DOCSLIB.ORG

NLRP9B Protein Is Dispensable for Oocyte Maturation and Early

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
NLRP9B Protein Is Dispensable for Oocyte Maturation and Early Journal of Reproduction and Development, Vol. 61, No 6, 2015 —Original Article— NLRP9B protein is dispensable for oocyte maturation and early embryonic development in the mouse Hui PENG1), Xiujiao LIN1), Fang LIU1), Cheng WANG1) and Wenchang ZHANG1) 1)College of Animal Science, Fujian Agriculture and Forestry University, Fujian 350002, P. R. China Abstract. Nlrp9a, Nlrp9b and Nlrp9c are preferentially expressed in oocytes and early embryos in the mouse. Simultaneous genetic ablation of Nlrp9a and Nlrp9c does not affect early embryonic development, but the function of Nlrp9b in the process of oocyte maturation and embryonic development has not been elucidated. Here we show that both Nlrp9b mRNA and its protein are expressed in ovaries and the small intestine. Moreover, the NLRP9B protein was restricted to oocytes in the ovary and declined with oocyte aging. After ovulation and fertilization, NLRP9B protein was found in preimplantation embryos. Confocal microscopy demonstrated that it was mainly localized in the cytoplasm in the oocytes and blastomeres. Thus, this protein might play a role in oocyte maturation and early embryonic development. However, knockdown of Nlrp9b expression in GV-stage oocytes using RNA interference did not affect oocyte maturation or subsequent parthenogenetic development after Nlrp9b-deficient oocytes were activated. Furthermore,Nlrp9b knockdown zygotes could reach the blastocyst stage after being cultured for 3.5 days in vitro. These results provide the first evidence that the NLRP9B protein is dispensable for oocyte maturation and early embryonic development in the mouse. Key words: Early development, Mouse, NLRP9B protein, Oocyte maturation (J. Reprod. Dev. 61: 559–564, 2015) here are 14 members of the NLRP gene family in primates, while research showed that the NLRP5/MATER, FLOPED, TLE6 and T20 members have been identified in the mouse, with Nlrp1, FILIA proteins form a subcortical complex in the oocyte that plays Nlrp4 and Nlrp9 showing lineage-specific replication. However, an important role in the first zygotic cleavage [3, 4]. Knockdown of Nlrp7, Nlrp8, Nlrp11 and Nlrp13 might have been lost during mouse Nlrp2 or Nlrp14 expressions in the zygote led to most zygotes being evolution and have not yet been identified. arrested at the 1-cell to 8-cell stage [6, 9]. Besides Nlrp2, Nlrp5 Phylogenetic analysis has shown that the Nlrp gene family has and Nlrp14, Nlrp4a–Nlrp4g also show specificity or are mainly divided into two clades involving immunization- and reproduction- expressed in the ovary [14, 16]. The latest research has indicated related functions in mice [1]. Initially, research on this gene fam- that the Nlrp9a–Nlrp9c transcripts exist predominantly in oocytes ily focused on apoptosis and inflammatory signaling pathways. and early embryos [15]. Furthermore, simultaneous genetic ablation Nevertheless, further studies have shown that some Nlrp genes also of Nlrp9a and Nlrp9c does not affect early embryonic development play a significant role in reproduction [2–6]. The reproduction-related in the mouse [17]. However, the function of Nlrp9b in the process genes are mainly expressed in the ovary and play vital roles in of oocyte maturation and embryonic development in the mouse has oogenesis and preimplantation embryo development [7–15]. Thus, not been elucidated. investigation of the functions of reproduction-related genes is of In this study, RNA interference was employed to investigate great significance in understanding the mechanism of oogenesis, the function of Nlrp9b in oocyte maturation and early embryonic oocyte maturation and early embryonic development in the mouse. development in the mouse. The results indicated that Nlrp9b-deficient In silico methods revealed that Nlrp2, Nlrp4a-Nlrp4g, Nlrp5/ oocytes can undergo normal maturation and that Nlrp9b knockdown Mater, Nlrp9a–Nlrp9c and Nlrp14 are reproduction-related genes in zygotes could reach the blastocyst stage. These data provide the first the mouse [1]. Nlrp5/Mater was one of the first genes to be identi- evidence that Nlrp9b is dispensable for oocyte maturation and early fied as having a maternal effect, as an Nlrp5 knockout experiment embryonic development in the mouse. showed that Nlrp5-deficient embryos arrested at the 2-cell stage, causing female infertility, even though the formation of follicles, Materials and Methods oocyte maturation and fertilization were all normal [2]. Further Ethics statement Received: April 20, 2015 The experimental procedure was approved by the Animal Care Accepted: August 7, 2015 Commission of the College of Animal Science, Fujian Agriculture Published online in J-STAGE: September 28, 2015 and Forestry University. Adult male and female ICR strain mice were ©2015 by the Society for Reproduction and Development purchased from the Experimental Animal Center of Fujian Medical Correspondence: W Zhang (e-mail: [email protected]) University (Fuzhou, P. R. China). They were provided with water This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial No Derivatives (by-nc-nd) License and mouse chow ad libitum and maintained on a 14/10 h light/dark <http://creativecommons.org/licenses/by-nc-nd/3.0/>. cycle in the Laboratory Animal Facility of the College of Animal 560 PENG et al. Science, Fujian Agriculture and Forestry University. Western blotting Protein samples from mouse tissues, oocytes, and preimplanta- Chemicals tion embryos were homogenized and solubilized in RIPA lysis All chemicals and reagents were obtained from Sigma-Aldrich buffer (P0013B, Beyotime Institute of Biotechnology, Jiangsu, P. (St Louis, MO, USA) unless otherwise stated. Sterile plastic ware R. China). The tissue lysates were centrifuged at 12,000 g for 20 was purchased from Nunclon (Roskilde, Denmark). min at 4 C. The supernatant fractions were collected, and the protein concentrations were determined using a bicinchoninic acid protein Collection of oocytes and preimplantation embryos assay kit (Pierce, Rockford, IL, USA). Equal amounts of protein In the experiments using germinal vesicle (GV)-stage oocytes, obtained from tissues or oocytes and preimplantation embryos were female ICR mice were injected with 10 IU pregnant mare serum separated in 10% polyacrylamide gels containing 0.1% SDS and gonadotropin (PMSG) by intraperitoneal injection 48 h before transferred to hydrophobic PVDF membranes (Millipore, Bedford, collection of oocytes. The ovaries were removed and placed in MA, USA). Membranes were blocked with Tris-buffered saline Hepes-buffered potassium simplex optimized medium (H-KSOM) (TBS pH 7.4)/0.1% Tween 20 (TBST) containing 5% dry milk containing 0.1 mM 3-isobutyl-1-methyl-xanthine to produce meiotic for 4 h at room temperature, incubated with antibodies against arrest, and oocytes were released by puncturing the edges of the NLRP9B (NBP2-24661, Novus Biologicals, Littleton, CO, USA; ovaries with hypodermic needles. Metaphase II oocytes were obtained 1:100) overnight at 4 C and then washed three times in TBST. A from the oviducts of female mice that had been given a second horseradish peroxidase-conjugated secondary antibody was added 2 injection of 10 IU human chorionic gonadotropin 48 h after the h prior to processing using an ECL (enhanced chemiluminescence) PMSG injection. Cumulus masses were released into H-KSOM Advance Western Blotting detection system (Pierce). β-Actin was containing hyaluronidase (1 mg/ml). Parthenogenetic activation of used as a loading control. oocytes and collection of preimplantation embryos were performed as described previously [6]. Immunohistochemistry Mouse ovaries were fixed in 4% paraformaldehyde overnight, Reverse transcription polymerase chain reaction (RT–PCR) embedded in paraffin wax and sectioned at 6 μm. These sections and quantitative real-time RT–PCR analysis were then deparaffinized, rehydrated and heated in 10 mM sodium Total RNA was collected from 4-week-old mouse tissues (ovary, citrate buffer (pH 6.0) with microwaves for antigen retrieval. small intestine, testis, lung, heart, liver, brain, stomach, spleen and Immunohistochemistry of ovarian tissues using UltraSensitive™ muscle) using RNeasy Mini Kits (Qiagen, Valencia, CA, USA). SAP IHC kits (Fuzhou Maixin Biotech, P. R. China) was performed as Complementary (c) DNA was synthesized using a PrimeScript II described previously [6]. In brief, sections were incubated with 10% 1st strand cDNA Synthesis Kit (TaKaRa, Otsu, Japan). Oocytes nonimmune goat serum and then with an anti-NLRP9B polyclonal (10 per group) were lysed, and first-strand cDNA was synthesized antibody (1:100) overnight at 4 C, followed by reaction with a directly using a SuperScript® III CellsDirect cDNA Synthesis Kit biotinylated goat anti-rabbit secondary antibody. After several washes, (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s streptavidin–peroxidase and a diaminobenzidine substrate solution protocol. The primer sequences used for RT–PCR and quantitative were applied to the sections. Negative controls were performed via real-time RT–PCR were 5′–GACTTCACCAGTGACTGTTGTG–3′ processing sections as above with the absence of the primary antibody. (forward) and 5′–CCATACCAGACGAACACCC–3′ (reverse) for Nlrp9a, 5′– CACCAGTGACTGTTGTAAGGAC–3′ (forward) Immunofluorescence and 5′–TTCCTGCTGTTCCATACCAG–3′ (reverse) for Nlrp9b, Oocytes and embryos were fixed in 4% paraformaldehyde in 5′–TTCCAGTGAATCAACATCAGCT–3′ (forward) and 5′– phosphate-buffered saline (PBS) for 1 h at room temperature, GAACAGGGTAGCAAAGTACCA–3′
Load more

Recommended publications
  • Role of Nlrs in the Regulation of Type I Interferon Signaling, Host Defense and Tolerance to Inflammation
    International Journal of Molecular Sciences Review Role of NLRs in the Regulation of Type I Interferon Signaling, Host Defense and Tolerance to Inflammation Ioannis Kienes 1, Tanja Weidl 1, Nora Mirza 1, Mathias Chamaillard 2 and Thomas A. Kufer 1,* 1 Department of Immunology, Institute for Nutritional Medicine, University of Hohenheim, 70599 Stuttgart, Germany; [email protected] (I.K.); [email protected] (T.W.); [email protected] (N.M.) 2 University of Lille, Inserm, U1003, F-59000 Lille, France; [email protected] * Correspondence: [email protected] Abstract: Type I interferon signaling contributes to the development of innate and adaptive immune responses to either viruses, fungi, or bacteria. However, amplitude and timing of the interferon response is of utmost importance for preventing an underwhelming outcome, or tissue damage. While several pathogens evolved strategies for disturbing the quality of interferon signaling, there is growing evidence that this pathway can be regulated by several members of the Nod-like receptor (NLR) family, although the precise mechanism for most of these remains elusive. NLRs consist of a family of about 20 proteins in mammals, which are capable of sensing microbial products as well as endogenous signals related to tissue injury. Here we provide an overview of our current understanding of the function of those NLRs in type I interferon responses with a focus on viral infections. We discuss how NLR-mediated type I interferon regulation can influence the development of auto-immunity and the immune response to infection. Citation: Kienes, I.; Weidl, T.; Mirza, Keywords: NOD-like receptors; Interferons; innate immunity; immune regulation; type I interferon; N.; Chamaillard, M.; Kufer, T.A.
    [Show full text]
  • NOD-Like Receptors in the Eye: Uncovering Its Role in Diabetic Retinopathy
    International Journal of Molecular Sciences Review NOD-like Receptors in the Eye: Uncovering Its Role in Diabetic Retinopathy Rayne R. Lim 1,2,3, Margaret E. Wieser 1, Rama R. Ganga 4, Veluchamy A. Barathi 5, Rajamani Lakshminarayanan 5 , Rajiv R. Mohan 1,2,3,6, Dean P. Hainsworth 6 and Shyam S. Chaurasia 1,2,3,* 1 Ocular Immunology and Angiogenesis Lab, University of Missouri, Columbia, MO 652011, USA; [email protected] (R.R.L.); [email protected] (M.E.W.); [email protected] (R.R.M.) 2 Department of Biomedical Sciences, University of Missouri, Columbia, MO 652011, USA 3 Ophthalmology, Harry S. Truman Memorial Veterans’ Hospital, Columbia, MO 652011, USA 4 Surgery, University of Missouri, Columbia, MO 652011, USA; [email protected] 5 Singapore Eye Research Institute, Singapore 169856, Singapore; [email protected] (V.A.B.); [email protected] (R.L.) 6 Mason Eye Institute, School of Medicine, University of Missouri, Columbia, MO 652011, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-573-882-3207 Received: 9 December 2019; Accepted: 27 January 2020; Published: 30 January 2020 Abstract: Diabetic retinopathy (DR) is an ocular complication of diabetes mellitus (DM). International Diabetic Federations (IDF) estimates up to 629 million people with DM by the year 2045 worldwide. Nearly 50% of DM patients will show evidence of diabetic-related eye problems. Therapeutic interventions for DR are limited and mostly involve surgical intervention at the late-stages of the disease. The lack of early-stage diagnostic tools and therapies, especially in DR, demands a better understanding of the biological processes involved in the etiology of disease progression.
    [Show full text]
  • ATP-Binding and Hydrolysis in Inflammasome Activation
    molecules Review ATP-Binding and Hydrolysis in Inflammasome Activation Christina F. Sandall, Bjoern K. Ziehr and Justin A. MacDonald * Department of Biochemistry & Molecular Biology, Cumming School of Medicine, University of Calgary, 3280 Hospital Drive NW, Calgary, AB T2N 4Z6, Canada; [email protected] (C.F.S.); [email protected] (B.K.Z.) * Correspondence: [email protected]; Tel.: +1-403-210-8433 Academic Editor: Massimo Bertinaria Received: 15 September 2020; Accepted: 3 October 2020; Published: 7 October 2020 Abstract: The prototypical model for NOD-like receptor (NLR) inflammasome assembly includes nucleotide-dependent activation of the NLR downstream of pathogen- or danger-associated molecular pattern (PAMP or DAMP) recognition, followed by nucleation of hetero-oligomeric platforms that lie upstream of inflammatory responses associated with innate immunity. As members of the STAND ATPases, the NLRs are generally thought to share a similar model of ATP-dependent activation and effect. However, recent observations have challenged this paradigm to reveal novel and complex biochemical processes to discern NLRs from other STAND proteins. In this review, we highlight past findings that identify the regulatory importance of conserved ATP-binding and hydrolysis motifs within the nucleotide-binding NACHT domain of NLRs and explore recent breakthroughs that generate connections between NLR protein structure and function. Indeed, newly deposited NLR structures for NLRC4 and NLRP3 have provided unique perspectives on the ATP-dependency of inflammasome activation. Novel molecular dynamic simulations of NLRP3 examined the active site of ADP- and ATP-bound models. The findings support distinctions in nucleotide-binding domain topology with occupancy of ATP or ADP that are in turn disseminated on to the global protein structure.
    [Show full text]
  • Expression Pro Les of NOD-Like Receptors and Regulation Of
    Expression Proles of NOD-Like Receptors and Regulation of NLRP3 Inammasome Activation in Toxoplasma Gondii- Infected Human Small Intestinal Epithelial Cells Jia-Qi CHu Guangdong Medical University Fei Fei Gao Chungnam National University Weiyun Wu Guangdong Medical College Zhanjiang Campus: Guangdong Medical University Chunchao Li Guangdong Medical University Zhaobin Pan Guangdong Medical University Jinhui Sun Guangdong Medical University Hao Wang Guangdong Medical University Cong Huang Peking University Shenzhen Hospital Sang Hyuk Lee Sun General Hospital: Daejeon Sun Hospital Juan-Hua Quan Guangdong Medical University Young-Ha Lee ( [email protected] ) Chungnam National University School of Medicine Research Keywords: Toxoplasma gondii, Human small intestinal epithelial cells, NOD-like receptors, inammasome, Caspase-cleaved interleukins Posted Date: December 23rd, 2020 DOI: https://doi.org/10.21203/rs.3.rs-133332/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published on March 12th, 2021. See the published version at https://doi.org/10.1186/s13071-021-04666-w. Page 1/17 Abstract Background: Toxoplasma gondii is a parasite that majorly infects through the oral route. Nucleotide-binding oligomerization domain (NOD)-like receptors (NLRs) play crucial roles in the immune responses generated during the parasitic infection and also drive the inammatory response against invading parasites. However, little is known about the regulation of NLRs and inammasome activation in T. gondii-infected human small intestinal epithelial (FHs 74 Int) cells. Methods: FHs 74 Int cells infected with T. gondii were subsequently evaluated for morphological changes, cytotoxicity, expression proles of NLRs, inammasome components, caspase-cleaved interleukins (ILs), and the mechanisms of NLRP3 and NLRP6 inammasome activation.
    [Show full text]
  • Characterisation of Human Macrophage Functions in Innate Immunity
    Characterisation of human macrophage functions in innate immunity Juliana Ariffin B. Biomedical Science (Hons) A thesis submitted for the degree of Doctor of Philosophy at The University of Queensland in 2015 Institute for Molecular Bioscience Abstract Macrophages are key cellular mediators of the innate immune system. During an infection, phagocytosis of microorganisms delivers them to the macrophage phagolysosome where they are targeted for destruction by immediate antimicrobial responses. In parallel with this, signalling via pattern recognition receptors such as the Toll-like Receptors (TLRs) turns on expression of a set of genes to enable a second wave of inducible antimicrobial responses. Such responses enable macrophages to combat microorganisms that can evade immediate antimicrobial pathways. Mouse models have provided a powerful tool to study the innate immune system in the context of infection and inflammation, however some antimicrobial pathways are divergently regulated between human and mouse. This may partly reflect divergent evolution between species, due to selection pressure to co-evolve with rapidly-evolving pathogens. In view of this, this project aimed to explore novel aspects of human macrophage antimicrobial pathways. In Chapter 3 of this thesis, genetic analysis was conducted to validate the differential expression of novel TLR4-inducible genes in primary human versus mouse macrophages. From this initial analysis, four genes (RNF144B, BATF3, G0S2 and SLC41A2) were chosen for further functional analysis. In addition to their differential regulation, these genes were chosen based on novelty and biological functions in the context of innate immunity. Functional analysis by gene knockdown focused on investigating potential roles in macrophage inflammatory and antimicrobial responses.
    [Show full text]
  • Phd Degree in Molecular Medicine (Curriculum in Computational Biology)
    PhD degree in Molecular Medicine (curriculum in Computational Biology) European School of Molecular Medicine (SEMM), University of Milan and University of Naples “Federico II” Settore Disciplinare: MED/04 Computational frameworks for the identification of somatic and germline variants contributing to cancer predisposition and development Giorgio Enrico Maria Melloni IIT@SEMM, Milan Matricola n. R10338 Supervisor: Prof. Piergiuseppe Pelicci IEO, Milan Added Supervisor: Dr. Laura Riva IIT@SEMM, Milan Anno accademico 2015-2016 2 TABLE OF CONTENTS 1 ABSTRACT ......................................................................................................................................... 5 2 INTRODUCTION ............................................................................................................................... 6 2.1 CANCER AS AN EVOLUTIONARY PROCESS .................................................................................................... 6 2.2 ACCUMULATING DRIVER MUTATIONS .......................................................................................................... 8 2.3 TUMOR HETEROGENEITY ............................................................................................................................. 10 2.4 CANCER GENOME LANDSCAPES ................................................................................................................. 11 2.5 DRIVER VS PASSENGER: A PROBLEM OF MUTATION RATE ....................................................................... 13 2.6 CANCER
    [Show full text]
  • NOD-Like Receptors (Nlrs) and Inflammasomes
    International Edition www.adipogen.com NOD-like Receptors (NLRs) and Inflammasomes In mammals, germ-line encoded pattern recognition receptors (PRRs) detect the presence of pathogens through recognition of pathogen-associated molecular patterns (PAMPs) or endogenous danger signals through the sensing of danger-associated molecular patterns (DAMPs). The innate immune system comprises several classes of PRRs that allow the early detection of pathogens at the site of infection. The membrane-bound toll-like receptors (TLRs) and C-type lectin receptors (CTRs) detect PAMPs in extracellular milieu and endo- somal compartments. TRLs and CTRs cooperate with PRRs sensing the presence of cytosolic nucleic acids, like RNA-sensing RIG-I (retinoic acid-inducible gene I)-like receptors (RLRs; RLHs) or DNA-sensing AIM2, among others. Another set of intracellular sensing PRRs are the NOD-like receptors (NLRs; nucleotide-binding domain leucine-rich repeat containing receptors), which not only recognize PAMPs but also DAMPs. PAMPs FUNGI/PROTOZOA BACTERIA VIRUSES MOLECULES C. albicans A. hydrophila Adenovirus Bacillus anthracis lethal Plasmodium B. brevis Encephalomyo- toxin (LeTx) S. cerevisiae E. coli carditis virus Bacterial pore-forming L. monocytogenes Herpes simplex virus toxins L. pneumophila Influenza virus Cytosolic dsDNA N. gonorrhoeae Sendai virus P. aeruginosa Cytosolic flagellin S. aureus MDP S. flexneri meso-DAP S. hygroscopicus S. typhimurium DAMPs MOLECULES PARTICLES OTHERS DNA Uric acid UVB Extracellular ATP CPPD Mutations R837 Asbestos Cytosolic dsDNA Irritants Silica Glucose Alum Hyaluronan Amyloid-b Hemozoin Nanoparticles FIGURE 1: Overview on PAMPs and DAMPs recognized by NLRs. NOD-like Receptors [NLRs] The intracellular NLRs organize signaling complexes such as inflammasomes and NOD signalosomes.
    [Show full text]
  • A Nucleotide-Binding Oligomerization Domain for Innate Immunity and Reproduction
    Editorial Page 1 of 5 A nucleotide-binding oligomerization domain for innate immunity and reproduction Yike Yin, Ce Shan, Zhonghan Li Center for Growth, Metabolism & Aging Key Laboratory of Bio-Resource and Eco-Environment of Ministry of Education, College of Life Sciences, Sichuan University, Chengdu 610065, China Correspondence to: Zhonghan Li. College of Life Sciences, Sichuan University, Chengdu 610065, China. Email: [email protected]. Provenance: This is an invited Editorial commissioned by Section Editor Dr. Ziwei Li (Department of Surgery, First Affiliated Hospital of Kunming Medical School, Kunming, China). Comment on: Abe T, Lee A, Sitharam R, et al. Germ-Cell-Specific Inflammasome Component NLRP14 Negatively Regulates Cytosolic Nucleic Acid Sensing to Promote Fertilization. Immunity 2017;46:621-34. Received: 02 February 2018; Accepted: 27 February 2018; Published: 03 April 2018. doi: 10.21037/amj.2018.03.05 View this article at: http://dx.doi.org/10.21037/amj.2018.03.05 Exposure to the various environmental microbial pathogens still largely unknown. is a constant threat to mammals. As a rapid mobilized first NOD, LRR, and pyrin domain containing proteins line defense, innate immunity is of critical importance for (NLRPs) are members of NLRs protein family (4). Previous mammalian cells to maintain their normal activities. One of studies focused on their roles in apoptotic and inflammatory the key features of innate immune response is to distinguish signaling pathways via the formation of an inflammasome non-self from self cues and thus initiates downstream and activation of caspases in innate immunity (5-7). defense responses including releasing cytokines, activation However, more recent researches have revealed their roles and recruitment of immune cells, etc.
    [Show full text]
  • The Evolution of Reproduction-Related NLRP Genes
    J Mol Evol (2014) 78:194–201 DOI 10.1007/s00239-014-9614-3 REVIEW The Evolution of Reproduction-Related NLRP Genes Edgar A. Due´n˜ez-Guzma´n • David Haig Received: 17 January 2013 / Accepted: 19 February 2014 / Published online: 11 March 2014 Ó Springer Science+Business Media New York 2014 Abstract NLRP proteins are important components of Introduction inflammasomes with a major role in innate immunity. A subset of NLRP genes, with unknown functions, are NLRP proteins (Nod-like receptors with a pyrin domain) expressed in oocytes and early embryos. Mutations of have attracted recent attention because of their role in Nlrp5 in mice are associated with maternal-effect embry- innate immunity and inflammation (Kufer and Sansonetti onic lethality and mutations of NLRP7 in women are 2011; Strowig et al. 2012). A subset of NLRP genes are associated with conception of biparental complete hyda- expressed in mammalian oocytes (Hamatami et al. 2004; tidiform moles (biCHMs), suggesting perturbed processes Ponsuksili et al. 2006; Zhang et al. 2008) and maternal of genomic imprinting. Recessive mutations on NLRP2/7 deficiency of some of these ‘‘reproduction-related’’ NLRPs in humans are associated with reproductive disorders and (rNLRPs) have been shown to cause embryonic lethality in appear to be induced by a demethylation of the maternal mice (Hamatami et al. 2004; Tong et al. 2000; Peng et al. pronucleus. In this study, we find that radiation of NLRP 2012) and perturbations of genomic imprinting in human genes occurred before the common ancestor of Afrotheria oocytes (Murdoch et al. 2006; Kou et al. 2008; Parry et al.
    [Show full text]
  • Regulation of the Antimicrobial Response by NLR Proteins
    Immunity Review Regulation of the Antimicrobial Response by NLR Proteins Eran Elinav,1,3 Till Strowig,1,3 Jorge Henao-Mejia,1,3 and Richard A. Flavell1,2,* 1Department of Immunobiology, Yale University School of Medicine, New Haven, CT 06520, USA 2Howard Hughes Medical Institute 3These authors contributed equally to this work *Correspondence: richard.fl[email protected] DOI 10.1016/j.immuni.2011.05.007 Nucleotide-binding, oligomerization domain (NOD)-like receptor (NLR) proteins are a family of innate immune receptors that play a pivotal role in microbial sensing, leading to the initiation of antimicrobial immune responses. Dysregulation of the function of multiple NLR family members has been linked, both in mice and humans, to a propensity for infection and autoinflammatory disease. Despite our increased under- standing of NLR function and interactions, many aspects related to mechanisms of sensing, downstream signaling, and in vivo functions remain elusive. In this review, we focus on key members of the NLR family, describing their activation by diverse microbes, downstream effector functions, and interactions with each other and with other innate sensor protein families. Also discussed is the role of microbial sensing by NLR receptors leading to activation of the adaptive immune arm that collaborates in the antimicrobial defense. Introduction building block of the cell wall. Although it is present only in Nucleotide-binding, oligomerization domain-like receptor (NLR) smaller amounts in Gram-negative bacteria, its general abun- proteins are a family of proteins with diverse functions in the dance and its highly conserved structure make PGN a prime immune system, characterized by a shared domain architecture target for recognition by pattern recognition receptors (PRRs).
    [Show full text]
  • The Inflammasomes in Kidney Disease
    BRIEF REVIEW www.jasn.org The Inflammasomes in Kidney Disease Hans-Joachim Anders* and Daniel A. Muruve† *Department of Nephrology, Medizinische Poliklinik, University of Munich, Munich, Germany; and †Department of Medicine, Division of Nephrology and Hypertension and the Immunology Research Group, Institute of Infection, Immunity, and Inflammation, University of Calgary, Calgary, Alberta, Canada ABSTRACT Renal inflammation is a universal response to infectious and noninfectious triggers. DAMP signaling can also trigger inappro- Sensors of the innate immune system, such as Toll-like receptors or RIG-like priate inflammation in sterile types of in- receptors, provide danger recognition platforms on renal cells that integrate and jury and thereby contribute to unnecessary translate the diverse triggers of renal inflammation by inducing cell activation and organ damage and dysfunction. The sci- the secretion of proinflammatory cytokines and chemokines. As a new entry, the ence of danger recognition has only re- inflammasome-forming NLR genes integrate various danger signals into caspase- cently been explored in the field of ne- 1-activating platforms that regulate the processing and secretion of pro-IL-1␤ and phrology,10 and it is still unclear how pro-IL-18 into the mature and active cytokines. Accumulating data now document innate immunity translates infectious and a role for the NLRP3 inflammasome and IL-1␤/IL-18 in many diseases, including noninfectious danger into the various atherosclerosis, diabetes, amyloidosis, malaria, crystal-related diseases, and other forms of kidney disease. Here we focus on autoinflammatory disorders, identifying this innate immune pathway as an attrac- the NLR family of genes that form intracel- tive therapeutic target.
    [Show full text]
  • Evolution and Functional Divergence of NLRP Genes in Mammalian Reproductive Systems Xin Tian, Géraldine Pascal and Philippe Monget*
    BMC Evolutionary Biology BioMed Central Research article Open Access Evolution and functional divergence of NLRP genes in mammalian reproductive systems Xin Tian, Géraldine Pascal and Philippe Monget* Address: Physiologie de la Reproduction et des Comportements, UMR 6175 INRA-CNRS-Université François Rabelais de Tours-Haras Nationaux, 37380 Nouzilly, France Email: Xin Tian - [email protected]; Géraldine Pascal - [email protected]; Philippe Monget* - [email protected] * Corresponding author Published: 14 August 2009 Received: 8 April 2009 Accepted: 14 August 2009 BMC Evolutionary Biology 2009, 9:202 doi:10.1186/1471-2148-9-202 This article is available from: http://www.biomedcentral.com/1471-2148/9/202 © 2009 Tian et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: NLRPs (Nucleotide-binding oligomerization domain, Leucine rich Repeat and Pyrin domain containing Proteins) are members of NLR (Nod-like receptors) protein family. Recent researches have shown that NLRP genes play important roles in both mammalian innate immune system and reproductive system. Several of NLRP genes were shown to be specifically expressed in the oocyte in mammals. The aim of the present work was to study how these genes evolved and diverged after their duplication, as well as whether natural selection played a role during their evolution. Results: By using in silico methods, we have evaluated the evolution and functional divergence of NLRP genes, in particular of mouse reproduction-related Nlrp genes.
    [Show full text]