DOCSLIB.ORG

Role of Periostin and Interleukin-4 in Recurrence of Pterygia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Cornea Role of Periostin and Interleukin-4 in Recurrence of Pterygia Chuan-Hui Kuo,1 Dai Miyazaki,1 Keiko Yakura,1 Kaoru Araki-Sasaki,2 and Yoshitsugu Inoue1 PURPOSE. To identify the candidate genes for pterygia recur- mitomycin treatment, radiation, and amniotic membrane trans- rence from a pterygia transcriptome and to analyze their tran- plantation, recurrences still occur.1 scriptional regulation and functional relationships. We have determined the minimum gene set that would ETHODS accurately differentiate primary from recurrent pterygia using a M . Transcriptional networks for pterygia recurrence 2 were constructed using network analysis that was applied to mathematical classification algorithm. We found that only 184 genes that showed a significant twofold change in the three genes—periostin, tissue inhibitor of metalloproteinases-2 (TIMP-2), and l-3-phosphoserine phosphatase homolog whole genome. Of the identified recurrence-related candidate 2 genes in the major networks, periostin and IL-4 were analyzed (PSPHL)—differentiate primary from recurrent pterygia. We have also reported on the numerous transcripts that are for transcriptional relationships using pterygia-derived fibro- 2 blasts. Immunohistochemical analysis was used to study ptery- related to pterygia recurrence. However, the functional in- gia tissue. Effector candidate molecule for recurrence periostin volvement in the genome or their significance in recurrence was analyzed for cell adhesive function. remains speculative. We have used knowledge-based analysis to understand the global interactions of the genes in the con- RESULTS. The pterygia transcriptome was divided into four text of their function and regulation. To simplify the complex major biological networks with high significance scores (P Ͻ Ϫ17 biological phenomena played by genes, network analysis has 10 ). The classifier with the highest accuracy using the been reported to be a very efficient method.3 We have applied support vector machine algorithm was periostin, which was the Ingenuity Pathways Knowledge Base (Ingenuity Systems, successfully linked to the network of cell cycle, connective Redwood City, CA, http://www.ingenuity.com), a biological tissue development and function, and cell morphology. Analy- network database created from known protein-protein interac- ses using pterygia-derived fibroblasts showed that periostin tions and the activation of signaling pathways, and found that was required for cell adhesion that was mediated by a pre- the complex phenomena of pterygia recurrences can be simply sumed pterygia-related extracellular matrix protein, fibronec- summarized into four highly significant molecular networks. In tin. Periostin was found to be transcriptionally induced by IL-4. this analyses, periostin and TIMP-2, which we reported as The IL-4-stimulated periostin induction was suppressed by significant classifier genes in the support vector machine MAP kinase/ERK kinase 1 inhibitor, indicating an involvement (SVM)-based classification algorithm,2 were statistically linked of the MAP kinase pathway. Pathologically, IL-4 was transcrip- to the generated networks. Previously, TIMP-2 was shown to tionally elevated in recurrent pterygia tissue and was localized be involved in tissue remodeling processes of pterygia.1 Al- to perivascular tissues and endothelial cells in the stroma of the though periostin showed the highest classification accuracies subconjunctiva of pterygia. of primary and recurrent pterygia,2 its functional characteris- CONCLUSIONS. Periostin is induced by IL-4 and is involved in the tics are not yet well understood, and its involvement in the fibronectin-mediated pterygia fibroblast adhesion. These find- pathogenesis of pterygia has not been reported. ings indicate that periostin probably promotes the recurrence Thus, the purpose of this study was to determine the mo- of pterygia. (Invest Ophthalmol Vis Sci. 2010;51:139–143) lecular function of periostin in pterygia pathology and the DOI:10.1167/iovs.09-4022 causative transcriptional event for periostin induction based on the generated networks. We shall show the function of peri- pterygium is an excessive fibrovascular proliferation of ostin in the recurrence of pterygia and relate it to the role of Adegenerated bulbar conjunctival tissue on the ocular sur- IL-4 as its inductive signal. face. At present, surgery is the only method for treating ptery- gia, and recurrences are a major complication of the surgical treatment of pterygia. Although numerous approaches have been attempted to reduce recurrences, such as adjunctive MATERIALS AND METHODS Patient Backgrounds and Specimen Collection From the 1Division of Ophthalmology and Visual Science, Tottori Pterygia heads were collected from 21 eyes of 21 Asian patients University Faculty of Medicine, Tottori, Japan; and 2Ideta Eye Hospital, undergoing pterygium excision with conjunctival autografting at the Kumamoto, Japan. Tottori University Hospital (Yonago, Japan) and the Ideta Eye Hospital Supported by Grant-in-Aid for Scientific Research (C) 21592258 (Kumamoto, Japan). Of these, 11 eyes of 11 patients showed primary from the Ministry of Education, Culture, Sports, Science and Technol- pterygia and 10 eyes of 10 patients showed recurrent pterygia. Patients ogy. were 11 men and 10 women whose mean age was 68 Ϯ 2 years (range, Submitted for publication May 21, 2009; revised July 1, 2009; 52–85 years). Patients with primary cicatricial ocular surface disease, accepted July 21, 2009. history of ocular allergic symptoms, and inflammatory ocular surface Disclosure: C.-H. Kuo, None; D. Miyazaki, None; K. Yakura, None; K. Araki-Sasaki, None; Y. Inoue, None disease of unknown etiology were excluded. The study protocol con- Corresponding author: Dai Miyazaki, Division of Ophthalmology formed to the tenets of the Declaration of Helsinki, and the procedures and Visual Science, Tottori University Faculty of Medicine, 36-1 Nishi- used were approved by the Tottori University Ethics Committee. cho, Yonago Tottori 683-8504, Japan; [email protected]. Signed informed consent was obtained from all patients. Investigative Ophthalmology & Visual Science, January 2010, Vol. 51, No. 1 Copyright © Association for Research in Vision and Ophthalmology 139 Downloaded from iovs.arvojournals.org on 09/29/2021 140 Kuo et al. IOVS, January 2010, Vol. 51, No. 1 Transcriptional Analysis Molecular Probes Inc., Eugene, OR) according to the manufacturer’s protocol. Briefly, the solution (CyQUANT GR; Molecular Probes Inc.) Pterygia head tissues collected from primary and recurrence cases was added to each well, and the fluorescence of the samples was were transcriptionally analyzed using an oligo microarray (AceGene, measured at 520 nm with excitation at 480 nm fluorescence micro- Hitachi, Japan) corresponding to 30,336 human genes.2 Genes that plate reader (FL600; BioTek Instruments, Winooski, VT). Cell counts were differentially induced or suppressed in the primary and recurrent were calculated based on the calibration curve of fluorescence of pterygia cases were extracted from the whole genome using t tests. diluted cell suspension. This set of genes was analyzed using a bioinformatics approach. To gain insight into the transcriptional network of molecular events Evaluation of Periostin Expression by in terms of the mechanism of recurrence, we applied commercially available analysis software (Ingenuity Pathway Analysis 3.0, based on Flow Cytometry the Ingenuity Pathways Knowledge Base; Ingenuity Systems, Redwood Pterygia fibroblasts were cultured with recombinant IL-4 (PeproTech, City, CA; http://www.ingenuity.com). The resultant networks were Rocky Hill, NJ) at the selected concentration for 48 hours. To inhibit evaluated by the significance score, which is expressed as the negative MAP kinase activity, a highly selective inhibitor of MAP kinase/ERK logarithm of that P-value. The obtained score in each instance indi- kinase1 (MEK1), PD98059 (10 ␮M; New England Biolabs, Beverly, MA), cated the likelihood that the assembly of a set of focus genes in a was added to the media. Then the serum-starved fibroblasts were network could be explained by random chance alone. collected by enzyme treatment (Accutase; Innovative Cell Technolo- gies) and incubated for 20 minutes at 37°C in a tube rotator. The Real-Time RT-PCR fibroblasts were stained by incubation with antiperiostin antibody (1 ␮g/mL) or control IgG in 0.1% BSA/PBS for 30 minutes at 4°C. After Total RNA was isolated from the treated fibroblasts using a purification kit washing, the cells were incubated with Alexa Fluor 488-antirabbit IgG (RNeasy Mini Kit; Qiagen, Hilden, Germany) according to the manufac- (Molecular Probes, Inc.) for 20 minutes at 4°C. The expression of turer’s protocol. One microgram of RNA samples was reverse transcribed periostin on the surfaces of the fibroblasts was analyzed (FACSCalibur; using random hexamers and superscript III (Invitrogen, Carlsbad, CA). Becton-Dickinson, San Jose, CA). The cDNAs were amplified and quantified (LightCycler; Roche, Mann- heim, Germany) with a one-step quantification of RNA kit (QuantiTect Statistical Analysis SYBR Green PCR kit; Qiagen). Sequences of the used real-time PCR primer pairs were as follows: IL-4: forward, 5Ј-CACCGAGTTGACCGTAACAG-3Ј; Data are presented as the mean Ϯ SEM. Statistical analyses were reverse, 5Ј- GCCCTGCAGAAGGTTTCC-3Ј; periostin: forward, 5Ј-TTGAG- performed by unpaired Student’s t-tests (two tailed) or ANOVA analy- ACGCTGGAAGGAAAT-3Ј; reverse, 5Ј-AGATCCGTGAAGGTGGTTTG-3Ј; sis. IL-13:
Recommended publications
  • Promotion of Periostin Expression Contributes to the Migration of Schwann Cells Eva Sonnenberg-Riethmacher1,2,*, Michaela Miehe2,3,* and Dieter Riethmacher1,2,‡

    Promotion of Periostin Expression Contributes to the Migration of Schwann Cells Eva Sonnenberg-Riethmacher1,2,*, Michaela Miehe2,3,* and Dieter Riethmacher1,2,‡

    © 2015. Published by The Company of Biologists Ltd | Journal of Cell Science (2015) 128, 3345-3355 doi:10.1242/jcs.174177 RESEARCH ARTICLE Promotion of periostin expression contributes to the migration of Schwann cells Eva Sonnenberg-Riethmacher1,2,*, Michaela Miehe2,3,* and Dieter Riethmacher1,2,‡ ABSTRACT Michailov et al., 2004; Riethmacher et al., 1997; Taveggia et al., Neuregulin ligands and their ErbB receptors are important for the 2005). Those experiments revealed that, later in development, development of Schwann cells, the glial cells of the peripheral mutant embryos exhibit a total loss of Schwann cells along their nervous system (PNS). ErbB3 deficiency is characterized by a peripheral axons, whereas pre-migratory Schwann cells are present complete loss of Schwann cells along axons of the peripheral nerves, near to the dorsal root ganglia but fail to migrate along the axons. impaired fasciculation and neuronal cell death. We performed The impaired glial cell migration in these mutants indicates a direct comparative gene expression analysis of dorsal root ganglia (DRG) function in migration. This interpretation is supported by the finding – explant cultures from ErbB3-deficient and wild-type mice in order to that mutations in the neuregulin ErbB signalling system lead to identify genes that are involved in Schwann cell development and changes in neural crest migration in mice (Britsch et al., 1998) and migration. The extracellular matrix (ECM) gene periostin was found to in directed Schwann cell migration in zebrafish (Lyons et al., 2005). exhibit the most prominent down regulation in ErbB3-deficient DRG. However, an earlier function in fate specification and/or Expression analysis revealed that the periostin-expressing cell proliferation that could in turn be a prerequisite for migration population in the PNS corresponds to Schwann cell precursors and cannot be completely ruled out.
  • 1 Supplementary Table S1. Primers Used for RT-Qpcr PROX1

    1 Supplementary Table S1. Primers Used for RT-Qpcr PROX1

    Supplementary Table S1. Primers used for RT-qPCR PROX1 (Prospero Homeobox 1) 5’ – CCAGCTCCAATATGCTGAAGACCTA – 3’ 5’ – CATCGTTGATGGCTTGACGTG – 3‘ MMP-1 (Matrix Metallopeptidase 1) 5' –CTGTCCCTGAACAGCCCAGTACTTA– 3' 5' –CTGGCCACAACTGCCAAATG– 3' FGF2 (Fibroblast Growth Factor 2) 5′ - GGCTTCTTCCTGCGCATCCA – 3′ 5′ – GCTCTTAGCAGACATTGGAAGA – 3′ MMP-3 (Matrix Metallopeptidase 3) GAAATGAGGTACGAGCTGGATACC– 3’ 5’ –ATGGCTGCATCGATTTTCCT– 3’ NUDT6 (Nudix Hydrolase 6) 5’ –GGCGAGCTGGACAGATTC– 3’ 5’ –GCAGCAGGGGCAATAAATCG– 3’ BAIAP2 (BAI1 Associated Protein 2) 5’ –AAGTCCACAGGCAGATCCAG– 3’ 5’ –GCCTTTGCTCCTTTGCTCAG– 3’ VEGFC (Vascular Endothelial Growth 5’ –GCCACGGCTTATGCAAGCAAAGAT– 3’ Factor C) 5’ –AGTTGAGGTTGGCCTGTTCTCTGT– 3’ ANGPT1 (Angiopoietin 1) 5’ –GAAGGGAACCGAGCCTATTC– 3’ 5’ –AGCATCAAACCACCATCCTC– 3’ KDR (Kinase Insert Domain Receptor) 5’ –AGGAGAGCGTGTCTTTGTGG– 3’ 5’ –GCCTGTCTTCAGTTCCCCTC– 3’ VEGFA (Vascular Endothelial Growth 5’ –CTTGCCTTGCTGCTCTACCT– 3’ Factor A) 5’ –AAGATGTCCACCAGGGTCTC– 3’ PLAT (Plasminogen Activator, Tissue 5’ –AGGAGAGCGTGTCTTTGTGG– 3’ Type) 5’ –GCCTGTCTTCAGTTCCCCTC– 3’ MDK (Midkine) 5’ –CCTGCAACTGGAAGAAGGAG– 3’ 5’ -- CTTTCCCTTCCCTTTCTTGG– 3’ ADAMTS9 (ADAM Metallopeptidase 5’ –ACGAAAAACCTGCCGTAATG– 3’ With Thrombospondin Type 1 Motif 9) 5’ –TCAGAGTCTCCATGCACCAG– 3’ TIMP3 (TIMP Metallopeptidase Inhibitor 5’ –CTGACAGGTCGCGTCTATGA– 3’ 3) 5’ –AGTCACAAAGCAAGGCAGGT– 3’ ACTB (Beta Actin) 5’ – GCCGAGGACTTTGATTGC – 3’ 5’– CTGTGTGGACTTGGGAGAG – 3’ 1 Figure S1. Efficient silencing of PROX1 in CGTH-W-1 and FTC-133 cells. Western blotting analysis shows a decrease in PROX1 protein level by targeting with siRNAs purchased from Santa Cruz (SC) and Sigma-Aldrich (SA) in both CGTH-W-1 and FTC-133 cell line. Beta-actin was used as a loading control of protein lysates. Figure S2. The tube formation assay. The silencing of PROX1 in CGTH-W-1 and FTC-133 cells enhances the angiogenesis in vitro of endothelial cells. HUVECs were cultured in 96-well plates coated with a semi-solid Matrigel.
  • Genomic Aberrations Associated with Erlotinib Resistance in Non-Small Cell Lung Cancer Cells

    Genomic Aberrations Associated with Erlotinib Resistance in Non-Small Cell Lung Cancer Cells

    ANTICANCER RESEARCH 33: 5223-5234 (2013) Genomic Aberrations Associated with Erlotinib Resistance in Non-small Cell Lung Cancer Cells MASAKUNI SERIZAWA1, TOSHIAKI TAKAHASHI2, NOBUYUKI YAMAMOTO2,3 and YASUHIRO KOH1 1Drug Discovery and Development Division, Shizuoka Cancer Center Research Institute, Sunto-gun, Shizuoka, Japan; 2Division of Thoracic Oncology, Shizuoka Cancer Center Hospital, Sunto-gun, Shizuoka, Japan; 3Third Department of Internal Medicine, Wakayama Medical University, Kimiidera, Wakayama, Japan Abstract. Background/Aim: Mechanisms of resistance to mutations develop resistance, usually within one year of epidermal growth factor receptor (EGFR)-tyrosine kinase treatment. Therefore, there is an urgent need to elucidate the inhibitors (TKIs) in non-small cell lung cancer (NSCLC) underlying mechanisms of resistance in such tumors to are not fully-understood. In this study we aimed to overcome this obstacle (11-14, 17, 24). Recent studies elucidate remaining unknown mechanisms using erlotinib- suggest that mechanisms of acquired resistance to EGFR- resistant NSCLC cells. Materials and Methods: We TKIs can be categorized into three groups: occurrence of performed array comparative genomic hybridization genetic alterations, activation of downstream pathways via (aCGH) to identify genomic aberrations associated with bypass signaling, and phenotypic transformation (15, 16, 21); EGFR-TKI resistance in erlotinib-resistant PC-9ER cells. therapeutic strategies to overcome these resistance Real-time polymerase chain reaction (PCR) and mechanisms are under development. However, although the immunoblot analyses were performed to confirm the results causes of acquired resistance to EGFR-TKIs have been of aCGH. Results: Among the five regions with copy investigated, in more than 30% of patients with acquired number gain detected in PC-9ER cells, we focused on resistance to EGFR-TKI treatment, the mechanisms remain 22q11.2-q12.1 including v-crk avian sarcoma virus CT10 unknown (15).
  • AP1B1 Rabbit Polyclonal Antibody – TA323221 | Origene

    AP1B1 Rabbit Polyclonal Antibody – TA323221 | Origene

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA323221 AP1B1 Rabbit Polyclonal Antibody Product data: Product Type: Primary Antibodies Applications: IHC Recommended Dilution: ELISA: 1:1000-5000, IHC: 1:25-100 Reactivity: Human, Mouse, Rat Host: Rabbit Isotype: IgG Clonality: Polyclonal Immunogen: Synthetic peptide corresponding to a region derived from 18-30 amino acids of Human Adapter-related protein complex 1 subunit beta-1 Formulation: PBS pH7.3, 0.05% NaN3, 50% glycerol Concentration: lot specific Purification: Antigen affinity purification Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Gene Name: adaptor related protein complex 1 beta 1 subunit Database Link: NP_001118 Entrez Gene 11764 MouseEntrez Gene 29663 RatEntrez Gene 162 Human Q10567 Background: Adaptor protein complex 1 is found at the cytoplasmic face of coated vesicles located at the Golgi complex; where it mediates both the recruitment of clathrin to the membrane and the recognition of sorting signals within the cytosolic tails of transmembrane receptors. This complex is a heterotetramer composed of two large; one medium; and one small adaptin subunit. The protein encoded by this gene serves as one of the large subunits of this complex and is a member of the adaptin protein family. This gene is a candidate meningioma gene. Alternative splicing results in multiple transcript variants. Synonyms: ADTB1; AP105A; BAM22; CLAPB2 Protein Pathways: Lysosome This product is to be used for laboratory only.
  • Periostin Modulates Myofibroblast Differentiation During Full-Thickness Cutaneous Wound Repair

    Periostin Modulates Myofibroblast Differentiation During Full-Thickness Cutaneous Wound Repair

    Research Article 121 Periostin modulates myofibroblast differentiation during full-thickness cutaneous wound repair Christopher G. Elliott1, Jian Wang2, Xiaolei Guo3, Shi-wen Xu4, Mark Eastwood5, Jianjun Guan3, Andrew Leask6, Simon J. Conway2 and Douglas W. Hamilton1,6,* 1Department of Anatomy and Cell Biology, Schulich School of Medicine and Dentistry, The University of Western Ontario, 1151 Richmond St, London, Ontario, Canada, N6A 5C1 2Riley Heart Research Center, Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, 1044 West Walnut, Indianapolis, IN 46202, USA 3Department of Materials Science and Engineering, The Ohio State University, 2041 College Road, Columbus, OH 43210, USA 4Centre for Rheumatology, Royal Free and University College Medical School, London, NW3 2PF, UK 5School of Life Sciences, University of Westminster, London, W1B 2UW, UK 6Division of Oral Biology, Schulich School of Medicine and Dentistry, The University of Western Ontario, 1151 Richmond St, London, Ontario, Canada, N6A 5C1 *Author for correspondence ([email protected]) Accepted 22 July 2011 Journal of Cell Science 125, 121–132 ß 2012. Published by The Company of Biologists Ltd doi: 10.1242/jcs.087841 Summary The matricellular protein periostin is expressed in the skin. Although periostin has been hypothesized to contribute to dermal homeostasis and repair, this has not been directly tested. To assess the contribution of periostin to dermal healing, 6 mm full-thickness excisional wounds were created in the skin of periostin-knockout and wild-type, sex-matched control mice. In wild-type mice, periostin was potently induced 5–7 days after wounding. In the absence of periostin, day 7 wounds showed a significant reduction in myofibroblasts, as visualized by expression of a-smooth muscle actin (a-SMA) within the granulation tissue.
  • Gene Alterations Identified by Expression Profiling in Tumor-Associated Endothelial Cells from Invasive Ovarian Carcinoma

    Gene Alterations Identified by Expression Profiling in Tumor-Associated Endothelial Cells from Invasive Ovarian Carcinoma

    Research Article Gene Alterations Identified by Expression Profiling in Tumor-Associated Endothelial Cells from Invasive Ovarian Carcinoma Chunhua Lu,1 Tomas Bonome,3 Yang Li,1 Aparna A. Kamat,1 Liz Y. Han,1 Rosemarie Schmandt,1 Robert L. Coleman,1 David M. Gershenson,1 Robert B. Jaffe,4 MichaelJ. Birrer, 3 and AnilK. Sood 1,2 Departments of 1Gynecologic Oncology and 2Cancer Biology, University of Texas M. D. Anderson Cancer Center, Houston, Texas; 3Cell and Cancer Biology Branch, National Cancer Institute, Bethesda, Maryland; and 4Center for Reproductive Sciences, University of California, San Francisco, San Francisco, California Abstract the promise of such approaches. However, the full spectrum of Therapeutic strategies based on antiangiogenic approaches differences in the tumor vasculature compared with its normal are beginning to show great promise in clinical studies. counterpart is not known. Identification of additional targets on However, full realization of these approaches requires tumor endothelium may allow opportunities for developing new identification of key differences in gene expression between therapeutic approaches to inhibit angiogenesis in a tumor-specific endothelial cells from tumors versus their normal counter- manner. parts. Here, we examined gene expression differences in Higher levels of proangiogenic cytokines and angiogenesis are purified endothelial cells from 10invasive epithelial ovarian associated with an increased risk of metastasis and poor prognosis cancers and 5 normal ovaries using Affymetrix U133 Plus in ovarian cancer (5, 6). To date, a small number of breast, colon, 2.0microarrays. More than 400differentially expressed genes and brain cancers have been analyzed for gene expression changes were identified in tumor-associated endothelial cells.
  • University of California Santa Cruz Sample

    University of California Santa Cruz Sample

    UNIVERSITY OF CALIFORNIA SANTA CRUZ SAMPLE-SPECIFIC CANCER PATHWAY ANALYSIS USING PARADIGM A dissertation submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in BIOMOLECULAR ENGINEERING AND BIOINFORMATICS by Stephen C. Benz June 2012 The Dissertation of Stephen C. Benz is approved: Professor David Haussler, Chair Professor Joshua Stuart Professor Nader Pourmand Dean Tyrus Miller Vice Provost and Dean of Graduate Studies Copyright c by Stephen C. Benz 2012 Table of Contents List of Figures v List of Tables xi Abstract xii Dedication xiv Acknowledgments xv 1 Introduction 1 1.1 Identifying Genomic Alterations . 2 1.2 Pathway Analysis . 5 2 Methods to Integrate Cancer Genomics Data 10 2.1 UCSC Cancer Genomics Browser . 11 2.2 BioIntegrator . 16 3 Pathway Analysis Using PARADIGM 20 3.1 Method . 21 3.2 Comparisons . 26 3.2.1 Distinguishing True Networks From Decoys . 27 3.2.2 Tumor versus Normal - Pathways associated with Ovarian Cancer 29 3.2.3 Differentially Regulated Pathways in ER+ve vs ER-ve breast can- cers . 36 3.2.4 Therapy response prediction using pathways (Platinum Free In- terval in Ovarian Cancer) . 38 3.3 Unsupervised Stratification of Cancer Patients by Pathway Activities . 42 4 SuperPathway - A Global Pathway Model for Cancer 51 4.1 SuperPathway in Ovarian Cancer . 55 4.2 SuperPathway in Breast Cancer . 61 iii 4.2.1 Chin-Naderi Cohort . 61 4.2.2 TCGA Breast Cancer . 63 4.3 Cross-Cancer SuperPathway . 67 5 Pathway Analysis of Drug Effects 74 5.1 SuperPathway on Breast Cell Lines .
  • A Peripheral Blood Gene Expression Signature to Diagnose Subclinical Acute Rejection

    A Peripheral Blood Gene Expression Signature to Diagnose Subclinical Acute Rejection

    CLINICAL RESEARCH www.jasn.org A Peripheral Blood Gene Expression Signature to Diagnose Subclinical Acute Rejection Weijia Zhang,1 Zhengzi Yi,1 Karen L. Keung,2 Huimin Shang,3 Chengguo Wei,1 Paolo Cravedi,1 Zeguo Sun,1 Caixia Xi,1 Christopher Woytovich,1 Samira Farouk,1 Weiqing Huang,1 Khadija Banu,1 Lorenzo Gallon,4 Ciara N. Magee,5 Nader Najafian,5 Milagros Samaniego,6 Arjang Djamali ,7 Stephen I. Alexander,2 Ivy A. Rosales,8 Rex Neal Smith,8 Jenny Xiang,3 Evelyne Lerut,9 Dirk Kuypers,10,11 Maarten Naesens ,10,11 Philip J. O’Connell,2 Robert Colvin,8 Madhav C. Menon,1 and Barbara Murphy1 Due to the number of contributing authors, the affiliations are listed at the end of this article. ABSTRACT Background In kidney transplant recipients, surveillance biopsies can reveal, despite stable graft function, histologic features of acute rejection and borderline changes that are associated with undesirable graft outcomes. Noninvasive biomarkers of subclinical acute rejection are needed to avoid the risks and costs associated with repeated biopsies. Methods We examined subclinical histologic and functional changes in kidney transplant recipients from the prospective Genomics of Chronic Allograft Rejection (GoCAR) study who underwent surveillance biopsies over 2 years, identifying those with subclinical or borderline acute cellular rejection (ACR) at 3 months (ACR-3) post-transplant. We performed RNA sequencing on whole blood collected from 88 indi- viduals at the time of 3-month surveillance biopsy to identify transcripts associated with ACR-3, developed a novel sequencing-based targeted expression assay, and validated this gene signature in an independent cohort.
  • Clathrin Heavy and Light Chain Isoforms Originated by Independent Mechanisms of Gene Duplication During Chordate Evolution

    Clathrin Heavy and Light Chain Isoforms Originated by Independent Mechanisms of Gene Duplication During Chordate Evolution

    Clathrin heavy and light chain isoforms originated by independent mechanisms of gene duplication during chordate evolution Diane E. Wakeham†‡, Laurent Abi-Rached‡§, Mhairi C. Towler†¶, Jeremy D. Wilbur†ʈ, Peter Parham§, and Frances M. Brodsky†,†† †The G. W. Hooper Foundation and Departments of Biopharmaceutical Sciences, Pharmaceutical Chemistry, and Microbiology and Immunology and ʈBiophysics Program, University of California, San Francisco, CA 94143-0552; and §Department of Structural Biology and Department of Microbiology and Immunology, Stanford University, Stanford, CA 94305 Communicated by J. Michael Bishop, University of California, San Francisco, CA, March 22, 2005 (received for review January 14, 2005) In humans, there are two isoforms each of clathrin heavy chain biogenesis. CHC17 is expressed ubiquitously in vertebrate tissues (CHC17 and CHC22) and light chain (LCa and LCb) subunits, all and a functional orthologue is present in all eukaryotic organ- encoded by separate genes. CHC17 forms the ubiquitous clathrin- isms analyzed. The CHC22 isoform is highly expressed in human coated vesicles that mediate membrane traffic. CHC22 is implicated skeletal muscle, with a low level detected in other tissues. CHC22 in specialized membrane organization in skeletal muscle. CHC17 is is concentrated at neuromuscular and myotendinous junctions, bound and regulated by LCa and LCb, whereas CHC22 does not and its expression increases during myogenesis and muscle functionally interact with either light chain. The imbalanced inter- regeneration (10, 11). Thus, CHC22 appears to have a role actions between clathrin subunit isoforms suggest a distinct evo- distinct from CHC17 in specialized muscle membrane organi- lutionary history for each isoform pair. Phylogenetic and sequence zation. CHC17 and CHC22 have a remarkably high protein sequence identity (85%), despite their evident differences in analysis placed both heavy and light chain gene duplications function.
  • Deletion of Periostin Reduces Muscular Dystrophy and Fibrosis in Mice By

    Deletion of Periostin Reduces Muscular Dystrophy and Fibrosis in Mice By

    Deletion of periostin reduces muscular dystrophy and fibrosis in mice by modulating the transforming growth factor-β pathway Angela Lortsa,1, Jennifer A. Schwanekampa,1, Troy A. Baudinob, Elizabeth M. McNallyc, and Jeffery D. Molkentina,d,2 aDepartment of Pediatrics, Cincinnati Children’s Hospital, University of Cincinnati, Cincinnati, OH 45229; bDepartment of Medicine, Texas A&M Health Science Center College of Medicine, Temple, TX 76504; cDepartment of Medicine, University of Chicago, Chicago, IL 60637; and dHoward Hughes Medical Institute, Cincinnati Children’s Hospital, Cincinnati, OH 45229 Edited by Kevin P. Campbell, University of Iowa Carver College of Medicine, Iowa City, IA, and approved May 18, 2012 (received for review March 20, 2012) The muscular dystrophies are broadly classified as muscle wasting induced and secreted into the ECM after acute injury, as well as diseases with myofiber dropout due to cellular necrosis, inflam- in dystrophic skeletal muscle (13). Periostin is expressed exclu- mation, alterations in extracellular matrix composition, and fatty sively by fibroblasts or cells that adopt a fibroblast-like phenotype cell replacement. These events transpire and progress despite after an injurious event (14). In the heart, we and others have ongoing myofiber regeneration from endogenous satellite cells. shown that periostin is strongly induced after myocardial in- The degeneration/regeneration response to muscle injury/disease farction and left ventricular pressure overload, where it plays is modulated by the proinflammatory cytokine transforming a role in ECM remodeling and healing (15, 16). growth factor-β (TGF-β), which can also profoundly influence ex- In the present study, we found that mice lacking periostin tracellular matrix composition through increased secretion of pro- (Postn) were profoundly protected from MD through mecha- fibrotic proteins, such as the matricellular protein periostin.
  • The Inter-Relationship of Periostin, Tgfβ, and BMP in Heart Valve Development and Valvular Heart Diseases

    The Inter-Relationship of Periostin, Tgfβ, and BMP in Heart Valve Development and Valvular Heart Diseases

    Review TheScientificWorldJOURNAL (2011) 11, 1509–1524 TSW Development & Embryology ISSN 1537-744X; DOI 10.1100/tsw.2011.132 The Inter-Relationship of Periostin, TGFβ, and BMP in Heart Valve Development and Valvular Heart Diseases Simon J. Conway1, Thomas Doetschman2,3, and Mohamad Azhar2,3,* 1Riley Heart Research Center, Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis; 2BIO5 Institute, University of Arizona, Tucson; 3Department of Cellular and Molecular Medicine, University of Arizona, Tucson E-mail: [email protected] Received August 23, 2009; Revised June 28, 2011; Accepted July 4, 2011; Published July 28, 2011 Recent studies have suggested an important role for periostin and transforming growth factor beta (TGFβ) and bone morphogenetic protein (BMP) ligands in heart valve formation and valvular heart diseases. The function of these molecules in cardiovascular development has previously been individually reviewed, but their association has not been thoroughly examined. Here, we summarize the current understanding of the association between periostin and TGFβ and BMP ligands, and discuss the implications of this association in the context of the role of these molecules in heart valve development and valvular homeostasis. Information about hierarchal connections between periostin and TGFβ and BMP ligands in valvulogenesis will increase our understanding of the pathogenesis, progression, and medical treatment of human valve diseases. KEYWORDS: periostin, transforming growth factor beta, TGFβ, bone morphogenetic protein, BMP, heart development, heart valves, Marfan syndrome INTRODUCTION About one-fourth of patients with congenital heart disease, which affects approximately 5% of live births, have structural anomalies of one or more heart valves[1,2]. Isolated bicuspid aortic valve and congenital polyvalvular disease represent major congenital cardiac valve malformations[3,4,5].
  • Periostin Induces Proliferation of Differentiated Cardiomyocytes and Promotes Cardiac Repair

    Periostin Induces Proliferation of Differentiated Cardiomyocytes and Promotes Cardiac Repair

    ARTICLES Periostin induces proliferation of differentiated cardiomyocytes and promotes cardiac repair Bernhard Ku¨hn1, Federica del Monte2, Roger J Hajjar2,4, Yuh-Shin Chang3, Djamel Lebeche2,4, Shima Arab1 & Mark T Keating1,4 Adult mammalian hearts respond to injury with scar formation and not with cardiomyocyte proliferation, the cellular basis of regeneration. Although cardiogenic progenitor cells may maintain myocardial turnover, they do not give rise to a robust regenerative response. Here we show that extracellular periostin induced reentry of differentiated mammalian cardiomyocytes into the cell cycle. Periostin stimulated mononucleated cardiomyocytes to go through the full mitotic cell cycle. Periostin activated aV, b1, b3 and b5 integrins located in the cardiomyocyte cell membrane. Activation of phosphatidylinositol-3-OH kinase was required for periostin- http://www.nature.com/naturemedicine induced reentry of cardiomyocytes into the cell cycle and was sufficient for cell-cycle reentry in the absence of periostin. After myocardial infarction, periostin-induced cardiomyocyte cell-cycle reentry and mitosis were associated with improved ventricular remodeling and myocardial function, reduced fibrosis and infarct size, and increased angiogenesis. Thus, periostin and the pathway that it regulates may provide a target for innovative strategies to treat heart failure. Differentiated cardiomyocytes carry the pump function of the heart. hypertrophic cardiomyopathy16. By contrast, liposomal gene delivery Loss of cardiomyocytes, which occurs, for example, after a large of periostin leads to dilative cardiomyopathy without hypertrophy17. myocardial infarction, typically results in heart failure. Observations Here we have investigated whether recombinant periostin, delivered spanning the twentieth century show that some cardiomyocytes in the through the cardiac extracellular matrix, can increase cardiomyocyte adult heart undergo DNA synthesis and mitosis1,2.