DOCSLIB.ORG

Loss-Of-Function Mutations in RAB18 Cause Warburg Micro Syndrome

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Loss-Of-Function Mutations in RAB18 Cause Warburg Micro Syndrome View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector REPORT Loss-of-Function Mutations in RAB18 Cause Warburg Micro Syndrome Danai Bem,1 Shin-Ichiro Yoshimura,2,12 Ricardo Nunes-Bastos,2 Frances F. Bond,3 Manju A. Kurian,1,13 Fatima Rahman,1 Mark T.W. Handley,4 Yavor Hadzhiev,1 Imran Masood,5 Ania A. Straatman-Iwanowska,1,13 Andrew R. Cullinane,1,14 Alisdair McNeill,1,3,15 Shanaz S. Pasha,1 Gail A. Kirby,1 Katharine Foster,6 Zubair Ahmed,7 Jenny E. Morton,3 Denise Williams,3 John M. Graham,8 William B. Dobyns,9 Lydie Burglen,10 John R. Ainsworth,11 Paul Gissen,1,13 Ferenc Mu¨ller,1 Eamonn R. Maher,1,3 Francis A. Barr,2 and Irene A. Aligianis1,3,16,* Warburg Micro syndrome and Martsolf syndrome are heterogenous autosomal-recessive developmental disorders characterized by brain, eye, and endocrine abnormalities. Previously, identification of mutations in RAB3GAP1 and RAB3GAP2 in both these syndromes implicated dysregulation of the RAB3 cycle (which controls calcium-mediated exocytosis of neurotransmitters and hormones) in disease pathogenesis. RAB3GAP1 and RAB3GAP2 encode the catalytic and noncatalytic subunits of the hetrodimeric enzyme RAB3GAP (RAB3GTPase-activating protein), a key regulator of the RAB3 cycle. We performed autozygosity mapping in five consanguineous families without RAB3GAP1/2 mutations and identified loss-of-function mutations in RAB18. A c.71T > A (p.Leu24Gln) founder mutation was identified in four Pakistani families, and a homozygous exon 2 deletion (predicted to result in a frameshift) was found in the fifth family. A single family whose members were compound heterozygotes for an anti-termination mutation of the stop codon c.619T > C (p.X207QextX20) and an inframe arginine deletion c.277_279 del (p.Arg93 del) were identified after direct gene sequencing and multiplex ligation-dependent probe amplification (MLPA) of a further 58 families. Nucleotide binding assays for RAB18(Leu24Gln) and RAB18(Arg93del) showed that these mutant proteins were functionally null in that they were unable to bind guanine. The clinical features of Warburg Micro syndrome patients with RAB3GAP1 or RAB3GAP2 mutations and RAB18 mutations are indistinguishable, although the role of RAB18 in trafficking is still emerging, and it has not been linked previously to the RAB3 pathway. Knockdown of rab18 in zebrafish suggests that it might have a conserved developmental role. Our findings imply that RAB18 has a critical role in human brain and eye development and neurodegeneration. Rabs, small G proteins belonging to the Ras superfamily, (GDIs), and GDI displacement factors (GDFs).1 RAB precisely coordinate vesicular trafficking in the cell. In GTPases are reversibly associated with membranes by humans, more than 60 RABs dynamically localize to hydrophobic geranylgeranyl groups that are attached to distinct intracellular membranes, where their recruitment one or (in most cases) two carboxy-terminal cysteine resi- of effector proteins such as sorting adaptors, kinases, dues. This prenylation is intrinsic to their role in regulating phosphatases, motors, and tethering factors regulates membrane traffic.1 RAB proteins can bind multiple effectors membrane identity and vesicle budding, motility, and and have been shown individually and as a group to have fusion. RABs function as molecular switches that alternate diverse roles in human diseases such as immunodeficiency, between two conformational states: the GTP-bound cancer, and neurodegeneration.1,2 In terms of inherited ‘‘active’’ form and the GDP-bound ‘‘inactive’’ form. This disorders, loss-of-function mutations in RAB27A (MIM allows them to associate and dissociate with target 603868) have been associated with autosomal-recessive membranes and regulate membrane transport in a spatially Griselli syndrome (MIM 607624); loss-of-function muta- and temporarily restricted manner.1,2 The switching of tions in RAB23 (MIM 604144) have been implicated in auto- RAB GTPases is governed by four classes of proteins: somal-recessive Carpenter syndrome (MIM 201000), and GTPase-activating proteins (GAPs), guanine nucleotide loss-of-function mutations in RAB39B (MIM 300774) cause exchange factors (GEFs), GDP dissociation inhibitors X-linked mental retardation associated with autism, 1Medical and Molecular Genetics, School of Clinical and Experimental Medicine and Centre for Rare Diseases and Personalised Medicine, University of Birmingham, Birmingham B15 2TT, UK; 2Cancer Research Centre, University of Liverpool, Liverpool L3 9TA, UK; 3West Midlands Regional Genetics Service, Birmingham Women’s Hospital, Birmingham B15 2TG, UK; 4Medical and Developmental Genetics, Medical Research Council Human Genetics Unit, Edinburgh EH4 2XU, UK; 5Department of Cellular Pathology, Queen Elizabeth Hospital National Health Service Foundation Trust, Birmingham B15 2WB Institute of Neurology, University College London WC1E 6BT, UK; 6Radiology Department, Birmingham Children’s Hospital, Birmingham B4 6NH, UK; 7Molecular Neuroscience Group, School of Clinical and Experimental Medicine, University of Birmingham, Birmingham B15 2TT, UK; 8Clinical Genetics and Dysmorphology, Cedars Sinai Medical Centre, Los Angeles, CA 90048, USA; 9Department of Human Genetics, Neurology and Pediatrics, University of Chicago, Chicago, IL 60637, USA; 10Service de Ge´ne´tique Me´dicale, Hoˆpital d’Enfants Armand-Trousseau, 75571 Paris, France; 11Department of Paediatric Ophthalmology, Birmingham Children’s Hospital, Birmingham B4 6NH, UK 12Present address: Department of Cell Biology, Graduate School of Medicine, Osaka University, Suita, Osaka 565-087, Japan 13Present address: Institute of Child Health, London WC1N 1EH, UK 14Present address: National Human Genome Research Institute, National Institutes of Health, Bethesda, MD 20892, USA 15Present address: Institute of Neurology, University College London, London WC1E 6BT, UK 16Present address: Medical and Developmental Genetics, Medical Research Council Human Genetics Unit, Edinburgh EH4 2XU, UK *Correspondence: [email protected] DOI 10.1016/j.ajhg.2011.03.012. Ó2011 by The American Society of Human Genetics. All rights reserved. The American Journal of Human Genetics 88, 499–507, April 8, 2011 499 epilepsy, and macrocephaly (MIM 300774). Mutations in Families 1–5 are consanguineous. Families 1–4 are of RAB7 (MIM 602298) are associated with autosomal-domi- Pakistani origin, and family 5 is Turkish (pedigrees of nant Charcot-Marie-Tooth disease type 2B (MIM 600882). families 1–5 are shown in Figure 1). The clinical phenotype Functionally, RAB proteins have been classified into for the families is summarized in Table S1 and is typical of those that regulate the endocytic versus the exocytic Warburg Micro syndrome. The eye phenotype in the oldest (secretory) pathways.2,3 The RAB3 proteins (RAB3A [MIM affected child from families 1–4 was previously reported.12 179490]; RAB3B [MIM 179510]; RAB3C [MIM 612829], All the affected children in these families presented at birth and RAB3D [MIM 604350]) modulate calcium-mediated with congenital cataracts, microphthalmia, and microcor- exocytosis of neurotransmitters and hormones and are nea. In addition, they have small atonic pupils that do not regulated by RAB3GAP.4–7 RAB3GAP is a heterodimeric react to light or mydriatic agents. Despite early cataract complex consisting of a catalytic subunit (p130), which surgery, their vision has remained poor (only light percep- is encoded by RAB3GAP1 (MIM 602536) on chromosome tion) as a result of progressive optic atrophy and severe 2q21.3, and a noncatalytic subunit (p150), encoded by cortical visual impairment (confirmed by normal electrore- RAB3GAP2 (MIM 609275) on chromosome 1q41.4,5 Muta- tinogram [ERG] and absent visually evoked potentials tions in these genes have been implicated in the pathogen- [VEPs]). The progressive neurological deterioration esis of two clinically overlapping autosomal-recessive observed in these children is highlighted in Table S1. conditions, Warburg Micro syndrome (MIM 600118) and Although they were born with normal head circumfer- Martsolf syndrome (MIM 212720).8–11 Both disorders are ences (50th–75th percentiles) and develop early mile- characterized by ocular and neurodevelopmental manifes- stones, such as smiling, they all have severe truncal tations; Warburg Micro syndrome is a more severe hypotonia such that they have limited head control and, disorder.8–14 Recent molecular studies have established at the very most, only learn to sit with support. The that these two syndromes represent a phenotypic children have achieved no developmental milestones continuum that appears to be related to the nature and beyond those at the 4 month level; they have not learned severity of the mutations present in RAB3GAP1 and RAB3- to crawl, pull up to a standing position, or walk. They GAP2. Severe loss-of-function mutations in RAB3GAP1 developed postnatal acquired microcephaly within the have been reported in about 50% (17/35) of Warburg first year of life, and their head circumferences fell to Micro syndrome patients.8,10 Two mutations have been re- between À4SD and À6SD below the mean. Although ported in RAB3GAP2; these are a homozygous frameshift some of the younger children have babbled, none have mutation in a family affected by Warburg Micro syndrome developed any recognizable words or speech. A character- and a hypomorphic homozygous splicing mutation in istic pattern of progressive lower-limb spasticity started a family affected
Load more

Recommended publications
  • The A–Z of Zika Drug Discovery, Drug Discov Today (2018)
    Drug Discovery Today Volume 00, Number 00 June 2018 REVIEWS Teaser Zika clinical outcomes might be nefarious impacting newborns for a lifetime. There is still no drug available to cure Zika. We provide guidance to help understand and advance the search for a cure. KEYNOTE REVIEW – The A Z of Zika drug discovery Reviews 1 1 1 Melina Mottin graduated Melina Mottin , Joyce V.V.B. Borba , Rodolpho C. Braga , in pharmacy and earned her 2,3 4 Master’s degree and PhD at Pedro H.M. Torres , Matheus C. Martini , University of Campinas 4 5 (UNICAMP), Brazil. The Jose Luiz Proenca-Modena , Carla C. Judice , main focus of her studies 5 6 7 was to apply molecular Fabio T.M. Costa , Sean Ekins , Alexander L. Perryman and dynamics simulations and 1,5 other computational Carolina Horta Andrade strategies for a nuclear receptor and its association with drugs and coregulatory proteins, implicated in diabetes. 1 LabMol – Laboratory for Molecular Modeling and Drug Design, Faculdade de Farmacia, Universidade Federal de Melina is currently Research Associate of the OpenZika project, at Federal University of Goias, mainly applying Goias – UFG, Goiânia, GO 74605-170, Brazil 2 virtual screening based on docking and QSAR models to Instituto Oswaldo Cruz, Fundação Oswaldo Cruz, Rio de Janeiro, RJ 21040-900, Brazil 3 select drug candidates against Zika virus. Department of Biochemistry, University of Cambridge, 80 Tennis Court Road, Cambridge CB2 1GA, UK 4 Alexander L. Perryman Laboratory of Emerging Viruses (LEVE), Department of Genetics, Evolution, Microbiology and Immunology, earned his PhD in Andy Institute of Biology, UNICAMP, Campinas, SP 13083-864, Brazil 5 McCammon’s lab at UCSD.
    [Show full text]
  • Rab18 Promotes Lipid Droplet (LD) Growth by Tethering the ER to Lds Through SNARE​ and NRZ Interactions
    Published Online: 24 January, 2018 | Supp Info: http://doi.org/10.1083/jcb.201704184 Article Downloaded from jcb.rupress.org on August 7, 2018 Rab18 promotes lipid droplet (LD) growth by tethering the ER to LDs through SNARE and NRZ interactions Dijin Xu,1* Yuqi Li,1* Lizhen Wu,1* Ying Li,1 Dongyu Zhao,1 Jinhai Yu,1 Tuozhi Huang,1 Charles Ferguson,2 Robert G. Parton,2,3 Hongyuan Yang,4 and Peng Li1 1State Key Laboratory of Membrane Biology, Tsinghua-Peking Center for Life Sciences, Beijing Advanced Innovation Center for Structural Biology, School of Life Sciences, Tsinghua University, Beijing, China 2Institute for Molecular Bioscience and 3Centre for Microscopy and Microanalysis, University of Queensland, Brisbane, Australia 4School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, Australia Lipid incorporation from endoplasmic reticulum (ER) to lipid droplet (LD) is important in controlling LD growth and intra- cellular lipid homeostasis. However, the molecular link mediating ER and LD cross talk remains elusive. Here, we identi- fied Rab18 as an important Rab guanosine triphosphatase in controlling LD growth and maturation.Rab18 deficiency resulted in a drastically reduced number of mature LDs and decreased lipid storage, and was accompanied by increased ER stress. Rab3GAP1/2, the GEF of Rab18, promoted LD growth by activating and targeting Rab18 to LDs. LD-associated Rab18 bound specifically to the ER-associated NAG-RINT1-ZW10 (NRZ) tethering complex and their associated SNAREs (Syntaxin18, Use1, BNIP1), resulting in the recruitment of ER to LD and the formation of direct ER–LD contact. Cells with defects in the NRZ/SNA RE complex function showed reduced LD growth and lipid storage.
    [Show full text]
  • Convergent Functional Genomics of Schizophrenia: from Comprehensive Understanding to Genetic Risk Prediction
    Molecular Psychiatry (2012) 17, 887 -- 905 & 2012 Macmillan Publishers Limited All rights reserved 1359-4184/12 www.nature.com/mp IMMEDIATE COMMUNICATION Convergent functional genomics of schizophrenia: from comprehensive understanding to genetic risk prediction M Ayalew1,2,9, H Le-Niculescu1,9, DF Levey1, N Jain1, B Changala1, SD Patel1, E Winiger1, A Breier1, A Shekhar1, R Amdur3, D Koller4, JI Nurnberger1, A Corvin5, M Geyer6, MT Tsuang6, D Salomon7, NJ Schork7, AH Fanous3, MC O’Donovan8 and AB Niculescu1,2 We have used a translational convergent functional genomics (CFG) approach to identify and prioritize genes involved in schizophrenia, by gene-level integration of genome-wide association study data with other genetic and gene expression studies in humans and animal models. Using this polyevidence scoring and pathway analyses, we identify top genes (DISC1, TCF4, MBP, MOBP, NCAM1, NRCAM, NDUFV2, RAB18, as well as ADCYAP1, BDNF, CNR1, COMT, DRD2, DTNBP1, GAD1, GRIA1, GRIN2B, HTR2A, NRG1, RELN, SNAP-25, TNIK), brain development, myelination, cell adhesion, glutamate receptor signaling, G-protein-- coupled receptor signaling and cAMP-mediated signaling as key to pathophysiology and as targets for therapeutic intervention. Overall, the data are consistent with a model of disrupted connectivity in schizophrenia, resulting from the effects of neurodevelopmental environmental stress on a background of genetic vulnerability. In addition, we show how the top candidate genes identified by CFG can be used to generate a genetic risk prediction score (GRPS) to aid schizophrenia diagnostics, with predictive ability in independent cohorts. The GRPS also differentiates classic age of onset schizophrenia from early onset and late-onset disease.
    [Show full text]
  • Avian Binocularity and Adaptation to Nocturnal Environments: Genomic Insights Froma Highly Derived Visual Phenotype Rui Borges Universidade Do Porto - Portugal
    Nova Southeastern University NSUWorks Biology Faculty Articles Department of Biological Sciences 8-22-2019 Avian Binocularity and Adaptation to Nocturnal Environments: Genomic Insights froma Highly Derived Visual Phenotype Rui Borges Universidade do Porto - Portugal Joao Fonseca Universidade do Porto - Portugal Cidalia Gomes Universidade do Porto - Portugal Warren E. Johnson Smithsonian Institution Stephen James O'Brien St. Petersburg State University - Russia; Nova Southeastern University, [email protected] See next page for additional authors Follow this and additional works at: https://nsuworks.nova.edu/cnso_bio_facarticles Part of the Biology Commons NSUWorks Citation Borges, Rui; Joao Fonseca; Cidalia Gomes; Warren E. Johnson; Stephen James O'Brien; Guojie Zhang; M. Thomas P. Gilbert; Erich D. Jarvis; and Agostinho Antunes. 2019. "Avian Binocularity and Adaptation to Nocturnal Environments: Genomic Insights froma Highly Derived Visual Phenotype." Genome Biology and Evolution 11, (8): 2244-2255. doi:10.1093/gbe/evz111. This Article is brought to you for free and open access by the Department of Biological Sciences at NSUWorks. It has been accepted for inclusion in Biology Faculty Articles by an authorized administrator of NSUWorks. For more information, please contact [email protected]. Authors Rui Borges, Joao Fonseca, Cidalia Gomes, Warren E. Johnson, Stephen James O'Brien, Guojie Zhang, M. Thomas P. Gilbert, Erich D. Jarvis, and Agostinho Antunes This article is available at NSUWorks: https://nsuworks.nova.edu/cnso_bio_facarticles/982 GBE Avian Binocularity and Adaptation to Nocturnal Environments: Genomic Insights from a Highly Derived Visual Downloaded from https://academic.oup.com/gbe/article-abstract/11/8/2244/5544263 by Nova Southeastern University/HPD Library user on 16 September 2019 Phenotype Rui Borges1,2,Joao~ Fonseca1,Cidalia Gomes1, Warren E.
    [Show full text]
  • Large Homozygous RAB3GAP1 Gene Microdeletion Causes Warburg
    Picker-Minh et al. Orphanet Journal of Rare Diseases 2014, 9:113 http://www.ojrd.com/content/9/1/113 LETTER TO THE EDITOR Open Access Large homozygous RAB3GAP1 gene microdeletion causes Warburg Micro Syndrome 1 Sylvie Picker-Minh1,2,3, Andreas Busche4, Britta Hartmann4, Birgit Spors5, Eva Klopocki6,7, Christoph Hübner1, Denise Horn6 and Angela M Kaindl1,2,3* Abstract Warburg micro syndrome (WARBM) is a genetic heterogeneous disease characterized by microcephaly, intellectual disability, brain, ocular, and endocrine anomalies. WARBM1-4 can be caused by biallelic mutations of the RAB3GAP1 (RAB3 GTPase-activating protein 1), RAB3GAP2, RAB18 (RAS-associated protein RAB18), or TBC1D20 (TBC1 domain protein, member 20) gene, respectively. Here, we delineate the so far largest intragenic homozygous RAB3GAP1 microdeletion. Despite the size of the RAB3GAP1 gene deletion, the patient phenotype is mainly consistent with that of other WARBM1 patients, supporting strongly the theory that WARBM1 is caused by a loss of RAB3GAP1 function. We further highlight osteopenia as a feature of WARBM1. Keywords: RAB3GAP1, WARBM, Warburg micro syndrome, Microcephaly, Intellectual disability, Congenital cataract, Array CGH Letter to the editor protein-function [1,2,4-7], putatively explaining the lack of Warburg micro syndrome (WARBM) is a rare autosomal a genotype-phenotype correlation. We here report the lar- recessive disorder characterized by neurodevelopmental gest RAB3GAP1 gene microdeletion to date in patients abnormalities such as congenital or postnatal microcephaly, with WARBM1 and compare their phenotype with that of severe intellectual disability, pachy- or polymicrogyria, other WARBM1 patients. The two index patients were and hypoplasia/agenesis of the corpus callosum as well as born at term without complications as the first and second ocular manifestations including congenital cataract, micro- child of healthy, consanguineous parents of Kurdish- cornea, microphthalmia, and optic atrophy [1-3].
    [Show full text]
  • D82b54407ece9642da45e12eee
    Oxford Medical Case Reports, 2020;4,1–3 doi: 10.1093/omcr/omaa031 Case Report CASE REPORT Novel mutation in the RAB3GAP1 gene, the first diagnosed Warburg Micro syndrome case in Syria Soubhi Tenawi1,†, Rawan Al Khudari1,†,* and Diana Alasmar2 1Faculty of Medicine, Damascus University, Damascus, Syria, 2Professor of Inborn Errors of Metabolism, Pediatrics Department, Damascus University, Damascus, Syria *Correspondence address. Faculty of Medicine, Damascus University, Damascus, Syria. Tel: +963992336336; E-mail: [email protected] Abstract Warburg Micro syndrome is a rare autosomal recessive disease due to mutation in the RAB3GAP1, RAB3GAP2, RAB18 and TBC1D20 genes. It is commonly seen in consanguineous marriages, characterized by optic (microcornea, microphthalmia, congenital cataracts), neurologic )microcephaly, corpus callosum hypoplasia, severe mental retardation( and hypogonadism; some non-typical findings could be present (cardiomyopathy, peripheral neuropathy). We report a novel homozygous mutation in the RAB3GAP1 gene in a 7-month-old boy from healthy nonconsanguineous parents from the same village in Syria, with bilateral congenital cataracts, hypogonadism, muscular hypotonia and severe developmental delay. Whole exome sequencing (WES) showed a homozygous mutation in the c.2195del p.(Pro732Glnfs∗6) in exon 19 of the RAB3GAP1 gene, which is likely pathogenic and correlates with Warburg Micro syndrome type 1. INTRODUCTION eye and brain [4]. Here, we report a novel RAB3GAP1 homozygous mutation in a child with WARBM. Warburg Micro syndrome (WARBM) is a rare autosomal reces- sive disorder characterized by postnatal growth retardation, hypoplasia of the corpus callosum, microcephalus, delayed CASE REPORT motor development, severe intellectual disability, microph- thalmia, microcornea, congenital cataracts, optic atrophy and A 7-month-old boy presented to Children’s University Hospi- hypogonadism [1].
    [Show full text]
  • Download Ppis for Each Single Seed, Thus Obtaining Each Seed’S Interactome (Ferrari Et Al., 2018)
    bioRxiv preprint doi: https://doi.org/10.1101/2021.01.14.425874; this version posted January 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Integrating protein networks and machine learning for disease stratification in the Hereditary Spastic Paraplegias Nikoleta Vavouraki1,2, James E. Tomkins1, Eleanna Kara3, Henry Houlden3, John Hardy4, Marcus J. Tindall2,5, Patrick A. Lewis1,4,6, Claudia Manzoni1,7* Author Affiliations 1: Department of Pharmacy, University of Reading, Reading, RG6 6AH, United Kingdom 2: Department of Mathematics and Statistics, University of Reading, Reading, RG6 6AH, United Kingdom 3: Department of Neuromuscular Diseases, UCL Queen Square Institute of Neurology, London, WC1N 3BG, United Kingdom 4: Department of Neurodegenerative Disease, UCL Queen Square Institute of Neurology, London, WC1N 3BG, United Kingdom 5: Institute of Cardiovascular and Metabolic Research, University of Reading, Reading, RG6 6AS, United Kingdom 6: Department of Comparative Biomedical Sciences, Royal Veterinary College, London, NW1 0TU, United Kingdom 7: School of Pharmacy, University College London, London, WC1N 1AX, United Kingdom *Corresponding author: [email protected] Abstract The Hereditary Spastic Paraplegias are a group of neurodegenerative diseases characterized by spasticity and weakness in the lower body. Despite the identification of causative mutations in over 70 genes, the molecular aetiology remains unclear. Due to the combination of genetic diversity and variable clinical presentation, the Hereditary Spastic Paraplegias are a strong candidate for protein- protein interaction network analysis as a tool to understand disease mechanism(s) and to aid functional stratification of phenotypes.
    [Show full text]
  • RAB3GAP1 Gene RAB3 Gtpase Activating Protein Catalytic Subunit 1
    RAB3GAP1 gene RAB3 GTPase activating protein catalytic subunit 1 Normal Function The RAB3GAP1 gene provides instructions for making a protein that helps regulate the activity of specialized proteins called GTPases, which control a variety of functions in cells. To perform its function, the RAB3GAP1 protein interacts with another protein called RAB3GAP2 (produced from the RAB3GAP2 gene) to form the RAB3GAP complex. Often referred to as molecular switches, GTPases can be turned on and off. They are turned on (active) when they are attached (bound) to a molecule called GTP and are turned off (inactive) when they are bound to another molecule called GDP. The RAB3GAP complex turns on a GTPase known as RAB18 by exchanging GTP for the attached GDP. When active, RAB18 is involved in a process called vesicle trafficking, which moves proteins and other molecules within cells in sac-like structures called vesicles. RAB18 regulates the movement of substances between compartments in cells and the storage and release of fats (lipids) by structures called lipid droplets. The protein also appears to play a role in a process called autophagy, which helps clear unneeded materials from cells. RAB18 is important for the organization of a cell structure called the endoplasmic reticulum, which is involved in protein processing and transport. The RAB3GAP complex is also thought to inactivate another GTPase known as RAB3 by stimulating a reaction that turns the attached GTP into GDP. RAB3 plays a role in the release of hormones and brain chemicals (neurotransmitters) from cells. Health Conditions Related to Genetic Changes RAB18 deficiency More than 60 RAB3GAP1 gene mutations have been found to cause RAB18 deficiency, resulting in conditions that affect the eyes, brain, and reproductive system.
    [Show full text]
  • Hypogonadotropic Hypogonadism Due to Variants in RAB3GAP2: Expanding The
    Downloaded from molecularcasestudies.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press Hypogonadotropic Hypogonadism due to Variants in RAB3GAP2: Expanding the Phenotypic and Genotypic spectrum of Martsolf Syndrome Wanxue Xu1, Lacey Plummer1, Richard Quinton2, Francesca Swords3, William F. Crowley1, Stephanie B. Seminara1, Ravikumar Balasubramanian1 1 Harvard Reproductive Endocrine Sciences Center, Reproductive Endocrine Unit of the Department of Medicine, Massachusetts General Hospital, Boston, MA, USA. 2 Newcastle-upon-Tyne Hospitals Foundation NHS Trust (Royal Victoria Infirmary) and Institute of Genetic Medicine, University of Newcastle-upon-Tyne, Newcastle-upon-Tyne, United Kingdom 3 Norfolk and Norwich University Hospitals NHS Foundation Trust, Clinical Research and Trials Unit, Norwich, UK. Corresponding author(s): [email protected]; [email protected] 1 Downloaded from molecularcasestudies.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press Abstract Biallelic pathogenic variants in RAB3GAP2 cause Warburg Micro syndrome (WARBM) and Martsolf syndrome (MS), two rare, phenotypically overlapping disorders characterized by congenital cataracts, intellectual disability, and hypogonadism. Although the initial report documented hypergonadotropic hypogonadism (implying a gonadal defect), an adolescent girl with WARBM/MS was subsequently reported to have hypogonadotropic hypogonadism (implying a central defect in either the hypothalamus or anterior pituitary).
    [Show full text]
  • A Genomic Approach to Delineating the Occurrence of Scoliosis in Arthrogryposis Multiplex Congenita
    G C A T T A C G G C A T genes Article A Genomic Approach to Delineating the Occurrence of Scoliosis in Arthrogryposis Multiplex Congenita Xenia Latypova 1, Stefan Giovanni Creadore 2, Noémi Dahan-Oliel 3,4, Anxhela Gjyshi Gustafson 2, Steven Wei-Hung Hwang 5, Tanya Bedard 6, Kamran Shazand 2, Harold J. P. van Bosse 5 , Philip F. Giampietro 7,* and Klaus Dieterich 8,* 1 Grenoble Institut Neurosciences, Université Grenoble Alpes, Inserm, U1216, CHU Grenoble Alpes, 38000 Grenoble, France; [email protected] 2 Shriners Hospitals for Children Headquarters, Tampa, FL 33607, USA; [email protected] (S.G.C.); [email protected] (A.G.G.); [email protected] (K.S.) 3 Shriners Hospitals for Children, Montreal, QC H4A 0A9, Canada; [email protected] 4 School of Physical & Occupational Therapy, Faculty of Medicine and Health Sciences, McGill University, Montreal, QC H3G 2M1, Canada 5 Shriners Hospitals for Children, Philadelphia, PA 19140, USA; [email protected] (S.W.-H.H.); [email protected] (H.J.P.v.B.) 6 Alberta Congenital Anomalies Surveillance System, Alberta Health Services, Edmonton, AB T5J 3E4, Canada; [email protected] 7 Department of Pediatrics, University of Illinois-Chicago, Chicago, IL 60607, USA 8 Institut of Advanced Biosciences, Université Grenoble Alpes, Inserm, U1209, CHU Grenoble Alpes, 38000 Grenoble, France * Correspondence: [email protected] (P.F.G.); [email protected] (K.D.) Citation: Latypova, X.; Creadore, S.G.; Dahan-Oliel, N.; Gustafson, Abstract: Arthrogryposis multiplex congenita (AMC) describes a group of conditions characterized A.G.; Wei-Hung Hwang, S.; Bedard, by the presence of non-progressive congenital contractures in multiple body areas.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name RAB18, member RAS oncogene family Gene Symbol RAB18 Organism Human Gene Summary The protein encoded by this gene is a member of a family of Ras-related small GTPases that regulate membrane trafficking in organelles and transport vesicles. Knockdown studies is zebrafish suggest that this protein may have a role in eye and brain development. Mutations in this gene are associated with Warburg micro syndrome type 3. Alternatively spliced transcript variants have been found for this gene. Gene Aliases RAB18LI1 RefSeq Accession No. NC_000010.10, NT_008705.16 UniGene ID Hs.406799 Ensembl Gene ID ENSG00000099246 Entrez Gene ID 22931 Assay Information Unique Assay ID qHsaCED0042708 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000356940, ENST00000375802, ENST00000535776 Amplicon Context Sequence GGAGGAGGAGCCTGTGGTGGTTATTGCTCTGTGTTATAAACTCTGGGAAATTCC ATCTCTTGCATATTTGATCAGATAGTGACATCTTTCTGTATATAAACTCTTTAACTG CTATTTT Amplicon Length (bp) 88 Chromosome Location 10:27826942-27827059 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 96 R2 0.9995 cDNA Cq 20.44 cDNA Tm (Celsius) 76.5 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 24.45 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report RAB18, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard
    [Show full text]
  • A SARS-Cov-2 Protein Interaction Map Reveals Targets for Drug Repurposing
    Article A SARS-CoV-2 protein interaction map reveals targets for drug repurposing https://doi.org/10.1038/s41586-020-2286-9 A list of authors and affiliations appears at the end of the paper Received: 23 March 2020 Accepted: 22 April 2020 A newly described coronavirus named severe acute respiratory syndrome Published online: 30 April 2020 coronavirus 2 (SARS-CoV-2), which is the causative agent of coronavirus disease 2019 (COVID-19), has infected over 2.3 million people, led to the death of more than Check for updates 160,000 individuals and caused worldwide social and economic disruption1,2. There are no antiviral drugs with proven clinical efcacy for the treatment of COVID-19, nor are there any vaccines that prevent infection with SARS-CoV-2, and eforts to develop drugs and vaccines are hampered by the limited knowledge of the molecular details of how SARS-CoV-2 infects cells. Here we cloned, tagged and expressed 26 of the 29 SARS-CoV-2 proteins in human cells and identifed the human proteins that physically associated with each of the SARS-CoV-2 proteins using afnity-purifcation mass spectrometry, identifying 332 high-confdence protein–protein interactions between SARS-CoV-2 and human proteins. Among these, we identify 66 druggable human proteins or host factors targeted by 69 compounds (of which, 29 drugs are approved by the US Food and Drug Administration, 12 are in clinical trials and 28 are preclinical compounds). We screened a subset of these in multiple viral assays and found two sets of pharmacological agents that displayed antiviral activity: inhibitors of mRNA translation and predicted regulators of the sigma-1 and sigma-2 receptors.
    [Show full text]