Physiological and Metabolic Diversity in the Yeast Kluyveromyces Marxianus
Total Page：16
File Type：pdf, Size：1020Kb
Antonie van Leeuwenhoek DOI 10.1007/s10482-011-9606-x ORIGINAL PAPER Physiological and metabolic diversity in the yeast Kluyveromyces marxianus Melanie M. Lane • Niall Burke • Rob Karreman • Kenneth H. Wolfe • Conor P. O’Byrne • John P. Morrissey Received: 1 March 2011 / Accepted: 3 June 2011 Ó Springer Science+Business Media B.V. 2011 Abstract Kluyveromyces marxianus is homothallic with some strains showing multi-stress resistance. hemiascomycete yeast frequently isolated from dairy These traits generally appeared unlinked indicating environments. It possesses phenotypic traits such as that, as with other yeasts, multiple resistance/adapta- enhanced thermotolerance, inulinase production, and tion pathways are present in K. marxianus. The data rapid growth rate that distinguish it from its closest indicate that it should be possible to identify the relative Kluyveromyces lactis. Certain of these traits, molecular basis of traits to facilitate selection or notably fermentation of lactose and inulin to ethanol, engineering of strains adapted for industrial environ- make this yeast attractive for industrial production of ments. The loci responsible for mating were also ethanol from inexpensive substrates. There is rela- identified by genome sequencing and PCR analysis. It tively little known, however, about the diversity in was found that K. marxianus can exist as stable this species, at the genetic, metabolic or physiological haploid or diploid cells, opening up additional levels. This study compared phenotypic traits of 13 prospects for future strain engineering. K. marxianus strains sourced from two European Culture Collections. A wide variety of responses to Keywords Kluyveromyces marxianus Á thermo, osmotic, and cell wall stress were observed, Industrial yeast Á Physiology Á Stress Á Ploidy Electronic supplementary material The online version of this article (doi:10.1007/s10482-011-9606-x) contains Introduction supplementary material, which is available to authorized users. Modern yeast biotechnology places a large emphasis M. M. Lane Á N. Burke Á R. Karreman Á J. P. Morrissey (&) on developing new traits in existing yeasts, or in Department of Microbiology, University College Cork, identifying yeast species with novel traits or properties Cork, Ireland (Porro and Branduardi 2009). Currently, the majority e-mail: [email protected] of yeast biotechnology uses the species Saccharomy- K. H. Wolfe ces cerevisiae (or close relatives) for applications as Smurfit Institute of Genetics, Trinity College Dublin, diverse as vaccine production and wine-making. Dublin 2, Ireland Limitations with S. cerevisiae, however, have led to an increased focus on the potential of so-called non- C. P. O’Byrne Microbiology Department, National University of Ireland conventional yeasts, such as Pichia, Zygosaccharomy- Galway, Galway, Ireland ces, and Kluyveromyces. Kluyveromyces is a genus 123 Antonie van Leeuwenhoek within the hemiascomycetous yeasts that has been ethanol production suggest that this may not be an restricted to six species following the reclassification entirely accurate classification. A number of recent into monophyletic genera based on 26S rDNA studies have attempted to understand respiro-fermen- sequence (Kurtzman 2003; Lachance 2007). Two tative metabolism in hemiascomycetous yeasts (Blank species within the genus, Kluyveromyces lactis and et al. 2005; Merico et al. 2007, 2009; Rozpedowska Kluyveromyces marxianus, carry the LAC12-LAC4 et al. 2011). Some interesting findings are that the gene pair, responsible for the uptake and subsequent distribution of this trait between species is variable, and cleavage of lactose into glucose and galactose, and are at least one reason for the poor fermentative ability of thus lactose positive (Schaffrath and Breunig 2000; some species may be an inability to maintain redox Rubio-Texeira 2006). K. lactis was selected as a model balance under low oxygen conditions (Merico et al. for genetic analysis of lactose positive yeasts and has 2007). Generally, however, these studies used a single been extensively studied at a molecular level (Schaff- representative strain from each species and the extent rath and Breunig 2000; Fukuhara 2006). In contrast, the of physiological variation within a species was not sister species, K. marxianus, is less well studied at the assessed. molecular level but has been adopted by industry for Because industrial fermentations typically use applications ranging from biomass production to complex substrates, other traits that are of general bioremediation (Fonseca et al. 2008; Lane and Mor- importance are tolerance to high osmolyte concen- rissey 2010). Industrial applications of K. marxianus trations and to cell-wall inhibitors. In S. cerevisiae, take advantage of traits such as rapid growth, thermo- the stress activated protein kinase Hog1p, is activated tolerance, secretion of the enzyme inulinase and by osmotic and other stresses, and this leads to an production of ethanol. Although these individual traits adaptive response to cope with adverse environmen- have been described in many strains of K. marxianus, tal conditions (Smith et al. 2010; Hohmann 2002; there has been little effort to study the molecular Hohmann et al. 2007). A homologous system has physiology of this yeast, nor to determine the level of been described in K. lactis (Kawasaki et al. 2008) phenotypic diversity within the species. and recently a HOG1 orthologue was disrupted in Many of the applications of K. marxianus take K. marxianus NBRC 1777, leading to sensitivity to advantage of specific strains to produce ethanol when salt and oxidative stress (Qian et al. 2010). Tolerance growing on substrates containing sugars such as to cell wall damage in S. cerevisiae is mediated by inulin or lactose. The particular interest in lactose as a another MAP kinase pathway termed the cell wall carbon source arises because it is present at a integrity (CWI) pathway, and research with K. lactis concentration of 4–5% in whey, traditionally a waste suggests that an orthologous system functions in this product of the dairy industry. K. marxianus is an yeast (Rodicio et al. 2008; Rodicio and Heinisch aerobic yeast and its capacity to generate energy by 2010). Overall, these findings indicate that similar mixed respiration and fermentation is described as stress response pathways may operate in Saccharo- respiro-fermentative metabolism. This dual capacity myces and Kluyveromyces species, but there are no is common in hemiascomycetous yeasts and appears data on regulatory mechanisms, nor on or genetic and most highly regulated and sophisticated in S. cerevi- phenotypic variation in these traits in K. marxianus. siae (Piskur et al. 2006). Several regulatory processes There are also no data to explain the increased contribute to the efficient fermentative capacity of thermotolerance of K. marxianus over its sister S. cerevisiae, most notably the strong ‘‘Crabtree species K. lactis. effect’’, which appears to be largely due to carbon Early assumptions that conservation of homolo- catabolite (glucose) repression of genes encoding gous genes implied that identical metabolic and respiratory enzymes, and the weak ‘‘Pasteur effect’’, regulatory processes occurred in related yeasts have which would be inhibition of fermentative metabo- long been dismissed (Li and Johnson 2010). In lism by oxygen (Barnett and Entian 2005). Both addition, however, from work with K. lactis,itis K. lactis and K. marxianus are traditionally classified clear that significant physiological differences can as ‘‘Crabtree negative’’ yeasts, implying an inability to also occur within the species (Schaffrath and Breunig effectively ferment sugars to ethanol. Nonetheless, the 2000; Suleau et al. 2005). From the wide spectrum of widespread reports of applications of K. marxianus in biotechnological studies of K. marxianus, it has 123 Antonie van Leeuwenhoek already become apparent that diversity is present (O’Donnell 1993) in a standard PCR reaction of within the species. The aim of this current study was annealing 30 s at 52°C, extension for 2 m at 72°C, to examine phenotypic and physiological diversity in and denaturation at 94°C for 1 m (36 cycles) a selection of strains to try to establish the extent of (Kurtzman and Robnett 1998). The ITS spacer region variation within the species. of the rDNA was amplified using primers ITS-1 (50-TCCGTAGGTGAACCTGCGG) and ITS-4 (50- TCCTCCGCTTATTGATATGC) in a standard PCR reaction of annealing 1 m at 55°C, extension for Materials and methods 2 m at 72°C, and denaturation at 94°C for 1 m (35 cycles). PCR products were purified using the Qiagen Yeast strains QIAquick PCR microcentrifuge purification kit as per manufacturer’s instructions and sequenced by GATC The K. marxianus strains used in this study were Germany. The strains were already classified as obtained as lyophilized stocks from the Centraalbu- K. marxianus in the source strain databases so the reau voor Schimmelcultures, Delft, The Netherlands main purpose was to confirm that no strain was in fact (CBS 397, CBS 608, CBS 745 and CBS 7858) or the the close relative Kluyveromyces lactis. The sequence National Collection of Yeast Cultures Norwich, UK data was compared to references in databanks (CBS, (NCYC 100, NCYC 179, NCYC 111, NCYC 587, NCYC, Genbank, NCBI) to confirm the identity of NCYC 970, NCYC 1424, NCYC 2597, NCYC 2791, the 13 strains and their classification as K. marxianus NCYC 2887). Some strains are also known by (Supplementary Fig. 1). alternative names,