DOCSLIB.ORG

Translational Control of Transcriptiontermination at The

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Translational Control of Transcriptiontermination at The Proc. Natl. Acad. Sc4. USA Vol. 75, No. 12, pp. 5988-5992, December 1978 Biochemistry Translational control of transcription termination at the attenuator of the Escherichia coli tryptophan operon (regulatory mutants/leader peptide synthesis/attenuation) GERARD ZURAWSKI, DIRK ELSEVIERS*, GEORGE V. STAUFFERt, AND CHARLES YANOFSKY Department of Biological Sciences, Stanford University, Stanford, California 94305 Contributed by Charles Yanofsky, October 2,1978 ABSTRACr We have isolated two regulatory mutants al- the absence of indole. To identify those mutations located in tered in the leader region of the Escherichia coli tryptophan the trp leader region we mapped the mutations relative to two (tp) operon. In one mutant, trpL29, the AUG translation start most of and trpD codon for the tip leader peptide is replaced by AUA. The other deletions-AtrpED24, which removes tipE mutant, trpL75, has a G-A change at residue 75, immediately but leaves the trp leader region intact (9), and AtrpLD102, after the UGA translation stop codon for the trp leader peptide. which removes most of trpL, trpE, and trpD but leaves the trp In vivo, trpL29 and trpL75 increase the efficiency of tran- operator-promoter intact (10). P1 cdr lysates prepared from the scr!ption termination at the tip attenuator 3-to 5-fold. trpL29 above mutants were UV irradiated to increase the frequency and tpL75 also fail to respond fully to tryptophan starvation of recombination (11) and used to transduce trpR tna2 and other conditions that normally relieve transcription ter- AtrpED24 or trpR tna2 AtrpLD102 to prototrophy. Of 10 mination at the tip attenuator. The tipL29 mutation, which presumably reduces synthesis of the tip leader peptide, is cis mutants examined, 3 produced 7.5-10% recombination be- dominant. The effect of starvation for a number of the amino tween the mutation and AtrpED24 but no recombination be- acids in the tp leaderpeptide was determined. Only starvation tween the mutation and AtrpLD102. Recombination was for tryptophan and arginine, amino acids that occur at residues monitored by scoring for the prototrophic 5-methyltrypto- 10, 11, and 12 of the 14-residue tip leader peptide, elicits relief phan-resistant recombinant class. of transcription termination. Our findings suggest that trans- Messenger RNA Experiments. Procedures for the growth lation of tip leader RNA is involved in regulation of transcrip- tion termination at the attenuator. A mode isiscussed in which of cells, pulse labeling with [3H]uridine for 30 sec. extraction the location of the ribosome synthesizing the leader peptide is of RNA, and hybridization to denatured, immobilized DNA communicated to the RNA polymerase transcribing the leader have been described (2). Amino acid starvation prior to pulse region. labeling of RNA was for 5 min at 370C. The DNAs used for hybridization are described in the legend to the appropriate RNA polymerase molecules that have initiated transcription table or figure. at the promoter of the tryptophan (trp) operon of Escherichia The effect of arginine starvation on the ratio of plasmid trp coil may either terminate transcription at the attenuator, or a mRNA to chromosomal tip mRNA was determined in two site, in the 160-base-pair leader region of the operon or continue strains: W3110 trpR his pro ilv argE trpL + AtrpED24/colVB transcription into the structural genes (1). Termination of trpL + trpEl0220 trpD + A(tonBtrpAC) and a strain isogenic transcription at trp a is regulated, and varies in response to except for AtrpLD102 as the chromosomal marker. Plasmid- changes in the levels of charged vs. uncharged tRNATrP (2). We and chromosomal-specific trp mRNAs were determined by define attenuation as the regulation of this termination (3). measuring trpB mRNA and trpE mRNA. DNA of phages The short RNA molecules produced by transcription ter- iAh48wtrpE and iAhV0tpBA15 were used for these measure- mination at an attenuator are termed leader transcripts. The ments. known leader transcripts of amino acid biosynthetic operons Enzyme Assays. Cells were grown in minimal medium (12) code for short peptides containing at least two tandem amino containing 0.05% acid casein hydrolysate and 50 ,ug of L- acid residues that are the end product of expression of that tryptophan per ml. Extracts were prepared, and the specific operon (refs. 4-7; unpublished results). This fact and the anal- activities of trpE, tipD, and tipB polypeptides were deter- yses presented here with a mutant that is presumed to be defi- mined as described (2). cient in synthesis of the trp leader peptide lead us to suggest that translation of the transcript of the trp leader region is involved RESULTS in attenuation. Isolation of Mutants in the Leader Region of the tip Op- eron That Increase the Efficiency of Transcription Termi- MATERIALS AND METHODS nation. E. coil strains that lack a functional Trp repressor Isolation and Mapping of 5-Methylanthranilic Acid-Re- protein (tipR) are growth inhibited when plated on a medium sistant Mutants. E. colh strain W3110 trpR tna2 trpB9579 was containing 5-MA plus a low concentration of indole. This in- infected with hydroxylamine-treated P1 cdr phage grown on hibition is presumably due to the conversion of the 5-MA to W3110 (8), and trp+ transductants were selected. About 1% toxic levels of 5-methyltryptophan by the high trp enzyme of the trp + transductants were resistant to 5-methylanthranilic levels present in the trpR strains. E. colh trpR + strains have acid (5-MA) (100 MAg/Ml) in the presence of indole (5 Mtg/ml). much lower levels of the tip enzymes (13) and are resistant to Approximately 10% of the trp-linked 5-MA-resistant clones had 5-MA under the same conditions. Thus 5-MA is suitable for the reduced levels of the tip enzymes, and, unlike the parental trpR selection in trpR strains of mutations that decrease the ex- strain, their growth was inhibited by 5-methyltryptophan in Abbreviation: 5-MA, 5-methylanthranilate. The publication costs of this article were defrayed in part by page * Present address: Department of Microbiology, New York Medical charge payment. This article must therefore be hereby marked "ad- College, Valhalla, NY. vertisement" in accordance with 18 U. S. C. §1734 solely to indicate t Present address: Department of Microbiology, University of Iowa, this fact. Iowa City, IA 52242. 5988 Downloaded by guest on September 24, 2021 Biochemistry: Zurawski et al. Proc. Nati. Acad. Sci. USA 75 (1978) 5989 pression of the trp operon. We have selected such mutants and G U A A then screened for those with alterations that map in the leader C A region of the trp operon and result in increased termination of G G transcription at the trp attenuator. U C To facilitate isolation of the desired mutants, we mutagenized A A P1 cdr phage grown on W3110 and transduced W3110 trpR C A tna2 trpB9579 to prototrophy. 5-MA-resistant mutants were C U identified among the transductants, and three were found to A C have mutations in the trp leader region that resulted in in- CU UA G creased termination of transcription at the trp attenuator. Table A U 1 shows that the levels of trp operon enzymes and structural Met30 U A-110 gene mRNAs in two of the mutants, trpL29 and trpL75, were -AUGAAAGCAAUA- G C reduced to 20-40% of those of the trpL + parental strain. We A U C cloned the trp leader regions of trpL29 and trpL75 onto the L 29 80-GC multicopy trpP + 0 +L +E +D + plasmid pVH153 (15) by ge- A AU UUUUUUU netic exchange (unpublished results) between the trp regions C G -C of the chromosome and the trp deletion plasmid pVH153 L 75 G C G AtrpLE1417 [designated pGM3 (16)]. The Hpa I1570 DNA 50 Trp-Trp 70 AG CG-130 restriction fragment, which carries the trpPOL region (17), was AGGUUGGUGGCGCACUUCCUGAAAC G C isolated from the plasmids carrying the trpL mutations and STOP C .GA transcribed ir vWtro (17). RNA sequence analysis of the isolated C G leader transcripts (18) was used initially to identify the muta- U U tional changes. trpL29 and trpL75 were found to have G-'A AA base changes at residues 29 and 75, respectively (Fig. 1). The FIG. 1. The nucleotide sequence of two portions of the leader above single base changes were confirmed by sequencing leader transcript from the E. coli trp operon. The residues are numbered I with respect to the 5' end. Residues 27-38 include the AUG translation region DNA in both directions from the Hha site at base pairs initiator codon for the trp leader peptide. Residues 50-71 code for the 54-62 (21). Similarly, a third mutant was found to be identical COOH-terminal part ofthe leader peptide, which includes the tandem to trpL75. Trp residues shown. The UGA translation stop codon for the leader To demonstrate that the phenotype of decreased operon peptide is at residues 69-71. Residues 74-134 are presented as the expression is due to the observed base pair changes in trpL29 secondary structure proposed by Lee and Yanofsky (17). Residues and trpL75, we isolated spontaneous 5-methyltryptophan- 114-119 can participate in two alternative stem and loop structures: resistant mutants from both strains that have a level of operon the first stem and loop includes residues 74-119; the second stem and loop includes residues 114-134. The trpL29 and trpL75 residue expression identical to that of the W3110 trpR tna2 parent changes are indicated. The trpL75 mutation changes the expected strain (Table 1). The leader region of one such 'revertant' from free energy offormation ofthe first stem and loop from AG -10 kcal each was cloned by genetic exchange and sequenced from the to AG _ -2 kcal (1 cal = 4.184 J) (17, 19, 20).
Load more

Recommended publications
  • Mirnas and Lncrnas As Novel Therapeutic Targets to Improve Cancer Immunotherapy
    cancers Review miRNAs and lncRNAs as Novel Therapeutic Targets to Improve Cancer Immunotherapy Maria Teresa Di Martino 1,*,† , Caterina Riillo 1,† , Francesca Scionti 2, Katia Grillone 1 , Nicoletta Polerà 1, Daniele Caracciolo 1, Mariamena Arbitrio 3, Pierosandro Tagliaferri 1 and Pierfrancesco Tassone 1 1 Department of Clinical and Experimental Medicine, Magna Graecia University of Catanzaro, 88100 Catanzaro, Italy; [email protected] (C.R.); [email protected] (K.G.); [email protected] (N.P.); [email protected] (D.C.); [email protected] (P.T.); [email protected] (P.T.) 2 Institute of Research and Biomedical Innovation (IRIB), Italian National Council (CNR), 98164 Messina, Italy; [email protected] 3 Institute of Research and Biomedical Innovation (IRIB), Italian National Council (CNR), 88100 Catanzaro, Italy; [email protected] * Correspondence: [email protected] † These authors contributed equally. Simple Summary: Cancer onset and progression are promoted by high deregulation of the immune system. Recently, major advances in molecular and clinical cancer immunology have been achieved, offering new agents for the treatment of common tumors, often with astonishing benefits in terms of prolonged survival and even cure. Unfortunately, most tumors are still resistant to current immune therapy approaches, and basic knowledge of the resistance mechanisms is eagerly awaited. We Citation: Di Martino, M.T.; Riillo, C.; focused our attention on noncoding RNAs, a class of RNA that regulates many biological processes Scionti, F.; Grillone, K.; Polerà, N.; by targeting selectively crucial molecular pathways and that, recently, had their role in cancer cell Caracciolo, D.; Arbitrio, M.; immune escape and modulation of the tumor microenvironment identified, suggesting their function Tagliaferri, P.; Tassone, P.
    [Show full text]
  • Transcription Initiation Sites of the Leucine Operons of Salmonella Typhimurium and Escherichia Coli
    J. Mol. Biol. (1983) 170, 39-59 Transcription Initiation Sites of the Leucine Operons of Salmonella typhimurium and Escherichia coli ROBERT M. GEMMILL~', JUDITH W. JONES, GEORGE W. HAUGHN AND JOSEPH M. CALVO Section of Biochemistry, Molecular and Cell Biology Cornell University, Ithaca, IV. Y. 14853, U.S.A. (Received 13 September 1982, and in revised form 15 June 1983) Evidence for a transcription attenuation site downstream from the leu promoter was obtained by transcription experiments in vitro. Most transcription initiated in vitro from teuP is terminated prematurely, resulting in the synthesis of a 160 nucleotide leader RNA. We define here the point at which transcription is initiated in vitro and in vivo and demonstrate that the site of premature termination is between the promoter and the first structural gene (leuA). Additional nucleotide sequences are presented that extend the known sequence 200 base-pairs upstream and 300 base-pairs downstream from leuP. The location of the promoter-proximal end of cistron leuA was deduced by comparing nucleotide sequence data with the sequence of the ten amino acids at the N-terminus of a-isopropylmalate synthase. To facilitate the isolation of quantities of material for sequencing experiments, the enzyme was isolated from a plasmid-containing strain, CV605, grown under conditions of leucine limitation. Under such conditions, about 20% of the total soluble protein of strain CV605 is a-isopropylmalate synthase and another 20~/o is fl-isopropylmalate dehydrogenase (leuB product). 1. Introduction Leucine biosynthesis in enteric bacteria is catalyzed by three enzymes whose levels are co-ordinately regulated by the intracellular concentration of leucine (Calvo et al., 1969a).
    [Show full text]
  • Noncoding RNA E
    Noncoding RNA E. Desgranges, S. Marzi, K. Moreau, P. Romby, Isabelle Caldelari To cite this version: E. Desgranges, S. Marzi, K. Moreau, P. Romby, Isabelle Caldelari. Noncoding RNA. Microbiology Spectrum, American Society for Microbiology, 2019, 7 (2), 10.1128/microbiolspec.GPP3-0038-2018. hal-02112074 HAL Id: hal-02112074 https://hal.archives-ouvertes.fr/hal-02112074 Submitted on 27 Oct 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Gram-positive pathogens, 3rd Edition (ASM) Staphylococcus section Chapter 5: non-coding RNA Desgranges, E. 1, Marzi, S. 1, Moreau, K. 2, Romby, P1, and Caldelari I1*. 1Université de Strasbourg, CNRS, Architecture et Réactivité de l’ARN, UPR9002, F-67000 Strasbourg, France 2CIRI, International Center for Infectiology Research, Inserm, U1111, Université Claude Bernard Lyon 1, CNRS, UMR5308, École Normale Supérieure de Lyon, Hospices Civils de Lyon, Univ Lyon, F-69008, Lyon, France *corresponding author General introduction Regulatory RNAs have been identified in many bacteria, and in pathogenic bacteria such as Staphylococcus aureus, where they play major roles in the regulation of virulence or metabolic proteins synthesis, beside transcriptional factors and two component systems (Bischoff and Romby, 2016, Tomasini et al., 2014, Guillet et al., 2013, Caldelari et al., 2011).
    [Show full text]
  • The Arginine Attenuator Peptide Interferes with the Ribosome Peptidyl Transferase Center
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Texas A&M University The Arginine Attenuator Peptide Interferes with the Ribosome Peptidyl Transferase Center Jiajie Wei, Cheng Wu, and Matthew S. Sachs Department of Biology, Texas A&M University, College Station, Texas, USA The fungal arginine attenuator peptide (AAP) is encoded by a regulatory upstream open reading frame (uORF). The AAP acts as a nascent peptide within the ribosome tunnel to stall translation in response to arginine (Arg). The effect of AAP and Arg on ri- bosome peptidyl transferase center (PTC) function was analyzed in Neurospora crassa and wheat germ translation extracts using Downloaded from the transfer of nascent AAP to puromycin as an assay. In the presence of a high concentration of Arg, the wild-type AAP inhib- ited PTC function, but a mutated AAP that lacked stalling activity did not. While AAP of wild-type length was most efficient at stalling ribosomes, based on primer extension inhibition (toeprint) assays and reporter synthesis assays, a window of inhibitory function spanning four residues was observed at the AAP’s C terminus. The data indicate that inhibition of PTC function by the AAP in response to Arg is the basis for the AAP’s function of stalling ribosomes at the uORF termination codon. Arg could inter- fere with PTC function by inhibiting peptidyltransferase activity and/or by restricting PTC A-site accessibility. The mode of PTC inhibition appears unusual because neither specific amino acids nor a specific nascent peptide chain length was required for AAP to inhibit PTC function.
    [Show full text]
  • Construction of L-Threonine Overproducing Strains Of
    Agric. Biol Chem., 47 (10), 2329-2334, 1983 2329 Construction of L-Threonine Overproducing Strains of Escherichia coli K-12 Using Recombinant DNATechniques Kiyoshi Miwa, Takayasu Tsuchida, Osamu Kurahashi, Shigeru Nakamori, Konosuke Sano and HaruoMomose Central Research Laboratories ofAjinomoto Co., Inc., Kawasaki-ku, Kawasaki 210, Japan Received April 4, 1983 The threonine operon of Escherichia coli was cloned in plasmid pBR322, using a threonine producing mutant, /?IM4, as the DNAdonor. A recombinant plasmid, pAJ294, that contains the whole threonine operon was obtained. No. 29-4, a transformant of /?IM4 with pAJ294, had about eleven copies of pAJ294, five times higher homoserine dehydrogenase activity (coded by the thrA gene), and about three times higher threonine productivity than those of /?IM4. No. 29-4 produced 13.4g/liter of l-threonine from 30 g/liter of glucose in the culture medium. Threonine biosynthesis is known to be reg- mutant /?IM44) was used as the DNA donor and the ulated by two mechanisms in E. coli. One is recipient. Threonine auxotrophic mutants, No. 1 thrA, feedback inhibition by L-threonine of a bi- No. 43 thrB, No. 313 thrC, No. 44 thr (not identified) and functional enzyme, aspartokinase I (AK-I)- No. 255 thr (not identified), were derived from /?IM4 and used as the recipients. Plasmid pBR3225) was used as the homoserine dehydrogenase I (HDH-I), and vector. another is multivalent repression of the thre- onine biosynthetic enzymes by L-threonine Media. L medium6) and Davis'7) minimal medium were used. Amino acids (100 /ig/ml), thiamine-HCl (1 /ig/ml), plus L-isoleucine1} through the attenuation ampicillin (lOOjUg/ml) and tetracycline (20/ig/ml) were mechanism.2'3) Wehave previously construct- added when required.
    [Show full text]
  • Attenuation Regulation of Amino Acid Biosynthetic Operons in Proteobacteria: Comparative Genomics Analysis
    FEMS Microbiology Letters 234 (2004) 357–370 www.fems-microbiology.org Attenuation regulation of amino acid biosynthetic operons in proteobacteria: comparative genomics analysis Alexey G. Vitreschak a,*, Elena V. Lyubetskaya a, Maxim A. Shirshin a, Mikhail S. Gelfand a,b, Vassily A. Lyubetsky a,c a Institute for Information Transmission Problems, Russian Academy of Sciences, Bolshoi Karetnyi per. 19, Moscow 127994, GSP-4, Russia b State Scientific Centre GosNIIGenetica, 1-st Dorozhny pr. 1, Moscow 113545, Russia c Institute for strategic stability, Atomic Energy of the Russian Federation, Luganskaya street, 9, 115304 Moscow, Russia Received 26 December 2003; received in revised form 16 March 2004; accepted 2 April 2004 First published online 16 April 2004 Abstract Candidate attenuators were identified that regulate operons responsible for biosynthesis of branched amino acids, histidine, threonine, tryptophan, and phenylalanine in c- and a-proteobacteria, and in some cases in low-GC Gram-positive bacteria, Thermotogales and Bacteroidetes/Chlorobi. This allowed us not only to describe the evolutionary dynamics of regulation by at- tenuation of transcription, but also to annotate a number of hypothetical genes. In particular, orthologs of ygeA of Escherichia coli were assigned the branched chain amino acid racemase function. Three new families of histidine transporters were predicted, or- thologs of yuiF and yvsH of Bacillus subtilis, and lysQ of Lactococcus lactis. In Pasteurellales, the single bifunctional aspartate kinase/homoserine dehydrogenase gene thrA was predicted to be regulated not only by threonine and isoleucine, as in E. coli, but also by methionine. In a-proteobacteria, the single acetolactate synthase operon ilvIH was predicted to be regulated by branched amino acids-dependent attenuators.
    [Show full text]
  • The Trp Operon (BIOT 4006: Genetics and Molecular Biology)
    The trp Operon (BIOT 4006: Genetics and Molecular Biology) Dr. Saurabh Singh Rathore Department of Biotechnology MGCU Introduction • Synthesis of the enzymes involved in the biosynthesis of tryptophan is controlled by the trptophan/trp operon in E. coli. • Charles Yanofsky and others have studied in detail the working of the five structural genes and the close regulatory elements of the trp operon. • The precursor for biosynthesis of the amino acid tryptophan is “chorismic acid”. • The five structural genes of the trp operon code for enzymes required for conversion of chorismic acid to tryptophan. • There are two levels of regulation of this operon: 1. Repression: works at the level of transcription initiation 2. Attenuation: works at the level of transcription termination Repression of the trp operon • The repression regulation works negatively. • The trpR gene coding for repressor of trp operon is distantly located from the operon itself. • P1 is for primary promoter region and it contains the operator (O) region. • P2 is a weak promoter found at that end of the trpD gene which is more far from the operator. Its function is to increase the basal transcription level of the trpC, trpB & trpA genes. • There are two termination regions, namely t and t’ placed downstream to the trpA gene. The trpL denotes a region for a mRNA leader sequence (162 nucleotides in length). E. Coli trp operon organization • The biosynthesis of tryptophan is shown at the bottom. • The five structural genes coding for enzymes needed for tryptophan biosynthesis are: trpE, trpD, trpC, trpB & trpA. • trpL is the regulatory segment. • The gene lengths and the intergenic distances are shown as bp’s.
    [Show full text]
  • S41467-020-20181-5.Pdf
    ARTICLE https://doi.org/10.1038/s41467-020-20181-5 OPEN The iron-dependent repressor YtgR is a tryptophan-dependent attenuator of the trpRBA operon in Chlamydia trachomatis ✉ Nick D. Pokorzynski 1,2, Nathan D. Hatch2, Scot P. Ouellette 2 & Rey A. Carabeo 2 The trp operon of Chlamydia trachomatis is organized differently from other model bacteria. It contains trpR, an intergenic region (IGR), and the biosynthetic trpB and trpA open-reading 1234567890():,; frames. TrpR is a tryptophan-dependent repressor that regulates the major promoter (PtrpR), while the IGR harbors an alternative promoter (PtrpBA) and an operator sequence for the iron- dependent repressor YtgR to regulate trpBA expression. Here, we report that YtgR repression at PtrpBA is also dependent on tryptophan by regulating YtgR levels through a rare triple- tryptophan motif (WWW) in the YtgCR precursor. Inhibiting translation during tryptophan limitation at the WWW motif subsequently promotes Rho-independent transcription ter- mination of ytgR, thereby de-repressing PtrpBA. Thus, YtgR represents an alternative strategy to attenuate trpBA expression, expanding the repertoire for trp operon attenuation beyond TrpL- and TRAP-mediated mechanisms described in other bacteria. Furthermore, repurposing the iron-dependent repressor YtgR underscores the fundamental importance of maintaining tryptophan-dependent attenuation of the trpRBA operon. 1 School of Molecular Biosciences, College of Veterinary Medicine, Washington State University, Pullman, WA, USA. 2 Department of Pathology and ✉ Microbiology, University of Nebraska Medical Center, Omaha, NE, USA. email: [email protected] NATURE COMMUNICATIONS | (2020) 11:6430 | https://doi.org/10.1038/s41467-020-20181-5 | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-020-20181-5 ccess to the amino acid tryptophan is an important TrpL-mediated tryptophan-dependent cis-attenuation27.
    [Show full text]
  • Design Rules of Synthetic Non-Coding Rnas in Bacteria Young Je Lee And
    1 Design rules of synthetic non-coding RNAs in bacteria 2 Young Je Lee and Tae Seok Moon* 3 4 Department of Energy, Environmental and Chemical Engineering, Washington University in St. 5 Louis, St. Louis, MO, 63130, USA 6 7 * To whom correspondence should be addressed. 8 Tae Seok Moon 9 One Brookings Dr., Box 1180 10 St. Louis, MO 63130, USA 11 Tel: +1 (314) 935-5026 12 Fax: +1 (314) 935-7211 13 Email: [email protected] 14 15 16 17 18 19 20 21 22 23 1 24 Abstract 25 One of the long-term goals of synthetic biology is to develop designable genetic parts with 26 predictable behaviors that can be utilized to implement diverse cellular functions. The discovery 27 of non-coding RNAs and their importance in cellular processing have rapidly attracted researchers’ 28 attention towards designing functional non-coding RNA molecules. These synthetic non-coding 29 RNAs have simple design principles governed by Watson-Crick base pairing, but exhibit 30 increasingly complex functions. Importantly, due to their specific and modular behaviors, 31 synthetic non-coding RNAs have been widely adopted to modulate transcription and translation of 32 target genes. In this review, we summarize various design rules and strategies employed to 33 engineer synthetic non-coding RNAs. Specifically, we discuss how RNA molecules can be 34 transformed into powerful regulators and utilized to control target gene expression. With the 35 establishment of generalizable non-coding RNA design rules, the research community will shift 36 its focus to RNA regulators from protein regulators. 37 38 Keywords 39 Non-coding RNA, antisense RNA, STAR, toehold switch, CRISPR, aptazyme 40 41 42 43 44 45 46 2 47 Contents 48 1.
    [Show full text]
  • Mechanism of UTP-Modulated Attenuation at the Pyre Gene Of
    Tlhe EMBO Journal vol.3 no.12 pp.2857-2861, 1984 Mechanism of UTP-modulated attenuation at the pyrE gene of Escherichia coli: an example of operon polarity control through the coupling of translation to transcription Fons Bonekamp, Kire Clemmesen1, Olle Karlstrom and (rpoBC) suggesting that the pyr genes are regulated by the Kaj Frank Jensen level of saturation of RNA polymerase with UTP (Jensen et University of Copenhagen, Institute of Biological Chemistry B, S0lvgade al., 1982). 83, DK-1307 Copenhagen K, and 'University of Copenhagen, Institute of We have previously shown that pyrE is the second gene of Microbiology, 0. Farimagsgade 2A, DK-1353 Copenhagen K, Denmark an operon preceded by an open reading frame (orJE) 238 Communicated by A.Munch-Petersen codons long, which directs the formation of considerable quantities of a polypeptide (mol. wt. 25 497) of unknown The pyrE gene of Escherichia coli is part of an operon where function (Poulsen et 1983, Transcription of it is preceded by an unknown gene (orfE) that ends 8 bp al., 1984). the operon is initiated at two in front of a before the start of the symmetry of promoters orfE at fre- the UTP-modulated pyrE quency independent of the cellular concentration attenuator. On a plasmid we have inserted this of UTP. attenuator However, a fraction of the mRNA region in a synthetic cloning site early in lacZ. The resulting only chains reach thepyrE gene due to a UTP a structure contains the lac promoter-operator, the first few regulated attenuation at transcription terminator in the intercistronic space between orfE and pyrE codons of lacZ, 42 bp of DNA from the orfE end, the pyrE et and an (Poulsen al., 1984) (Figure 1).
    [Show full text]
  • Versatile RNA-Sensing Transcriptional Regulators for Engineering Genetic Networks
    Versatile RNA-sensing transcriptional regulators for engineering genetic networks Julius B. Lucksa,b,1,2, Lei Qia,1, Vivek K. Mutalikc, Denise Wanga, and Adam P. Arkina,c,d,3 aDepartment of Bioengineering, University of California, Berkeley, CA 94720; bMiller Institute for Basic Research in Science, Berkeley, CA 94720; cPhysical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720; and dCalifornia Institute for Quantitative Sciences (QB3), Berkeley, CA 94720 Edited* by Jennifer A. Doudna, University of California, Berkeley, CA, and approved April 11, 2011 (received for review October 19, 2010) The widespread natural ability of RNA to sense small molecules and There is a potential to greatly simplify genetic networks by regulate genes has become an important tool for synthetic biology directly propagating signals as RNA molecules (Fig. 1B). One in applications as diverse as environmental sensing and metabolic way to do this would be to implement network connections with engineering. Previous work in RNA synthetic biology has engi- RNA regulatory elements that sense an input RNA signal and neered RNA mechanisms that independently regulate multiple regulate the synthesis of an output RNA signal. Antisense-RNA- targets and integrate regulatory signals. However, intracellular mediated transcription attenuators are ideal candidate mechan- regulatory networks built with these systems have required pro- isms to use as a starting point for engineering this capability. teins to propagate regulatory signals. In this work, we remove this Much like riboswitches (15), they reside in 5′ untranslated regions requirement and expand the RNA synthetic biology toolkit by en- of mRNA and regulate the synthesis of downstream protein-cod- gineering three unique features of the plasmid pT181 antisense- ing regions by terminating transcription through RNA structural RNA-mediated transcription attenuation mechanism.
    [Show full text]
  • One-Step of Tryptophan Attenuator Inactivation and Promoter Swapping
    Gu et al. Microbial Cell Factories 2012, 11:30 http://www.microbialcellfactories.com/content/11/1/30 RESEARCH Open Access One-step of tryptophan attenuator inactivation and promoter swapping to improve the production of L-tryptophan in Escherichia coli Pengfei Gu, Fan Yang, Junhua Kang, Qian Wang and Qingsheng Qi* Abstract Background: L-tryptophan is an aromatic amino acid widely used in the food, chemical and pharmaceutical industries. In Escherichia coli, L-tryptophan is synthesized from phosphoenolpyruvate and erythrose 4-phosphate by enzymes in the shikimate pathway and L-tryptophan branch pathway, while L-serine and phosphoribosylpyrophosphate are also involved in L-tryptophan synthesis. In order to construct a microbial strain for efficient L-tryptophan production from glucose, we developed a one step tryptophan attenuator inactivation and promoter swapping strategy for metabolic flux optimization after a base strain was obtained by overexpressing the tktA, mutated trpE and aroG genes and inactivating a series of competitive steps. Results: The engineered E. coli GPT1002 with tryptophan attenuator inactivation and tryptophan operon promoter substitution exhibited 1.67 ~ 9.29 times higher transcription of tryptophan operon genes than the control GPT1001. In addition, this strain accumulated 1.70 g l-1 L-tryptophan after 36 h batch cultivation in 300-mL shake flask. Bioreactor fermentation experiments showed that GPT1002 could produce 10.15 g l-1 L-tryptophan in 48 h. Conclusions: The one step inactivating and promoter swapping is an efficient method for metabolic engineering. This method can also be applied in other bacteria. Background arabino-heptulosonate-7-phosphate (DAHP), and then L-tryptophan is an essential aromatic amino acid for proceeds to chorismate, a key intermediate product humans and animals which can be used as food additive, leading to the formation of L-tryptophan, L-tyrosine, infusion liquids, pellagra treatment, sleep induction and and L-phenylalanine (Figure 1).
    [Show full text]