Arch Virol (2014) 159:2445–2449 DOI 10.1007/s00705-014-2060-0 BRIEF REPORT Identification of lymphocystis disease virus from paradise fish Macropodus opercularis (LCDV-PF) Liwen Xu • Juan Feng • Youhua Huang Received: 26 December 2013 / Accepted: 17 March 2014 / Published online: 6 April 2014 Ó Springer-Verlag Wien 2014 Abstract Iridoviruses are large DNA viruses that are reptiles, crustaceans and mollusks. The family Iridoviridae subdivided into five genera: Ranavirus, Megalocytivirus, is currently divided into five genera: Ranavirus, Lympho- Lymphocystivirus, Chloriridovirus and Iridovirus. The iri- cystivirus, Megalocytivirus, Iridovirus and Chloriridovirus dovirus lymphocystis disease virus (LCDV) is an important [7, 16]. Lymphocystis disease virus (LCDV), which fish pathogen that can infect marine and freshwater fish belongs to the genus Lymphocystivirus, is the etiological worldwide. In this study, we have identified the pathogen agent of lymphocystis disease, which is characterized by in paradise fish (Macropodus opercularis) with lympho- the appearance of pearl-like nodules, formed by hypertro- cystis. On the skin and fins of diseased paradise fish, a large phic fibroblastic cells, located on skin and fins of fish number of nodules were observed. H&E staining showed [6, 10, 13]. Lymphocystis disease has been reported in that the nodules were composed of encapsulated hyper- over 125 different fish species from 34 different families trophied cells. Using electron microscopy, numerous virus [11–13]. Although many attempts have been made to particles with a diameter of [210 nm and with hexagonal propagate LCDV in vitro, the complete replication cycle profiles were observed in the cytoplasm. Phylogenetic and pathogenesis process of this virus are not well under- analysis based on the major capsid protein (MCP), DNA stood. To explore the molecular mechanism of LCDV polymerase and myristylated membrane protein (MMP) pathogenesis, the complete genome sequence of two LCDV genes revealed that LCDV from paradise fish (LCDV-PF) isolates, including LCDV-C from Japanese flounder was closely related to lymphocystis disease virus from (Paralichthys olivaceus) in China and LCDV-1 from China (LCDV-C), followed by lymphocystis disease virus flounder (Platichtys flesus L.) in Europe, have been deter- 1 (LCDV-1). Taken together, our data provide the first mined [14, 17]. Comparative genome analysis indicated molecular evidence that, in addition to megalocytivirus, that LCDV-C shared low similarity to LCDV-1, based on LCDV is an important iridoviral pathogen in paradise fish genome size, gene organization and gene product identity besides megalocytivirus. [17]. Notably, when compared to members of other genera in family Iridoviridae, the MCP sequences of different LCDV isolates exhibited a low degree of identity [2]. Fur- Iridoviruses are large DNA viruses that infect invertebrates ther studies focusing on identification and genome and lower vertebrates, such as insects, fish, amphibians, sequencing of different LCDV isolates will contribute to understanding of genetic variations and evolution of LCDV. Paradise fish (Macropodus opercularis) are not only L. Xu Á J. Feng important tropical ornamental fish but are also an ideal South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou 510300, Guangdong, China experimental system for behavioral genetic studies [3, 8]. To our knowledge, only megalocytivirus has been detected Y. Huang (&) and identified as a viral agent in paradise fish [8]. Although Key Laboratory of Tropical Marine Bio-resources and Ecology, lymphocystis in paradise fish has been described by Ash- South China Sea Institute of Oceanology, Chinese Academy of Sciences, 164 West Xingang Road, Guangzhou 510301, China burner [1], no molecular data or morphological features of e-mail: [email protected] the pathogen were presented. 123 2446 L. Xu et al. Here, we have investigated a lymphocystis outbreak in processed for routine paraffin sectioning, and stained with cultured paradise fish at a local farm in Guangdong Prov- H&E for histopathological observation as described pre- ince, China, in which about 20 % of the fish displayed viously [13]. We observed that many inclusion bodies were symptoms of lymphocystis, including a decrease in strongly stained by hematoxylin and were observed mobility and loss of appetite. Moreover, wart-like nodules peripherally near the membrane (Fig. 1D). Similar symp- were diffusely distributed over the whole body but pre- toms were observed previously in LCDV infected white- dominantly located on the caudal and pectoral fins and spotted puffer [13]. opercular region (Fig. 1A and B). Further observation To determine whether the wart-like lesions contained under light microscopy showed that the nodules were virus particles, the nodules were fixed with 2.5 % glutar- composed of growing clusters of lymphocystic cells. The aldehyde overnight and prepared for electron microscopy fibroblasts exhibited cytomegalia with spheroidal shapes observation as described previously [5]. As shown in surrounded by an unusually thick outer membrane, forming Fig. 2, numerous virus particles with a diameter of [200 a hyaline capsule (Fig. 1C). The nodules were fixed, nm in and with hexagonal profiles were observed, Fig. 1 Characterization of lymphocystis disease in A B paradise fish. Typical symptoms on the fin (A) and snout (B)of diseased paradise fish are shown. Nodules are indicated by arrows. (C) Many lymphocystis cells are seen on the cephalic skin of diseased paradise fish by light microscopy. (D) Histological sections of the nodules on the skin C D Fig. 2 Ultrastructure of viral particles from nodules A B 2 µm 200 nm 123 Lymphocystis disease virus from paradise fish 2447 A LCDV-1 100 LCDV from yellow perch 60 LCDV from rockfish 95 LCDV from pearl gourami 65 LCDV-C LCDV from gilthead seabream 89 92 LCDV from painted glassfish 52 LCDV-PF STIV 67 RGV 80 FV3 94 BIV 100 TFV CMTV ATV 48 100 88 EHNV 59 ECV SGIV 80 100 GIV 56 TRBIV ISKNV 100 RBIV GSDIV 57 OSGIV 67 RSIV IIV-3 100 IIV-6 0.05 STIV 65 STIV 94 B RGV C 94 RGV 28 FV3 42 FV3 28 99 CMTV CMTV TFV 81 99 TFV 100 EHNV EHNV 99 ATV 100 ATV SGIV SGIV 99 GIV 100 GIV 99 LCDV-PF 100 LCDV-PF 99 LCDV-C 100 LCDV-C LCDV-1 LCDV-1 55 TRBIV 66 TRBIV ISKNV 99 ISKNV RSIV 100 47 RSIV 53 65 RBIV 58 RBIV 99 OSGIV 100 OSGIV IIV-3 IIV-3 99 IIV-6 100 IIV-6 0.1 0.1 Fig. 3 Phylogenetic analysis of three core genes from different iridovirus isolates. Phylogenetic trees of LCDV-PF and other iridovirus isolates were constructed based on the MCP (A), DNA polymerase (B) and MMP genes (C). The bootstrap confidence values are shown at the nodes of the tree 123 2448 L. Xu et al. indicating that the white nodules in paradise fish were among LCDV isolates is more closely associated with the lymphocystis lesions. host species than with geographic distribution. Interest- Given that the major capsid protein (MCP) of iridovi- ingly, although LCDV-C and LCDV-1 were both isolated ruses is a suitable target gene for the study of iridovirus from flounder, LCDV-C showed a closer relationship to evolution and their classification [4, 15], we designed LCDV-PF than LCDV-1 based on the phylogenetic tree. primers based on the MCP gene sequences of LCDV-1 and Therefore, the question whether genetic relation- LCDV-C as well as two other iridovirus core genes, DNA ships between LCDV isolates are influenced more by polymerase (DNA Pol) and myristylated membrane protein geographic location or virus/host specificity needs further (MMP). Three pairs of primers were used in this study, investigation. including MCP-F/R (MCP-F, ATGACTTCTGTAGCGGG In summary, we describe for the first time the ultra- TTCAAGTG; MCP-R, CTAAAGTACAG GAAATCCCA structure and genome sequence of an LCDV isolate from a TTGAAC), DNA Pol-F/R (Pol-F, ATGATAGTTTTTATT paradise fish. Phylogenetic analysis based on three core TTTCAAT GG; Pol-R, AGCTGATATTTTACATGCTA genes indicates that LCDV-PF is a novel isolate that, like ATTG), and MMP-F/R (MMP-F, CACAAGTAGCAGAT megalocytivirus, can cause disease in paradise fish. To ATTAACAACA; MMP-R, TCTTGAGCACAATCTTG better understand the differences between LCDV-PF and AAATA). After extraction of genomic DNA from the other LCDV isolates, more sequences of complete gen- nodules of five fish, PCR amplification was carried out omes of LCDV-PF isolates are needed. using LA TaqÒ (TaKaRa) according to the manufacturer’s instructions, with the following cycling conditions: 95 °C Acknowledgments We thank Fanmei Zeng from the Administra- for 3 min, followed by 35 cycles of 45 s at 95 °C, 45 s at tion of Ocean and Fisheries of Guangdong Province for the sample collection. This work was supported by grants from the National 48 °C, and 2 min at 72 °C. The PCR products were sub- Basic Research Program of China (973) (2012CB114402) and Special cloned into the pMD18-T vector for sequencing, and the Scientific Research Funds for Central Non-Profit Institutes, Chinese data that were obtained were assembled and submitted to Academy of Fishery Sciences (2012A0503; 2013A0604). the GenBank database (accession numbers of MCP, DNA Pol and MMP: KJ408271, KJ408272 and KJ408273, respectively). A homology search revealed that the LCDV- References PF MCP shared 90 % sequence identity with LCDV from painted glassfish, followed by LCDV from gilthead sea 1. Ashburner LD (1975) Letter: Lymphocystis in paradise fish bream (89 %), LCDV-C (86 %) and LCDV-1 (84 %). In (Macropodus opercularis) in Australia. Aust Vet J 51:448–449 addition, DNA polymerase and MMP of LCDV-PF shared 2. Cano I, Ferro P, Alonso MC, Bergmann SM, Ro¨mer-Oberdo¨rfer A, Garcia-Rosado E, Castro D, Borrego JJ (2007) Development 84 % and 86 % identity, respectively, with that of LCDV- of molecular techniques for detection of lymphocystis disease C. The MCP sequences of different LCDV isolates virus in different marine fish species.