DOCSLIB.ORG

Ten Simple Rules for Getting Published Philip E

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Ten Simple Rules for Getting Published Philip E Editorial Ten Simple Rules for Getting Published Philip E. Bourne journal in which you plan to publish. Rule 6: The ingredients of good Outstanding editors demand and get science are obvious—novelty of he student council (http://www. outstanding reviews. Put your energy iscbsc.org/) of the International research topic, comprehensive into improving the quality of the Society for Computational coverage of the relevant literature, T manuscript before submission. Ideally, Biology asked me to present my good data, good analysis including the reviews will improve your paper. thoughts on getting published in the strong statistical support, and a But they will not get to imparting field of computational biology at the thought-provoking discussion. The that advice if there are fundamental Intelligent Systems in Molecular ingredients of good science flaws. Biology conference held in Detroit in reporting are obvious—good late June of 2005. Close to 200 bright Rule 4: If you do not write well in the organization, the appropriate use of young souls (and a few not so young) English language, take lessons early; tables and figures, the right length, crammed into a small room for what it will be invaluable later. writing to the intended audience— proved to be a wonderful interchange This is not just about grammar, but do not ignore the obvious. among a group of whom approximately more importantly comprehension. The Be objective about these ingredients one-half had yet to publish their first best papers are those in which complex when you review the first draft, and do paper. The advice I gave that day I have ideas are expressed in a way that those not rely on your mentor. Get a candid modified and present as ten rules for who are less than immersed in the field opinion by having the paper read by getting published. can understand. Have you noticed that colleagues without a vested interest in Rule 1: Read many papers, and learn the most renowned scientists often give the work, including those not directly involved in the topic area. from both the good and the bad the most logical and simply stated yet work of others. stimulating lectures? This extends to Rule 7: Start writing the paper the It is never too early to become a their written work as well. Note that day you have the idea of what critic. Journal clubs, where you critique writing clearly is valuable, even if your questions to pursue. ultimate career does not hinge on a paper as a group, are excellent for Some would argue that this places producing good scientific papers in having this kind of dialogue. Reading at too much emphasis on publishing, but English language journals. Submitted least two papers a day in detail (not just it could also be argued that it helps in your area of research) and thinking papers that are not clearly written in define scope and facilitates hypothesis- about their quality will also help. Being good English, unless the science is truly driven science. The temptation of well read has another potential major outstanding, are often rejected or at novice authors is to try to include benefit—it facilitates a more objective best slow to publish since they require everything they know in a paper. Your view of one’s own work. It is too easy extensive copyediting. thesis is/was your kitchen sink. Your after many late nights spent in front of Rule 5: Learn to live with rejection. papers should be concise, and impart as a computer screen and/or laboratory much information as possible in the A failure to be objective can make bench to convince yourself that your least number of words. Be familiar with rejection harder to take, and you will work is the best invention since sliced the guide to authors and follow it, the be rejected. Scientific careers are full of bread. More than likely it is not, and editors and reviewers do. Maintain a rejection, even for the best scientists. your mentor is prone to falling into the good bibliographic database as you go, The correct response to a paper being same trap, hence rule 2. and read the papers in it. rejected or requiring major revision is Rule 2: The more objective you can to listen to the reviewers and respond be about your work, the better that in an objective, not subjective, manner. work will ultimately become. Reviews reflect how your paper is being Alas, some scientists will never be judged—learn to live with it. If objective about their own work, and reviewers are unanimous about the Citation: Bourne PE (2005) Ten simple rules for will never make the best scientists— poor quality of the paper, move on—in getting published. PLoS Comput Biol 1(5): e57. learn objectivity early, the editors and virtually all cases, they are right. If they Copyright: Ó 2005 Philip E. Bourne. This is an open- reviewers have. request a major revision, do it and access article distributed under the terms of the address every point they raise both in Creative Commons Attribution License, which permits unrestricted use, distribution, and Rule 3: Good editors and reviewers your cover letter and through obvious reproduction in any medium, provided the original will be objective about your work. revisions to the text. Multiple rounds of author and source are properly credited. The quality of the editorial board is revision are painful for all those DOI: 10.1371/journal.pcbi.0010057 an early indicator of the review concerned and slow the publishing Philip E. Bourne is Editor-in-Chief of PLoS process. Look at the masthead of the process. Computational Biology. E-mail: [email protected] PLoS Computational Biology | www.ploscompbiol.org0341 October 2005 | Volume 1 | Issue 5 | e57 Rule 8: Become a reviewer early in which is an important ingredient in like Google Scholar and the ISI Web of your career. deciding where to send your paper. Science are being used by tenure committees and employers to define Reviewing other papers will help you Rule 9: Decide early on where to try write better papers. To start, work with metrics for the quality of your work. It to publish your paper. your mentors; have them give you used to be that just the journal name This will define the form and level of papers they are reviewing and do the was used as a metric. In the digital detail and assumed novelty of the work first cut at the review (most mentors world, everyone knows if a paper has you are doing. Many journals have a will be happy to do this). Then, go little impact. Try to publish in journals presubmission enquiry system through the final review that gets sent that have high impact factors; chances available—use it. Even before the paper in by your mentor, and where allowed, are your paper will have high impact, is written, get a sense of the novelty of as is true of this journal, look at the too, if accepted. the work, and whether a specific When you are long gone, your reviews others have written. This will journal will be interested. provide an important perspective on scientific legacy is, in large part, the the quality of your reviews and, Rule 10: Quality is everything. literature you left behind and the hopefully, allow you to see your own It is better to publish one paper in a impact it represents. I hope these ten work in a more objective way. You will quality journal than multiple papers in simple rules can help you leave behind also come to understand the review lesser journals. Increasingly, it is harder something future generations of process and the quality of reviews, to hide the impact of your papers; tools scientists will admire. & PLoS Computational Biology | www.ploscompbiol.org0342 October 2005 | Volume 1 | Issue 5 | e57 Editorial Ten Simple Rules for Getting Grants Philip E. Bourne*, Leo M. Chalupa his piece follows an earlier and that you are the best person to do an inappropriately formulated Editorial, ‘‘Ten Simple Rules it. Different granting programs require application may aggravate the T for Getting Published’’ [1], differing amounts of preliminary data. reviewers, and will have a negative which has generated significant For certain programs, it can be said impact even if the science is sound. interest, is well read, and continues to that the work must be essentially done Length and format are the most generate a variety of positive before the grant is awarded, and that frequent offenders. comments. That Editorial was aimed at the funds are then used for the next students in the early stages of a life of phase of the research program. There is Rule 5: Obey the Three Cs—Concise, scientific paper writing. This interest some truth in this. So where Clear, and Complete has prompted us to try to help appropriate, do provide some The grant does not have to fill the scientists in making the next academic tantalizing preliminary result, making allotted page count. Your goal should career step—becoming a young sure to tell the reviewers what these be to provide a complete reckoning of principal investigator. Leo Chalupa has results imply with respect to the what is to be done, as briefly as joined us in putting together ten simple specific aims of your proposal. In possible. Do not rely on supplements rules for getting grants, based on our formulating the motivation for your (which may not be allowed) or on Web many collective years of writing both proposal, make sure to cite all relevant sites (review may be actively successful and unsuccessful grants.
Load more

Recommended publications
  • Easybuild Documentation Release 20210907.0
    EasyBuild Documentation Release 20210907.0 Ghent University Tue, 07 Sep 2021 08:55:41 Contents 1 What is EasyBuild? 3 2 Concepts and terminology 5 2.1 EasyBuild framework..........................................5 2.2 Easyblocks................................................6 2.3 Toolchains................................................7 2.3.1 system toolchain.......................................7 2.3.2 dummy toolchain (DEPRECATED) ..............................7 2.3.3 Common toolchains.......................................7 2.4 Easyconfig files..............................................7 2.5 Extensions................................................8 3 Typical workflow example: building and installing WRF9 3.1 Searching for available easyconfigs files.................................9 3.2 Getting an overview of planned installations.............................. 10 3.3 Installing a software stack........................................ 11 4 Getting started 13 4.1 Installing EasyBuild........................................... 13 4.1.1 Requirements.......................................... 14 4.1.2 Using pip to Install EasyBuild................................. 14 4.1.3 Installing EasyBuild with EasyBuild.............................. 17 4.1.4 Dependencies.......................................... 19 4.1.5 Sources............................................. 21 4.1.6 In case of installation issues. .................................. 22 4.2 Configuring EasyBuild.......................................... 22 4.2.1 Supported configuration
    [Show full text]
  • The 7Th White Coat Ceremony at SSPPS by Binh Tran, Pharmd
    The 7th White Coat Ceremony at SSPPS By Binh Tran, PharmD The White Coat Ceremony at the Skaggs School of Pharmacy and Pharmaceutical Sciences (SSPPS) on September 25th held special meaning as the University of California - San Diego celebrates its 50th Anniversary this year. SSPPS faculty, alumni, student pharmacists, the incoming class of 2014, their families and their friends listened to Dean Palmer Taylor’s welcoming address in the spacious Health Sciences auditorium modeled with panels made of eucalyptus wood. Dr Rita Shane, Director of Pharmacy Services at Cedars-Sinai Medical Center and Assistant Dean of Clinical Pharmacy at the UCSF School of Pharmacy delivered an energizing speech on The Power of Differentiation: Will you be a Brand or Generic? Attributes mentioned were competency, responsibility and accountability, intellectual curiosity, being able to seize opportunities, and establishing credibility. Dr. Anthony Manoguerra, Associate Dean for Student Affairs, reported that the class of 2014’s grade point average of 3.71 broke the record set by the previous class which averaged 3.70. The White Coat hooding by Dean Taylor was a moving ceremony with Justine Abella being last due to a recent foot injury. The class recited the Pharmacist’s Oath, which brought back memories of our own experiences. The Student Welcome by second- year student, Ammar Zanial, was heartfelt and reminiscent of his comments during pharmacy conference class. Little did I know at the time that the student pharmacist who volunteered at many outreaches in the community and helped backstage during Cultural Fusion Night was the President of his class. In closing, Dean Taylor commented on the ingeniousness of the class when he observed them tacitly move their seats in order to step closer to the stage.
    [Show full text]
  • Bioperl What’S Bioperl?
    Bioperl What’s Bioperl? Bioperl is not a new language It is a collection of Perl modules that facilitate the development of Perl scripts for bioinformatics applications. Bioperl and perl Bioperl Modules Perl Modules Perls script input Perl Interpreter output Bioperl and Perl Why bioperl for bioinformatics? Perl is good at file manipulation and text processing, which make up a large part of the routine tasks in bioinformatics. Perl language, documentation and many Perl packages are freely available. Perl is easy to get started in, to write small and medium-sized programs. Where to get help Type perldoc <modulename> in terminal Search for particular module in https://metacpan.org Bioperl Document Object-oriented and Process-oriented programming Process-oriented: Yuan Hao eats chicken Name object: $name Action method: eat Food object: $food Object-oriented: $name->eat($food) Modularize the program Platform and Related Software Required Perl 5.6.1 or higher Version 5.8 or higher is highly recommended make for Mac OS X, this requires installing the Xcode Developer Tools Installation On Linux or Max OS X Install from cpanminus: perlbrew install-cpanm cpanm Bio::Perl Install from source code: git clone https://github.com/bioperl/bioperl-live.git cd bioperl-live perl Build.PL ./Build test (optional) ./Build install Installation On Windows Install MinGW (MinGW is incorporated in Strawberry Perl, but must it be installed through PPM for ActivePerl) : ppm install MinGW Install Module::Build, Test::Harness and Test::Most through CPAN: Type cpan to enter the CPAN shell. At the cpan> prompt, type install CPAN Quit (by typing ‘q’) and reload CPAN.
    [Show full text]
  • The Bioperl Toolkit: Perl Modules for the Life Sciences
    Downloaded from genome.cshlp.org on January 25, 2012 - Published by Cold Spring Harbor Laboratory Press The Bioperl Toolkit: Perl Modules for the Life Sciences Jason E. Stajich, David Block, Kris Boulez, et al. Genome Res. 2002 12: 1611-1618 Access the most recent version at doi:10.1101/gr.361602 Supplemental http://genome.cshlp.org/content/suppl/2002/10/20/12.10.1611.DC1.html Material References This article cites 14 articles, 9 of which can be accessed free at: http://genome.cshlp.org/content/12/10/1611.full.html#ref-list-1 Article cited in: http://genome.cshlp.org/content/12/10/1611.full.html#related-urls Email alerting Receive free email alerts when new articles cite this article - sign up in the box at the service top right corner of the article or click here To subscribe to Genome Research go to: http://genome.cshlp.org/subscriptions Cold Spring Harbor Laboratory Press Downloaded from genome.cshlp.org on January 25, 2012 - Published by Cold Spring Harbor Laboratory Press Resource The Bioperl Toolkit: Perl Modules for the Life Sciences Jason E. Stajich,1,18,19 David Block,2,18 Kris Boulez,3 Steven E. Brenner,4 Stephen A. Chervitz,5 Chris Dagdigian,6 Georg Fuellen,7 James G.R. Gilbert,8 Ian Korf,9 Hilmar Lapp,10 Heikki Lehva¨slaiho,11 Chad Matsalla,12 Chris J. Mungall,13 Brian I. Osborne,14 Matthew R. Pocock,8 Peter Schattner,15 Martin Senger,11 Lincoln D. Stein,16 Elia Stupka,17 Mark D. Wilkinson,2 and Ewan Birney11 1University Program in Genetics, Duke University, Durham, North Carolina 27710, USA; 2National Research Council of
    [Show full text]
  • Are You an Invited Speaker? a Bibliometric Analysis of Elite Groups for Scholarly Events in Bioinformatics
    Are You an Invited Speaker? A Bibliometric Analysis of Elite Groups for Scholarly Events in Bioinformatics Senator Jeong, Sungin Lee, and Hong-Gee Kim Biomedical Knowledge Engineering Laboratory, Seoul National University, 28–22 YeonGeon Dong, Jongno Gu, Seoul 110–749, Korea. E-mail: {senator, sunginlee, hgkim}@snu.ac.kr Participating in scholarly events (e.g., conferences, work- evaluation, but it would be hard to claim that they have pro- shops, etc.) as an elite-group member such as an orga- vided comprehensive lists of evaluation measurements. This nizing committee chair or member, program committee article aims not to provide such lists but to add to the current chair or member, session chair, invited speaker, or award winner is beneficial to a researcher’s career develop- practices an alternative metric that complements existing per- ment.The objective of this study is to investigate whether formance measures to give a more comprehensive picture of elite-group membership for scholarly events is represen- scholars’ performance. tative of scholars’ prominence, and which elite group is By one definition (Jeong, 2008), a scholarly event is the most prestigious. We collected data about 15 global “a sequentially and spatially organized collection of schol- (excluding regional) bioinformatics scholarly events held in 2007. We sampled (via stratified random sampling) ars’ interactions with the intention of delivering and shar- participants from elite groups in each event. Then, bib- ing knowledge, exchanging research ideas, and performing liometric indicators (total citations and h index) of seven related activities.” As such, scholarly events are communica- elite groups and a non-elite group, consisting of authors tion channels from which our new evaluation tool can draw who submitted at least one paper to an event but were its supporting evidence.
    [Show full text]
  • Vasco Da Rocha Figueiras Algoritmos Para Genómica Comparativa
    Universidade de Aveiro Departamento Electrónica, Telecomunicações 2010 e Informática Vasco da Rocha Algoritmos para Genómica Comparativa Figueiras Universidade de Aveiro Departamento de Electrónica, Telecomunicações 2010 e Informática Vasco da Rocha Algoritmos para Genómica Comparativa Figueiras Dissertação apresentada à Universidade de Aveiro para cumprimento dos requisitos necessários à obtenção do grau de Mestre em Engenharia Electrónica e Telecomunicações, realizada sob a orientação científica do Doutor José Luís Oliveira, Professor associado da Universidade de Aveiro. o júri presidente Prof. Doutor Armando José Formoso de Pinho Professor Associado do Departamento de Electrónica, Telecomunicações e Informática da Universidade de Aveiro Prof. Doutor Rui Pedro Sanches de Castro Lopes Professor Coodenador do Departamento de Informática e Comunicações do Instituto Politécnico de Bragança orientador Prof. Doutor José Luis Guimarães de Oliveira Professor Associado do Departamento de Electrónica, Telecomunicações e Informática da Universidade de Aveiro agradecimentos Durante o desenvolvimento desta dissertação, recebi muito apoio de colegas e amigos. Agora que termino o trabalho não posso perder a oportunidade de agradecer a todas as pessoas que me ajudaram nesta etapa. Um agradecimento ao meu orientador Professor Doutor José Luís Oliveira e ao Doutor Miguel Monsanto Pinheiro, pela oportunidade de aprendizagem. À minha família pelo apoio incondicional, incentivo e carinho. Aos meus colegas e amigos por toda a ajuda e pelos momentos de convívio e de descontracção, que quebraram tantas dificuldades, ao longo desta etapa. A ti, Rita por todo o carinho, paciência e amor. palavras-chave Bioinformática, sequenciação, BLAST, alinhamento de sequências, genómica comparativa. resumo Com o surgimento da Genómica e da Proteómica, a Bioinformática conduziu a alguns dos avanços científicos mais relevantes do século XX.
    [Show full text]
  • Perl for Bioinformatics Perl and Bioperl I
    Perl for Bioinformatics Perl and BioPerl I Jason Stajich July 13, 2011 Perl for Bioinformatics Slide 1/83 Outline Perl Intro Basics Syntax and Variables More complex: References Routines Reading and Writing Regular Expressions BioPerl Intro Useful modules Data formats Databases in BioPerl Sequence objects details Trees Multiple Alignments BLAST and Sequence Database searching Other general Perl modules Perl for Bioinformatics Perl Intro Slide 2/83 Outline Perl Intro Basics Syntax and Variables More complex: References Routines Reading and Writing Regular Expressions BioPerl Intro Useful modules Data formats Databases in BioPerl Sequence objects details Trees Multiple Alignments BLAST and Sequence Database searching Other general Perl modules Perl for Bioinformatics Perl Intro Basics Slide 3/83 Why Perl for data processing & bioinformatics Fast text processing Regular expressions Extensive module libraries for pre-written tools Large number of users in community of bioinformatics Scripts are often faster to write than full compiled programs Cons Syntax sometimes confusing to new users; 'There's more than one way to do it' can also be confusing. (TMTOWTDI) Cons Not a true object-oriented language so some abstraction is clunky and hacky Scripting languages (Perl, Python, Ruby) generally easier to write simply than compiled ones (C, C++, Java) as they are often not strongly typed and less memory management control. Perl for Bioinformatics Perl Intro Basics Slide 4/83 Perl packages CPAN - Comprehensive Perl Archive http://www.cpan.org Perl
    [Show full text]
  • Pipenightdreams Osgcal-Doc Mumudvb Mpg123-Alsa Tbb
    pipenightdreams osgcal-doc mumudvb mpg123-alsa tbb-examples libgammu4-dbg gcc-4.1-doc snort-rules-default davical cutmp3 libevolution5.0-cil aspell-am python-gobject-doc openoffice.org-l10n-mn libc6-xen xserver-xorg trophy-data t38modem pioneers-console libnb-platform10-java libgtkglext1-ruby libboost-wave1.39-dev drgenius bfbtester libchromexvmcpro1 isdnutils-xtools ubuntuone-client openoffice.org2-math openoffice.org-l10n-lt lsb-cxx-ia32 kdeartwork-emoticons-kde4 wmpuzzle trafshow python-plplot lx-gdb link-monitor-applet libscm-dev liblog-agent-logger-perl libccrtp-doc libclass-throwable-perl kde-i18n-csb jack-jconv hamradio-menus coinor-libvol-doc msx-emulator bitbake nabi language-pack-gnome-zh libpaperg popularity-contest xracer-tools xfont-nexus opendrim-lmp-baseserver libvorbisfile-ruby liblinebreak-doc libgfcui-2.0-0c2a-dbg libblacs-mpi-dev dict-freedict-spa-eng blender-ogrexml aspell-da x11-apps openoffice.org-l10n-lv openoffice.org-l10n-nl pnmtopng libodbcinstq1 libhsqldb-java-doc libmono-addins-gui0.2-cil sg3-utils linux-backports-modules-alsa-2.6.31-19-generic yorick-yeti-gsl python-pymssql plasma-widget-cpuload mcpp gpsim-lcd cl-csv libhtml-clean-perl asterisk-dbg apt-dater-dbg libgnome-mag1-dev language-pack-gnome-yo python-crypto svn-autoreleasedeb sugar-terminal-activity mii-diag maria-doc libplexus-component-api-java-doc libhugs-hgl-bundled libchipcard-libgwenhywfar47-plugins libghc6-random-dev freefem3d ezmlm cakephp-scripts aspell-ar ara-byte not+sparc openoffice.org-l10n-nn linux-backports-modules-karmic-generic-pae
    [Show full text]
  • Your Scientific Reputation Class Slides
    Your Scientific Reputation and Being a Responsible Member of Society Peter D Sottile, MD October 2020 • Silence personal devices. • Stay muted when not talking. • Set up in a quiet location. Housekeeping: Zoom • Remain attentive. Avoid checking Etiquette: email/phone/web. • Use the Chat function to ask questions or get technical help. • Use your full name, not an alias. Receiving credit for attendance: To satisfy the NIH Requirement for Instruction in the Responsible Conduct of Research, the following are required in order to receive credit for attendance: Attend the full 90 minutes of the training. Attending any 8 out of the 9 RCR seminars we offer will satisfy the NIH requirement. Keep your video camera on throughout the session. NIH requirements for RCR training specify face- to-face discussion. Participate interactively throughout the session. Participate in discussions, respond to polls, and sign the attendance sheet (link will be distributed in the Chat). Raise your Hand to participate in discussions: In order to participate in discussions, raise your hand. Try it now! • Click “Participants” at the bottom of your screen. • Click “Raise Hand” in the popup window. • Click “Lower Hand” to stop raising your hand. 3 Objectives: • Explain why a good scientific reputation is important in academia • Describe the factors that contribute to a good scientific reputation • Identify the components to being a responsible member of the scientific community • Describe threats that may harm one’s scientific reputation, and responses to challenges
    [Show full text]
  • Web & Grid Technologies in Bioinformatics, Computational And
    Current Bioinformatics, 2008, 3, 000-000 1 Web & Grid Technologies in Bioinformatics, Computational and Systems Biology: A Review Azhar A. Shah1, Daniel Barthel1, Piotr Lukasiak2,3, Jacek Blazewicz2,3 and Natalio Krasnogor*,1 1School of Computer Science, University of Nottingham, Jubilee Campus, NG81BB, Nottingham, UK 2Institute of Computing Science, Poznan University of Technology, Piotrowo 2, 60-965 Poznan, Poland 3Institute of Bioorganic Chemistry, Laboratory of Bioinformatics, Polish Academy of Sciences, Noskowskiego 12/14, 61- 704 Poznan, Poland Abstract: The acquisition of biological data, ranging from molecular characterization and simulations (e.g. protein fold- ing dynamics), to systems biology endeavors (e.g. whole organ simulations) all the way up to ecological observations (e.g. as to ascertain climate change’s impact on the biota) is growing at unprecedented speed. The use of computational and networking resources is thus unavoidable. As the datasets become bigger and the acquisition technology more refined, the biologist is empowered to ask deeper and more complex questions. These, in turn, drive a runoff effect where large re- search consortia emerge that span beyond organizations and national boundaries. Thus the need for reliable, robust, certi- fied, curated, accessible, secure and timely data processing and management becomes entrenched within, and crucial to, 21st century biology. Furthermore, the proliferation of biotechnologies and advances in biological sciences has produced a strong drive for new informatics solutions, both at the basic science and technological levels. The previously unknown situation of dealing with, on one hand, (potentially) exabytes of data, much of which is noisy, has large experimental er- rors or theoretical uncertainties associated with it, or on the other hand, large quantities of data that require automated computationally intense analysis and processing, have produced important innovations in web and grid technology.
    [Show full text]
  • BINF 634 Bioinformatics Programming
    UNIVERSITA’ DEGLI Teacher: Matteo Re STUDI DI MILANO Metodi e linguaggi per il trattamento dei dati PERL scripting S introduction • PERL programming • Problem solving and Debugging • To read and write documentation • Data manipulation: filtering and transformation • Pattern matching and data mining (examples) • Example application: Computational Biology • Analysis and manipulation of biological sequences • Interaction with biological batabases (NCBI, EnsEMBL, UCSC) • BioPERL Objectives Guidelines • Operating system • During class appointments we will use windows • PERL installation WIN: http://www.activestate.com/activeperl/downloads UNIX, MacOS: available by default • Text editor PERL are saved as text files. Many options available… Vim (UNIX like OS) Notepad (Windows) Sequence file – FASTA format >gi|40457238|HIV-1 isolate 97KE128 from Kenya gag gene, partial cds CTTTTGAATGCATGGGTAAAAGTAATAGAAGAAAGAGGTTTCAGTCCAGAAGTAATACCCATGTTCTCAG CATTATCAGAAGGAGCCACCCCACAAGATTTAAATACGATGCTGAACATAGTGGGGGGACACCAGGCAGC TATGCAAATGCTAAAGGATACCATCAATGAGGAAGCTGCAGAATGGGACAGGTTACATCCAGTACATGCA GGGCCTATTCCGCCAGGCCAGATGAGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCCTC AAGAACAAGTAGGATGGATGACAAACAATCCACCTATCCCAGTGGGAGACATCTATAAAAGATGGATCAT CCTGGGCTTAAATAAAATAGTAAGAATGTATAGCCCTGTTAGCATTTTGGACATAAAACAAGGGCCAAAA GAACCCTTTAGAGACTATGTAGATAGGTTCTTTAAAACTCTCAGAGCCGAACAAGCTT >gi|40457236| HIV-1 isolate 97KE127 from Kenya gag gene, partial cds TTGAATGCATGGGTGAAAGTAATAGAAGAAAAGGCTTTCAGCCCAGAAGTAATACCCATGTTCTCAGCAT TATCAGAAGGAGCCACCCCACAAGATTTAAATATGATGCTGAATATAGTGGGGGGACACCAGGCAGCTAT
    [Show full text]
  • Annual Scientific Report 2011 Annual Scientific Report 2011 Designed and Produced by Pickeringhutchins Ltd
    European Bioinformatics Institute EMBL-EBI Annual Scientific Report 2011 Annual Scientific Report 2011 Designed and Produced by PickeringHutchins Ltd www.pickeringhutchins.com EMBL member states: Austria, Croatia, Denmark, Finland, France, Germany, Greece, Iceland, Ireland, Israel, Italy, Luxembourg, the Netherlands, Norway, Portugal, Spain, Sweden, Switzerland, United Kingdom. Associate member state: Australia EMBL-EBI is a part of the European Molecular Biology Laboratory (EMBL) EMBL-EBI EMBL-EBI EMBL-EBI EMBL-European Bioinformatics Institute Wellcome Trust Genome Campus, Hinxton Cambridge CB10 1SD United Kingdom Tel. +44 (0)1223 494 444, Fax +44 (0)1223 494 468 www.ebi.ac.uk EMBL Heidelberg Meyerhofstraße 1 69117 Heidelberg Germany Tel. +49 (0)6221 3870, Fax +49 (0)6221 387 8306 www.embl.org [email protected] EMBL Grenoble 6, rue Jules Horowitz, BP181 38042 Grenoble, Cedex 9 France Tel. +33 (0)476 20 7269, Fax +33 (0)476 20 2199 EMBL Hamburg c/o DESY Notkestraße 85 22603 Hamburg Germany Tel. +49 (0)4089 902 110, Fax +49 (0)4089 902 149 EMBL Monterotondo Adriano Buzzati-Traverso Campus Via Ramarini, 32 00015 Monterotondo (Rome) Italy Tel. +39 (0)6900 91402, Fax +39 (0)6900 91406 © 2012 EMBL-European Bioinformatics Institute All texts written by EBI-EMBL Group and Team Leaders. This publication was produced by the EBI’s Outreach and Training Programme. Contents Introduction Foreword 2 Major Achievements 2011 4 Services Rolf Apweiler and Ewan Birney: Protein and nucleotide data 10 Guy Cochrane: The European Nucleotide Archive 14 Paul Flicek:
    [Show full text]