Reiterative Ap2a Activity Controls Sequential Steps in the Neural Crest Gene Regulatory Network
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Ncomms2254.Pdf
ARTICLE Received 3 May 2012 | Accepted 5 Nov 2012 | Published 4 Dec 2012 DOI: 10.1038/ncomms2254 The RB family is required for the self-renewal and survival of human embryonic stem cells Jamie F. Conklin1,2,3, Julie Baker2,3 & Julien Sage1,2,3 The mechanisms ensuring the long-term self-renewal of human embryonic stem cells are still only partly understood, limiting their use in cellular therapies. Here we found that increased activity of the RB cell cycle inhibitor in human embryonic stem cells induces cell cycle arrest, differentiation and cell death. Conversely, inactivation of the entire RB family (RB, p107 and p130) in human embryonic stem cells triggers G2/M arrest and cell death through functional activation of the p53 pathway and the cell cycle inhibitor p21. Differences in E2F target gene activation upon loss of RB family function between human embryonic stem cells, mouse embryonic stem cells and human fibroblasts underscore key differences in the cell cycle regulatory networks of human embryonic stem cells. Finally, loss of RB family function pro- motes genomic instability in both human and mouse embryonic stem cells, uncoupling cell cycle defects from chromosomal instability. These experiments indicate that a homeostatic level of RB activity is essential for the self-renewal and the survival of human embryonic stem cells. 1 Department of Pediatrics, Stanford Medical School, Stanford, California 94305, USA. 2 Department of Genetics, Stanford Medical School, Stanford, California 94305, USA. 3 Institute for Stem Cell Biology and Regenerative Medicine, Stanford Medical School, Stanford, California 94305, USA. Correspondence and requests for materials should be addressed to J.S. -
Prospective Isolation of NKX2-1–Expressing Human Lung Progenitors Derived from Pluripotent Stem Cells
The Journal of Clinical Investigation RESEARCH ARTICLE Prospective isolation of NKX2-1–expressing human lung progenitors derived from pluripotent stem cells Finn Hawkins,1,2 Philipp Kramer,3 Anjali Jacob,1,2 Ian Driver,4 Dylan C. Thomas,1 Katherine B. McCauley,1,2 Nicholas Skvir,1 Ana M. Crane,3 Anita A. Kurmann,1,5 Anthony N. Hollenberg,5 Sinead Nguyen,1 Brandon G. Wong,6 Ahmad S. Khalil,6,7 Sarah X.L. Huang,3,8 Susan Guttentag,9 Jason R. Rock,4 John M. Shannon,10 Brian R. Davis,3 and Darrell N. Kotton1,2 2 1Center for Regenerative Medicine, and The Pulmonary Center and Department of Medicine, Boston University School of Medicine, Boston, Massachusetts, USA. 3Center for Stem Cell and Regenerative Medicine, Brown Foundation Institute of Molecular Medicine, University of Texas Health Science Center, Houston, Texas, USA. 4Department of Anatomy, UCSF, San Francisco, California, USA. 5Division of Endocrinology, Diabetes and Metabolism, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts, USA. 6Department of Biomedical Engineering and Biological Design Center, Boston University, Boston, Massachusetts, USA. 7Wyss Institute for Biologically Inspired Engineering, Harvard University, Boston, Massachusetts, USA. 8Columbia Center for Translational Immunology & Columbia Center for Human Development, Columbia University Medical Center, New York, New York, USA. 9Department of Pediatrics, Monroe Carell Jr. Children’s Hospital, Vanderbilt University, Nashville, Tennessee, USA. 10Division of Pulmonary Biology, Cincinnati Children’s Hospital, Cincinnati, Ohio, USA. It has been postulated that during human fetal development, all cells of the lung epithelium derive from embryonic, endodermal, NK2 homeobox 1–expressing (NKX2-1+) precursor cells. -
Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897 -
A Role for Histone Modification in the Mechanism of Action of Antidepressant and Stimulant Drugs: a Dissertation
University of Massachusetts Medical School eScholarship@UMMS GSBS Dissertations and Theses Graduate School of Biomedical Sciences 2007-12-28 A Role for Histone Modification in the Mechanism of Action of Antidepressant and Stimulant Drugs: a Dissertation Frederick Albert Schroeder University of Massachusetts Medical School Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/gsbs_diss Part of the Amino Acids, Peptides, and Proteins Commons, Cells Commons, Enzymes and Coenzymes Commons, Genetic Phenomena Commons, Mental Disorders Commons, Nervous System Commons, and the Therapeutics Commons Repository Citation Schroeder FA. (2007). A Role for Histone Modification in the Mechanism of Action of Antidepressant and Stimulant Drugs: a Dissertation. GSBS Dissertations and Theses. https://doi.org/10.13028/7bk0-a687. Retrieved from https://escholarship.umassmed.edu/gsbs_diss/370 This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in GSBS Dissertations and Theses by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. A Dissertation Presented by Frederick Albert Schroeder Submitted to the Faculty of the University of Massachusetts Graduate School of Biomedical Sciences Worcester, Massachusetts, USA in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY December 28, 2007 Program in Neuroscience A Role for Histone Modification in the Mechanism of Action of Antidepressant and Stimulant Drugs A Dissertation Presented By Frederick Albert Schroeder Approved as to style and content by: _____________________________________ Alonzo Ross, Ph.D., Chair of Committee _____________________________________ Pradeep Bhide, Ph.D., Member of Committee _____________________________________ Craig L. -
Expression of the Human PAC1 Receptor Leads to Dose- Dependent Hydrocephalus-Related Abnormalities in Mice
Expression of the human PAC1 receptor leads to dose- dependent hydrocephalus-related abnormalities in mice Bing Lang, … , Anthony J. Harmar, Sanbing Shen J Clin Invest. 2006;116(7):1924-1934. https://doi.org/10.1172/JCI27597. Research Article Neuroscience Hydrocephalus is a common and potentially devastating birth defect affecting the CNS, and its relationship with G protein–coupled receptors (GPCRs) is unknown. We have expressed 2, 4, or 6 copies of a GPCR — the human PAC1 receptor with a 130-kb transgene in the mouse nervous system in a pattern closely resembling that of the endogenous gene. Consistent with PAC1 actions, PKA and PKC activity were elevated in the brains of Tg mice. Remarkably, Tg mice developed dose-dependent hydrocephalus-like characteristics, including enlarged third and lateral ventricles and reduced cerebral cortex, corpus callosum, and subcommissural organ (SCO). Neuronal proliferation and apoptosis were implicated in hydrocephalus, and we observed significantly reduced neuronal proliferation and massively increased neuronal apoptosis in the developing cortex and SCO of Tg embryos, while neurite outgrowth and neuronal migration in vitro remain uncompromised. Ventricular ependymal cilia are crucial for directing cerebrospinal fluid flow, and ependyma of Tg mice exhibited disrupted cilia with increased phospho-CREB immunoreactivity. These data demonstrate that altered neuronal proliferation/apoptosis and disrupted ependymal cilia are the main factors contributing to hydrocephalus in PAC1-overexpressing mice. This is the first report to our knowledge demonstrating that misregulation of GPCRs can be involved in hydrocephalus-related neurodevelopmental disorders. Find the latest version: https://jci.me/27597/pdf Research article Related Commentary, page 1828 Expression of the human PAC1 receptor leads to dose-dependent hydrocephalus- related abnormalities in mice Bing Lang,1 Bing Song,1 Wendy Davidson,1 Alastair MacKenzie,1 Norman Smith,2 Colin D. -
Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Cross-Modulatory Actions of Cell Cycle Machinery on Estrogen Receptor-Α Level and Transcriptional Activity in Breast Cancer Cells
CROSS-MODULATORY ACTIONS OF CELL CYCLE MACHINERY ON ESTROGEN RECEPTOR-α LEVEL AND TRANSCRIPTIONAL ACTIVITY IN BREAST CANCER CELLS BY SHWETA BHATT DISSERTATION Submitted In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in Biochemistry in the Graduate College of the University of Illinois at Urbana-Champaign, 2010 Urbana, Illinois Doctoral Committee: Professor Benita S. Katzenellenbogen (Chair) Professor David J. Shapiro Professor Milan K. Bagchi Professor Paul J. Hergenrother THESIS ABSTRACT Breast cancer is one of the most highly diagnosed cancers in women and the second largest cause of death of women in United States. The anti-estrogen tamoxifen which blocks gene expression through estradiol bound ERα, and hence the growth stimulatory effects of estradiol, has been widely used for decades for treating patients with ERα positive or hormone dependent breast cancer. Despite its obvious benefits, in as high as 40% of the patients receiving tamoxifen therapy there is an eventual relapse of the disease largely due to acquired resistance to the drug, underlying mechanism for which is rather poorly understood. Elucidating the molecular basis underlying “acquired tamoxifen resistance” and agonistic effects of tamoxifen on cellular growth was the primary focus of my doctoral research. We addressed this by two approaches, one being studying the molecular mechanism for the regulation of cellular levels of ERα so as to prevent its loss in ERα positive or restore its levels in ERα negative breast cancers and second to investigate the role of tamoxifen in modulating the expression of ERα target genes independent of estradiol as a function of its stimulatory or estrogenic effects on breast cancer cell growth. -
To Proliferate Or to Die: Role of Id3 in Cell Cycle Progression and Survival of Neural Crest Progenitors
Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press To proliferate or to die: role of Id3 in cell cycle progression and survival of neural crest progenitors Yun Kee and Marianne Bronner-Fraser1 Division of Biology, California Institute of Technology, Pasadena, California 91125, USA The neural crest is a unique population of mitotically active, multipotent progenitors that arise at the vertebrate neural plate border. Here, we show that the helix–loop–helix transcriptional regulator Id3 has a novel role in cell cycle progression and survival of neural crest progenitors in Xenopus. Id3 is localized at the neural plate border during gastrulation and neurulation, overlapping the domain of neural crest induction. Morpholino oligonucleotide-mediated depletion of Id3 results in the absence of neural crest precursors and a resultant loss of neural crest derivatives. This appears to be mediated by cell cycle inhibition followed by cell death of the neural crest progenitor pool, rather than a cell fate switch. Conversely, overexpression of Id3 increases cell proliferation and results in expansion of the neural crest domain. Our data suggest that Id3 functions by a novel mechanism, independent of cell fate determination, to mediate the decision of neural crest precursors to proliferate or die. [Keywords: Xenopus; Id3; neural crest; cell cycle; survival] Received September 1, 2004; revised version accepted January 19, 2005. The neural crest is an embryonic cell population that origi- et al. 2003), c-Myc (Bellmeyer et al. 2003), and Msx1 nates from the lateral edges of the neural plate during (Tribulo et al. 2003) have been identified in Xenopus nervous system formation. -
Lncmyod Promotes Skeletal Myogenesis and Regulates Skeletal Muscle Fiber-Type Composition by Sponging Mir-370-3P
G C A T T A C G G C A T genes Article LncMyoD Promotes Skeletal Myogenesis and Regulates Skeletal Muscle Fiber-Type Composition by Sponging miR-370-3p Peiwen Zhang 1,2,† , Jingjing Du 1,2,†, Xinyu Guo 1,2, Shuang Wu 1,2, Jin He 1,2 , Xinrong Li 1,2, Linyuan Shen 1,2 , Lei Chen 1,2, Bohong Li 1, Jingjun Zhang 1, Yuhao Xie 1, Lili Niu 1,2, Dongmei Jiang 1,2, Xuewei Li 1,2, Shunhua Zhang 1,2 and Li Zhu 1,2,* 1 College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130, China; [email protected] (P.Z.); [email protected] (J.D.); [email protected] (X.G.); [email protected] (S.W.); [email protected] (J.H.); [email protected] (X.L.); [email protected] (L.S.); [email protected] (L.C.); [email protected] (B.L.); [email protected] (J.Z.); [email protected] (Y.X.); [email protected] (L.N.); [email protected] (D.J.); [email protected] (X.L.); [email protected] (S.Z.) 2 Farm Animal Genetic Resources Exploration and Innovation Key Laboratory of Sichuan Province, Sichuan Agricultural University, Chengdu 611130, China * Correspondence: [email protected] † These authors contributed equally to this work. Abstract: The development of skeletal muscle is a highly ordered and complex biological process. Increasing evidence has shown that noncoding RNAs, especially long-noncoding RNAs (lncRNAs) and microRNAs, play a vital role in the development of myogenic processes. -
Whole-Genome Cartography of Estrogen Receptor a Binding Sites
Whole-Genome Cartography of Estrogen Receptor a Binding Sites Chin-Yo Lin1[¤, Vinsensius B. Vega1[, Jane S. Thomsen1, Tao Zhang1, Say Li Kong1, Min Xie1, Kuo Ping Chiu1, Leonard Lipovich1, Daniel H. Barnett2, Fabio Stossi2, Ailing Yeo3, Joshy George1, Vladimir A. Kuznetsov1, Yew Kok Lee1, Tze Howe Charn1, Nallasivam Palanisamy1, Lance D. Miller1, Edwin Cheung1,3, Benita S. Katzenellenbogen2, Yijun Ruan1, Guillaume Bourque1, Chia-Lin Wei1, Edison T. Liu1* 1 Genome Institute of Singapore, Singapore, Republic of Singapore, 2 Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, Urbana, Illinois, United States of America, 3 Department of Biochemistry, Yong Loo Lin School of Medicine, National University of Singapore, Singapore, Republic of Singapore Using a chromatin immunoprecipitation-paired end diTag cloning and sequencing strategy, we mapped estrogen receptor a (ERa) binding sites in MCF-7 breast cancer cells. We identified 1,234 high confidence binding clusters of which 94% are projected to be bona fide ERa binding regions. Only 5% of the mapped estrogen receptor binding sites are located within 5 kb upstream of the transcriptional start sites of adjacent genes, regions containing the proximal promoters, whereas vast majority of the sites are mapped to intronic or distal locations (.5 kb from 59 and 39 ends of adjacent transcript), suggesting transcriptional regulatory mechanisms over significant physical distances. Of all the identified sites, 71% harbored putative full estrogen response elements (EREs), 25% bore ERE half sites, and only 4% had no recognizable ERE sequences. Genes in the vicinity of ERa binding sites were enriched for regulation by estradiol in MCF-7 cells, and their expression profiles in patient samples segregate ERa-positive from ERa-negative breast tumors. -
Onset of Taste Bud Cell Renewal Starts at Birth and Coincides with a Shift In
RESEARCH ARTICLE Onset of taste bud cell renewal starts at birth and coincides with a shift in SHH function Erin J Golden1,2, Eric D Larson2,3, Lauren A Shechtman1,2, G Devon Trahan4, Dany Gaillard1,2, Timothy J Fellin1,2, Jennifer K Scott1,2, Kenneth L Jones4, Linda A Barlow1,2* 1Department of Cell & Developmental Biology, University of Colorado Anschutz Medical Campus, Aurora, United States; 2The Rocky Mountain Taste and Smell Center, University of Colorado Anschutz Medical Campus, Aurora, United States; 3Department of Otolaryngology, University of Colorado Anschutz Medical Campus, Aurora, United States; 4Department of Pediatrics, Section of Hematology, Oncology, and Bone Marrow Transplant, University of Colorado Anschutz Medical Campus, Aurora, United States Abstract Embryonic taste bud primordia are specified as taste placodes on the tongue surface and differentiate into the first taste receptor cells (TRCs) at birth. Throughout adult life, TRCs are continually regenerated from epithelial progenitors. Sonic hedgehog (SHH) signaling regulates TRC development and renewal, repressing taste fate embryonically, but promoting TRC differentiation in adults. Here, using mouse models, we show TRC renewal initiates at birth and coincides with onset of SHHs pro-taste function. Using transcriptional profiling to explore molecular regulators of renewal, we identified Foxa1 and Foxa2 as potential SHH target genes in lingual progenitors at birth and show that SHH overexpression in vivo alters FoxA1 and FoxA2 expression relevant to taste buds. We further bioinformatically identify genes relevant to cell adhesion and cell *For correspondence: locomotion likely regulated by FOXA1;FOXA2 and show that expression of these candidates is also LINDA.BARLOW@CUANSCHUTZ. altered by forced SHH expression.