Nudipleura Bathydorididae Bathydoris Clavigera AY165754 2064 AY427444 1383 AF249222 445 AF249808 599

Home , Akera bullata, Akeridae, Amphiboloidea, Caliphyllidae, Discidae, Euopisthobranchia

!"#$"%&'"()*&**'+),#-"',).+%/0+.+()-,)12+),",1+.)$./&3)1/),+-),'&$,)45&("3'+&.-6) !"#$%&'()*"%&+,)-"#."%)-'/%0(%1/'2,3,)45/6"%7/')89:0/5;,)8/'(7")<=)>(5#&%?)@)A(BC"/5)DBC'E752,3

+F/G"':H/%:)&I)A"'(%/)JB&#K#:/H#)FK%"H(B#,)4:H&#GC/'/)"%7)LB/"%)M/#/"'BC)N%#.:$:/,)OC/)P%(Q/'#(:K)&I)O&RK&,)?S+S?) *"#C(T"%&C",)*"#C(T",)UC(V")2WWSX?Y;,)Z"G"%=)2D8D-S-"Q"'("%)D:":/)U&55/B.&%)&I)[&&5&1K,)A9%BCC"$#/%#:'=)2+,)X+2;W) A9%BC/%,)"1%/'SD:'=)+a,)Xa333)A9%BC/%,)/#:/'%)4$#:'"5("%)A$#/$H,)\&BR/7)-"1);b,)>/5#CG&&5)FU,)_/':C,) >4)YbXY,)4$#:'"5("=))U&''/#G&%7/%B/)"%7)'/c$/#:#)I&')H":/'("5#)#C&$57)V/)"77'/##/7):&)!=*=)d/H"(5e)R"%&f"&'(=$S :&RK&="B=gGh)

7&33'+8+#1-.9)"#:/.8-;/#<) =-*'+)7>?)8$B5/&.7/)#/c$/%B/#)&I)G'(H/'#)$#/7)I&')"HG5(iB".&%)"%7)#/c$/%B(%1 =-*'+)7@?)<"#:'&G&7)#G/B(/#)"%7)#/c$/%B/#)$#/7)(%):C/)GCK5&1/%/.B)'/B&%#:'$B.&%)&I)/$:CK%/$'"%)B5"7/#)(%B5$7(%1) M(%1(B$5&(7/" A"$&.+)7>?)M46A\):'//#)V"#/7)&%)I&$'S1/%/)7":"#/:)T(:C&$:)&%/)&I):T&)H"g&')%$7(G5/$'"%)#$VB5"7/#e)d"h)8$7(V'"%BC(") d!"#$%&'()*+"%7),-.)/)&"h)"%7)dVh)_5/$'&V'"%BC&(7/")d0.-1('2("34$1*+"%7)5'/#$'/6*'3)"h= A"$&.+)7@?)O(H/SB"5(V'":/7)-J4DO):'//#)T(:C&$:)&%/)&I)I&$')B"5(V'".&%)G'(&'#e)d"h)i'#:)#G5(:)T(:C(%)J$&G(#:C&V'"%BC(")"%7) dVh)#G5(:#)V/:T//%)7"(%4$)1/)"%7)8/-"9'.)"%7)dBh)V/:T//%):)39)41.'6*)*)"%7):C'//)&:C/')'(%1(B$5(7#= A"$&.+)7B?)A'-"K/#):'//)V"#/7)&%)I&$'S1/%/)7":"#/:= A"$&.+)7C?)M46A\):'//#)(%I/''/7)I'&H)(%7/G/%7/%:)1/%/)I'"1H/%:#e)d"h)+XD)'F84,)dVh)2XD)'F84,)dBh)+YD)'F84)"%7)d7h)ULN= A"$&.+)7D?)M46A\):'//#)(%I/''/7)I'&H)B&HV(%/7)%$B5/"')&')H(:&BC&%7'("5)1/%/)7":"#/:e)d"h)%$B5/"')+XD)"%7)2XD`)dVh) H(:&BC&%7'("5)+YD)"%7)ULN= !"#$%&'%"()%*"+(&%,-)%./0(&$'12&%3&4/�&3%$5%6718&73%/3&2%5$7%"86(1510"'1$#%"#2%3&4/#9)%

Locus Primer Sequence Direction Position*1 Reference 18S 18A1 CCTACCTGGTTGATCCTGCCAG Forward –21 to 0 Steiner and Dreyer (2003) 188f GGATCTATTGGAGGGCAAGT Forward 554–573 Nakamura et al. (2007) NS2*2 GGCTGCTGGCACCAGACTTGC Reverse 568–588 White et al. (1990) NS5 AACTTAAAGGAATTGACGGAAG Forward 1168–1189 White et al. (1990) 189r TCGGAATTAACCAGACAAATC Reverse 1335–1355 Nakamura et al. (2007) 1800r ATGATCCTTCCGCAGGTTCACC Reverse 1957–1978 Steiner and Dreyer (2003)

28S LSU5 TAGGTCGACCCGCTGAAYTTAAGCA Forward –33 to –9 Littlewood et al. (2000) 900F CCGTCTTGAAACACGGACCAAG Forward 636–657 Lockyer et al. (2003) ECD2S CTTGGTCCGTGTTTCAAGACGG Reverse 636–657 Williams and Ozawa (2006) LSU1600R AGCGCCATCCATTTTCAGG Reverse 1024–1042 Williams et al. (2003)

COI–16S LCO1490 GGTCAACAAATCATAAAGATATTGG Forward –24 to 0 Folmer et al. (1994) COIf*2 CCTGCAGGAGGAGGAGAYCC Forward 617–636 This study COIf-A*2 CCTGCTGGTGGAGGTGAYCC Forward 617–636 This study COIf-B*2 CCTGCTGGTGGTGGAGAYCC Forward 617–636 This study COIf-G*2 CCAGCTGGWGGGGGTGATCC Forward 617–636 This study HCO2198 TAAACTTCAGGGTGACCAAAAAATCA Reverse 659–684 Folmer et al. (1994) Opis COI-Fm ACTTTTTTTCCTCAACATTTYTT Forward 1220–1242 Modified from Grande et al. (2002) COIa-NER CATTTAGTGTAGCAATCAGGRTARTC Reverse 1274–1299 Kano and Kase (2004) 16Sar-L CGCCTGTTTATCAAAAACAT Forward 2017–2036 Palumbi et al. (1991) Opis1-R ATTAYGCTACCTTAGCACRGTCA Reverse 2098–2120 Grande et al. (2002) 16Sbr-H CCGGTCTGAACTCAGATCAYGT Reverse 2458–2479 Modified from Palumbi et al. (1991)

*1Position of primers on amplified sequences of ‘Microglyphis’ sp. (AORI YK#1460; 18S: LC150579) or Ringicula doliaris (#901; 28S: LC150580; COI–16S: LC150582) *2Sequencing primers References

Folmer, O., Black, M., Hoeh, W., Luts, R., Vrijenhoek, R., 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 3, 294–299. Grande, C., Templado, J., Lucas Cervera, J., Zardoya, R. 2004. The complete mitochondrial genome of the nudibranch Roboastra europaea (Mollusca: Gastropoda) supports the monophyly of opisthobranchs. Mol. Biol. Evol. 21, 303–313. Kano, Y., Kase, T. 2004. Genetic exchange between anchialine cave populations by means of larval dispersal: the case of a new gastropod species Neritilia cavernicola. Zool. Scr. 33, 423–437. Littlewood, D.T.J., Curini-Galletti, M., Herniou, A., 2000. The interrelationships of Proseriata (Platyhelminthes: Seriata) tested with molecules and morphology. Mol. Phylogenet. Evol. 16, 449–466. Lockyer, A.E., Olson, P.D., Østergaard, P., Rollinson, D., Johnston, D.A., Attwood, S.W., Southgate, V.R., Horak, P., Snyder, S.D., Le, T.H., Agatsuma, T., McManus, D.P., Carmichael, A.C., Naem, S., Littlewood, D.T.J., 2003. The phylogeny of the Schistosomatidae based on three genes with emphasis on the interrelationships of Schistosoma Weinland, 1858. Parasitology 126, 203–224. Nakamura, K., Kano, Y., Suzuki, N., Namatame, T., Kosaku, A. 2007. 18S rRNA phylogeny of sea spiders with emphasis on the position of Rhynchothoracidae. Mar. Biol., 153, 213–223. Palumbi, S., Martin, A., Romano, S., McMillan, W.O., Stice, L., Grabowski, G., 1991. The Simple Fool’s Guide to PCR, Version 2.0. Department of Zoology and Kewalo Marine Laboratory, University of Hawaii, Honolulu. Steiner, G., Dreyer, H., 2003. Molecular phylogeny of Scaphopoda (Mollusca) inferred from 18S rRNA sequences—support for a Scaphopoda–Cephalopoda clade. Zool. Scr. 32, 343–356. White, T.J., Bruns, T., Lee, S., Taylor, J.W., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, in: Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J. (Eds.), PCR Protocols: a Guide to Methods and Applications. Academic Press, New York, pp. 315–322. Williams, S.T., Ozawa, T., 2006. Molecular phylogeny suggests polyphyly of both the turban shells (family Turbinidae) and the superfamily Trochoidea (Mollusca: Vetigastropoda). Mol. Phylogenet. Evol. 39, 33–51. Williams, S.T., Reid, D.G., Littlewood, D.T.J., 2003. A molecular phylogeny of the Littorininae (Gastropoda: Littorinidae): unequal evolutionary rates, morphological parallelism, and biogeography of the southern ocean. Mol. Phylogenet. Evol. 28, 60–86. !"#$%&'%"()%*"+(&%,-)!."/'0$1$2%/1&34&/%"#2%/&56&/%6/&2%4#%'7&%178($9&#&'43%0&3$#/'063'4$#%$:%&6'78#&60"#% 3("2&/%4#3(624#9%;4#9436($42&")%<<=>?@A=B?.&#="#C%"33&//4$#%#6D+&0%"#2%( '7%$:%/&56&/%"0&%/7$E#% "($#9%E4'7%'7&%F$637&0%$:%/&56&2%/1&34D&#/)%

Clade Family Species 18S length 28S length 16S length COI length Voucher

Caenogastropoda Cyclophoridae Aperostoma palmeri DQ093435 1791 DQ279983 1951 DQ093479 519 DQ093523 657

Abyssochrysidae Abyssochrysos melanioides AB930376 1765 AB930325 2127 AB930403 475 AB930459 630 AORI YK#1482 Littorinidae Littorina littorea X91970 1831 AJ488672 1443 DQ093481 519 AJ622946 1199

Orbitestelloidea Orbitestellidae Orbitestella vera FJ917207 1793 FJ917239 1032 FJ917250 479 FJ917268 580 EED-Phy-518

Rissoelloidea Rissoellidae Rissoella rissoaformis FJ917214 1418 FJ917226 3681 FJ917252 403 FJ917271 577 EED-Phy-502 Rissoella elongatospira FJ917203 2175 FJ917232 1106 – FJ917270 577 EED-Phy-501

Acteonoidea Acteonidae Pupa solidula AY427516 1842 AY427481 1065 EF489319* 429 DQ238006 593 *EED-Phy-35

Rictaxis punctocaelatus EF489346 1387 FJ917243 2536 EF489318 365 EF489393 624 EED-Phy-454 /EF489370 1071

Hydatinidae Hydatina physis AY427515 1804 AY427480 1087 EF489320* 420 DQ991932 14153 *EED-Phy-37

Ringiculoidea Ringiculidae Ringicula doliaris LC150577 1304 LC150580 1014 LC150582 2457 LC150582 2457 AORI YK#901

Ringiculia sp. cf. pilula – – LC150583 2462 LC150583 2462 AORI YK#1463

Ringiculopsis foveolata LC150578 1315 LC150581 929 LC150584 2520 LC150584 2520 AORI YK#1461

Microglyphis japonica – – LC150587 425 LC150586 658 AORI YK#2528

Microglyphis sp. – – LC150589 441 LC150588 658 ZSM Mol 20140700

‘Microglyphis’ sp. LC150579 1956 – LC150585 2470 LC150585 2470 AORI YK#1460

Ringiculoides kurilensis – – LC150591 438 LC150590 1273 AORI YK#2531

– – LC150593 440 LC150592 658 ZSM Mol 20130355

Nudipleura Bathydorididae Bathydoris clavigera AY165754 2064 AY427444 1383 AF249222 445 AF249808 599

Chromodorididae Felimida krohni AJ224774 1887 AY427445 1064 AY345036 2647 AY345036 2647 Pleurobranchidae Pleurobranchus peroni AY427494 2022 AY427455 1120 EF489331* 443 DQ237993 593 *EED-Phy-436 Tomthompsonia antarctica AY427492 2105 AY427452 1156 EF489330* 440 DQ237992 593 *EED-Phy-435

Umbraculoidea Umbraculidae Umbraculum umbraculum AY165753 1843 FJ917246* 2375 EF489322* 439 AY345023 1360 *EED-Phy-51

(U. mediterraneum) /AY427457 1069 Anaspidea Akeridae Akera bullata AY427502 1789 AY427466 1047 AF156127 418 AF156143 658

Aplysiidae Aplysia californica AY039804 1802 AY026366 3951 AF192295 422 AF077759 658

Cephalaspidea Philinidae Philine exigua HQ168425 1798 HQ168438 1036 HQ168412 420 HQ168450 624 ZSM Mol 20080752 Scaphandridae Scaphander lignarius EF489348* 1788 KC351544 1488 EF489324* 441 DQ974663 698 *EED-Phy-442

Haminoeidae Haminoea hydatis AY427504 1847 AY427468 1037 EF489323* 425 DQ238004 593 *EED-Phy-421

Sacoglossa Oxynoidae Oxynoe antillarum FJ917441 1998 FJ917247* 2411 FJ917425 487 FJ917483 593 *EED-Phy-723 /FJ917466 1085

Volvatellidae Volvatella viridis HQ168426 1930 HQ168439 1074 HQ168413 435 HQ168451 657 AORI YK#890

Caliphyllidae Cyerce nigricans AY427500 1847 AY427463 1063 EU140843 441 DQ237995 593 Plakobranchidae Thuridilla bayeri AF249220 1847 AY427461 1058 DQ480206 434 DQ471271 618

Siphonarioidea Siphonariidae Siphonaria pectinata HQ659934 1785 DQ256744 2931 AY377627 438 AF120638 669

Glacidorboidea Glacidorbidae Glacidorbis rusticus FJ917211 1879 FJ917227 3493 FJ917264 454 FJ917284 577 EED-Phy-881 Pyramidelloidea Pyramidellidae Turbonilla sp. EF489351 1838 EF489376 1004 EF489332 473 EF489396 621 EED-Phy-526

Amphiboloidea Phallomedusidae Phallomedusa solida DQ093440 1816 DQ279991 2081 DQ093484 442 DQ093528 654

Hygrophila Physidae Physella acuta AY282600 1708 EF489368* 1011 AY651241 494 JQ390525 14490 *SMF 325459

Planorbinae Ancylus fluviatilis AY282593 1707 EF489365* 1042 EF489312* 427 AY282582 959 *SMF 325462

Acochlidia Parhedylidae Microhedyle glandulifera HQ168437 1796 HQ168449 1046 HQ168424 441 HQ168461 655 ZSM Mol 20081019

Pseudunelidae Pseudunela marteli HQ168431 1795 HQ168444 1032 HQ168418 438 HQ168456 655 ZSM Mol 20080393

Eupulmonata Discidae Discus rotundatus FJ917212 1854 FJ917240 1052 FJ917265 425 FJ917285 577 EED-Phy-607

Onchidiidae Onchidium verruculatum Y427522 1791 AY427487 1050 EF489316* 486 EF489391* 626 *EED-Phy-38

Onchidella floridana AY427521 1790 AY427486 1049 EF489317* 492 EF489392* 619 *EED-Phy-462

Ellobiidae Smeagol phillipensis FJ917210 1840 FJ917229 3399 FJ917263 425 FJ917283 577 EED-Phy-878

Carychium minimum EF489341 1739 EF489361 1061 EF489308 465 EF489386 663 J D 436..$5<%6.$.(:*)'&"$"/*. DGG !"##$%"&'()"##$%*' 4-*%$.#$:'(-'):*%" 2%3"#*.#*))'(1*%' DGG 8"..$*))'(%"..$'7$%:".

F C 8"..$*))'(*)$&>'#$.-"%'

DGG +,-'(.$)"/,)' J C 8"5#'9".(-,&5#$5'*)'#,. DGG K6/'#"&'(-<6.". DGG 8"&>"5,)$"/*.(;,%")*&.".(ABID 8"&>"5,)$"/*.(;,%")*&.".(LIDJ C R J R ?"5%$>)6-<".(.-(LGGC

DGG DGG ?"5%$>)6-<".(@'-$&"5'(ABAC 8"&>"5,)$-.".(7$1*$)'#'(DEFD J C R F 8"&>"5,)'(/$)"'%".(JGD C F ?"5%$>)6-<".(.-(DEFG 8"&>"5,)'(57(-"),)'(DEFI DGG +)*,%$3%'&5<,.(-*%$&" N$:#<$:-.$&"'('&#'%5#"5'

B J M:3%'5,),:(,:3%'5,),: DGG 4;*%'(3,))'#' C J 4-)6."'(5')"7$%&"5'

DGG +<")"&*(*9">,' C D H5'-<'&/*%()">&'%",. K':"&$*'(<6/'#". F C DGG Q6*%5*(&">%"5'&. J R N<,%"/"))'(3'6*%" DGG 0$)1'#*))'(1"%"/". 296&$*('&#"))'%,: F G H"-<$&'%"'(-*5#"&'#' +.*,/,&*)'(:'%#*)" ?"5%$<*/6)*(>)'&/,)"7*%' B J DGG +<6.*))'('5,#' 4&56),.(7),1"'#")".

B B N,%3$&"))'(.-(PP= F F F D +<'))$:*/,.'(.$)"/' O)'5"/$%3".(%,.#"5,. Kano et al. Figure S1. Sensitivity analysis. =".5,.(%$#,&/'#,. C C DGG 2&5<"/",:(1*%%,5$.,: (a) RAxML tree based on four-gene dataset J E 2&5<"/*))'(7)$%"/'&' without Bathydoris and Felimida. Numerals on J E H:*'>$)(-<"))"-*&.". branches denote bootstrap values as percentages Q'%65<",:(:"&":,: (< 50% not shown). 1005@@ Aperostoma_palmeriA);$%+<%C3,)3'C;$" 98? / Abyssochrysos_melanioidesAB(++%#*$(+%+,C;'31"%":;+ O"Littorina_littorea<<%$"13,'"<<%$;3 Orbitestella_veraF$B"<;+<;''3,=;$3 1005@@ Rissoella_rissoaformis0"++%;''3,$"++%34%$C"+

78R / Rissoella_elongatospira0"++%;''3,;'%1&3<%+)"$3

1005@@ Pupa_solidula>2)3,+%'":2'3 ?99? Rictaxis_punctocaelatus0"#<3G"+,)21#<%#3;'3<2+ HHydatina_physis(:3<"13,)*(+"+ 1005@@ Ringiculoides_kurilensis_25310"1&"#2'%":;+,D2$"';1+"+,-.85 29 1005@@ Ringiculoides_kurilensis_B3190"1&"#2'%":;+,D2$"';1+"+,E85? 97? R 1005@@ Microglyphis_sp_B008!"#$%&'()*"+,+),E@@/

99? ? Microglyphis_sp_2528!"#$%&'()*"+,+),-.-/ 0"1&"#2'%)+"+,4%=;%'3<3,567Ringiculopsis_foveolata_14615 31 657 . 697 ? Ringicula_doliaris_9010"1&"#2'3,:%'"3$"+,?@5 85/ . 0"1&"#2'3,#4,)"'2'3,567Ringicula_cf_pilula_14638 Microglyphis_sp_1460!"#$%&'()*"+,+),567@

1005@@ 1005@@ Bathydoris_clavigeraE3<*(:%$"+,#'3="&;$3 Felimida_krohniP;'"C":3,D$%*1"

52. - LCB$3#2'2C,2CB$3#2'2Umbraculum_umbraculumC 1005@@ Akera_bullataAD;$3,B2''3<3 ? @ 90 Aplysia_californicaA)'(+"3,#3'"4%$1"#3

1005@@ >*"'"1;,;G"&2Philine_exigua3 84/ 6 9#3)*31:;$,'"&13$"2Scaphander_lignarius+ Haminoea_hydatisH3C"1%;3,*(:3<"+ 75R . 5@100@ Cyerce_nigricansI(;$#;,1"&$"#31+ 91? 5 Thuridilla_bayeriM*2$":"''3,B3(;$" 1005@@ Volvatella_viridisK%'=3<;''3,="$":"+ Oxynoe_antillarumFG(1%;,31<"''3$2C 55. . Siphonaria_pectinata9")*%13$"3,);#<"13<3 31 Pseudunela_marteli>+;2:21;'3,C3$<;'" Microhedyle_glandulifera!"#$%*;:(';,&'31:2'"4;$3 667 7 49 1005@@ >*(+;'Physella_acuta'3,3#2<3

39 Ancylus_fluviatilisA1#('2+,4'2="3<"'"+

607 @ Turbonilla_sp_EEDM2$B%1"''3,+),NNJ 72R - .59? Phallomedusa_solida>*3''%C;:2+3,+%'":3 Glacidorbis_rusticusQ'3#":%$B"+,$2+<"#2+ Kano et al. Figure S1. Sensitivity analysis. Discus_rotundatusJ"+#2+,$%<21:3<2+ ? 6 94 1005@@ F1#*":"2C,=;$$2#%+2Onchidium_verrucosumC (b) RAxML tree based on four-gene dataset without 97? R Onchidella_floridanaF1#*":;''3,4'%$":313 Pleurobranchus and Tomthompsonia. Numerals on 96? 7 Smeagol_phillipensis9C;3&%',)*"''");1+"+ branches denote bootstrap values as percentages Carychium_minimumI3$(#*"2C,C"1"C2C (< 50% not shown). 1 Aperostoma_palmeri 1 Abyssochrysos_melanioides Littorina_littorea Orbitestella_vera 1 Rissoella_rissoaformis 1 Rissoella_elongatospira 1 Pupa_solidula 1 Rictaxis_punctocaelatus 1 Hydatina_physis 1 Ringiculoides_kurilensis_2531 Ringiculoides_kurilensis_B319 1 1 Microglyphis_sp_B008 1 Microglyphis_japonica_2528 1 Ringiculopsis_foveolata_1461 0.78 1 1 Ringicula_doliaris_901 0.99 Ringicula_cf_pilula_1463 Microglyphis_sp_1460 1 Bathydoris_clavigera 1 Felimida_krohni 1 Pleurobranchus_peroni Tomthompsonia_antarctica 0.95 0.97 Umbraculum_umbraculum 1 Akera_bullata 1 Aplysia_californica

1 Philine_exigua 0.99 Scaphander_lignarius Haminoea_hydatis 1 1 Cyerce_nigricans 1 Thuridilla_bayeri 1 Volvatella_viridis Oxynoe_antillarum 1 Siphonaria_pectinata 0.91 Microhedyle_glandulifera Pseudunela_marteli 0.69 0.99 0.69 Phallomedusa_solida 0.97 Glacidorbis_rusticus 0.91 Turbonilla_sp_EED 1 1 Physella_acuta Kano et al. Figure S2. Sensitivity analysis. Ancylus_fluviatilis Discus_rotundatus (a) Time-calibrated Beast tree without prior for the first 1 1 Onchidium_verrucosum split within Euopisthobranchia. Numerals on branches 0.97 Onchidella_floridana denote posterior probabilities. 1 Smeagol_phillipensis Carychium_minimum

1 Philine_exigua 0.9964 Scaphander_lignarius Haminoea_hydatis 1 1 Cyerce_nigricans 1 Thuridilla_bayeri 1 Volvatella_viridis Oxynoe_antillarum 1 Siphonaria_pectinata 0.9124 Microhedyle_glandulifera Pseudunela_marteli 0.7471 0.9789 0.6853 Phallomedusa_solida 0.9664 Glacidorbis_rusticus 0.8991 Turbonilla_sp_EED 1 1 Physella_acuta Kano et al. Figure S2. Sensitivity analysis. Ancylus_fluviatilis Discus_rotundatus (b) Time-calibrated Beast tree without prior for split 1 1 Onchidium_verrucosum between Carychium and Smeagol. Numerals on 0.9829 Onchidella_floridana branches denote posterior probabilities. 1 Smeagol_phillipensis Carychium_minimum

1 Philine_exigua 0.97 Scaphander_lignarius Haminoea_hydatis 1 1 Cyerce_nigricans 1 Thuridilla_bayeri 1 Volvatella_viridis Oxynoe_antillarum 1 Siphonaria_pectinata 0.78 Microhedyle_glandulifera Pseudunela_marteli 0.72 0.98 0.85 Phallomedusa_solida 0.98 Glacidorbis_rusticus 0.78 Turbonilla_sp_EED 1 1 Physella_acuta Kano et al. Figure S2. Sensitivity analysis. Ancylus_fluviatilis Discus_rotundatus (c) Time-calibrated Beast tree without prior for split 1 1 Onchidium_verrucosum between Ringiculopsis and three other ringiculids. 0.97 Onchidella_floridana Numerals on branches denote posterior probabilities. 1 Smeagol_phillipensis Carychium_minimum

500.0 400.0 300.0 200.0 100.0 0.0 1 Aperostoma_palmeri 1 Abyssochrysos_melanioides Littorina_littorea Orbitestella_vera 1 Rissoella_rissoaformis 1 Rissoella_elongatospira 1 Pupa_solidula 1 Rictaxis_punctocaelatus Hydatina_physis 1 1 Ringiculoides_kurilensis_B319 Ringiculoides_kurilensis_2531 1 1 Microglyphis_sp_B008 1 Microglyphis_japonica_2528 Ringiculopsis_foveolata_1461 0.78 1 1 Ringicula_doliaris_901 0.97 Ringicula_cf_pilula_1463 1 Microglyphis_sp_1460 1 Bathydoris_clavigera 1 Felimida_krohni 1 Pleurobranchus_peroni Tomthompsonia_antarctica 0.91 Umbraculum_umbraculum 1 Akera_bullata 1 Aplysia_californica 1 Philine_exigua 1 Scaphander_lignarius Haminoea_hydatis 1 1 Cyerce_nigricans 1 Thuridilla_bayeri 1 Volvatella_viridis Oxynoe_antillarum 1 Siphonaria_pectinata Pseudunela_marteli 0.99 Microhedyle_glandulifera 0.99 1 Kano et al. Figure S3. Bayesian tree. Physella_acuta 0.98 Ancylus_fluviatilis Phallomedusa_solida MrBayes tree based on four-gene dataset. Each 1 0.8 0.52 gene and codon position was allowed to have Turbonilla_sp_EED Glacidorbis_rusticus different models and parameters; HKY+I+G Discus_rotundatus rd 1 model was selected for 16S and 3 codon of 1 Onchidium_verrucosum COI and GTR+I+G for remaining four partitions 0.97 Onchidella_floridana according to AIC in jModelTest2 (Darriba et al. 1 Smeagol_phillipensis Carychium_minimum 2012: Nat. Methods 9, 772). Numerals on branches denote posterior probabilities. 0.2 D P F84/.06.5+,8+*54/% 2!! F./5%0

O D $%00.4**+,4*.&'+6.08%/+ 3)8+,0.*%-)*+ 2!! 2!! 1 # $%(6+7%0,8)&(6.(+4*+6)0 @A-+6%&+,8:A0%0 $%&'%()*+,-.*%+/%0,1!2 2!! Q D $%&'%()*.80%0,>.=4.*+6+,2#D2 2!! D D C%(/.'*A8:%0,08,2#D! 2!! G+6:A-./%0,(*+=%'4/+ 1 D K4*%5%-+,L/.:&% 2!! 3*4)/.*)=%+6%*%0 O Q FL4/+,<)**+6+ F8*A0%+,(+*%>./&%(+ ?54/+ 304)-)&4*+,5+/64*% I%0()0,/.6)&-+6)0 954+'.*,8:%**%84&0%0 3:+**.54-)0+,0.*%-+ 9%8:.&+/%+,84(6%&+6+ Kano et al. Figure S4. Independent gene trees. O 1 ;&(:%-%)5,=4//)(.0)5 (a) RAxML tree based on 18S gene (1,707 sites). ;&(:%-4**+,>*./%-+&+ Numerals on branches denote bootstrap values as !"!# percentages (< 50% not shown). 98./0130+4,845+./( #!! Q O 9;?110&'/?101,+.54%(0().1 2(330/(%4,5(330/.4

$/;(3.13.554,-./4

#!! M43'?)0/(1,&54-(7./4

#!! Q O H.5(+()4,I/0'%( #!! @5.*/0;/4%&'*1,8./0%( :0+3'0+810%(4,4%34/&3(&4 Q J #!! A(%7(&*5081(1,B0-.05434,#JK# A(%7(&*54,)05(4/(1,N!#

@*84,105()*54 O ! #!! N K A(&34>(1,8*%&30&4.543*1 G?)43(%4,8'?1(1

@'4550+.)*14,105()4

#!! A(110.554,/(1104B0/+(1 A(110.554,.50%743018(/4

O P :*/;0%(554,18,<<= E54&()0/;(1,/*13(&*1

N R 9I./4,;*55434 985?1(4,&45(B0/%(&4

@'(5(%.,.>(7*4 N K K P 6&48'4%)./,5(7%4/(*1 G4+(%0.4,'?)43(1

F+;/4&*5*+,*+;/4&*5*+

#!! 9%&?5*1,B5*-(43(5(1 @'?1.554,4&*34

@1.*)*%.54,+4/3.5(

#!! C?./&.,%(7/(&4%1

Q ! :'*/()(554,;4?./(

#!! D05-43.554,-(/()(1 $>?%0.,4%3(554/*+

6(8'0%4/(4,8.&3(%434

L(&/0'.)?5.,754%)*5(B./4

O # =(1&*1,/03*%)43*1

N K 6+.4705,8'(55(8.%1(1 C4/?&'(*+,+(%(+*+ Kano et al. Figure S4. Independent gene trees. $%&'()(*+,-.//*&01*+ K Q (b) RAxML tree based on 28S gene (973 sites). $%&'().554,B50/()4%4 Numerals on branches denote bootstrap values as !"# percentages (< 50% not shown). I H D%,,+*%-/)6%,,+*5/ H!! 012&&+'3*2&+&)456/-%+%.5& 0:5*+&,+4/):/645*% Q(*1+-%66/)&:)RR$ $%&'(&)*+,(-./,(& 0-'26(&);6(9%/,%6%& H!! >32&566/)/'(,/ >3/66+45.(&/)&+6%./ J6/'%.+*1%&)*(&,%'(& P/*2'3%(4)4%-%4(4 @%'*+35.265)=6/-.(6%;5*/ >&5(.(-56/)4/*,56% I K B?2-+5)/-,%66/*(4 8+69/,566/)9%*%.%& B-'3%.%(4)95**('+&(4 B-'3%.566/);6+*%./-/ C45/=+6):3%66%:5-&%& C%:3+-/*%/):5',%-/,/ A G P25*'5)-%=*%'/-& Q3(*%.%66/)1/25*%

A # C'/:3/-.5*)6%=-/*%(& K G M/4%-+5/)32./,%& O O >3%6%-5)5?%=(/

T # E41*/'(6(4)(41*/'(6(4 I I 075*/)1(66/,/ 0:62&%/)'/6%;+*-%'/ >(:/)&+6%.(6/ K H 65(*+1*/-'3(&):5*+-% Q+4,3+4:&+-%/)/-,/*',%'/ B*1%,5&,566/)95*/ M2./,%-/):32&%& F%&&+566/)*%&&+/;+*4%& F%',/?%&):(-',+'/56/,(& H!! F%-=%'(6+%.5&)7(*%65-&%&)#KGH F%-=%'(6+%.5&)7(*%65-&%&)

I I @%'*+=62:3%&)&:)HNO! F%-=%'(6+:&%&);+95+6/,/)HNOH F%-=%'(6/).+6%/*%&)I!H Kano et al. Figure S4. Independent gene trees. A T @%'*+=62:3%&)&:)

T J D3)-.*%4,534- 8 : 1,0'-G,*.)3+0'%0-64-'3* PA5-',+-.)(A*,* D(A*644-.-03'- :"" 1,+2,034%,56*.73/,46+*,*.!89: 1,+2,034%,56*.73/,46+*,*.I9:J M Q R " 1,+2,034%)*,*.B%C6%4-'-.:QR: M ! L,0/%24A)(,*.*).I""M 8 T L,0/%24A)(,*.N-)%+,0-.!8!M

R 9 1,+2,034-.0B.),434-.:QR9 R 9 1,+2,034-.5%4,-/,*.J": L,0/%24A)(,*.*).:QR" ;&

R Q D(,4,+6.6G,23- T 9 >0-)(-+56/.4,2+-/,3* P-&,+%6-.(A5-',* >,)(%+-/,-.)60',+-'- 8 Q HA6/06.+,2/,0-+* R J $(3/,5,44-.<-A6/, O%4C-'644-.C,/,5,* EGA+%6.-+',44-/3& $3/<%+,44-.*).KK@ D*6353+64-.&-/'64, 8 M =4-0,5%/<,*./3*',03* D(-44%&653*-.*%4,5- L,0/%(65A46.24-+534,B6/- ?+0A43*.B43C,-',4,* Kano et al. Figure S4. Independent gene trees. @,*03*./%'3+5-'3* 8 : (d) RAxML tree based on COI gene (657 sites). E+0(,5644-.B4%/,5-+- E+0(,5,3&.C6//30%*3& Numerals on branches denote bootstrap values as R " >&6-2%4.)(,44,)6+*,* percentages (< 50% not shown). H-/A0(,3&.&,+,&3&

!"#" # # H=(,'&7'.*+=*).(,% @!! HF6&&':2,6&'&+.()*3%'%0(& M%77',%3*+)%77',(* 4,F%7(&7())*+C(,* @!! $%&&'())*+,%&&'*-',.%&

O ! $%&&'())*+()'3;*7'&=%,* E8=*+&')%08)* @!! O O $%:7*5%&+=83:7':*()*78& <60*7%3*+=26&%& @!! $%3;%:8)*+0')%*,%&+O!@ @!! P ! $%3;%:8)'=&%&+-'C(')*7*+@AB@

P @ 9%:,';)6=2%&+&=+@AB! @!! D*7260',%&+:)*C%;(,* @!! /()%.%0*+1,'23% @!! E)(8,'F,*3:28&+=(,'3% J'.72'.=&'3%*+*37*,:7%:* @!! @!! ?6(,:(+3%;,%:*3& O R J28,%0%))*+F*6(,% @!! I')C*7())*+C%,%0%& 4563'(+*37%))*,8. J8,F'3%))*+&=+KKL N)*:%0',F%&+,8&7%:8& E2*))'.(08&*+&')%0* S @ G.F,*:8)8.+8.F,*:8)8. @!! H1(,*+F8))*7*

B R H=)6&%*+:*)%-',3%:* E2%)%3(+(5%;8* @!! B ! P Q >:*=2*30(,+)%;3*,%8& <*.%3'(*+260*7%& @!! E26&())*+*:87* H3:6)8&+-)8C%*7%)%& E&(8083()*+.*,7()% >%=2'3*,%*+=(:7%3*7* 9%:,'2(06)(+;)*308)%-(,* L%&:8&+,'7830*78& S # @!! 43:2%0%8.+C(,,8:'&8. B O 43:2%0())*+-)',%0*3* Kano et al. Figure S5. Nuclear/mitochondrial trees. B A >.(*;')+=2%))%=(3&%& (a) RAxML tree based on concatenated 18S and 28S ?*,6:2%8.+.%3%.8. genes (2,680 sites). Numerals on branches denote !"!# bootstrap values as percentages (< 50% not shown). 4## J:-1+.8+7;/:;*7-1% 4## N%88+1%&;/*%88+1-; JE>..+(91>.+./7-*;&%+%,-. F1E%8-.8-**;/K-1; 4## $%..+-**;/-*+&';8+.:%1; $%..+-**;/1%..+;H+17%. 4## T ! 2;89>,+1%./(*;K%'-1; ! A O-*%7%,;/01+9&% 5 5 I*-)1+E1;&(9)./:-1+&% 4## 6+789+7:.+&%;/;&8;1(8%(;

A 4 I):;/.+*%,)*; 5 # $%(8;G%./:)&(8+(;-*;8). L>,;8%&;/:9>.%. 4## $%&'%()*+%,-./0)1%*-&.%./@A34 $%&'%()*+%,-./0)1%*-&.%./2345 5 4 5 B =%(1+'*>:9%./?;:+&%(;/@A@B 5 5 =%(1+'*>:9%./.:/2##B $%&'%()*+:.%./H+K-+*;8;/4C!4

! 5 $%&'%()*;/,+*%;1%./5#4 B 5 $%&'%()*;/(H/:%*)*;/4C!3 =%(1+'*>:9%./.:/4C!# P7E1;()*)7/)7E1;()*)7 5 5 J0-1;/E)**;8; T T J:*>.%;/(;*%H+1&%(;

5 # I9%*%&-/-G%'); ! B <(;:9;&,-1/*%'&;1%). L;7%&+-;/9>,;8%. <%:9+&;1%;/:-(8%&;8; 5 C Q>-1(-/&%'1%(;&. T 5 69)1%,%**;/E;>-1% 5 ! M+*K;8-**;/K%1%,%. FG>&+-/;&8%**;1)7 I9>.-**;/;()8; 6)1E+&%**;/.:/RRS J&(>*)./H*)K%;8%*%.

A @ S%.()./1+8)&,;8). ! ! D*;(%,+1E%./1).8%(). I9;**+7-,).;/.+*%,; =%(1+9-,>*-/'*;&,)*%H-1; I.-),)&-*;/7;18-*% 5 3 F&(9%,%)7/K-11)(+.)7 B C F&(9%,-**;/H*+1%,;&; Kano et al. Figure S5. Nuclear/mitochondrial trees. 5 B <7-;'+*/:9%**%:-&.%. (b) RAxML tree based on concatenated 16S and COI Q;1>(9%)7/7%&%7)7 genes (999 sites). Numerals on branches denote !"# bootstrap values as percentages (< 50% not shown).