DOCSLIB.ORG

Identification of Lymphocystis Disease Virus from Paradise Fish

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification of Lymphocystis Disease Virus from Paradise Fish Arch Virol (2014) 159:2445–2449 DOI 10.1007/s00705-014-2060-0 BRIEF REPORT Identification of lymphocystis disease virus from paradise fish Macropodus opercularis (LCDV-PF) Liwen Xu • Juan Feng • Youhua Huang Received: 26 December 2013 / Accepted: 17 March 2014 / Published online: 6 April 2014 Ó Springer-Verlag Wien 2014 Abstract Iridoviruses are large DNA viruses that are reptiles, crustaceans and mollusks. The family Iridoviridae subdivided into five genera: Ranavirus, Megalocytivirus, is currently divided into five genera: Ranavirus, Lympho- Lymphocystivirus, Chloriridovirus and Iridovirus. The iri- cystivirus, Megalocytivirus, Iridovirus and Chloriridovirus dovirus lymphocystis disease virus (LCDV) is an important [7, 16]. Lymphocystis disease virus (LCDV), which fish pathogen that can infect marine and freshwater fish belongs to the genus Lymphocystivirus, is the etiological worldwide. In this study, we have identified the pathogen agent of lymphocystis disease, which is characterized by in paradise fish (Macropodus opercularis) with lympho- the appearance of pearl-like nodules, formed by hypertro- cystis. On the skin and fins of diseased paradise fish, a large phic fibroblastic cells, located on skin and fins of fish number of nodules were observed. H&E staining showed [6, 10, 13]. Lymphocystis disease has been reported in that the nodules were composed of encapsulated hyper- over 125 different fish species from 34 different families trophied cells. Using electron microscopy, numerous virus [11–13]. Although many attempts have been made to particles with a diameter of [210 nm and with hexagonal propagate LCDV in vitro, the complete replication cycle profiles were observed in the cytoplasm. Phylogenetic and pathogenesis process of this virus are not well under- analysis based on the major capsid protein (MCP), DNA stood. To explore the molecular mechanism of LCDV polymerase and myristylated membrane protein (MMP) pathogenesis, the complete genome sequence of two LCDV genes revealed that LCDV from paradise fish (LCDV-PF) isolates, including LCDV-C from Japanese flounder was closely related to lymphocystis disease virus from (Paralichthys olivaceus) in China and LCDV-1 from China (LCDV-C), followed by lymphocystis disease virus flounder (Platichtys flesus L.) in Europe, have been deter- 1 (LCDV-1). Taken together, our data provide the first mined [14, 17]. Comparative genome analysis indicated molecular evidence that, in addition to megalocytivirus, that LCDV-C shared low similarity to LCDV-1, based on LCDV is an important iridoviral pathogen in paradise fish genome size, gene organization and gene product identity besides megalocytivirus. [17]. Notably, when compared to members of other genera in family Iridoviridae, the MCP sequences of different LCDV isolates exhibited a low degree of identity [2]. Fur- Iridoviruses are large DNA viruses that infect invertebrates ther studies focusing on identification and genome and lower vertebrates, such as insects, fish, amphibians, sequencing of different LCDV isolates will contribute to understanding of genetic variations and evolution of LCDV. Paradise fish (Macropodus opercularis) are not only L. Xu Á J. Feng important tropical ornamental fish but are also an ideal South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou 510300, Guangdong, China experimental system for behavioral genetic studies [3, 8]. To our knowledge, only megalocytivirus has been detected Y. Huang (&) and identified as a viral agent in paradise fish [8]. Although Key Laboratory of Tropical Marine Bio-resources and Ecology, lymphocystis in paradise fish has been described by Ash- South China Sea Institute of Oceanology, Chinese Academy of Sciences, 164 West Xingang Road, Guangzhou 510301, China burner [1], no molecular data or morphological features of e-mail: [email protected] the pathogen were presented. 123 2446 L. Xu et al. Here, we have investigated a lymphocystis outbreak in processed for routine paraffin sectioning, and stained with cultured paradise fish at a local farm in Guangdong Prov- H&E for histopathological observation as described pre- ince, China, in which about 20 % of the fish displayed viously [13]. We observed that many inclusion bodies were symptoms of lymphocystis, including a decrease in strongly stained by hematoxylin and were observed mobility and loss of appetite. Moreover, wart-like nodules peripherally near the membrane (Fig. 1D). Similar symp- were diffusely distributed over the whole body but pre- toms were observed previously in LCDV infected white- dominantly located on the caudal and pectoral fins and spotted puffer [13]. opercular region (Fig. 1A and B). Further observation To determine whether the wart-like lesions contained under light microscopy showed that the nodules were virus particles, the nodules were fixed with 2.5 % glutar- composed of growing clusters of lymphocystic cells. The aldehyde overnight and prepared for electron microscopy fibroblasts exhibited cytomegalia with spheroidal shapes observation as described previously [5]. As shown in surrounded by an unusually thick outer membrane, forming Fig. 2, numerous virus particles with a diameter of [200 a hyaline capsule (Fig. 1C). The nodules were fixed, nm in and with hexagonal profiles were observed, Fig. 1 Characterization of lymphocystis disease in A B paradise fish. Typical symptoms on the fin (A) and snout (B)of diseased paradise fish are shown. Nodules are indicated by arrows. (C) Many lymphocystis cells are seen on the cephalic skin of diseased paradise fish by light microscopy. (D) Histological sections of the nodules on the skin C D Fig. 2 Ultrastructure of viral particles from nodules A B 2 µm 200 nm 123 Lymphocystis disease virus from paradise fish 2447 A LCDV-1 100 LCDV from yellow perch 60 LCDV from rockfish 95 LCDV from pearl gourami 65 LCDV-C LCDV from gilthead seabream 89 92 LCDV from painted glassfish 52 LCDV-PF STIV 67 RGV 80 FV3 94 BIV 100 TFV CMTV ATV 48 100 88 EHNV 59 ECV SGIV 80 100 GIV 56 TRBIV ISKNV 100 RBIV GSDIV 57 OSGIV 67 RSIV IIV-3 100 IIV-6 0.05 STIV 65 STIV 94 B RGV C 94 RGV 28 FV3 42 FV3 28 99 CMTV CMTV TFV 81 99 TFV 100 EHNV EHNV 99 ATV 100 ATV SGIV SGIV 99 GIV 100 GIV 99 LCDV-PF 100 LCDV-PF 99 LCDV-C 100 LCDV-C LCDV-1 LCDV-1 55 TRBIV 66 TRBIV ISKNV 99 ISKNV RSIV 100 47 RSIV 53 65 RBIV 58 RBIV 99 OSGIV 100 OSGIV IIV-3 IIV-3 99 IIV-6 100 IIV-6 0.1 0.1 Fig. 3 Phylogenetic analysis of three core genes from different iridovirus isolates. Phylogenetic trees of LCDV-PF and other iridovirus isolates were constructed based on the MCP (A), DNA polymerase (B) and MMP genes (C). The bootstrap confidence values are shown at the nodes of the tree 123 2448 L. Xu et al. indicating that the white nodules in paradise fish were among LCDV isolates is more closely associated with the lymphocystis lesions. host species than with geographic distribution. Interest- Given that the major capsid protein (MCP) of iridovi- ingly, although LCDV-C and LCDV-1 were both isolated ruses is a suitable target gene for the study of iridovirus from flounder, LCDV-C showed a closer relationship to evolution and their classification [4, 15], we designed LCDV-PF than LCDV-1 based on the phylogenetic tree. primers based on the MCP gene sequences of LCDV-1 and Therefore, the question whether genetic relation- LCDV-C as well as two other iridovirus core genes, DNA ships between LCDV isolates are influenced more by polymerase (DNA Pol) and myristylated membrane protein geographic location or virus/host specificity needs further (MMP). Three pairs of primers were used in this study, investigation. including MCP-F/R (MCP-F, ATGACTTCTGTAGCGGG In summary, we describe for the first time the ultra- TTCAAGTG; MCP-R, CTAAAGTACAG GAAATCCCA structure and genome sequence of an LCDV isolate from a TTGAAC), DNA Pol-F/R (Pol-F, ATGATAGTTTTTATT paradise fish. Phylogenetic analysis based on three core TTTCAAT GG; Pol-R, AGCTGATATTTTACATGCTA genes indicates that LCDV-PF is a novel isolate that, like ATTG), and MMP-F/R (MMP-F, CACAAGTAGCAGAT megalocytivirus, can cause disease in paradise fish. To ATTAACAACA; MMP-R, TCTTGAGCACAATCTTG better understand the differences between LCDV-PF and AAATA). After extraction of genomic DNA from the other LCDV isolates, more sequences of complete gen- nodules of five fish, PCR amplification was carried out omes of LCDV-PF isolates are needed. using LA TaqÒ (TaKaRa) according to the manufacturer’s instructions, with the following cycling conditions: 95 °C Acknowledgments We thank Fanmei Zeng from the Administra- for 3 min, followed by 35 cycles of 45 s at 95 °C, 45 s at tion of Ocean and Fisheries of Guangdong Province for the sample collection. This work was supported by grants from the National 48 °C, and 2 min at 72 °C. The PCR products were sub- Basic Research Program of China (973) (2012CB114402) and Special cloned into the pMD18-T vector for sequencing, and the Scientific Research Funds for Central Non-Profit Institutes, Chinese data that were obtained were assembled and submitted to Academy of Fishery Sciences (2012A0503; 2013A0604). the GenBank database (accession numbers of MCP, DNA Pol and MMP: KJ408271, KJ408272 and KJ408273, respectively). A homology search revealed that the LCDV- References PF MCP shared 90 % sequence identity with LCDV from painted glassfish, followed by LCDV from gilthead sea 1. Ashburner LD (1975) Letter: Lymphocystis in paradise fish bream (89 %), LCDV-C (86 %) and LCDV-1 (84 %). In (Macropodus opercularis) in Australia. Aust Vet J 51:448–449 addition, DNA polymerase and MMP of LCDV-PF shared 2. Cano I, Ferro P, Alonso MC, Bergmann SM, Ro¨mer-Oberdo¨rfer A, Garcia-Rosado E, Castro D, Borrego JJ (2007) Development 84 % and 86 % identity, respectively, with that of LCDV- of molecular techniques for detection of lymphocystis disease C. The MCP sequences of different LCDV isolates virus in different marine fish species.
Load more

Recommended publications
  • Artemia Spp., a Susceptible Host and Vector for Lymphocystis Disease Virus
    viruses Article Artemia spp., a Susceptible Host and Vector for Lymphocystis Disease Virus Estefania J. Valverde, Alejandro M. Labella, Juan J. Borrego and Dolores Castro * Departamento de Microbiología, Facultad de Ciencias, Universidad de Málaga, 29017 Málaga, Spain; [email protected] (E.J.V.); [email protected] (A.M.L.); [email protected] (J.J.B.) * Correspondence: [email protected]; Tel.: +34-952134214 Received: 8 May 2019; Accepted: 30 May 2019; Published: 1 June 2019 Abstract: Different developmental stages of Artemia spp. (metanauplii, juveniles and adults) were bath-challenged with two isolates of the Lymphocystis disease virus (LCDV), namely, LCDV SA25 (belonging to the species Lymphocystis disease virus 3) and ATCC VR-342 (an unclassified member of the genus Lymphocystivirus). Viral quantification and gene expression were analyzed by qPCR at different times post-inoculation (pi). In addition, infectious titres were determined at 8 dpi by integrated cell culture (ICC)-RT-PCR, an assay that detects viral mRNA in inoculated cell cultures. In LCDV-challenged Artemia, the viral load increased by 2–3 orders of magnitude (depending on developmental stage and viral isolate) during the first 8–12 dpi, with viral titres up to 2.3 102 × Most Probable Number of Infectious Units (MPNIU)/mg. Viral transcripts were detected in the infected Artemia, relative expression values showed a similar temporal evolution in the different experimental groups. Moreover, gilthead seabream (Sparus aurata) fingerlings were challenged by feeding on LCDV-infected metanauplii. Although no Lymphocystis symptoms were observed in the fish, the number of viral DNA copies was significantly higher at the end of the experimental trial and major capsid protein (mcp) gene expression was consistently detected.
    [Show full text]
  • Megalocytivirus Induces Complicated Fish Immune Response at Multiple RNA Levels Involving Mrna, Mirna, and Circrna
    International Journal of Molecular Sciences Article Megalocytivirus Induces Complicated Fish Immune Response at Multiple RNA Levels Involving mRNA, miRNA, and circRNA Qian Wu 1,2,3, Xianhui Ning 1 and Li Sun 1,2,3,* 1 CAS and Shandong Province Key Laboratory of Experimental Marine Biology, CAS Center for Ocean Mega-Science, Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, China; [email protected] (Q.W.); [email protected] (X.N.) 2 Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, 1 Wenhai Road, Qingdao 266237, China 3 College of Earth and Planetary Sciences, University of Chinese Academy of Sciences, 19 Yuquan Road, Beijing 100049, China * Correspondence: [email protected]; Tel.: +86-532-82898829 Abstract: Megalocytivirus is an important viral pathogen to many farmed fishes, including Japanese flounder (Paralichthys olivaceus). In this study, we examined megalocytivirus-induced RNA responses in the spleen of flounder by high-throughput sequencing and integrative analysis of various RNA- seq data. A total of 1327 microRNAs (miRNAs), including 368 novel miRNAs, were identified, among which, 171 (named DEmiRs) exhibited significantly differential expressions during viral infection in a time-dependent manner. For these DEmiRs, 805 differentially expressed target mRNAs (DETmRs) were predicted, whose expressions not only significantly changed after megalocytivirus infection but were also negatively correlated with their paired DEmiRs. Integrative analysis of Citation: Wu, Q.; Ning, X.; Sun, L. Megalocytivirus Induces immune-related DETmRs and their target DEmiRs identified 12 hub DEmiRs, which, together with Complicated Fish Immune Response their corresponding DETmRs, formed an interaction network containing 84 pairs of DEmiR and at Multiple RNA Levels Involving DETmR.
    [Show full text]
  • Genome Analysis of Ranavirus Frog Virus 3Isolated from American Bullfrog
    www.nature.com/scientificreports OPEN Genome analysis of Ranavirus frog virus 3 isolated from American Bullfrog (Lithobates catesbeianus) in South America Marcelo Candido 1*, Loiane Sampaio Tavares1, Anna Luiza Farias Alencar2, Cláudia Maris Ferreira3, Sabrina Ribeiro de Almeida Queiroz1, Andrezza Maria Fernandes1 & Ricardo Luiz Moro de Sousa1 Ranaviruses (family Iridoviridae) cause important diseases in cold-blooded vertebrates. In addition, some occurrences indicate that, in this genus, the same virus can infect animals from diferent taxonomic groups. A strain isolated from a Ranavirus outbreak (2012) in the state of Sao Paulo, Brazil, had its genome sequenced and presented 99.26% and 36.85% identity with samples of Frog virus 3 (FV3) and Singapore grouper iridovirus (SGIV) ranaviruses, respectively. Eight potential recombination events among the analyzed sample and reference FV3 samples were identifed, including a recombination with Bohle iridovirus (BIV) sample from Oceania. The analyzed sample presented several rearrangements compared to FV3 reference samples from North America and European continent. We report for the frst time the complete genome of Ranavirus FV3 isolated from South America, these results contribute to a greater knowledge related to evolutionary events of potentially lethal infectious agent for cold-blooded animals. Among the major viral pathogens, worldwide distributed and recent history, Ranavirus (Rv) is highlighted, on which, studies in South America remain limited. Rv are part of the family Iridoviridae that is divided into fve genera, of which three are considered more relevant by infectious severity in aquatic and semi-aquatic animals: Lymphocystivirus, Megalocytivirus and Rv. Tey are enveloped and unenveloped viruses, showing double-stranded DNA whose genome ranges from 103 to 220 kbp.
    [Show full text]
  • The Lymphocystis Diseases in the Olive Flounder, Paralichthys Olivaceus
    Univ. j. zool. Rajshahi Univ. Vol. 26, 2007. pp. 59-62 ISSN 1023-6104 http://journals.sfu.ca/bd/index.php/UJZRU © Rajshahi University Zoological Society The lymphocystis diseases in the Olive flounder, Paralichthys olivaceus Mosharrof Hossain, Seok Ryel Kim and Myung Joo Oh* Division of Food Science and Aqualife Medicine, Chonnam National University Yeosu-550-749, Korea. Abstract: Lymphocystis disease virus (LCDV) is the causative agent of lymphocystis disease, affecting more than 100 teleost species worldwide. Characteristically, LCD is chronic, self limiting and species specific. The greatly hypertrophied cells, called lymphocystis tumor cells, typically occur on the skin, fins and oral region. Lymphocystis cells were ovoid to circular and varied in sizes ranging from 200-250 mm. The lymphocystis disease infected flounder have unsightly appearances that discourage the commercial values. A PCR detection technique was developed to amplify a fragment of LCDV major capsid protein gene (1347bp) which is shortcoming and useful. The PCR result proved that the LCD-virus replicated in the epidermis (fins and skin) not in the spleen, kidney, intestine or brain of Paralichthys olivaceus. Keyword: Lymphocystis disease, LCDV, PCR, Paralichthys olivaceus Introduction diseases have been isolated from more than 100 teleost Lymphocystis disease (LCD) is a chronic, self-limiting, species (Anders, 1989), however the infections and viral disease affecting many species of teleosts virus replication is unknown. LCDV has been studied worldwide. Freshwater, estuarine, and marine fish in for the different isolation and characterization warm-water, and cold-water environments are techniques (Iwamoto et al., 2002; Alonso et al., 2005; susceptible to this disease. In general, lymphocystis is a Cano et al., 2006) that helping shortcoming detection disease of more evolutionarily advanced species of of the disease and to take initiatives to a disease free teleosts, like perches, seabreams and flounders.
    [Show full text]
  • The Megalocytivirus RBIV Induces Apoptosis and MHC Class I Presentation in Rock Bream (Oplegnathus Fasciatus) Red Blood Cells
    ORIGINAL RESEARCH published: 04 March 2019 doi: 10.3389/fimmu.2019.00160 The Megalocytivirus RBIV Induces Apoptosis and MHC Class I Presentation in Rock Bream (Oplegnathus fasciatus) Red Blood Cells Myung-Hwa Jung 1, Verónica Chico 2, Sergio Ciordia 3, Maria Carmen Mena 3, Sung-Ju Jung 1 and Maria Del Mar Ortega-Villaizan 2* 1 Department of Aqualife Medicine, Chonnam National University, Gwangju, South Korea, 2 IBMC-IDiBE, Universidad Miguel Hernandez, Elche, Spain, 3 Unidad de Proteómica, Centro Nacional de Biotecnología (CSIC), Madrid, Spain Rock bream iridovirus (RBIV) causes severe mass mortality in Korean rock bream (Oplegnathus fasciatus) populations. To date, immune defense mechanisms of rock bream against RBIV are unclear. While red blood cells (RBCs) are known to be involved in the immune response against viral infections, the participation of rock bream RBCs in the immune response against RBIV has not been studied yet. In this study, we examined induction of the immune response in rock bream RBCs Edited by: Brian Dixon, after RBIV infection. Each fish was injected with RBIV, and virus copy number in University of Waterloo, Canada RBCs gradually increased from 4 days post-infection (dpi), peaking at 10 dpi. A total Reviewed by: of 318 proteins were significantly regulated in RBCs from RBIV-infected individuals, Stephanie DeWitte-Orr, 183 proteins were upregulated and 135 proteins were downregulated. Differentially Wilfrid Laurier University, Canada Magdalena Chadzinska, upregulated proteins included those involved in cellular amino acid metabolic processes, Jagiellonian University, Poland cellular detoxification, snRNP assembly, and the spliceosome. Remarkably, the MHC *Correspondence: class I-related protein pathway was upregulated during RBIV infection.
    [Show full text]
  • First Report of Megalocytivirus (Iridoviridae) in Grouper Culture in Sabah, Malaysia
    Int.J.Curr.Microbiol.App.Sci (2014) 3(3): 896-909 ISSN: 2319-7706 Volume 3 Number 3 (2014) pp. 896-909 http://www.ijcmas.com Original Research Article First report of Megalocytivirus (Iridoviridae) in grouper culture in Sabah, Malaysia Asrazitah Abd Razak1, Julian Ransangan1* and Ahemad Sade2 1Microbiology and Fish Disease Laboratory, Borneo Marine Research Institute, Universiti Malaysia Sabah, Jalan UMS, 88400, Kota Kinabalu, Sabah, Malaysia 2Fisheries Department Sabah, Wisma Pertanian, Jalan Tasek, 88628 Kota Kinabalu, Sabah, Malaysia *Corresponding author A B S T R A C T Groupers are popular aquaculture species in Sabah, Malaysia. However, its aquaculture production is often limited by disease outbreaks. Although many diseases are known to affect groupers, iridovirus infection is a major concern because it causes high mortality within a short period of time. Recently, a disease resembled to iridovirus occurred and caused heavy losses to grouper aquaculture in K e y w o r d s Sabah. This has prompted us to conduct a study with the aim to determine if iridovirus present in the culture groupers. In this study, we examined 212 fish Grouper; specimens, which represented all the major culture grouper species in Malaysia. Megalo- The examination was carried out using single- and nested-PCR methods and cytivirus; followed by DNA sequencing. Two genes (major capsid protein and ATPase) were ISKNV; targeted for the PCR amplification and DNA sequencing. The finding showed nested-PCR; 15.6% (33/212) of the grouper specimens were severely infected by iridovirus. Sabah; Meanwhile, 17.4% of the specimens exhibited latent infection or asymptomatic Malaysia carriers.
    [Show full text]
  • Comparative Analysis of Transcriptional Regulation Patterns: Understanding the Gene Expression Profile in Nucleocytoviricota
    pathogens Review Comparative Analysis of Transcriptional Regulation Patterns: Understanding the Gene Expression Profile in Nucleocytoviricota Fernanda Gil de Souza †,Jônatas Santos Abrahão * and Rodrigo Araújo Lima Rodrigues *,† Laboratório de Vírus, Departamento de Microbiologia, Instituto de Ciências Biológicas, Universidade Federal de Minas Gerais, Belo Horizonte, Minas Gerais 31270-901, Brazil; [email protected] * Correspondence: [email protected] (J.S.A.); [email protected] (R.A.L.R.) † These authors contributed equally to this work. Abstract: The nucleocytoplasmic large DNA viruses (NCLDV) possess unique characteristics that have drawn the attention of the scientific community, and they are now classified in the phylum Nucleocytoviricota. They are characterized by sharing many genes and have their own transcriptional apparatus, which provides certain independence from their host’s machinery. Thus, the presence of a robust transcriptional apparatus has raised much discussion about the evolutionary aspects of these viruses and their genomes. Understanding the transcriptional process in NCLDV would provide information regarding their evolutionary history and a better comprehension of the biology of these viruses and their interaction with hosts. In this work, we reviewed NCLDV transcription and performed a comparative functional analysis of the groups of genes expressed at different times of infection of representatives of six different viral families of giant viruses. With this analysis, it was possible to observe
    [Show full text]
  • D:\Publikasi-Kumpulan Iaj-Pdf\I
    Distribution analysis of enlarged cells derived from ... (Indah Mastuti) DISTRIBUTION ANALYSIS OF ENLARGED CELLS DERIVED FROM GROUPER SLEEPY DISEASE IRIDOVIRUS (GSDIV) INFECTED HUMPBACK GROUPER Cromileptes altivelis Indah Mastuti# and Ketut Mahardika Research and Development Institute for Mariculture, Gondol, Bali (Received 5 December 2011 ; Accepted 12 April 2012) ABSTRACT Characteristic of Megalocytivirus infection has been known to produce formation of inclusion body bearing cells (IBCs) on internals organs of fish predominantly on spleen and kidney. Megalocytivirus that infected grouper is known as Grouper Sleepy Disease Iridovirus (GSDIV). This study was conducted to answer the effect of entry sites of GSDIV on distribution of enlarged cells formed on the internal organs of humpback grouper Cromileptes altivelis. Enlarged cells were observed histologically under the light microscope on spleen, head kidney, trunk kidney, liver, gill, heart, stomach, intestine, muscle and brain. Entry sites were designated to intramuscularly injection, intraperitoneally injection, dipped gill and inoculum added feed. Enlarged cells were formed on spleen, head kidney, trunk kidney, liver, gill, heart, stomach, muscle, except on intestine and brain. All the entry sites resulted in formation of enlarged cells on spleen, head kidney, trunk kidney, liver, heart. Spleen and head kidney were the most frequent observed organ. These results suggested that distribution of enlarged cells were not affected by the entry site of GSDIV. KEYWORDS: Megalocytivirus, enlarged cells, distribution, internal organs INTRODUCTION The ultrastructure study of enlarged cells on GSDIV infected fish revealed that IBCs con- Megalocytivirus which infect grouper is tained replication site of the virus (Mahardika known as Grouper Sleepy Disease Iridovirus et al., 2004; 2008; Sudthongkong et al., 2002).
    [Show full text]
  • Nota Técnica Tilapias
    Viral Diseases in Tilapias Dr. Marco Rozas-Serri DVM, MSc, PhD 2020 VIRAL DISEASES IN TILAPIAS The viral infections have the potential to cause relatively high mortalities of up to 90% in some affected populations. The actual impact and geographical distribution of the viruses are not known so there is a potential danger of the viruses being introduced to new countries or regions unintentionally through movement of sub-clinically infected fish that are destined for aquaculture farms lacking appropriate control measures (Table 1). The priority focus of the Brazilian tilapia industry As outlined by the OIE Guide for aquatic animal, surveillance may be should be on the active relatively simple in the form of passive surveillance or highly sophisticated in surveillance of two important the form of active surveillance that implements specific sampling strategies exotic viruses: Infectious and that may target specific disease agents. In all the viral diseases that spleen kidney necrosis virus affect tilapia, the correlation between virulence, genetic type, survival outside host as well as environmental factors, is an area of research requiring infection and Tilapia lake virus attention. Table 1. Summary of viral diseases affecting tilapines. Infectious spleen kidney necrosis virus - ISKNV The first DNA viruses discovered in tilapia were iridoviruses. Although the family Iridoviridae is composed of 5 genera, only members of the genera Megalocytivirus, Lymphocystivirus, and Ranavirus infect fish. The ISKNV is the only formally accepted into the Megalocytivirus genus. The ISKNV virus has been isolated from both marine and freshwater fish: rock bream iridovirus (RBIV), red seabream iridovirus (RSIV), orange spotted grouper iridovirus (OSGIV), turbot reddish body iridovirus (TRBIV), large yellow croaker iridovirus (LYCIV), giant seaperch The disease was described in tilapia after a US Midwestern iridovirus (GSIV-K1), scale drop disease virus aquaculture tilapia facility experienced heavy mortalities of 50– (SDDV).
    [Show full text]
  • Ultrastructural Morphogenesis of a Virus Associated with Lymphocystis-Like Lesions in Parore Girella Tricuspidata (Kyphosidae: Perciformes)
    Vol. 121: 129–139, 2016 DISEASES OF AQUATIC ORGANISMS Published September 26 doi: 10.3354/dao03050 Dis Aquat Org OPENPEN ACCESSCCESS Ultrastructural morphogenesis of a virus associated with lymphocystis-like lesions in parore Girella tricuspidata (Kyphosidae: Perciformes) P. M. Hine1,3,*, St. J. Wakefield2, G. Mackereth1, R. Morrison1 1National Centre for Disease Investigation, MAF Operations, Ministry of Agriculture and Forestry, PO Box 40-742, Upper Hutt, New Zealand 2School of Medicine, University of Otago, PO Box 7343, Newtown, Wellington, New Zealand 3Present address: 73, rue de la Fée au Bois, Fouras 17450, France ABSTRACT: The morphogenesis of large icosahedral viruses associated with lymphocystis-like lesions in the skin of parore Girella tricuspidata is described. The electron-lucent perinuclear viro- matrix comprised putative DNA with open capsids at the periphery, very large arrays of smooth endoplasmic reticulum (sER), much of it with a reticulated appearance (rsER) or occurring as rows of vesicles. Lysosomes, degenerating mitochondria and virions in various stages of assembly, and paracrystalline arrays were also present. Long electron-dense inclusions (EDIs) with 15 nm repeating units split terminally and curled to form tubular structures internalising the 15 nm repeating structures. These tubular structures appeared to form the virion capsids. Large parallel arrays of sER sometimes alternated with aligned arrays of crinkled cisternae along which passed a uniformly wide (20 nm) thread-like structure. Strings of small vesicles near open capsids may also have been involved in formation of an inner lipid layer. Granules with a fine fibrillar appear- ance also occurred in the viromatrix, and from the presence of a halo around mature virions it appeared that the fibrils may form a layer around the capsid.
    [Show full text]
  • Complete Genome Sequence Analysis of an Iridovirus Isolated from the Orange-Spotted Grouper, Epinephelus Coioides
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Virology 339 (2005) 81 – 100 www.elsevier.com/locate/yviro Complete genome sequence analysis of an iridovirus isolated from the orange-spotted grouper, Epinephelus coioides Ling Lu¨ a,1, Song Y. Zhoua,1, Cheng Chena, Shao P. Wenga,b, Siu-Ming Chanb, Jian G. Hea,* aState Key Laboratory for Biocontrol, School of Life Sciences, Zhongshan University, Guangzhou 510275, P. R. China bDepartment of Zoology, The University of Hong Kong, Hong Kong, P. R. China Received 25 February 2005; returned to author for revision 9 March 2005; accepted 11 May 2005 Available online 20 June 2005 Abstract Orange-spotted grouper iridovirus (OSGIV) was the causative agent of serious systemic diseases with high mortality in the cultured orange-spotted grouper, Epinephelus coioides. Here we report the complete genome sequence of OSGIV. The OSGIV genome consists of 112,636 bp with a G + C content of 54%. 121 putative open reading frames (ORF) were identified with coding capacities for polypeptides varying from 40 to 1168 amino acids. The majority of OSGIV shared homologies to other iridovirus genes. Phylogenetic analysis of the major capsid protein, ATPase, cytosine DNA methyl transferase and DNA polymerase indicated that OSGIV was closely related to infectious spleen and kidney necrosis virus (ISKNV) and rock bream iridovirus (RBIV), but differed from lymphocytisvirus and ranavirus. The determination of the genome of OSGIV will facilitate a better understanding of the molecular mechanism underlying the pathogenesis of the OSGIV and may provide useful information to develop diagnosis method and strategies to control outbreak of OSGIV.
    [Show full text]
  • Oplegnathus Fasciatus) Under Megalocytivirus Infection and T Vaccination
    Fish and Shellfish Immunology 87 (2019) 275–285 Contents lists available at ScienceDirect Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi Full length article Cloning and expressional analysis of secretory and membrane-bound IgM in rock bream (Oplegnathus fasciatus) under megalocytivirus infection and T vaccination ∗ Jinhwan Parka, Wooju Kwonb, Wi-Sik Kimc, Hyun-Do Jeongb, Suhee Honga, a Department of Wellness Bio-Industrial, Gangneung Wonju National University, South Korea b Department of Aquatic Life Medicine, Pukyung National University, South Korea c Department of Aquatic Life Medicine, Chonnam National University, South Korea ARTICLE INFO ABSTRACT Keywords: In this study, for better understanding the humoral immunity of rock bream (Oplegnathus fasciatus), 2 transcripts Oplegnathus fasciatus of immunoglobulin M (IgM) heavy chain gene including membrane bound (m-IgM) and secretory (s-IgM) forms Immunoglobulin M were sequenced and analyzed their tissue distribution and differential expression in rock bream under rock Membrane bound (m-IgM) and secretory (s- bream iridovirus (RBIV) infection and vaccination since RBIV has caused mass mortality in rock bream aqua- IgM) forms culture in Korea. Consequently, s-IgM cDNA was 1902 bp in length encoding a leader region, a variable region, Rock bream iridovirus four constant regions (CH1, CH2, CH3, CH4) and a C-terminal region while m-IgM cDNA was 1689 bp in length encoding shorter three constant regions (CH1, CH2, CH3) and two transmembrane regions. The predicted s-IgM and m-IgM represent a high structural similarity to other species including human. In tissue distribution analysis in healthy fish, the highest expression of s-IgM was observed in head kidney followed by body kidney, spleen, and mid gut whereas m-IgM expression was the highest in blood followed by head kidney and spleen.
    [Show full text]