DOCSLIB.ORG

Bioperl What’S Bioperl?

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Bioperl What’S Bioperl? Bioperl What’s Bioperl? Bioperl is not a new language It is a collection of Perl modules that facilitate the development of Perl scripts for bioinformatics applications. Bioperl and perl Bioperl Modules Perl Modules Perls script input Perl Interpreter output Bioperl and Perl Why bioperl for bioinformatics? Perl is good at file manipulation and text processing, which make up a large part of the routine tasks in bioinformatics. Perl language, documentation and many Perl packages are freely available. Perl is easy to get started in, to write small and medium-sized programs. Where to get help Type perldoc <modulename> in terminal Search for particular module in https://metacpan.org Bioperl Document Object-oriented and Process-oriented programming Process-oriented: Yuan Hao eats chicken Name object: $name Action method: eat Food object: $food Object-oriented: $name->eat($food) Modularize the program Platform and Related Software Required Perl 5.6.1 or higher Version 5.8 or higher is highly recommended make for Mac OS X, this requires installing the Xcode Developer Tools Installation On Linux or Max OS X Install from cpanminus: perlbrew install-cpanm cpanm Bio::Perl Install from source code: git clone https://github.com/bioperl/bioperl-live.git cd bioperl-live perl Build.PL ./Build test (optional) ./Build install Installation On Windows Install MinGW (MinGW is incorporated in Strawberry Perl, but must it be installed through PPM for ActivePerl) : ppm install MinGW Install Module::Build, Test::Harness and Test::Most through CPAN: Type cpan to enter the CPAN shell. At the cpan> prompt, type install CPAN Quit (by typing ‘q’) and reload CPAN. You may be asked some configuration questions, accept defaults At the cpan> prompt, type o conf prefer_installer MB then type o conf commit At the cpan> prompt, type install Module::Build. At the cpan> prompt, type install Test::Harness. At the cpan> prompt, type install Test::Most. Installation On Windows Finish install from cpan: type /d/bioperl/ .... Distribution C/CJ/CJFIELDS/BioPerl-1.007001.tar.gz type install C/CJ/CJFIELDS/BioPerl-1.007001.tar.gz Finish install from source code: Go to GitHub and press the Download ZIP button. Extract the archive in the normal way. In a cmd window cd to the directory you extracted to. Eg. if you extracted to directory ‘bioperl-live’, cd bioperl-live Type perl Build.PL and answer the questions appropriately. Type perl Build test. All the tests should pass, but if they don’t, let us know. Your usage of Bioperl may not be affected by the failure, so you can choose to continue anyway. Type perl Build install to install Bioperl. Show the capability of bioperl in following examples Creating a sequence, and an Object #!/usr/bin/perl -w use Bio::Seq; my $seq_obj = Bio::Seq->new(-seq => 'aaaatgggggggggggccccgtt', -alphabet => 'dna' ); object class method argument Creating a sequence, and an Object #!/usr/bin/perl -w use Bio::Seq; my $seq_obj = Bio::Seq->new(-seq => 'aaaatgggggggggggccccgtt', -alphabet => 'dna' ); print $seq_obj->seq . "\n" More True-to-life example #!/usr/bin/perl -w use Bio::Seq; my $seq_obj = Bio::Seq->new(-seq => "aaaatgggggggggggccccgtt", -display_id => "#12345", -desc => "example 1", -alphabet => "dna" ); print $seq_obj->seq(); Write Sequence to File #!/usr/bin/perl -w use Bio::Seq; use Bio::SeqIO; my $seq_obj = Bio::Seq->new(-seq => 'aaaatgggggggggggccccgtt', -alphabet => 'dna' ); my $seqio_obj = Bio::SeqIO->new(-file => '>sequence.fasta', -format => 'fasta' ); Create object for IO from class Bio::SeqIO Write Sequence to File #!/usr/bin/perl -w use Bio::Seq; use Bio::SeqIO; my $seq_obj = Bio::Seq->new(-seq => "aaaatgggggggggggccccgtt", -display_id => "#12345", -desc => "example 1", -alphabet => "dna" ); my $seqio_obj = Bio::SeqIO->new(-file => '>sequence.fasta', -format => 'fasta' ); $seqio_obj->write_seq($seq_obj); Write Sequence to File #!/usr/bin/perl -w use Bio::Seq; use Bio::SeqIO; my $seq_obj = Bio::Seq->new(-seq => "aaaatgggggggggggccccgtt", -display_id => "#12345", -desc => "example 1", -alphabet => "dna" ); my $seqio_obj = Bio::SeqIO->new(-file => '>sequence.fasta', -format => 'Genbank' ); $seqio_obj->write_seq($seq_obj); Unified Programming~~ Retrieving a Sequence from a File #!/usr/bin/perl -w use Bio::SeqIO; my $seqio_obj = Bio::SeqIO->new(-file => "sequence.fasta", -format => "genbank" ); my $seq_obj = $seqio_obj->next_seq; print $seq_obj->seq . "\n"; Multiple Sequences Alignment #!/usr/bin/perl -w use Bio::Tools::Run::Alignment::Muscle; use Bio::AlignIO; my @params = (quiet => 0, maxiters => '100'); my $factory = Bio::Tools::Run::Alignment::Muscle->new(@params); my $inputfilename = "$ARGV[0]"; my $aln = $factory->align($inputfilename); my $out = Bio::AlignIO->new(-file => ">$ARGV[1]", -format => 'fasta'); $out->write_aln($aln); Bioperl can incorporate with other software Retrieving a Sequence from a Database #!/usr/bin/perl -w use strict; use Bio::EnsEMBL::Registry; my $registry = 'Bio::EnsEMBL::Registry'; $registry->load_registry_from_db( -host => 'ensembldb.ensembl.org', -user => 'anonymous', ); my $slice_adaptor = $registry->get_adaptor( 'Human', 'Core', 'Slice' ); my $slice = $slice_adaptor->fetch_by_gene_stable_id('ENSG00000128573'); print $slice->seq . "\n"; Application Programming Interface (API) Database Bioperl provides various kind of API to extract user-defined dataset from database efficiently even you aren’t familiar with data structure of them Obstacle in Learning OOP Programming in a total different way Familiar with different object, method and class That’s worthwhile !!! Thanks.
Load more

Recommended publications
  • Easybuild Documentation Release 20210907.0
    EasyBuild Documentation Release 20210907.0 Ghent University Tue, 07 Sep 2021 08:55:41 Contents 1 What is EasyBuild? 3 2 Concepts and terminology 5 2.1 EasyBuild framework..........................................5 2.2 Easyblocks................................................6 2.3 Toolchains................................................7 2.3.1 system toolchain.......................................7 2.3.2 dummy toolchain (DEPRECATED) ..............................7 2.3.3 Common toolchains.......................................7 2.4 Easyconfig files..............................................7 2.5 Extensions................................................8 3 Typical workflow example: building and installing WRF9 3.1 Searching for available easyconfigs files.................................9 3.2 Getting an overview of planned installations.............................. 10 3.3 Installing a software stack........................................ 11 4 Getting started 13 4.1 Installing EasyBuild........................................... 13 4.1.1 Requirements.......................................... 14 4.1.2 Using pip to Install EasyBuild................................. 14 4.1.3 Installing EasyBuild with EasyBuild.............................. 17 4.1.4 Dependencies.......................................... 19 4.1.5 Sources............................................. 21 4.1.6 In case of installation issues. .................................. 22 4.2 Configuring EasyBuild.......................................... 22 4.2.1 Supported configuration
    [Show full text]
  • The Bioperl Toolkit: Perl Modules for the Life Sciences
    Downloaded from genome.cshlp.org on January 25, 2012 - Published by Cold Spring Harbor Laboratory Press The Bioperl Toolkit: Perl Modules for the Life Sciences Jason E. Stajich, David Block, Kris Boulez, et al. Genome Res. 2002 12: 1611-1618 Access the most recent version at doi:10.1101/gr.361602 Supplemental http://genome.cshlp.org/content/suppl/2002/10/20/12.10.1611.DC1.html Material References This article cites 14 articles, 9 of which can be accessed free at: http://genome.cshlp.org/content/12/10/1611.full.html#ref-list-1 Article cited in: http://genome.cshlp.org/content/12/10/1611.full.html#related-urls Email alerting Receive free email alerts when new articles cite this article - sign up in the box at the service top right corner of the article or click here To subscribe to Genome Research go to: http://genome.cshlp.org/subscriptions Cold Spring Harbor Laboratory Press Downloaded from genome.cshlp.org on January 25, 2012 - Published by Cold Spring Harbor Laboratory Press Resource The Bioperl Toolkit: Perl Modules for the Life Sciences Jason E. Stajich,1,18,19 David Block,2,18 Kris Boulez,3 Steven E. Brenner,4 Stephen A. Chervitz,5 Chris Dagdigian,6 Georg Fuellen,7 James G.R. Gilbert,8 Ian Korf,9 Hilmar Lapp,10 Heikki Lehva¨slaiho,11 Chad Matsalla,12 Chris J. Mungall,13 Brian I. Osborne,14 Matthew R. Pocock,8 Peter Schattner,15 Martin Senger,11 Lincoln D. Stein,16 Elia Stupka,17 Mark D. Wilkinson,2 and Ewan Birney11 1University Program in Genetics, Duke University, Durham, North Carolina 27710, USA; 2National Research Council of
    [Show full text]
  • Vasco Da Rocha Figueiras Algoritmos Para Genómica Comparativa
    Universidade de Aveiro Departamento Electrónica, Telecomunicações 2010 e Informática Vasco da Rocha Algoritmos para Genómica Comparativa Figueiras Universidade de Aveiro Departamento de Electrónica, Telecomunicações 2010 e Informática Vasco da Rocha Algoritmos para Genómica Comparativa Figueiras Dissertação apresentada à Universidade de Aveiro para cumprimento dos requisitos necessários à obtenção do grau de Mestre em Engenharia Electrónica e Telecomunicações, realizada sob a orientação científica do Doutor José Luís Oliveira, Professor associado da Universidade de Aveiro. o júri presidente Prof. Doutor Armando José Formoso de Pinho Professor Associado do Departamento de Electrónica, Telecomunicações e Informática da Universidade de Aveiro Prof. Doutor Rui Pedro Sanches de Castro Lopes Professor Coodenador do Departamento de Informática e Comunicações do Instituto Politécnico de Bragança orientador Prof. Doutor José Luis Guimarães de Oliveira Professor Associado do Departamento de Electrónica, Telecomunicações e Informática da Universidade de Aveiro agradecimentos Durante o desenvolvimento desta dissertação, recebi muito apoio de colegas e amigos. Agora que termino o trabalho não posso perder a oportunidade de agradecer a todas as pessoas que me ajudaram nesta etapa. Um agradecimento ao meu orientador Professor Doutor José Luís Oliveira e ao Doutor Miguel Monsanto Pinheiro, pela oportunidade de aprendizagem. À minha família pelo apoio incondicional, incentivo e carinho. Aos meus colegas e amigos por toda a ajuda e pelos momentos de convívio e de descontracção, que quebraram tantas dificuldades, ao longo desta etapa. A ti, Rita por todo o carinho, paciência e amor. palavras-chave Bioinformática, sequenciação, BLAST, alinhamento de sequências, genómica comparativa. resumo Com o surgimento da Genómica e da Proteómica, a Bioinformática conduziu a alguns dos avanços científicos mais relevantes do século XX.
    [Show full text]
  • Perl for Bioinformatics Perl and Bioperl I
    Perl for Bioinformatics Perl and BioPerl I Jason Stajich July 13, 2011 Perl for Bioinformatics Slide 1/83 Outline Perl Intro Basics Syntax and Variables More complex: References Routines Reading and Writing Regular Expressions BioPerl Intro Useful modules Data formats Databases in BioPerl Sequence objects details Trees Multiple Alignments BLAST and Sequence Database searching Other general Perl modules Perl for Bioinformatics Perl Intro Slide 2/83 Outline Perl Intro Basics Syntax and Variables More complex: References Routines Reading and Writing Regular Expressions BioPerl Intro Useful modules Data formats Databases in BioPerl Sequence objects details Trees Multiple Alignments BLAST and Sequence Database searching Other general Perl modules Perl for Bioinformatics Perl Intro Basics Slide 3/83 Why Perl for data processing & bioinformatics Fast text processing Regular expressions Extensive module libraries for pre-written tools Large number of users in community of bioinformatics Scripts are often faster to write than full compiled programs Cons Syntax sometimes confusing to new users; 'There's more than one way to do it' can also be confusing. (TMTOWTDI) Cons Not a true object-oriented language so some abstraction is clunky and hacky Scripting languages (Perl, Python, Ruby) generally easier to write simply than compiled ones (C, C++, Java) as they are often not strongly typed and less memory management control. Perl for Bioinformatics Perl Intro Basics Slide 4/83 Perl packages CPAN - Comprehensive Perl Archive http://www.cpan.org Perl
    [Show full text]
  • Perl on Windows
    BrokenBroken GlassGlass Perl on Windows Chris 'BinGOs' Williams “This is your last chance. After this, there is no turning back. You take the blue pill - the story ends, you wake up in your bed and believe whatever you want to believe. You take the red pill - you stay in Wonderland and I show you how deep the rabbit-hole goes.” A bit of history ● 5.003_24 - first Windows port ● 5.004 - first Win32 and Cygwin support, [MSVC++ and Borland C++] ● 5.005 - experimental threads, support for GCC and EGCS ● 5.6.0 - experimental fork() support ● 5.8.0 - proper ithreads, fork() support, 64bit Windows [Intel IA64] ● 5.8.1 - threads support for Cygwin ● 5.12.0 - AMD64 with Mingw gcc ● 5.16.0 - buh-bye Borland C++ Time for some real archaeology Windows NT 4.0 Resource Kit CDROM ActivePerl http://www.activestate.com/perl ● July 1998 - ActivePerl 5.005 Build 469 ● March 2000 - ActivePerl 5.6.0 Build 613 ● November 2002 - ActivePerl 5.8.0 Build 804 ● November 2005 - ActivePerl 5.8.7 Build 815 [Mingw compilation support] ● August 2006 - ActivePerl 5.8.8 Build 817 [64bit] ● June 2012 - ActivePerl 5.16.0 Build 1600 ● Built with MSVC++ ● Can install or use MinGW ● PPM respositories of popular modules ● Commercial support ● PerlScript – Active Scripting engine ● Perl ISAPI Strawberry Perl http://strawberryperl.com ● July 2006 - Strawberry Perl 5.8.8 Alpha 1 released ● April 2008 - Strawberry Perl 5.10.0.1 and 5.8.8.1 released ● January 2009 - first portable release ● April 2010 - 64bit and 32bit releases ● May 2012 - Strawberry Perl 5.16.0.1 released ● August
    [Show full text]
  • Vandalforge Printer Software Team Vulcan – Full Manual
    5/4/2018 VandalForge Printer Software Team Vulcan – Full Manual Jonathan Buch, Tim Clemans, Michael Madsen, James Young UNIVERSITY OF IDAHO Page | 1 Table of Contents Executive Summary ....................................................................................................................................................4 Background .................................................................................................................................................................5 Problem Definition .................................................................................................................................................5 Project Plan .................................................................................................................................................................6 Objectives ...............................................................................................................................................................6 Requirements .........................................................................................................................................................6 Specifications ..........................................................................................................................................................6 Concepts Considered ..................................................................................................................................................7 Cura Ultimaker (Slic3r Alternative)
    [Show full text]
  • Pipenightdreams Osgcal-Doc Mumudvb Mpg123-Alsa Tbb
    pipenightdreams osgcal-doc mumudvb mpg123-alsa tbb-examples libgammu4-dbg gcc-4.1-doc snort-rules-default davical cutmp3 libevolution5.0-cil aspell-am python-gobject-doc openoffice.org-l10n-mn libc6-xen xserver-xorg trophy-data t38modem pioneers-console libnb-platform10-java libgtkglext1-ruby libboost-wave1.39-dev drgenius bfbtester libchromexvmcpro1 isdnutils-xtools ubuntuone-client openoffice.org2-math openoffice.org-l10n-lt lsb-cxx-ia32 kdeartwork-emoticons-kde4 wmpuzzle trafshow python-plplot lx-gdb link-monitor-applet libscm-dev liblog-agent-logger-perl libccrtp-doc libclass-throwable-perl kde-i18n-csb jack-jconv hamradio-menus coinor-libvol-doc msx-emulator bitbake nabi language-pack-gnome-zh libpaperg popularity-contest xracer-tools xfont-nexus opendrim-lmp-baseserver libvorbisfile-ruby liblinebreak-doc libgfcui-2.0-0c2a-dbg libblacs-mpi-dev dict-freedict-spa-eng blender-ogrexml aspell-da x11-apps openoffice.org-l10n-lv openoffice.org-l10n-nl pnmtopng libodbcinstq1 libhsqldb-java-doc libmono-addins-gui0.2-cil sg3-utils linux-backports-modules-alsa-2.6.31-19-generic yorick-yeti-gsl python-pymssql plasma-widget-cpuload mcpp gpsim-lcd cl-csv libhtml-clean-perl asterisk-dbg apt-dater-dbg libgnome-mag1-dev language-pack-gnome-yo python-crypto svn-autoreleasedeb sugar-terminal-activity mii-diag maria-doc libplexus-component-api-java-doc libhugs-hgl-bundled libchipcard-libgwenhywfar47-plugins libghc6-random-dev freefem3d ezmlm cakephp-scripts aspell-ar ara-byte not+sparc openoffice.org-l10n-nn linux-backports-modules-karmic-generic-pae
    [Show full text]
  • Web & Grid Technologies in Bioinformatics, Computational And
    Current Bioinformatics, 2008, 3, 000-000 1 Web & Grid Technologies in Bioinformatics, Computational and Systems Biology: A Review Azhar A. Shah1, Daniel Barthel1, Piotr Lukasiak2,3, Jacek Blazewicz2,3 and Natalio Krasnogor*,1 1School of Computer Science, University of Nottingham, Jubilee Campus, NG81BB, Nottingham, UK 2Institute of Computing Science, Poznan University of Technology, Piotrowo 2, 60-965 Poznan, Poland 3Institute of Bioorganic Chemistry, Laboratory of Bioinformatics, Polish Academy of Sciences, Noskowskiego 12/14, 61- 704 Poznan, Poland Abstract: The acquisition of biological data, ranging from molecular characterization and simulations (e.g. protein fold- ing dynamics), to systems biology endeavors (e.g. whole organ simulations) all the way up to ecological observations (e.g. as to ascertain climate change’s impact on the biota) is growing at unprecedented speed. The use of computational and networking resources is thus unavoidable. As the datasets become bigger and the acquisition technology more refined, the biologist is empowered to ask deeper and more complex questions. These, in turn, drive a runoff effect where large re- search consortia emerge that span beyond organizations and national boundaries. Thus the need for reliable, robust, certi- fied, curated, accessible, secure and timely data processing and management becomes entrenched within, and crucial to, 21st century biology. Furthermore, the proliferation of biotechnologies and advances in biological sciences has produced a strong drive for new informatics solutions, both at the basic science and technological levels. The previously unknown situation of dealing with, on one hand, (potentially) exabytes of data, much of which is noisy, has large experimental er- rors or theoretical uncertainties associated with it, or on the other hand, large quantities of data that require automated computationally intense analysis and processing, have produced important innovations in web and grid technology.
    [Show full text]
  • BINF 634 Bioinformatics Programming
    UNIVERSITA’ DEGLI Teacher: Matteo Re STUDI DI MILANO Metodi e linguaggi per il trattamento dei dati PERL scripting S introduction • PERL programming • Problem solving and Debugging • To read and write documentation • Data manipulation: filtering and transformation • Pattern matching and data mining (examples) • Example application: Computational Biology • Analysis and manipulation of biological sequences • Interaction with biological batabases (NCBI, EnsEMBL, UCSC) • BioPERL Objectives Guidelines • Operating system • During class appointments we will use windows • PERL installation WIN: http://www.activestate.com/activeperl/downloads UNIX, MacOS: available by default • Text editor PERL are saved as text files. Many options available… Vim (UNIX like OS) Notepad (Windows) Sequence file – FASTA format >gi|40457238|HIV-1 isolate 97KE128 from Kenya gag gene, partial cds CTTTTGAATGCATGGGTAAAAGTAATAGAAGAAAGAGGTTTCAGTCCAGAAGTAATACCCATGTTCTCAG CATTATCAGAAGGAGCCACCCCACAAGATTTAAATACGATGCTGAACATAGTGGGGGGACACCAGGCAGC TATGCAAATGCTAAAGGATACCATCAATGAGGAAGCTGCAGAATGGGACAGGTTACATCCAGTACATGCA GGGCCTATTCCGCCAGGCCAGATGAGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCCTC AAGAACAAGTAGGATGGATGACAAACAATCCACCTATCCCAGTGGGAGACATCTATAAAAGATGGATCAT CCTGGGCTTAAATAAAATAGTAAGAATGTATAGCCCTGTTAGCATTTTGGACATAAAACAAGGGCCAAAA GAACCCTTTAGAGACTATGTAGATAGGTTCTTTAAAACTCTCAGAGCCGAACAAGCTT >gi|40457236| HIV-1 isolate 97KE127 from Kenya gag gene, partial cds TTGAATGCATGGGTGAAAGTAATAGAAGAAAAGGCTTTCAGCCCAGAAGTAATACCCATGTTCTCAGCAT TATCAGAAGGAGCCACCCCACAAGATTTAAATATGATGCTGAATATAGTGGGGGGACACCAGGCAGCTAT
    [Show full text]
  • Download G++ Windows 10 MSYS2
    download g++ windows 10 MSYS2. Software Distribution and Building Platform for Windows. MSYS2 is a collection of tools and libraries providing you with an easy-to-use environment for building, installing and running native Windows software. It consists of a command line terminal called mintty, bash, version control systems like git and subversion, tools like tar and awk and even build systems like autotools, all based on a modified version of Cygwin. Despite some of these central parts being based on Cygwin, the main focus of MSYS2 is to provide a build environment for native Windows software and the Cygwin-using parts are kept at a minimum. MSYS2 provides up- to-date native builds for GCC, mingw-w64, CPython, CMake, Meson, OpenSSL, FFmpeg, Rust, Ruby, just to name a few. To provide easy installation of packages and a way to keep them updated it features a package management system called Pacman, which should be familiar to Arch Linux users. It brings many powerful features such as dependency resolution and simple complete system upgrades, as well as straight-forward and reproducible package building. Our package repository contains more than 2000 pre-built packages ready to install. For more details see 'What is MSYS2?' which also compares MSYS2 to other software distributions and development environments like Cygwin, WSL, Chocolatey, Scoop, . and 'Who Is Using MSYS2?' to see which projects are using MSYS2 and what for. Installation. Verify with SHA256 checksum 7e055b71306e64192e2612f959f54ae99a5cf57186206ac702d113ef00ba35c0 or GPG signature by 0xf7a49b0ec. Run the installer. MSYS2 requires 64 bit Windows 7 or newer. Enter your desired Installation Folder (short ASCII-only path on a NTFS volume, no accents, no spaces, no symlinks, no subst or network drives, no FAT).
    [Show full text]
  • EPICS How-Tos
    EPICS How-Tos Sep 10, 2021 Contents 1 Installation on Linux/UNIX/DARWIN (Mac)1 1.1 What is EPICS about?..........................................1 1.2 Prepare your system...........................................1 1.3 Install EPICS...............................................1 1.4 Test EPICS................................................2 1.5 Create a demo/test ioc to test ca and pva.................................3 1.6 Add the asyn package..........................................4 1.7 Install StreamDevice (by Dirk Zimoch, PSI)..............................5 2 Packages required for EPICS on Centos 87 2.1 Overview.................................................7 2.2 Packages required to build EPICS base.................................8 2.3 Packages required by the sequencer...................................8 2.4 Packages required by epics-modules/asyn................................8 2.5 Packages required by the Canberra and Amptek support in epics-modules/mca............8 2.6 Packages required by the Linux drivers in epics-modules/measComp.................8 2.7 Packages required by areaDetector/ADSupport/GraphicsMagick....................8 2.8 Packages required by areaDetector/ADEiger..............................9 2.9 Packages required to build aravis 7.0.2 for areaDetector/ADAravis...................9 2.10 Packages required to build areaDetector/ADVimba...........................9 2.11 Packages required to build EDM.....................................9 2.12 Packages required to build MEDM...................................9
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 8,407,013 B2 Rogan (45) Date of Patent: Mar
    USOO8407013B2 (12) United States Patent (10) Patent No.: US 8,407,013 B2 Rogan (45) Date of Patent: Mar. 26, 2013 (54) AB INITIOGENERATION OF SINGLE COPY Claverie, J-M.. “Computational Methods of the Identification of GENOMIC PROBES Genes in Vertebrate Genomic Sequences.” Hum Molec Genet, 1997. 6.10:1735-1744. Craig, J.M., et al., “Removal of Repetitive Sequences from FISH (76) Inventor: Peter K. Rogan, London (CA) Probes Using PCR-Assisted Affinity Chromatography.” Hum Genet, 1997, 100/3-4:472-476. (*) Notice: Subject to any disclaimer, the term of this Delcher, A.L., et al., “Alignment of Whole Genomes.” Nucl Acids patent is extended or adjusted under 35 Res, 1999, 27/11:2369-2376. U.S.C. 154(b) by 0 days. Devereux, J., et al., A Comprehensive Set of Sequence Analysis Programs for the VAX, NuclAcids Res, 1984, 12/1:387-395. Dover, G., et al., “Molecular Drive.” Trends in Genetics, 2002, (21) Appl. No.: 13/469,531 18.11:587-589. Edgar, R.C., et al., “PILER: Identification and Classification of (22) Filed: May 11, 2012 Genomic Repeats.” Bioinformatics, 2005, 21(S1):i152-i158. Eisenbarth, I., et al., "Long-Range Sequence Composition Mirrors (65) Prior Publication Data Linkage Disequilibrium Pattern in a 1.13 Mb Region of Human Chromosome 22, Human Molec Genet, 2001, 10/24:2833-2839. US 2012/O253689 A1 Oct. 4, 2012 Faranda, S., et al., “The Human Genes Encoding Renin-Binding Related U.S. Application Data Protein and Host Cell Factor are Closely Linked in Xq28 and Tran scribed in the Same Direction.
    [Show full text]