Hlx+/– versus Hlx–/–; n ≥

9 livers of each genotype). In contrast, loss of one Hlx allele did not yield a statistically

- 65 - significant difference, compared with wildtype cells (p = 0.0966 for Hlx+/+ versus Hlx+/–).

We confirmed increased IFN-γ production by Hlx–/– NK at the protein level by ELISA

(data not shown) and at the mRNA level by quantitative RT-PCR (QRT-PCR) (Figure

13C). Therefore, loss of Hlx resulted in elevated levels of IFN-γ mRNA and protein

synthesis by murine NK cells following monokine co-stimulation.

Hlx promotes STAT4 degradation in NK-92 and CD56bright NK by a proteasome

dependent pathway

We hypothesized that Hlx might regulate IFN-γ mRNA levels by inhibiting the

function and/or activity of a positive regulator of IFN-γ production. STAT4 is a known

trans-activator of the IFN-γ promoter in NK cells(62, 63). STAT4 is activated by

tyrosine phosphorylation at tyrosine residue 693 (Y693) in response to IL-12 stimulation,

resulting in its nuclear translocation and direct association with the IFN-γ promoter(38).

Interestingly, endogenous levels of STAT4 protein decreased following stimulation of

primary human NK or NK-92 cells with IL-12 and IL-18, in parallel with Hlx induction

(Figure 14A). We therefore hypothesized that Hlx may affect the levels of STAT4 in NK

cells, thereby inhibiting IFN-γ mRNA synthesis. We investigated the levels of total

STAT4 and Y693 pSTAT4 protein in NK-92 cells transduced with Hlx or empty vector,

following stimulation with IL-12 and IL-18 (Figure 14B). PINCO-Hlx infected cells

initially expressed equal or even greater levels of Y693 pSTAT4 than PINCO control

cells. However, Y693 pSTAT4 levels were not maintained at later time-points (12 hr and onward) in PINCO-Hlx infected cells, and the entire pool of STAT4 protein was - 66 - significantly reduced as well. We also found that retroviral expression of Hlx in primary

NK reduced the proportion of Y693 pSTAT4(+) cells following IL-12 and IL-18 treatment (Figure 14C; n = 5 independent experiments; p = 0.0045).

This reduction in total STAT4 protein levels led us to test whether Hlx expression is associated with a decrease in STAT4 mRNA; however, no difference in STAT4 transcript levels was observed in Hlx and vector infected NK-92 cells during time-course experiments in IL-12 and IL-18 (n=4 experiments; data not shown). Y693 pSTAT4 has been shown to undergo proteasome-dependent degradation in T lymphocytes following

IL-12 treatment(90-92). We therefore attempted to reverse the loss of Y693 pSTAT4 protein through the application of MG-132, an inhibitor of the 26S proteasome subunit.

Indeed, MG-132 rescued the loss of Y693 pSTAT4 following treatment of Hlx expressing NK-92 cells with IL-12 and IL-18 (Figure 14D). Similar results were obtained using additional proteasome inhibitors, epoxomicin and lactacystin (Figure

14E). The simplest interpretation of this experiment is that Hlx promotes the proteasomal degradation of polyubiquitylated Y693 pSTAT4. This is consistent with the proteasome dependent loss of Y693 pSTAT4 protein in T cells following IL-12 treatment(90-92).

However, we have been unable thus far to detect this presumably unstable polyubiquitylated pSTAT4 intermediate by immunoprecipitating with STAT4 antisera and blotting with ubiquitin antisera (B. Becknell, data not shown). A recent study of

STAT5 regulation in myeloid cells has demonstrated that pSTAT5 is degraded exclusively in the nucleus(93). These authors experienced a similar difficulty in detected polyubiquitylated pSTAT5 by immunoprecipitation with STAT5 antisera. However, they resolved this technical difficulty by performing DNA affinity purification of pSTAT5

- 67 - from nuclear extracts, and this approach facilitated the detection of polyubiquitylated pSTAT5 protein in the presence of proteasome inhibitors(93). In the future, it will be important to determine if STAT4 degradation is compartmentalized in the nucleus in NK-

92 cells over-expressing Hlx. If so, a similar strategy of DNA affinity purification from

nuclear extracts may be applied to successfully detect the polyubiquitylated Y693

pSTAT4 protein in the presence of MG-132 following IL-12 and IL-18 stimulation.

How might Hlx facilitate ubiquitin-dependent degradation of STAT4? One

possibility is that Hlx is required for the expression and/or activity of SLIM, an E3

ubiquitin ligase for STAT4(90). We tested the effect of Hlx overexpression on SLIM

protein levels in NK-92 cells, both at rest and following IL-12 and IL-18 stimulation, and

did not find an effect (data not shown). However, this does not rule out the possibility

that Hlx interacts with SLIM and modulates its association with STAT4 or its ubiquitin ligase activity. Since Hlx is a putative regulator of transcription, it is conceivable that a transcriptional target of Hlx – rather than Hlx itself - may be responsible for STAT4 degradation in NK-92 cells over-expressing Hlx. We therefore tested the effect of cycloheximide (CHX), a global inhibitor of protein translation, on STAT4 levels in NK-

92 cells infected with Hlx or PINCO following IL-12 and IL-18 treatment. We found that the effect of Hlx over-expression on Y693 pSTAT4 levels was preserved in the presence of CHX (Figure 15). This CHX resistance is consistent with the hypothesis that

Hlx itself may regulate STAT4 degradation, although it does not eliminate the

possibilities that: (1) Hlx regulates transcription of a target gene that is constitutively

altered in Hlx over-expressing NK-92 in a manner independent of IL-12 and IL-18

treatment; and/or that (2) Hlx regulates transcription but not translation of a functional

- 68 - RNA that regulates STAT4 turnover. Moreover, the CHX resistance of decreased

STAT4 levels in Hlx over-expressing cells fits our hypothesis that Hlx regulates STAT4 degradation, not new STAT4 protein synthesis.

Hlx represses IFN-γ promoter activity in NK cells

Since Hlx is a homeobox TF, we reasoned that Hlx may associate with and regulate transcriptional activity at the IFN-γ promoter in NK cells, in a manner potentially independent from its ability to regulate Y693 pSTAT4 protein levels. To begin to test this hypothesis, we determined if Hlx can inhibit IFN-γ promoter activity in vivo. To this end, we made use of luciferase reporter assays in the DERL-7 NK-like cell line, which is easily transduced by electroporation(94, 95). As described in detail under

"Methods", DERL-7 were electroporated with a previously characterized "full-length" human IFN-γ promoter-firefly luciferase reporter construct, containing approximately 3.6 kB of IFN-γ 5' flanking sequence as well as a 0.8 kB intron one fragment following the luciferase open reading frame (Figure 16A, (37)). Following electroporation, cells were

placed in medium alone or treated with IL-12 and IL-18. After normalizing for

transfection efficiency, we determined that Hlx exhibits some repressive activity toward

the IFN-γ promoter in the absence of monokine co-stimulation, but - more importantly -

Hlx inhibits IL-12 and IL-18 inducible IFN-γ promoter activity entirely (Figure 16B).

This finding, in agreement with our functional data, is consistent with the theory that Hlx

may act as a transcriptional repressor. Moreover, we have observed that Hlx is capable

- 69 - of repressing IFN-γ activity in mouse mesenchymal fibroblasts (data not shown) as well as in transformed embryonic kidney cells (Figure 16C), both of which lack detectable

STAT4 protein.

4.4 Discussion

Regulation of Hlx Expression in NK Cells

In this study, we found that Hlx is a novel negative regulator of IFN-γ production in NK cells following monokine co-stimulation. The delayed kinetics of Hlx protein induction with respect to IFN-γ itself are consistent with a model in which Hlx serves as a feedback inhibitor of IFN-γ synthesis in activated CD56bright NK. This Hlx-mediated

negative feedback pathway is likely important in vivo, given the potentially deleterious

effects of unchecked IFN-γ production on the host(22, 24). Exactly how the Hlx protein

is induced is a matter of current investigation. Since our studies were performed using

highly purified NK populations, the inference is that these cells possess an intrinsic

program to initiate Hlx expression. The process of Hlx protein induction following

monokine co-stimulation is likely complex. Indeed, Hlx regulation must occur at

transcriptional and post-transcriptional levels, since our expression studies establish long

lags both between monokine co-stimulation and the onset of Hlx mRNA expression

(approximately 12 hours, B. Becknell, data not shown), as well as between the onset of

detectable Hlx mRNA and increased Hlx protein expression (between 12-36 hours).

With regard to translational control of Hlx, it might be insightful in the future to - 70 - determine the relative association of cytoplasmic Hlx mRNA with the polyribosomal

(translationally active) versus monoribosomal (translationally silent) fractions in NK cells following monokine co-stimulation. In this case, a late-occurring shift from the monoribosomal to the polyribosomal fraction would attest to a potentially crucial regulatory interaction at the level of Hlx translation(75).

Regulation of STAT4 Protein Levels by Hlx

We have demonstrated that over-expression of Hlx results in a loss of Y693 pSTAT4 as well as unphosphorylated STAT4 protein following monokine co- stimulation. We found that proteasome inhibitor treatment can partially rescue the loss of

STAT4 protein, especially Y693 pSTAT4. The incomplete nature of the rescue is likely due to a limitation in the use of broad-spectrum proteasome inhibitors. Indeed, we observed that >6 hr treatment with these drugs resulted in a paradoxical decrease in pSTAT4 and total STAT4 protein levels in cells following monokine co-stimulation, irrespective of Hlx over-expression (B. Becknell, data not shown). This apparent reliance on the proteasome for long-term maintenance of STAT4 phosphorylation and overall protein expression may be due to a requirement for NFκB, a TF activated in a proteasome-dependent manner following treatment with IL-18(58, 96). Alternatively, the incomplete rescue of Y693 pSTAT4 levels by proteasome inhibition may be due to the detection of this protein in whole cell extracts. Indeed, pSTAT5 has been shown to undergo proteasome-dependent degradation in the nucleus, whereas cytoplasmic pSTAT5 is dephosphorylated and is not degraded(93). It may be useful in the future to fractionate

- 71 - nuclear and cytoplasmic protein from Hlx over-expressing NK-92 cells following IL-12

and IL-18 treatment, to determine if the effects of Hlx and the proteasome are restricted

to the nucleus.

Interestingly, we observed that co-stimulation with IL-18 is required for the effect

of Hlx on Y693 pSTAT4 and total STAT4 levels, as well as IFN-γ. In contrast, Hlx

over-expression does not affect Y693 pSTAT4 or total STAT4 levels following treatment

with IL-12 alone, and the expression of IFN-γ is slightly increased under these conditions

(B. Becknell, data not shown). Thus, whereas IL-12 is sufficient for STAT4

phosphorylation in NK cells(97), the combination of IL-12 and IL-18 is required – at

least in NK-92 cells – to elicit the Hlx-dependent effects on STAT4 and IFN-γ

expression. The ability of Hlx to maintain its effect on Y693 pSTAT4 levels in the

presence of CHX eliminates the contribution of new protein synthesis to this process

(Figure 15), suggesting that Hlx alone may be sufficient to promote STAT4 degradation.

However, we have not fully rejected the hypothesis that Hlx functions as a TF and that it

is in fact the transcriptional target(s) of Hlx - that are translated prior to CHX and

monokine treatment - which modulate Y693 pSTAT4 levels.

The unquestionable key to unlocking the mysterious role of Hlx in STAT4

regulation is the additional requirement for IL-18 stimulation. One may well ask: What

is known about IL-18 signaling in NK cells? The answer to this question is complicated

by the finding that IL-18 receptor expression and hence, responsiveness to this cytokine,

requires co-stimulation with IL-12(98). Therefore, it is important to consider that IL-18

signaling is proceeding in parallel to and likely converging upon multiple targets of IL-12

signaling. Indeed, it is the convergence of IL-12 and IL-18 signaling that permits these - 72 - monokines to potently synergize at the level of IFN-γ transcription. In this regard, the best described target of convergent IL-12 and IL-18 signals also happens to be the most

relevant to this discussion, namely, the IFN-γ promoter itself. STAT4 undergoes tyrosine

phosphorylation at residue 693 in response to IL-12 elicited JAK activity(99). The

addition of IL-18 results in activation of JNK, which phosphorylates c-Jun(39), resulting

in increased transcriptional activity(100). In the nucleus of IL-12 and IL-18 stimulated

cells, the association of phosphorylated c-Jun and Y693 pSTAT4 at an AP-1 element in

the proximal IFN-γ promoter is critical for monokine co-stimulation(39).

While the convergence of c-Jun and STAT4 provides a sound molecular basis for

transcriptional synergy of IL-12 and IL-18 at the IFN-γ promoter, this protein complex

strikes us as an opportune target to attenuate transcription, given the recent description of

a ubiquitin ligase, called Itch, that promotes c-Jun turnover in T cells(101). Itch is

normally quiescent through an autoinhibitory interaction between its HECT and WW domains(102). In response to JNK phosphorylation, Itch undergoes an activatory conformational change that permits its association – via the WW domain – with multiple cellular protein substrates, including c-Jun, resulting in substrate polyubiquitylation and degradation(101). Since IL-18 activates JNK activity, it is conceivable that – in addition to phosphorylating c-Jun itself - JNK phosphorylates Itch after some delay, resulting in polyubiquitylation of c-Jun and downmodulation of IFN-γ transcription. Since STAT4 is

associated with c-Jun, the degradation of these two TFs may be coupled together, and

STAT4 may even be a bone fide substrate of Itch. In support of the latter, the extreme C-

terminus of STAT4α contains four putative class IV WW domain interaction motifs

(eukaryotic linear motif resource, http://www.elm.eu.org). Class IV motifs interact with - 73 - WW domains in a manner dependent on phosphorylation of serine or threonine(103), which is particularly interesting given that one motif in STAT4α, at residues 718-723

(LPMSPS) contains serine 721, a residue that undergoes MAPK-dependent

phosphorylation(99). This is all the more enticing an idea, given the observation that the

alternatively transcribed STAT4β isoform, which lacks the C-terminus including serine

721, apparently fails to undergo polyubiquitylation and proteasome dependent

degradation(92). While this admittedly speculative model accounts for the requirement

for IL-18 in Y693 pSTAT4 degradation, namely via JNK activation and Itch recruitment

to the c-Jun / pSTAT4 complex, it still does not account for the role of Hlx. However, it

is conceivable that Hlx may trigger JNK activity or serve as a cofactor to accelerate

polyubiquitylation of c-Jun and/or Y963 pSTAT4 by Itch, perhaps by recruiting Itch to

these TFs at the level of DNA. Notably, this model would not necessarily require new

protein synthesis, and is therefore consistent with the CHX-resistance of pSTAT4

degradation in Hlx over-expressing cells. To begin to test this model, it will be insightful

to determine if c-Jun undergoes degradation in NK cells following IL-12 and IL-18

treatment, and if Hlx over-expression promotes this process as it does for Y693 pSTAT4.

If c-Jun and Y693 pSTAT4 degradation parallel one another, and if these processes are

accelerated by Hlx, then it may be insightful to explore the potential role of Itch in this

process.

- 74 - Does Hlx Function as a Direct Repressor of IFN-γ?

Based on reporter assays, our work identifies the IFN-γ promoter as a potential direct target of Hlx transcriptional repression. However, this work is preliminary and must be validated via mapping experiments that establish the region(s) of the IFN-γ promoter that are both necessary and sufficient for Hlx repression, as well as by determining if repression occurs via binding of Hlx to DNA. Of note, the IFN-γ promoter construct used in the reporter assays contains an intron one enhancer element that has been shown to directly bind STAT4 both in vivo by chromatin immunoprecipitation and in vitro by electrophoretic mobility shift assays (EMSA) and in DNase I footprinting experiments(35, 38, 64). Therefore, in subsequent work, it will be essential to distinguish the effects of Hlx on STAT4 from its direct effect – if any – at the IFN-γ promoter.

Distinguishing these scenarios may be a difficult task, since Hlx may have to associate with and displace STAT4 before Hlx can bind to the IFN-γ promoter. Moreover, STAT4 is required for IFN-γ production in response to IL-12(62, 63). This may make it prohibitive to explore the consequence of Hlx over-expression in STAT4 deficient NK cells on IFN-γ production following IL-12 and IL-18 treatment. Instead, we propose to perform a structure-function analysis of Hlx as well as to dissect the region of the IFN-γ promoter required for its repressive activity. This may lead to Hlx mutants that maintain

IFN-γ repression without affecting STAT4 levels, as well as IFN-γ promoter derivatives that maintain STAT4 inducibility but are not repressed by Hlx. In addition, the use of agents such as CHX may also provide a facile means to distinguish the STAT4 from IFN-

- 75 - γ effects of Hlx. We have already determined that Hlx-dependent degradation of Y693 pSTAT4 is resistant to CHX; perhaps, in contrast, the effect of Hlx on IFN-γ transcription requires new protein synthesis and is therefore CHX sensitive. Such a finding would provide a system to further comprehend the effect of Hlx on each process in a manner independent of the other. Alternatively, the abilities of Hlx to repress IFN-γ promoter activity and to promote Y693 pSTAT4 degradation may be intimately linked in a manner that precludes their separation. Indeed, it is conceivable that Hlx associates transiently with DNA-bound Y693 pSTAT4, either to displace this TF or to directly promote its polyubiquitylation, and that - subsequent to dissociation or degradation of STAT4 – Hlx is retained at the same DNA site.

By what mechanism(s) might Hlx act as a transcriptional repressor? Using a bioinformatics approach, we have identified two potential clues in this regard, which we have begun to test in the laboratory. First, by scanning the predicted amino acid sequence of the Hlx protein (Eukaryotic Linear Motif server at http://www.elm.eu.org), we found that the N-terminal half of Hlx contains two engrailed homology 1 (eh1) motifs

(Figure 17A). Eh1 motifs have been previously implicated in transcriptional repression by homeobox TFs, via the direct recruitment of transcriptional co-repressors of the

Groucho / Transducin-like enhancer of split (TLE) family(104). In support of this potential mode of transciptional repression, we found that deletion of a single Eh1 motif abolished Hlx repression of IFN-γ activity in 239T cells (Figure 17B). Further support for TLE based repression is offered by a genome-wide yeast 2 hybrid analysis in

Drosophila melanogaster (available online at http://biodata.mshri.on.ca/fly_grid/servlet/SearchPage), which detected a genetic - 76 - interaction between H2.0 and Groucho, which encode Hlx and TLE homologues, respectively (Table 2). The yeast 2-hybrid analysis using H2.0 as bait also detected a potential genetic interaction between H2.0 and Snr1, which encodes an essential protein component of an ATP-dependent nucleosomal remodeling complex called Swi/Snf, which is implicated in transcriptional activation and repression (105). The Snr1 homologue, INI1, is evolutionarily conserved as a component of the mammalian Swi/Snf complex, and is required for optimal nucleosomal remodeling in vitro (106). To

determine if human Hlx can participate in a physical interaction with INI1, we performed

a GST pull-down experiment using in vitro synthesized Hlx and bacterially expressed

INI1 as described under "Methods". Indeed, we found a reproducible interaction in this

experiment (Figure 18). We strongly emphasize that these experiments do not in any

way implicate Hlx as a direct repressor of IFN-γ, nor do they implicate TLE and/or a

repressive Swi/Snf complex in such a process. Testing this hypothesis awaits require two

types of experiments. First, these putative protein interactions between Hlx and TLE

and/or SWI/SNF must be tested in vivo – both in solution and in situ at the IFN-γ

promoter. Second, the functional signficance of these interactions must be tested

rigorously using mutants of Hlx and its putative partner protein(s) that eliminate these

interactions to determine their impact on IFN-γ promoter activity.

Potential in vivo Relevance of Hlx in the Immune Response

In this study, we demonstrated that Y693 pSTAT4 protein is a target of Hlx action. Multiple lines of evidence have established the role of STAT4 as a requisite, - 77 - direct trans-activator of the IFN-γ promoter in NK cells(38, 62, 63). Constitutive STAT4 activation is strongly implicated in autoimmune disease, including rheumatoid arthritis and inflammatory bowel disease(22, 107). The inhibitory role of Hlx on STAT4 levels identifies Hlx as a relevant molecular target to exploit in autoimmunity. However, the physiological role of Hlx as an attenuator of pSTAT4 activity and IFN-γ transcription awaits validation in vivo. Given the embryonic lethality of Hlx deficient animals, such in vivo experiments must be performed in alymphoid animals reconstituted with Hlx-/- or wildtype fetal liver hematopoietic progenitors. Transplantation of fetal liver cells from

E13.5 embryos with Hlx-/- or wildtype genotypes reportedly results in full reconstitution of hematopoiesis in lethally irradiated recipient animals (83). We have confirmed this

-/- -/- finding at the level of NK cell reconstitution in alymphoid (Rag2 ,γc ) mice otherwise devoid of this lineage (B. Becknell, data not shown). Therefore, we have a system in place to investigate the contribution of Hlx to pSTAT4 and IFN-γ levels in vivo, and we

are currently exploring this in mice challenged with murine cytomegalovirus (in

collaboration with Dr. Christine Biron at Brown University).

Hlx in NK Cells Versus T Cells: Challenging the Paradigm

Our interest in Hlx was prompted by published accounts of its role as a positive regulator of IFN-γ production in CD4(+) T lymphocytes(43, 45, 82). While the data

presented here are not consistent with this role in NK cells, considerable caution should

be exercised in comparing this work with the existing studies, given the distinctly

different mechanisms of IFN-γ production in NK and CD4(+) T cell populations. - 78 - Whereas NK cells produce IFN-γ within minutes of monokine stimulation(19), CD4(+) T cells must undergo a process of “polarization” – entailing cell division and active chromatin remodeling at the IFN-γ locus - before IFN-γ transcription can occur(32).

Ectopic expression of Hlx during TH2 polarization of CD4(+) T cells has been shown to

promote IFN-γ production, but Hlx expression during TH1 polarization as well as in fully

TH1 and TH2 polarized CD4(+) T cells reportedly does not influence IFN-γ synthesis(43,

45, 82). Interestingly, recent work from the Zheng laboratory clearly implicates Hlx as a negative regulator of the IL-4 receptor alpha chain(46). Since IL-4 is required for normal

TH2 differentiation, Hlx deficiency results in impaired production of TH2 cytokines, and this phenotype can be reversed by ectopic retroviral expression of IL-4 receptor alpha(46). Apart from promoting TH2 differentiation, IL-4 is a potent inhibitor of IFN-γ

production by T cells (108). Therefore, by decreasing the responsiveness of a TH2 polarized CD4(+) T cell to IL-4, Hlx may be indirectly promoting the production of IFN-

γ by this lymphocyte population. If the effect of Hlx on IFN-γ is due entirely to IL-4 receptor alpha regulation, it will be important in the future to determine if loss of IL-4 receptor alpha expression eliminates the increase in IFN-γ seen upon ectopic Hlx

expression in TH2 cells.

It is likely that Hlx serves different roles in the T and NK lineages, and the extent of its function may be limited to discrete developmental windows. It is not without precedent that transcription factors perform divergent functions in multiple lineages.

GATA-3 is one transcriptional regulator shown to have apparently opposing functions in

IFN-γ regulation by NK versus CD4(+) T cells(109). One can envision multiple

- 79 - scenarios that could account for opposing Hlx activities in CD4(+) T and NK cells, such as post-translational modification of Hlx or unique expression of Hlx interacting proteins in lineage-specific fashion. It is anticipated that more detailed studies of the Hlx protein and its interactions will elucidate its mechanism of action in both T and NK cell lineages in the future. In addition, future work must investigate the significance of these lineage- specific effects of Hlx in vivo. In this regard, we feel that the in vivo studies of Hlx deficient NK and T cells in the context the innate and adaptive immune response to virus infection, respectively, will offer an insightful and relevant physiologic context to explore the lineage-specific roles of Hlx on IFN-γ and STAT4 protein levels.

- 80 - Figure 10. Hlx is induced by monokine co-stimulation in CD56bright NK cells, and its

expression is delayed with respect to IFN-γ. (A) Delayed induction of Hlx protein with respect to IFN-γ production in primary NK cells. Upper panel: Total NK were stimulated with IL-12 and IL-18 for indicated time-points, and Hlx protein levels were analyzed by immunoblotting. β-actin levels were analyzed to ensure equal loading (n=4 experiments). Lower panel: In parallel, IFN-γ mRNA levels were analyzed by QRT-

PCR. The average ± S.E.M. from 4 separate experiments is shown. (B) Maximal Hlx

protein induction requires monokine co-stimulation. Total NK were stimulated for 72

hours as indicated, and Hlx and β-actin protein levels were analyzed by immunoblotting

(n=3 experiments). (C) Preferential induction of Hlx mRNA and protein in the

CD56bright NK subset. Left panel: FACS purified NK subsets were lysed directly

(“UN”) or after stimulation with IL-12 and IL-18 or IL-12 and IL-15 (24 hours). Lysates were analyzed for Hlx and β-actin protein by immunoblotting (n=3 experiments) Right panel: FACS purified NK subsets were lysed immediately for RNA (“UN”) or stimulated with IL-12 and IL-15 for 14 hours prior to lysis. Hlx mRNA levels were analyzed by

QRT-PCR. The average ± S.E.M. from 5 separate donors is shown.

- 81 -

A B Primary NK, 72 hr 8 Primary NK 8 1 1 15 15 18 18 + Time (hr) 0 24 48 72 96 + UN 15 UN 15 12 18 12 12 18 12 12+ 12+ 15+ HLX 15+ Hlx β-actin β−actin

15000

10000 NA NA mR mR γ γ - - 5000 IFN IFN 0 0 24487296 Time (hr) C CD56bright CD56dim p = 0.0001 p = 0.0002 A A 1000 * 100 +15 +18 +15 +18 mRN mRN 10 UN UN UN UN 12+18 12+18 12 12 12 12 12+15 12+15 ** Hlx Hlx Hlx 1 UN 12+15 UN 12+15

β−actin CD56bright CD56dim

Figure 10.

- 82 - Figure 11. Hlx inhibits IFN-γ production by primary CD56bright NK cells. PINCO or

PINCO-Hlx infected primary human NK cells were stimulated 24 hr with IL-12 and IL-

18 and subject to staining for CD56 and IFN-γ. Left: Infected cells were gated on

CD56brightEGFP(+) or CD56dimEGFP(+); Right: IFN-γ staining in these populations, compared to isotype controls. This is representative of 4 experiments.

- 83 -

Isotype Controls PINCO-Hlx bright CD56

PINCO Events

CD56dim CD56 APC

EGFP Events

IFN-γ PE-Cy7

Figure 11.

- 84 - Figure 12. Hlx inhibits IFN-γ mRNA and protein expression in NK-92 cells. (A)

Over-expression of Hlx protein in NK-92 cells. FACS-purified NK-92 cells transduced

with PINCO or PINCO-Hlx were subject to nucleocytoplasmic fractionation and

immunoblotting for Hlx. Enrichment of nuclear protein was confirmed by Brg1 staining.

Equal loading was confirmed by Ku70 staining. (B) Inhibition of IFN-γ production by

Hlx. PINCO or PINCO-Hlx infected NK-92 cells were stimulated with IL-12 and IL-18 and supernatants were harvested after 24 hours for IFN-γ ELISA (top panel). IFN-γ mRNA was measured by QRT-PCR after 6 hours (bottom panel). Shown is the average

± SEM from 5 separate experiments (ELISA) or 3 separate experiments (QRT-PCR). (C)

Time-course of IFN-γ mRNA in PINCO versus PINCO-Hlx transduced NK-92 in response to IL-12 plus IL-18. Shown is a representative experiment from 4 timecourses; error bars represent standard deviation of triplicate PCR reactions.

- 85 -

A C

nucleus cytoplasm 1400 PINCO x x 1200 PINCO-Hlx l l H H -Hlx -Hlx - - 1000 800 NCO NCO NCO NCO mRNA mRNA I I I I 600 γ γ PINCO PINCO P P P P PINCO PINCO Hlx 400 IFN- Brg1 IFN- 200 Ku70 0 B 0 5 10 15 20 25 30 1000 Hours post monokine stimulation ) )

750 ml ml p = 0.002 (ng/ (ng/ 500 γ γ 250 * IFN- IFN- * 0 PINCO PINCO-Hlx 300 250 200 RNA RNA p = 0.006 m m 150 γ γ 100 * N- N- 50 IF IF 0 PINCO-Hlx PINCO

Figure 12.

- 86 - Figure 13. Increased expression of IFN-γ mRNA and protein by Hlx deficient NK cells. (A) Derivation of NK cells from fetal liver. A homogeneous population of

NK1.1(+)DX5(+)CD3(-) NK cells was confirmed by cytometric analysis (left panel).

NK cells from all three expected Hlx genotypes were detected by PCR (right panel). (B)

Increased IFN-γ production by Hlx–/– NK in response to monokine co-stimulation. Fetal liver derived NK were subject to 24 hour stimulation with IL-12 and IL-15 followed by staining for IFN-γ. Numbers in the corners of each histogram indicate the percentage of events in each quadrant after electronic gating on viable cells. A representative comparison of Hlx+/– and Hlx–/– NK is shown (top), as well as summary data for all experiments (bottom; the average +/- SEM from 9 experiments with NK cells derived from ≥ 9 livers of each genotype is shown; * p = 0.0003 Hlx+/+ versus Hlx–/–; ** p =

0.0048 Hlx+/– versus Hlx–/–). (C) Increased IFN-γ mRNA production by Hlx–/– NK in response to monokine stimulation. Fetal liver derived NK were subject to 24 hour stimulation with IL-12 and IL-15, and IFN-γ mRNA levels were measured by QRT-PCR.

The average ± SEM of 5 experiments with NK cells from ≥ 4 livers of each genotype is shown (* p = 0.0039 Hlx+/+ versus Hlx–/–; ** p = 0.011 Hlx+/–; versus Hlx–/–).

- 87 -

A C C – – –/– –/– +/+ +/+ +/ +/ 333 bp 221 bp NK1.1 AP NK1.1 AP

DX5 PE B Hlx+/– Hlx–/– 40 47 47 18 78 NK NK 30 (+) (+) 20 γ γ 1 APC 1 APC . . ** N- N- 10 * NK1 NK1 4 2 2 2 0 % IF % IF +/– –/– IFN-γ PE +/+ C 5 4

3 mRNA mRNA γ γ - - 2 **** 1 * IFN IFN 0 +/+ +/– –/–

Figure 13.

- 88 - Figure 14. Hlx decreases expression of active, Y693 pSTAT4 protein in a proteasome dependent manner. (A) Endogenous Hlx levels increase as total STAT4

levels decline. Primary human NK or NK-92 were harvested at indicated time-points

following IL-12 and IL-18 stimulation, and Hlx, STAT4, and β-actin protein levels were

determined by immunoblotting. (B) Hlx over-expression decreases total and Y693 pSTAT4 levels in NK-92 following IL-12 and IL-18 treatment. Total STAT4, Y693 pSTAT4, and β-actin levels were assessed by immunoblotting. (C) Hlx over-expression inhibits Y693 pSTAT4 levels in primary human NK. Human NK were infected with

PINCO-Hlx or empty PINCO retrovirus, and stimulated with IL-12 and IL-18 for 24 hours. Y693 pSTAT4 was detected by intracellular staining. The % of

CD56(+)EGFP(+) cells that are Y693 pSTAT4(+) is shown. This is the average ± S.E.M. of 5 experiments (* p = 0.0045). (D) Proteasome inhibition rescues loss of Y693

pSTAT4 in NK-92 cells over-expressing Hlx. PINCO-Hlx expressing NK-92 were pre-

incubated for 30 minutes with 20 µM MG-132 (MG), DMSO vehicle (V), or medium

alone (–), followed by IL-12 and IL-18 treatment for 3 hours. Total cellular protein was

harvested, and Y693 pSTAT4, total STAT4, and β-actin levels were assessed by immunoblotting. (E) Similar results were obtained using additional proteasome inhibitors, epoxomicin (EPO, 20 µM) and lactacystin (LC, 20 µM)(n=2 experiments).

- 89 -

A Primary Human NK NK-92 Time (hr) 024487296 Time (hr) 0244872 Hlx Hlx STAT4 STAT4 β-actin β-actin

) ) B C ) 90 (+ (+ (+ 4 4 PINCO Hlx 4

Time (hr) 00.513612 18 24 00.51 3 612 18 24 80 Y693 pSTAT4 pSTAT pSTAT pSTAT

3 3 3 * STAT4 70 β−actin % Y69 % Y69 % Y69 60 PINCO HLX PINCO Hlx D E

− VMG Hlx PINCO Y693 pSTAT4 - V EPO LC MG - V EPO LC MG Y693 pSTAT4 STAT4 β-Actin β-Actin

Figure 14.

- 90 -

Figure 15. Hlx regulates Y693 pSTAT4 levels independently of new protein synthesis. PINCO and PINCO-Hlx NK-92 were pre-treated with CHX, a global inhibitor of protein translation, at 20 µg/ml final concentration for 30 minutes and subsequently stimulated with IL-12 and IL-18. Total cellular protein was extracted at the indicated time-points and subject to immunoblotting with the indicated antisera. (Note:

Y693 pSTAT4 is represented by the upper band in the total STAT4 blot).

- 91 -

PINCO-Hlx PINCO

IL-12 + IL-18 (hr) 0936 12 0 3 6 912

STAT4

β-Actin

Figure 15.

- 92 -

Figure 16. Hlx represses IFN-γ promoter activity in NK cells and 293T cells. (A)

Schematic of the "full-length" IFN-γ reporter construct used in luciferase assays, with

STAT4 sites shown as red vertical lines. Numbering is with respect to the transcriptional

start site of IFN-γ, i.e., +1; (B) Hlx represses IFN-γ promoter activity in DERL-7 cells, both at rest and particularly after IL-12 and IL-18 stimulation; (C) Hlx represses IFN-γ promoter activity in 293T cells, in the absence of monokine stimulation (n = 6 experiments, of which one representative experiment is shown, p = 0.0006). All luciferase values are normalized to cells transfected with an empty luciferase vector

(lacking the IFN-γ promoter), after first adjusting for transfection efficiency as described in details under "Methods".

- 93 -

A 5’ flanking region Intron 1

-236 +830 luciferase

B C

12 30

8 20

4 10

Activity (RLU) Activity (RLU) 0 0 Vector Hlx Vector Hlx VECTOR HLX

Resting IL-12 + IL-18 293T cells

Figure 16.

- 94 - Figure 17. Potential role for Groucho/TLE co-repressors in Hlx repression of IFN-γ promoter activity. (A) Schematic of wildtype Hlx protein with its two eh1 motifs, characterized by the amino acid sequence, FXIXXIL, illustrated as red vertical lines.

Also shown is an N-terminally truncated Hlx mutant lacking the first 59 amino acids of this protein, Hlx∆N, including the N-terminal eh1 motif. Numbers indicate amino acid residues; (B) Luciferase assay in 293T cells using the full-length IFN-γ promoter illustrated in Figure 16A, contrasting the repressive effect of wildtype Hlx with that of

Hlx∆N.

- 95 -

A

1 HD 488 Hlx

60 HD 488 Hlx∆N

B 6000

4000

2000

0 Vector Hlx Hlx∆N

Figure 17.

- 96 - Figure 18. Hlx associates with INI1, an essential component of SWI/SNF chromatin remodeling complexes, in vitro. Radiolabeled Hlx was incubated with immobilized

GST fusion proteins: GST alone, GST-PAHII domain (of mSin3a), or GST-INI1. After extensive washing, eluted protein was resolved by SDS-PAGE and the dried gel was subject to autoradiography.

- 97 -

35 S-HLX pull-dow n

GST PAHII INI1 5% INPUT

HLX

Figure 18.

- 98 - Table 2. Potential Protein Binding Partners of Hlx Identified by Yeast 2-Hybrid

Screen. The Drosophila Hlx homologue, H2.0, was used as bait in a yeast 2-hybrid screen (http://biodata.mshri.on.ca/fly_grid/servlet/SearchResults?keywords=H2.0). This screen identified 28 potential binding partners of H2.0 in the fly, 18 of which have human homologues based on a BlastP query (http://www.ncbi.nlm.nih.gov/BLAST) and are listed here along with their biological roles, if known. A cautionary note is warranted: all

of these interactions await confirmation in vivo.

- 99 - Drosophila protein Human homologue Comments CG15602 Zinc finger, FYVE domain FYVE domain binds PI-3 phosphate containing 19 (ZFVE19) Ts Thymidylate synthase (TYMS) CG7611, isoform E WD repeat protein 26 Inhibitor of MAPK signaling (WDR26) CG32056 Phospholipid scramblase 1 Binds to DNA (PLSCR1) CG14996, isoform B Transgelin 2 (TAGLN2) Putative CH domain binds to actin Groucho TLE family Nuclear co-repressor CG1486, isoform A KIAA0251 Putative pyridoxal-dependent decarboxylase snr INI1 An essential component of the Swi/Snf chromatin remodeling complex pelo Pelota (PELO) Centriole associated protein, potential role in protein translation CG6459, isoform A C1QBP p32 subunit of splicing factor SF2 CG15529 YES C-terminal SH2 domain, most homologous to BLNK (B cell linker) CG6866, isoform B TRBP1/2 Double stranded RNA binding domain; important for protein translation CG9572, isoform A Notch homologue 1 (NOTCH1) Yolkless low density lipoprotein- related protein 2 (LRP2) gbb Bone morphogenetic protein 7 (BMP7) rhodopsin Melanopsin (OPN4) CG15141, isoform A UBR7 Potential E3 ubiquitin ligase zyxin, Zyx102EF lipoma-preferred partner isoforms gene (LPP)

Table 2. Potential Protein Binding Partners of Hlx Identified by Yeast 2-Hybrid Screen.

- 100 -

CHAPTER 5

Synthesis and Conclusion

The transcriptional regulation of IFN-γ in NK cells is complex and deservedly so, given the profound consequences of insufficient and excessive cytokine production on physiologic host processes including the development and homeostasis of immune cells as well as pathophysiology including: tumorigenesis, microbial infection, and autoimmune disease. While our ability to generate hypotheses to account for observed changes in IFN-γ trancription has been enriched by the T cell literature, it is dangerously presumptive to use these data to make broad generalizations about IFN-γ transcription in

NK cells, which is so fundamentally different. Loss of function experiments have implicated a host of TFs in IFN-γ production by NK cells (Table 1). However, in nearly every case, the critical, complementary gain of function experiments have not been performed. This study, together with other work from our laboratory(84, 86), validates the use of PINCO for the delivery of TF and other genes of interest to primary NK cells and NK cell lines. This methodology has already enriched our knowledge about signaling pathways triggered by monokine co-stimulation in primary human NK cells, and it is likely that PINCO will be an essential tool for similar work in the future.

- 101 - Our results identify a role for Hlx as a negative regulator of IFN-γ production by

NK cells. Most surprisingly, Hlx regulates STAT4 protein stability via by triggering the proteasome-dependent degradation of Y693 pSTAT4. As we seek to validate the importance of Hlx as a physiologic regulator of these processes in vivo, we continue our efforts to comprehend the mechanism(s) of Hlx action through more in-depth experimentation in vitro. By developing a better understanding of these mechanisms as well as the ramifications of Hlx activity in NK cells, we may eventually arrive at a means to target Hlx and thereby “fine-tune” the regulation of STAT4 and IFN-γ in patients with immune deficiency as well as in those suffering from autoimmune disease.

- 102 -

LITERATURE CITED

1. Dorner, B.G., H.R. Smith, A.R. French, S. Kim, J. Poursine-Laurent, D.L. Beckman, J.T. Pingel, R.A. Kroczek, and W.M. Yokoyama. 2004. Coordinate expression of cytokines and chemokines by NK cells during murine cytomegalovirus infection. J Immunol 172:3119-3131.

2. Shankaran, V., H. Ikeda, A.T. Bruce, J.M. White, P.E. Swanson, L.J. Old, and R.D. Schreiber. 2001. IFNgamma and lymphocytes prevent primary tumour development and shape tumour immunogenicity. Nature 410:1107-1111.

3. Shtrichman, R., and C.E. Samuel. 2001. The role of gamma interferon in antimicrobial immunity. Curr Opin Microbiol 4:251-259.

4. Gilmour, K.C., H. Fujii, T. Cranston, E.G. Davies, C. Kinnon, and H.B. Gaspar. 2001. Defective expression of the interleukin-2/interleukin-15 receptor beta subunit leads to a natural killer cell-deficient form of severe combined immunodeficiency. Blood 98:877-879.

5. Fehniger, T.A., M.A. Cooper, and M.A. Caligiuri. 2002. Interleukin-2 and interleukin-15: immunotherapy for cancer. Cytokine Growth Factor Rev 13:169-183.

6. Ruggeri, L., M. Capanni, E. Urbani, K. Perruccio, W.D. Shlomchik, A. Tosti, S. Posati, D. Rogaia, F. Frassoni, F. Aversa, M.F. Martelli, and A. Velardi. 2002. Effectiveness of donor natural killer cell alloreactivity in mismatched hematopoietic transplants. Science 295:2097-2100.

7. Lieberman, L.A., and C.A. Hunter. 2002. Regulatory pathways involved in the infection-induced production of IFN-gamma by NK cells. Microbes Infect 4:1531-1538.

8. Schroder, K., P.J. Hertzog, T. Ravasi, and D.A. Hume. 2004. Interferon-gamma: an overview of signals, mechanisms and functions. J Leukoc Biol 75:163-189. - 103 -

9. Doffinger, R., S. Dupuis, C. Picard, C. Fieschi, J. Feinberg, G. Barcenas-Morales, and J.L. Casanova. 2002. Inherited disorders of IL-12- and IFNgamma-mediated immunity: a molecular genetics update. Mol Immunol 38:903-909.

10. Dunn, G.P., L.J. Old, and R.D. Schreiber. 2004. The immunobiology of cancer immunosurveillance and immunoediting. Immunity 21:137-148.

11. Fehniger, T.A., M.A. Cooper, G.J. Nuovo, M. Cella, F. Facchetti, M. Colonna, and M.A. Caligiuri. 2003. CD56bright natural killer cells are present in human lymph nodes and are activated by T cell-derived IL-2: a potential new link between adaptive and innate immunity. Blood 101:3052-3057.

12. Ferlazzo, G., M. Pack, D. Thomas, C. Paludan, D. Schmid, T. Strowig, G. Bougras, W.A. Muller, L. Moretta, and C. Munz. 2004. Distinct roles of IL-12 and IL-15 in human natural killer cell activation by dendritic cells from secondary lymphoid organs. Proc Natl Acad Sci U S A 101:16606-16611.

13. Bajenoff, M., B. Breart, A.Y. Huang, H. Qi, J. Cazareth, V.M. Braud, R.N. Germain, and N. Glaichenhaus. 2006. Natural killer cell behavior in lymph nodes revealed by static and real-time imaging. J Exp Med 203:619-631.

14. Granucci, F., I. Zanoni, N. Pavelka, S.L. Van Dommelen, C.E. Andoniou, F. Belardelli, M.A. Degli Esposti, and P. Ricciardi-Castagnoli. 2004. A contribution of mouse dendritic cell-derived IL-2 for NK cell activation. J Exp Med 200:287-295.

15. Andoniou, C.E., S.L. van Dommelen, V. Voigt, D.M. Andrews, G. Brizard, C. Asselin-Paturel, T. Delale, K.J. Stacey, G. Trinchieri, and M.A. Degli-Esposti. 2005. Interaction between conventional dendritic cells and natural killer cells is integral to the activation of effective antiviral immunity. Nat Immunol 6:1011-1019.

16. Martin-Fontecha, A., L.L. Thomsen, S. Brett, C. Gerard, M. Lipp, A. Lanzavecchia, and F. Sallusto. 2004. Induced recruitment of NK cells to lymph nodes provides IFN-gamma for T(H)1 priming. Nat Immunol 5:1260-1265.

- 104 - 17. Nagler, A., L.L. Lanier, S. Cwirla, and J.H. Phillips. 1989. Comparative studies of human FcRIII-positive and negative natural killer cells. J Immunol 143:3183-3191.

18. Caligiuri, M.A., A. Zmuidzinas, T.J. Manley, H. Levine, K.A. Smith, and J. Ritz. 1990. Functional consequences of interleukin 2 receptor expression on resting human lymphocytes. Identification of a novel natural killer cell subset with high affinity receptors. J Exp Med 171:1509-1526.

19. Fehniger, T.A., M.H. Shah, M.J. Turner, J.B. VanDeusen, S.P. Whitman, M.A. Cooper, K. Suzuki, M. Wechser, F. Goodsaid, and M.A. Caligiuri. 1999. Differential cytokine and chemokine gene expression by human NK cells following activation with IL-18 or IL-15 in combination with IL-12: implications for the innate immune response. J Immunol 162:4511-4520.

20. Cooper, M.A., T.A. Fehniger, S.C. Turner, K.S. Chen, B.A. Ghaheri, T. Ghayur, W.E. Carson, and M.A. Caligiuri. 2001. Human natural killer cells: a unique innate immunoregulatory role for the CD56(bright) subset. Blood 97:3146-3151.

21. Ellison, C.A., J.M. Fischer, K.T. HayGlass, and J.G. Gartner. 1998. Murine graft- versus-host disease in an F1-hybrid model using IFN-gamma gene knockout donors. J Immunol 161:631-640.

22. Bouma, G., and W. Strober. 2003. The immunological and genetic basis of inflammatory bowel disease. Nat Rev Immunol 3:521-533.

23. Fehniger, T.A., H. Yu, M.A. Cooper, K. Suzuki, M.H. Shah, and M.A. Caligiuri. 2000. Cutting edge: IL-15 costimulates the generalized Shwartzman reaction and innate immune IFN-gamma production in vivo. J Immunol 164:1643-1647.

24. Shimozato, O., J.R. Ortaldo, K.L. Komschlies, and H.A. Young. 2002. Impaired NK cell development in an IFN-gamma transgenic mouse: aberrantly expressed IFN- gamma enhances hematopoietic stem cell apoptosis and affects NK cell differentiation. J Immunol 168:1746-1752.

- 105 - 25. Sloand, E., S. Kim, J.P. Maciejewski, J. Tisdale, D. Follmann, and N.S. Young. 2002. Intracellular interferon-gamma in circulating and marrow T cells detected by flow cytometry and the response to immunosuppressive therapy in patients with aplastic anemia. Blood 100:1185-1191.

26. Glimcher, L.H., M.J. Townsend, B.M. Sullivan, and G.M. Lord. 2004. Recent developments in the transcriptional regulation of cytolytic effector cells. Nat Rev Immunol 4:900-911.

27. Hodge, D.L., A. Martinez, J.G. Julias, L.S. Taylor, and H.A. Young. 2002. Regulation of nuclear gamma interferon gene expression by (IL-12) and IL-2 represents a novel form of posttranscriptional control. Mol Cell Biol 22:1742-1753.

28. Mavropoulos, A., G. Sully, A.P. Cope, and A.R. Clark. 2005. Stabilization of IFN-gamma mRNA by MAPK p38 in IL-12- and IL-18-stimulated human NK cells. Blood 105:282-288.

29. Wang, J.G., M. Collinge, V. Ramgolam, O. Ayalon, X.C. Fan, R. Pardi, and J.R. Bender. 2006. LFA-1-dependent HuR nuclear export and cytokine mRNA stabilization in T cell activation. J Immunol 176:2105-2113.

30. Hardy, K.J., B.M. Peterlin, R.E. Atchison, and J.D. Stobo. 1985. Regulation of expression of the human interferon gamma gene. Proc Natl Acad Sci U S A 82:8173- 8177.

31. Agarwal, S., and A. Rao. 1998. Modulation of chromatin structure regulates cytokine gene expression during T cell differentiation. Immunity 9:765-775.

32. Bird, J.J., D.R. Brown, A.C. Mullen, N.H. Moskowitz, M.A. Mahowald, J.R. Sider, T.F. Gajewski, C.R. Wang, and S.L. Reiner. 1998. Helper T cell differentiation is controlled by the cell cycle. Immunity 9:229-237.

33. Avni, O., D. Lee, F. Macian, S.J. Szabo, L.H. Glimcher, and A. Rao. 2002. T(H) cell differentiation is accompanied by dynamic changes in histone acetylation of cytokine genes. Nat Immunol 3:643-651.

- 106 - 34. Lee, D.U., O. Avni, L. Chen, and A. Rao. 2004. A distal enhancer in the interferon-gamma (IFN-gamma) locus revealed by genome sequence comparison. J Biol Chem 279:4802-4810.

35. Chang, S., and T.M. Aune. 2005. Histone hyperacetylated domains across the Ifng gene region in natural killer cells and T cells. Proc Natl Acad Sci U S A 102:17095- 17100.

36. Tato, C.M., G.A. Martins, F.A. High, C.B. DiCioccio, S.L. Reiner, and C.A. Hunter. 2004. Cutting Edge: Innate production of IFN-gamma by NK cells is independent of epigenetic modification of the IFN-gamma promoter. J Immunol 173:1514-1517.

37. Bream, J.H., D.L. Hodge, R. Gonsky, R. Spolski, W.J. Leonard, S. Krebs, S. Targan, A. Morinobu, J.J. O'Shea, and H.A. Young. 2004. A distal region in the interferon-gamma gene is a site of epigenetic remodeling and transcriptional regulation by interleukin-2. J Biol Chem 279:41249-41257.

38. Matikainen, S., A. Paananen, M. Miettinen, M. Kurimoto, T. Timonen, I. Julkunen, and T. Sareneva. 2001. IFN-alpha and IL-18 synergistically enhance IFN- gamma production in human NK cells: differential regulation of Stat4 activation and IFN-gamma gene expression by IFN-alpha and IL-12. Eur J Immunol 31:2236-2245.

39. Nakahira, M., H.J. Ahn, W.R. Park, P. Gao, M. Tomura, C.S. Park, T. Hamaoka, T. Ohta, M. Kurimoto, and H. Fujiwara. 2002. Synergy of IL-12 and IL-18 for IFN- gamma gene expression: IL-12-induced STAT4 contributes to IFN-gamma promoter activation by up-regulating the binding activity of IL-18-induced activator protein 1. J Immunol 168:1146-1153.

40. Townsend, M.J., A.S. Weinmann, J.L. Matsuda, R. Salomon, P.J. Farnham, C.A. Biron, L. Gapin, and L.H. Glimcher. 2004. T-bet regulates the terminal maturation and homeostasis of NK and Valpha14i NKT cells. Immunity 20:477-494.

41. Szabo, S.J., S.T. Kim, G.L. Costa, X. Zhang, C.G. Fathman, and L.H. Glimcher. 2000. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 100:655- 669.

- 107 - 42. Cho, J.Y., V. Grigura, T.L. Murphy, and K. Murphy. 2003. Identification of cooperative monomeric Brachyury sites conferring T-bet responsiveness to the proximal IFN-gamma promoter. Int Immunol 15:1149-1160.

43. Mullen, A.C., A.S. Hutchins, F.A. High, H.W. Lee, K.J. Sykes, L.A. Chodosh, and S.L. Reiner. 2002. Hlx is induced by and genetically interacts with T-bet to promote heritable T(H)1 gene induction. Nat Immunol 3:652-658.

44. Afkarian, M., J.R. Sedy, J. Yang, N.G. Jacobson, N. Cereb, S.Y. Yang, T.L. Murphy, and K.M. Murphy. 2002. T-bet is a STAT1-induced regulator of IL-12R expression in naive CD4+ T cells. Nat Immunol 3:549-557.

45. Martins, G.A., A.S. Hutchins, and S.L. Reiner. 2005. Transcriptional activators of helper T cell fate are required for establishment but not maintenance of signature cytokine expression. J Immunol 175:5981-5985.

46. Mikhalkevich, N., B. Becknell, M.A. Caligiuri, M.D. Bates, R. Harvey, and W.P. Zheng. 2006. Responsiveness of naive CD4 T cells to polarizing cytokine determines the ratio of Th1 and Th2 cell differentiation. J Immunol 176:1553-1560.

47. Bates, M.D., J.M. Wells, and B. Venkatesh. 2005. Comparative genomics of the Hlx homeobox gene and protein: conservation of structure and expression from fish to mammals. Gene 352:45-56.

48. Li, M.O., Y.Y. Wan, S. Sanjabi, A.K. Robertson, and R.A. Flavell. 2006. TRANSFORMING GROWTH FACTOR-beta REGULATION OF IMMUNE RESPONSES. Annu Rev Immunol 24:99-146.

49. Espevik, T., I.S. Figari, M.R. Shalaby, G.A. Lackides, G.D. Lewis, H.M. Shepard, and M.A. Palladino, Jr. 1987. Inhibition of cytokine production by cyclosporin A and transforming growth factor beta. J Exp Med 166:571-576.

50. Bright, J.J., and S. Sriram. 1998. TGF-beta inhibits IL-12-induced activation of Jak-STAT pathway in T lymphocytes. J Immunol 161:1772-1777.

- 108 - 51. Lin, J.T., S.L. Martin, L. Xia, and J.D. Gorham. 2005. TGF-beta 1 uses distinct mechanisms to inhibit IFN-gamma expression in CD4+ T cells at priming and at recall: differential involvement of Stat4 and T-bet. J Immunol 174:5950-5958.

52. Gorelik, L., S. Constant, and R.A. Flavell. 2002. Mechanism of transforming growth factor beta-induced inhibition of T helper type 1 differentiation. J Exp Med 195:1499-1505.

53. Neurath, M.F., B. Weigmann, S. Finotto, J. Glickman, E. Nieuwenhuis, H. Iijima, A. Mizoguchi, E. Mizoguchi, J. Mudter, P.R. Galle, A. Bhan, F. Autschbach, B.M. Sullivan, S.J. Szabo, L.H. Glimcher, and R.S. Blumberg. 2002. The transcription factor T-bet regulates mucosal T cell activation in experimental colitis and Crohn's disease. J Exp Med 195:1129-1143.

54. Laouar, Y., F.S. Sutterwala, L. Gorelik, and R.A. Flavell. 2005. Transforming growth factor-beta controls T helper type 1 cell development through regulation of natural killer cell interferon-gamma. Nat Immunol 6:600-607.

55. Kaisho, T., H. Tsutsui, T. Tanaka, T. Tsujimura, K. Takeda, T. Kawai, N. Yoshida, K. Nakanishi, and S. Akira. 1999. Impairment of natural killer cytotoxic activity and interferon gamma production in CCAAT/enhancer binding protein gamma-deficient mice. J Exp Med 190:1573-1582.

56. Lacorazza, H.D., Y. Miyazaki, A. Di Cristofano, A. Deblasio, C. Hedvat, J. Zhang, C. Cordon-Cardo, S. Mao, P.P. Pandolfi, and S.D. Nimer. 2002. The ETS protein MEF plays a critical role in perforin gene expression and the development of natural killer and NK-T cells. Immunity 17:437-449.

57. Tato, C.M., N. Mason, D. Artis, S. Shapira, J.C. Caamano, J.H. Bream, H.C. Liou, and C.A. Hunter. 2006. Opposing roles of NF-{kappa}B family members in the regulation of NK cell proliferation and production of IFN-{gamma}. Int Immunol 18:505-513.

58. Strengell, M., S. Matikainen, J. Siren, A. Lehtonen, D. Foster, I. Julkunen, and T. Sareneva. 2003. IL-21 in synergy with IL-15 or IL-18 enhances IFN-gamma production in human NK and T cells. J Immunol 170:5464-5469.

- 109 - 59. Sica, A., L. Dorman, V. Viggiano, M. Cippitelli, P. Ghosh, N. Rice, and H.A. Young. 1997. Interaction of NF-kappaB and NFAT with the interferon-gamma promoter. J Biol Chem 272:30412-30420.

60. Caamano, J., J. Alexander, L. Craig, R. Bravo, and C.A. Hunter. 1999. The NF- kappa B family member RelB is required for innate and adaptive immunity to Toxoplasma gondii. J Immunol 163:4453-4461.

61. Sica, A., T.H. Tan, N. Rice, M. Kretzschmar, P. Ghosh, and H.A. Young. 1992. The c-rel protooncogene product c-Rel but not NF-kappa B binds to the intronic region of the human interferon-gamma gene at a site related to an interferon-stimulable response element. Proc Natl Acad Sci U S A 89:1740-1744.

62. Thierfelder, W.E., J.M. van Deursen, K. Yamamoto, R.A. Tripp, S.R. Sarawar, R.T. Carson, M.Y. Sangster, D.A. Vignali, P.C. Doherty, G.C. Grosveld, and J.N. Ihle. 1996. Requirement for Stat4 in interleukin-12-mediated responses of natural killer and T cells. Nature 382:171-174.

63. Kaplan, M.H., Y.L. Sun, T. Hoey, and M.J. Grusby. 1996. Impaired IL-12 responses and enhanced development of Th2 cells in Stat4-deficient mice. Nature 382:174-177.

64. Xu, X., Y.L. Sun, and T. Hoey. 1996. Cooperative DNA binding and sequence- selective recognition conferred by the STAT amino-terminal domain. Science 273:794- 797.

65. Fehniger, T.A., and M.A. Caligiuri. 2001. Ontogeny and expansion of human natural killer cells: clinical implications. Int Rev Immunol 20:503-534.

66. Jiang, K., B. Zhong, D.L. Gilvary, B.C. Corliss, E. Hong-Geller, S. Wei, and J.Y. Djeu. 2000. Pivotal role of phosphoinositide-3 kinase in regulation of cytotoxicity in natural killer cells. Nat Immunol 1:419-425.

67. Schroers, R., Y. Hildebrandt, J. Hasenkamp, B. Glass, A. Lieber, G. Wulf, and M. Piesche. 2004. Gene transfer into human T lymphocytes and natural killer cells by Ad5/F35 chimeric adenoviral vectors. Exp Hematol 32:536-546.

- 110 - 68. Maasho, K., A. Marusina, N.M. Reynolds, J.E. Coligan, and F. Borrego. 2004. Efficient gene transfer into the human natural killer cell line, NKL, using the Amaxa nucleofection system. J Immunol Methods 284:133-140.

69. Trompeter, H.I., S. Weinhold, C. Thiel, P. Wernet, and M. Uhrberg. 2003. Rapid and highly efficient gene transfer into natural killer cells by nucleofection. J Immunol Methods 274:245-256.

70. Palu, G., C. Parolin, Y. Takeuchi, and M. Pizzato. 2000. Progress with retroviral gene vectors. Rev Med Virol 10:185-202.

71. Kinsella, T.M., and G.P. Nolan. 1996. Episomal vectors rapidly and stably produce high-titer recombinant retrovirus. Hum Gene Ther 7:1405-1413.

72. Grignani, F., T. Kinsella, A. Mencarelli, M. Valtieri, D. Riganelli, L. Lanfrancone, C. Peschle, G.P. Nolan, and P.G. Pelicci. 1998. High-efficiency gene transfer and selection of human hematopoietic progenitor cells with a hybrid EBV/retroviral vector expressing the green fluorescence protein. Cancer Res 58:14-19.

73. Kinoshita, S., L. Su, M. Amano, L.A. Timmerman, H. Kaneshima, and G.P. Nolan. 1997. The T cell activation factor NF-ATc positively regulates HIV-1 replication and gene expression in T cells. Immunity 6:235-244.

74. Pear, W.S., J.P. Miller, L. Xu, J.C. Pui, B. Soffer, R.C. Quackenbush, A.M. Pendergast, R. Bronson, J.C. Aster, M.L. Scott, and D. Baltimore. 1998. Efficient and rapid induction of a chronic myelogenous leukemia-like myeloproliferative disease in mice receiving P210 bcr/abl-transduced bone marrow. Blood 92:3780-3792.

75. Trotta, R., T. Vignudelli, O. Candini, R.V. Intine, L. Pecorari, C. Guerzoni, G. Santilli, M.W. Byrom, S. Goldoni, L.P. Ford, M.A. Caligiuri, R.J. Maraia, D. Perrotti, and B. Calabretta. 2003. BCR/ABL activates mdm2 mRNA translation via the La antigen. Cancer Cell 3:145-160.

76. Carson, W.E., J.G. Giri, M.J. Lindemann, M.L. Linett, M. Ahdieh, R. Paxton, D. Anderson, J. Eisenmann, K. Grabstein, and M.A. Caligiuri. 1994. Interleukin (IL) 15 is a novel cytokine that activates human natural killer cells via components of the IL-2 receptor. J Exp Med 180:1395-1403.

- 111 -

77. Galandrini, R., I. Tassi, S. Morrone, L. Lanfrancone, P. Pelicci, M. Piccoli, L. Frati, and A. Santoni. 2001. The adaptor protein shc is involved in the negative regulation of NK cell-mediated cytotoxicity. Eur J Immunol 31:2016-2025.

78. Chiorean, E.G., S.J. Dylla, K. Olsen, T. Lenvik, Y. Soignier, and J.S. Miller. 2003. BCR/ABL alters the function of NK cells and the acquisition of killer immunoglobulin-like receptors (KIRs). Blood 101:3527-3533.

79. Unutmaz, D., V.N. KewalRamani, S. Marmon, and D.R. Littman. 1999. Cytokine signals are sufficient for HIV-1 infection of resting human T lymphocytes. J Exp Med 189:1735-1746.

80. Windebank, K.P., R.T. Abraham, G. Powis, R.A. Olsen, T.J. Barna, and P.J. Leibson. 1988. Signal transduction during human natural killer cell activation: inositol phosphate generation and regulation by cyclic AMP. J Immunol 141:3951-3957.

81. Yusa, S., T.L. Catina, and K.S. Campbell. 2002. SHP-1- and phosphotyrosine- independent inhibitory signaling by a killer cell Ig-like receptor cytoplasmic domain in human NK cells. J Immunol 168:5047-5057.

82. Zheng, W.P., Q. Zhao, X. Zhao, B. Li, M. Hubank, D.G. Schatz, and R.A. Flavell. 2004. Up-regulation of Hlx in immature Th cells induces IFN-gamma expression. J Immunol 172:114-122.

83. Hentsch, B., I. Lyons, R. Li, L. Hartley, T.J. Lints, J.M. Adams, and R.P. Harvey. 1996. Hlx homeo box gene is essential for an inductive tissue interaction that drives expansion of embryonic liver and gut. Genes Dev 10:70-79.

84. Becknell, B., R. Trotta, J. Yu, W. Ding, H.C. Mao, T. Hughes, T. Marburger, and M.A. Caligiuri. 2005. Efficient infection of human natural killer cells with an EBV/retroviral hybrid vector. J Immunol Methods 296:115-123.

85. Uzel, G., D.M. Frucht, T.A. Fleisher, and S.M. Holland. 2001. Detection of intracellular phosphorylated STAT-4 by flow cytometry. Clin Immunol 100:270-276.

- 112 -

86. Trotta, R., R. Parihar, J. Yu, B. Becknell, J. Allard, 2nd, J. Wen, W. Ding, H. Mao, S. Tridandapani, W.E. Carson, and M.A. Caligiuri. 2005. Differential expression of SHIP1 in CD56bright and CD56dim NK cells provides a molecular basis for distinct functional responses to monokine costimulation. Blood 105:3011-3018.

87. Dignam, J.D., P.L. Martin, B.S. Shastry, and R.G. Roeder. 1983. Eukaryotic gene transcription with purified components. Methods Enzymol 101:582-598.

88. Pal, S., R. Yun, A. Datta, L. Lacomis, H. Erdjument-Bromage, J. Kumar, P. Tempst, and S. Sif. 2003. mSin3A/histone deacetylase 2- and PRMT5-containing Brg1 complex is involved in transcriptional repression of the Myc target gene cad. Mol Cell Biol 23:7475-7487.

89. Frangioni, J.V., and B.G. Neel. 1993. Solubilization and purification of enzymatically active glutathione S-transferase (pGEX) fusion proteins. Anal Biochem 210:179-187. 90. Tanaka, T., M.A. Soriano, and M.J. Grusby. 2005. SLIM is a nuclear ubiquitin E3 ligase that negatively regulates STAT signaling. Immunity 22:729-736.

91. Wang, K.S., E. Zorn, and J. Ritz. 2001. Specific down-regulation of interleukin- 12 signaling through induction of phospho-STAT4 protein degradation. Blood 97:3860- 3866.

92. Hoey, T., S. Zhang, N. Schmidt, Q. Yu, S. Ramchandani, X. Xu, L.K. Naeger, Y.L. Sun, and M.H. Kaplan. 2003. Distinct requirements for the naturally occurring splice forms Stat4alpha and Stat4beta in IL-12 responses. Embo J 22:4237-4248.

93. Chen, Y., X. Dai, A.L. Haas, R. Wen, and D. Wang. 2006. Proteasome-dependent down-regulation of activated Stat5A in the nucleus. Blood

94. Fedele, M., F. Pentimalli, G. Baldassarre, S. Battista, A.J. Klein-Szanto, L. Kenyon, R. Visone, I. De Martino, A. Ciarmiello, C. Arra, G. Viglietto, C.M. Croce, and A. Fusco. 2005. Transgenic mice overexpressing the wild-type form of the HMGA1 gene develop mixed growth hormone/prolactin cell pituitary adenomas and natural killer cell lymphomas. Oncogene 24:3427-3435.

- 113 - 95. Di Noto, R., F. Pane, A. Camera, L. Luciano, M. Barone, C. Lo Pardo, P. Boccuni, M. Intrieri, B. Izzo, M.R. Villa, M. Macri, B. Rotoli, L. Sacchetti, F. Salvatore, and L. Del Vecchio. 2001. Characterization of two novel cell lines, DERL-2 (CD56+/CD3+/Tcry5+) and DERL-7 (CD56+/CD3-/TCRgammadelta-), derived from a single patient with CD56+ non-Hodgkin's lymphoma. Leukemia 15:1641-1649.

96. Robinson, D., K. Shibuya, A. Mui, F. Zonin, E. Murphy, T. Sana, S.B. Hartley, S. Menon, R. Kastelein, F. Bazan, and A. O'Garra. 1997. IGIF does not drive Th1 development but synergizes with IL-12 for interferon-gamma production and activates IRAK and NFkappaB. Immunity 7:571-581.

97. Wang, K.S., J. Ritz, and D.A. Frank. 1999. IL-2 induces STAT4 activation in primary NK cells and NK cell lines, but not in T cells. J Immunol 162:299-304.

98. Yoshimoto, T., K. Takeda, T. Tanaka, K. Ohkusu, S. Kashiwamura, H. Okamura, S. Akira, and K. Nakanishi. 1998. IL-12 up-regulates IL-18 receptor expression on T cells, Th1 cells, and B cells: synergism with IL-18 for IFN-gamma production. J Immunol 161:3400-3407.

99. Visconti, R., M. Gadina, M. Chiariello, E.H. Chen, L.F. Stancato, J.S. Gutkind, and J.J. O'Shea. 2000. Importance of the MKK6/p38 pathway for interleukin-12-induced STAT4 serine phosphorylation and transcriptional activity. Blood 96:1844-1852.

100. Karin, M. 1995. The regulation of AP-1 activity by mitogen-activated protein kinases. J Biol Chem 270:16483-16486.

101. Gao, M., T. Labuda, Y. Xia, E. Gallagher, D. Fang, Y.C. Liu, and M. Karin. 2004. Jun turnover is controlled through JNK-dependent phosphorylation of the E3 ligase Itch. Science 306:271-275.

102. Gallagher, E., M. Gao, Y.C. Liu, and M. Karin. 2006. Activation of the E3 ubiquitin ligase Itch through a phosphorylation-induced conformational change. Proc Natl Acad Sci U S A 103:1717-1722.

103. Lu, P.J., X.Z. Zhou, M. Shen, and K.P. Lu. 1999. Function of WW domains as phosphoserine- or phosphothreonine-binding modules. Science 283:1325-1328.

- 114 -

104. Swingler, T.E., K.L. Bess, J. Yao, S. Stifani, and P.S. Jayaraman. 2004. The proline-rich homeodomain protein recruits members of the Groucho/Transducin-like enhancer of split protein family to co-repress transcription in hematopoietic cells. J Biol Chem 279:34938-34947.

105. Sif, S. 2004. ATP-dependent nucleosome remodeling complexes: enzymes tailored to deal with chromatin. J Cell Biochem 91:1087-1098.

106. Phelan, M.L., S. Sif, G.J. Narlikar, and R.E. Kingston. 1999. Reconstitution of a core chromatin remodeling complex from SWI/SNF subunits. Mol Cell 3:247-253.

107. Kaplan, M.H. 2005. STAT4: a critical regulator of inflammation in vivo. Immunol Res 31:231-242.

108. Szabo, S.J., A.S. Dighe, U. Gubler, and K.M. Murphy. 1997. Regulation of the interleukin (IL)-12R beta 2 subunit expression in developing T helper 1 (Th1) and Th2 cells. J Exp Med 185:817-824.

109. Samson, S.I., O. Richard, M. Tavian, T. Ranson, C.A. Vosshenrich, F. Colucci, J. Buer, F. Grosveld, I. Godin, and J.P. Di Santo. 2003. GATA-3 promotes maturation, IFN-gamma production, and liver-specific homing of NK cells. Immunity 19:701-711.

- 115 -