POSIX Regular Expression Parsing with Derivatives
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Use Perl Regular Expressions in SAS® Shuguang Zhang, WRDS, Philadelphia, PA
NESUG 2007 Programming Beyond the Basics Use Perl Regular Expressions in SAS® Shuguang Zhang, WRDS, Philadelphia, PA ABSTRACT Regular Expression (Regexp) enhance search and replace operations on text. In SAS®, the INDEX, SCAN and SUBSTR functions along with concatenation (||) can be used for simple search and replace operations on static text. These functions lack flexibility and make searching dynamic text difficult, and involve more function calls. Regexp combines most, if not all, of these steps into one expression. This makes code less error prone, easier to maintain, clearer, and can improve performance. This paper will discuss three ways to use Perl Regular Expression in SAS: 1. Use SAS PRX functions; 2. Use Perl Regular Expression with filename statement through a PIPE such as ‘Filename fileref PIPE 'Perl programm'; 3. Use an X command such as ‘X Perl_program’; Three typical uses of regular expressions will also be discussed and example(s) will be presented for each: 1. Test for a pattern of characters within a string; 2. Replace text; 3. Extract a substring. INTRODUCTION Perl is short for “Practical Extraction and Report Language". Larry Wall Created Perl in mid-1980s when he was trying to produce some reports from a Usenet-Nes-like hierarchy of files. Perl tries to fill the gap between low-level programming and high-level programming and it is easy, nearly unlimited, and fast. A regular expression, often called a pattern in Perl, is a template that either matches or does not match a given string. That is, there are an infinite number of possible text strings. -
Lecture 18: Theory of Computation Regular Expressions and Dfas
Introduction to Theoretical CS Lecture 18: Theory of Computation Two fundamental questions. ! What can a computer do? ! What can a computer do with limited resources? General approach. Pentium IV running Linux kernel 2.4.22 ! Don't talk about specific machines or problems. ! Consider minimal abstract machines. ! Consider general classes of problems. COS126: General Computer Science • http://www.cs.Princeton.EDU/~cos126 2 Why Learn Theory In theory . Regular Expressions and DFAs ! Deeper understanding of what is a computer and computing. ! Foundation of all modern computers. ! Pure science. ! Philosophical implications. a* | (a*ba*ba*ba*)* In practice . ! Web search: theory of pattern matching. ! Sequential circuits: theory of finite state automata. a a a ! Compilers: theory of context free grammars. b b ! Cryptography: theory of computational complexity. 0 1 2 ! Data compression: theory of information. b "In theory there is no difference between theory and practice. In practice there is." -Yogi Berra 3 4 Pattern Matching Applications Regular Expressions: Basic Operations Test if a string matches some pattern. Regular expression. Notation to specify a set of strings. ! Process natural language. ! Scan for virus signatures. ! Search for information using Google. Operation Regular Expression Yes No ! Access information in digital libraries. ! Retrieve information from Lexis/Nexis. Concatenation aabaab aabaab every other string ! Search-and-replace in a word processors. cumulus succubus Wildcard .u.u.u. ! Filter text (spam, NetNanny, Carnivore, malware). jugulum tumultuous ! Validate data-entry fields (dates, email, URL, credit card). aa Union aa | baab baab every other string ! Search for markers in human genome using PROSITE patterns. aa ab Closure ab*a abbba ababa Parse text files. -
Backtrack Parsing Context-Free Grammar Context-Free Grammar
Context-free Grammar Problems with Regular Context-free Grammar Language and Is English a regular language? Bad question! We do not even know what English is! Two eggs and bacon make(s) a big breakfast Backtrack Parsing Can you slide me the salt? He didn't ought to do that But—No! Martin Kay I put the wine you brought in the fridge I put the wine you brought for Sandy in the fridge Should we bring the wine you put in the fridge out Stanford University now? and University of the Saarland You said you thought nobody had the right to claim that they were above the law Martin Kay Context-free Grammar 1 Martin Kay Context-free Grammar 2 Problems with Regular Problems with Regular Language Language You said you thought nobody had the right to claim [You said you thought [nobody had the right [to claim that they were above the law that [they were above the law]]]] Martin Kay Context-free Grammar 3 Martin Kay Context-free Grammar 4 Problems with Regular Context-free Grammar Language Nonterminal symbols ~ grammatical categories Is English mophology a regular language? Bad question! We do not even know what English Terminal Symbols ~ words morphology is! They sell collectables of all sorts Productions ~ (unordered) (rewriting) rules This concerns unredecontaminatability Distinguished Symbol This really is an untiable knot. But—Probably! (Not sure about Swahili, though) Not all that important • Terminals and nonterminals are disjoint • Distinguished symbol Martin Kay Context-free Grammar 5 Martin Kay Context-free Grammar 6 Context-free Grammar Context-free -
Adaptive LL(*) Parsing: the Power of Dynamic Analysis
Adaptive LL(*) Parsing: The Power of Dynamic Analysis Terence Parr Sam Harwell Kathleen Fisher University of San Francisco University of Texas at Austin Tufts University [email protected] [email protected] kfi[email protected] Abstract PEGs are unambiguous by definition but have a quirk where Despite the advances made by modern parsing strategies such rule A ! a j ab (meaning “A matches either a or ab”) can never as PEG, LL(*), GLR, and GLL, parsing is not a solved prob- match ab since PEGs choose the first alternative that matches lem. Existing approaches suffer from a number of weaknesses, a prefix of the remaining input. Nested backtracking makes de- including difficulties supporting side-effecting embedded ac- bugging PEGs difficult. tions, slow and/or unpredictable performance, and counter- Second, side-effecting programmer-supplied actions (muta- intuitive matching strategies. This paper introduces the ALL(*) tors) like print statements should be avoided in any strategy that parsing strategy that combines the simplicity, efficiency, and continuously speculates (PEG) or supports multiple interpreta- predictability of conventional top-down LL(k) parsers with the tions of the input (GLL and GLR) because such actions may power of a GLR-like mechanism to make parsing decisions. never really take place [17]. (Though DParser [24] supports The critical innovation is to move grammar analysis to parse- “final” actions when the programmer is certain a reduction is time, which lets ALL(*) handle any non-left-recursive context- part of an unambiguous final parse.) Without side effects, ac- free grammar. ALL(*) is O(n4) in theory but consistently per- tions must buffer data for all interpretations in immutable data forms linearly on grammars used in practice, outperforming structures or provide undo actions. -
Perl Regular Expressions Tip Sheet Functions and Call Routines
– Perl Regular Expressions Tip Sheet Functions and Call Routines Basic Syntax Advanced Syntax regex-id = prxparse(perl-regex) Character Behavior Character Behavior Compile Perl regular expression perl-regex and /…/ Starting and ending regex delimiters non-meta Match character return regex-id to be used by other PRX functions. | Alternation character () Grouping {}[]()^ Metacharacters, to match these pos = prxmatch(regex-id | perl-regex, source) $.|*+?\ characters, override (escape) with \ Search in source and return position of match or zero Wildcards/Character Class Shorthands \ Override (escape) next metacharacter if no match is found. Character Behavior \n Match capture buffer n Match any one character . (?:…) Non-capturing group new-string = prxchange(regex-id | perl-regex, times, \w Match a word character (alphanumeric old-string) plus "_") Lazy Repetition Factors Search and replace times number of times in old- \W Match a non-word character (match minimum number of times possible) string and return modified string in new-string. \s Match a whitespace character Character Behavior \S Match a non-whitespace character *? Match 0 or more times call prxchange(regex-id, times, old-string, new- \d Match a digit character +? Match 1 or more times string, res-length, trunc-value, num-of-changes) Match a non-digit character ?? Match 0 or 1 time Same as prior example and place length of result in \D {n}? Match exactly n times res-length, if result is too long to fit into new-string, Character Classes Match at least n times trunc-value is set to 1, and the number of changes is {n,}? Character Behavior Match at least n but not more than m placed in num-of-changes. -
Sequence Alignment/Map Format Specification
Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345. -
Lexing and Parsing with ANTLR4
Lab 2 Lexing and Parsing with ANTLR4 Objective • Understand the software architecture of ANTLR4. • Be able to write simple grammars and correct grammar issues in ANTLR4. EXERCISE #1 Lab preparation Ï In the cap-labs directory: git pull will provide you all the necessary files for this lab in TP02. You also have to install ANTLR4. 2.1 User install for ANTLR4 and ANTLR4 Python runtime User installation steps: mkdir ~/lib cd ~/lib wget http://www.antlr.org/download/antlr-4.7-complete.jar pip3 install antlr4-python3-runtime --user Then in your .bashrc: export CLASSPATH=".:$HOME/lib/antlr-4.7-complete.jar:$CLASSPATH" export ANTLR4="java -jar $HOME/lib/antlr-4.7-complete.jar" alias antlr4="java -jar $HOME/lib/antlr-4.7-complete.jar" alias grun='java org.antlr.v4.gui.TestRig' Then source your .bashrc: source ~/.bashrc 2.2 Structure of a .g4 file and compilation Links to a bit of ANTLR4 syntax : • Lexical rules (extended regular expressions): https://github.com/antlr/antlr4/blob/4.7/doc/ lexer-rules.md • Parser rules (grammars) https://github.com/antlr/antlr4/blob/4.7/doc/parser-rules.md The compilation of a given .g4 (for the PYTHON back-end) is done by the following command line: java -jar ~/lib/antlr-4.7-complete.jar -Dlanguage=Python3 filename.g4 or if you modified your .bashrc properly: antlr4 -Dlanguage=Python3 filename.g4 2.3 Simple examples with ANTLR4 EXERCISE #2 Demo files Ï Work your way through the five examples in the directory demo_files: Aurore Alcolei, Laure Gonnord, Valentin Lorentz. 1/4 ENS de Lyon, Département Informatique, M1 CAP Lab #2 – Automne 2017 ex1 with ANTLR4 + Java : A very simple lexical analysis1 for simple arithmetic expressions of the form x+3. -
Unicode Regular Expressions Technical Reports
7/1/2019 UTS #18: Unicode Regular Expressions Technical Reports Working Draft for Proposed Update Unicode® Technical Standard #18 UNICODE REGULAR EXPRESSIONS Version 20 Editors Mark Davis, Andy Heninger Date 2019-07-01 This Version http://www.unicode.org/reports/tr18/tr18-20.html Previous Version http://www.unicode.org/reports/tr18/tr18-19.html Latest Version http://www.unicode.org/reports/tr18/ Latest Proposed http://www.unicode.org/reports/tr18/proposed.html Update Revision 20 Summary This document describes guidelines for how to adapt regular expression engines to use Unicode. Status This is a draft document which may be updated, replaced, or superseded by other documents at any time. Publication does not imply endorsement by the Unicode Consortium. This is not a stable document; it is inappropriate to cite this document as other than a work in progress. A Unicode Technical Standard (UTS) is an independent specification. Conformance to the Unicode Standard does not imply conformance to any UTS. Please submit corrigenda and other comments with the online reporting form [Feedback]. Related information that is useful in understanding this document is found in the References. For the latest version of the Unicode Standard, see [Unicode]. For a list of current Unicode Technical Reports, see [Reports]. For more information about versions of the Unicode Standard, see [Versions]. Contents 0 Introduction 0.1 Notation 0.2 Conformance 1 Basic Unicode Support: Level 1 1.1 Hex Notation 1.1.1 Hex Notation and Normalization 1.2 Properties 1.2.1 General -
Regular Expressions with a Brief Intro to FSM
Regular Expressions with a brief intro to FSM 15-123 Systems Skills in C and Unix Case for regular expressions • Many web applications require pattern matching – look for <a href> tag for links – Token search • A regular expression – A pattern that defines a class of strings – Special syntax used to represent the class • Eg; *.c - any pattern that ends with .c Formal Languages • Formal language consists of – An alphabet – Formal grammar • Formal grammar defines – Strings that belong to language • Formal languages with formal semantics generates rules for semantic specifications of programming languages Automaton • An automaton ( or automata in plural) is a machine that can recognize valid strings generated by a formal language . • A finite automata is a mathematical model of a finite state machine (FSM), an abstract model under which all modern computers are built. Automaton • A FSM is a machine that consists of a set of finite states and a transition table. • The FSM can be in any one of the states and can transit from one state to another based on a series of rules given by a transition function. Example What does this machine represents? Describe the kind of strings it will accept. Exercise • Draw a FSM that accepts any string with even number of A’s. Assume the alphabet is {A,B} Build a FSM • Stream: “I love cats and more cats and big cats ” • Pattern: “cat” Regular Expressions Regex versus FSM • A regular expressions and FSM’s are equivalent concepts. • Regular expression is a pattern that can be recognized by a FSM. • Regex is an example of how good theory leads to good programs Regular Expression • regex defines a class of patterns – Patterns that ends with a “*” • Regex utilities in unix – grep , awk , sed • Applications – Pattern matching (DNA) – Web searches Regex Engine • A software that can process a string to find regex matches. -
Regular Expressions
CS 172: Computability and Complexity Regular Expressions Sanjit A. Seshia EECS, UC Berkeley Acknowledgments: L.von Ahn, L. Blum, M. Blum The Picture So Far DFA NFA Regular language S. A. Seshia 2 Today’s Lecture DFA NFA Regular Regular language expression S. A. Seshia 3 Regular Expressions • What is a regular expression? S. A. Seshia 4 Regular Expressions • Q. What is a regular expression? • A. It’s a “textual”/ “algebraic” representation of a regular language – A DFA can be viewed as a “pictorial” / “explicit” representation • We will prove that a regular expressions (regexps) indeed represent regular languages S. A. Seshia 5 Regular Expressions: Definition σ is a regular expression representing { σσσ} ( σσσ ∈∈∈ ΣΣΣ ) ε is a regular expression representing { ε} ∅ is a regular expression representing ∅∅∅ If R 1 and R 2 are regular expressions representing L 1 and L 2 then: (R 1R2) represents L 1⋅⋅⋅L2 (R 1 ∪∪∪ R2) represents L 1 ∪∪∪ L2 (R 1)* represents L 1* S. A. Seshia 6 Operator Precedence 1. *** 2. ( often left out; ⋅⋅⋅ a ··· b ab ) 3. ∪∪∪ S. A. Seshia 7 Example of Precedence R1*R 2 ∪∪∪ R3 = ( ())R1* R2 ∪∪∪ R3 S. A. Seshia 8 What’s the regexp? { w | w has exactly a single 1 } 0*10* S. A. Seshia 9 What language does ∅∅∅* represent? {ε} S. A. Seshia 10 What’s the regexp? { w | w has length ≥ 3 and its 3rd symbol is 0 } ΣΣΣ2 0 ΣΣΣ* Σ = (0 ∪∪∪ 1) S. A. Seshia 11 Some Identities Let R, S, T be regular expressions • R ∪∪∪∅∅∅ = ? • R ···∅∅∅ = ? • Prove: R ( S ∪∪∪ T ) = R S ∪∪∪ R T (what’s the proof idea?) S. -
Context-Free Grammar for the Syntax of Regular Expression Over the ASCII
Context-free Grammar for the syntax of regular expression over the ASCII character set assumption : • A regular expression is to be interpreted a Haskell string, then is used to match against a Haskell string. Therefore, each regexp is enclosed inside a pair of double quotes, just like any Haskell string. For clarity, a regexp is highlighted and a “Haskell input string” is quoted for the examples in this document. • Since ASCII character strings will be encoded as in Haskell, therefore special control ASCII characters such as NUL and DEL are handled by Haskell. context-free grammar : BNF notation is used to describe the syntax of regular expressions defined in this document, with the following basic rules: • <nonterminal> ::= choice1 | choice2 | ... • Double quotes are used when necessary to reflect the literal meaning of the content itself. <regexp> ::= <union> | <concat> <union> ::= <regexp> "|" <concat> <concat> ::= <term><concat> | <term> <term> ::= <star> | <element> <star> ::= <element>* <element> ::= <group> | <char> | <emptySet> | <emptyStr> <group> ::= (<regexp>) <char> ::= <alphanum> | <symbol> | <white> <alphanum> ::= A | B | C | ... | Z | a | b | c | ... | z | 0 | 1 | 2 | ... | 9 <symbol> ::= ! | " | # | $ | % | & | ' | + | , | - | . | / | : | ; | < | = | > | ? | @ | [ | ] | ^ | _ | ` | { | } | ~ | <sp> | \<metachar> <sp> ::= " " <metachar> ::= \ | "|" | ( | ) | * | <white> <white> ::= <tab> | <vtab> | <nline> <tab> ::= \t <vtab> ::= \v <nline> ::= \n <emptySet> ::= Ø <emptyStr> ::= "" Explanations : 1. Definition of <metachar> in our definition of regexp: Symbol meaning \ Used to escape a metacharacter, \* means the star char itself | Specifies alternatives, y|n|m means y OR n OR m (...) Used for grouping, giving the group priority * Used to indicate zero or more of a regexp, a* matches the empty string, “a”, “aa”, “aaa” and so on Whi tespace char meaning \n A new line character \t A horizontal tab character \v A vertical tab character 2. -
PHP Regular Expressions
PHP Regular Expressions What is Regular Expression Regular Expressions, commonly known as "regex" or "RegExp", are a specially formatted text strings used to find patterns in text. Regular expressions are one of the most powerful tools available today for effective and efficient text processing and manipulations. For example, it can be used to verify whether the format of data i.e. name, email, phone number, etc. entered by the user was correct or not, find or replace matching string within text content, and so on. PHP (version 5.3 and above) supports Perl style regular expressions via its preg_ family of functions. Why Perl style regular expressions? Because Perl (Practical Extraction and Report Language) was the first mainstream programming language that provided integrated support for regular expressions and it is well known for its strong support of regular expressions and its extraordinary text processing and manipulation capabilities. Let's begin with a brief overview of the commonly used PHP's built-in pattern- matching functions before delving deep into the world of regular expressions. Function What it Does preg_match() Perform a regular expression match. preg_match_all() Perform a global regular expression match. preg_replace() Perform a regular expression search and replace. preg_grep() Returns the elements of the input array that matched the pattern. preg_split() Splits up a string into substrings using a regular expression. preg_quote() Quote regular expression characters found within a string. Note: The PHP preg_match() function stops searching after it finds the first match, whereas the preg_match_all() function continues searching until the end of the string and find all possible matches instead of stopping at the first match.