Physiological and Metabolic Diversity in the Yeast Kluyveromyces Marxianus

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Antonie van Leeuwenhoek DOI 10.1007/s10482-011-9606-x ORIGINAL PAPER Physiological and metabolic diversity in the yeast Kluyveromyces marxianus Melanie M. Lane • Niall Burke • Rob Karreman • Kenneth H. Wolfe • Conor P. O’Byrne • John P. Morrissey Received: 1 March 2011 / Accepted: 3 June 2011 Ó Springer Science+Business Media B.V. 2011 Abstract Kluyveromyces marxianus is homothallic with some strains showing multi-stress resistance. hemiascomycete yeast frequently isolated from dairy These traits generally appeared unlinked indicating environments. It possesses phenotypic traits such as that, as with other yeasts, multiple resistance/adapta- enhanced thermotolerance, inulinase production, and tion pathways are present in K. marxianus. The data rapid growth rate that distinguish it from its closest indicate that it should be possible to identify the relative Kluyveromyces lactis. Certain of these traits, molecular basis of traits to facilitate selection or notably fermentation of lactose and inulin to ethanol, engineering of strains adapted for industrial environ- make this yeast attractive for industrial production of ments. The loci responsible for mating were also ethanol from inexpensive substrates. There is rela- identified by genome sequencing and PCR analysis. It tively little known, however, about the diversity in was found that K. marxianus can exist as stable this species, at the genetic, metabolic or physiological haploid or diploid cells, opening up additional levels. This study compared phenotypic traits of 13 prospects for future strain engineering. K. marxianus strains sourced from two European Culture Collections. A wide variety of responses to Keywords Kluyveromyces marxianus Á thermo, osmotic, and cell wall stress were observed, Industrial yeast Á Physiology Á Stress Á Ploidy Electronic supplementary material The online version of this article (doi:10.1007/s10482-011-9606-x) contains Introduction supplementary material, which is available to authorized users. Modern yeast biotechnology places a large emphasis M. M. Lane Á N. Burke Á R. Karreman Á J. P. Morrissey (&) on developing new traits in existing yeasts, or in Department of Microbiology, University College Cork, identifying yeast species with novel traits or properties Cork, Ireland (Porro and Branduardi 2009). Currently, the majority e-mail: [email protected] of yeast biotechnology uses the species Saccharomy- K. H. Wolfe ces cerevisiae (or close relatives) for applications as Smurfit Institute of Genetics, Trinity College Dublin, diverse as vaccine production and wine-making. Dublin 2, Ireland Limitations with S. cerevisiae, however, have led to an increased focus on the potential of so-called non- C. P. O’Byrne Microbiology Department, National University of Ireland conventional yeasts, such as Pichia, Zygosaccharomy- Galway, Galway, Ireland ces, and Kluyveromyces. Kluyveromyces is a genus 123 Antonie van Leeuwenhoek within the hemiascomycetous yeasts that has been ethanol production suggest that this may not be an restricted to six species following the reclassification entirely accurate classification. A number of recent into monophyletic genera based on 26S rDNA studies have attempted to understand respiro-fermen- sequence (Kurtzman 2003; Lachance 2007). Two tative metabolism in hemiascomycetous yeasts (Blank species within the genus, Kluyveromyces lactis and et al. 2005; Merico et al. 2007, 2009; Rozpedowska Kluyveromyces marxianus, carry the LAC12-LAC4 et al. 2011). Some interesting findings are that the gene pair, responsible for the uptake and subsequent distribution of this trait between species is variable, and cleavage of lactose into glucose and galactose, and are at least one reason for the poor fermentative ability of thus lactose positive (Schaffrath and Breunig 2000; some species may be an inability to maintain redox Rubio-Texeira 2006). K. lactis was selected as a model balance under low oxygen conditions (Merico et al. for genetic analysis of lactose positive yeasts and has 2007). Generally, however, these studies used a single been extensively studied at a molecular level (Schaff- representative strain from each species and the extent rath and Breunig 2000; Fukuhara 2006). In contrast, the of physiological variation within a species was not sister species, K. marxianus, is less well studied at the assessed. molecular level but has been adopted by industry for Because industrial fermentations typically use applications ranging from biomass production to complex substrates, other traits that are of general bioremediation (Fonseca et al. 2008; Lane and Mor- importance are tolerance to high osmolyte concen- rissey 2010). Industrial applications of K. marxianus trations and to cell-wall inhibitors. In S. cerevisiae, take advantage of traits such as rapid growth, thermo- the stress activated protein kinase Hog1p, is activated tolerance, secretion of the enzyme inulinase and by osmotic and other stresses, and this leads to an production of ethanol. Although these individual traits adaptive response to cope with adverse environmen- have been described in many strains of K. marxianus, tal conditions (Smith et al. 2010; Hohmann 2002; there has been little effort to study the molecular Hohmann et al. 2007). A homologous system has physiology of this yeast, nor to determine the level of been described in K. lactis (Kawasaki et al. 2008) phenotypic diversity within the species. and recently a HOG1 orthologue was disrupted in Many of the applications of K. marxianus take K. marxianus NBRC 1777, leading to sensitivity to advantage of specific strains to produce ethanol when salt and oxidative stress (Qian et al. 2010). Tolerance growing on substrates containing sugars such as to cell wall damage in S. cerevisiae is mediated by inulin or lactose. The particular interest in lactose as a another MAP kinase pathway termed the cell wall carbon source arises because it is present at a integrity (CWI) pathway, and research with K. lactis concentration of 4–5% in whey, traditionally a waste suggests that an orthologous system functions in this product of the dairy industry. K. marxianus is an yeast (Rodicio et al. 2008; Rodicio and Heinisch aerobic yeast and its capacity to generate energy by 2010). Overall, these findings indicate that similar mixed respiration and fermentation is described as stress response pathways may operate in Saccharo- respiro-fermentative metabolism. This dual capacity myces and Kluyveromyces species, but there are no is common in hemiascomycetous yeasts and appears data on regulatory mechanisms, nor on or genetic and most highly regulated and sophisticated in S. cerevi- phenotypic variation in these traits in K. marxianus. siae (Piskur et al. 2006). Several regulatory processes There are also no data to explain the increased contribute to the efficient fermentative capacity of thermotolerance of K. marxianus over its sister S. cerevisiae, most notably the strong ‘‘Crabtree species K. lactis. effect’’, which appears to be largely due to carbon Early assumptions that conservation of homolo- catabolite (glucose) repression of genes encoding gous genes implied that identical metabolic and respiratory enzymes, and the weak ‘‘Pasteur effect’’, regulatory processes occurred in related yeasts have which would be inhibition of fermentative metabo- long been dismissed (Li and Johnson 2010). In lism by oxygen (Barnett and Entian 2005). Both addition, however, from work with K. lactis,itis K. lactis and K. marxianus are traditionally classified clear that significant physiological differences can as ‘‘Crabtree negative’’ yeasts, implying an inability to also occur within the species (Schaffrath and Breunig effectively ferment sugars to ethanol. Nonetheless, the 2000; Suleau et al. 2005). From the wide spectrum of widespread reports of applications of K. marxianus in biotechnological studies of K. marxianus, it has 123 Antonie van Leeuwenhoek already become apparent that diversity is present (O’Donnell 1993) in a standard PCR reaction of within the species. The aim of this current study was annealing 30 s at 52°C, extension for 2 m at 72°C, to examine phenotypic and physiological diversity in and denaturation at 94°C for 1 m (36 cycles) a selection of strains to try to establish the extent of (Kurtzman and Robnett 1998). The ITS spacer region variation within the species. of the rDNA was amplified using primers ITS-1 (50-TCCGTAGGTGAACCTGCGG) and ITS-4 (50- TCCTCCGCTTATTGATATGC) in a standard PCR reaction of annealing 1 m at 55°C, extension for Materials and methods 2 m at 72°C, and denaturation at 94°C for 1 m (35 cycles). PCR products were purified using the Qiagen Yeast strains QIAquick PCR microcentrifuge purification kit as per manufacturer’s instructions and sequenced by GATC The K. marxianus strains used in this study were Germany. The strains were already classified as obtained as lyophilized stocks from the Centraalbu- K. marxianus in the source strain databases so the reau voor Schimmelcultures, Delft, The Netherlands main purpose was to confirm that no strain was in fact (CBS 397, CBS 608, CBS 745 and CBS 7858) or the the close relative Kluyveromyces lactis. The sequence National Collection of Yeast Cultures Norwich, UK data was compared to references in databanks (CBS, (NCYC 100, NCYC 179, NCYC 111, NCYC 587, NCYC, Genbank, NCBI) to confirm the identity of NCYC 970, NCYC 1424, NCYC 2597, NCYC 2791, the 13 strains and their classification as K. marxianus NCYC 2887). Some strains are also known by (Supplementary Fig. 1). alternative names,
Recommended publications
  • Deep Microbial Community Profiling Along the Fermentation Process of Pulque, a Major Biocultural Resource of Mexico

    Deep Microbial Community Profiling Along the Fermentation Process of Pulque, a Major Biocultural Resource of Mexico

    bioRxiv preprint doi: https://doi.org/10.1101/718999; this version posted July 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Deep microbial community profiling along the fermentation process of pulque, a major biocultural resource of Mexico. 1 1 2 Carolina Rocha-Arriaga ,​ Annie Espinal-Centeno ,​ Shamayim Martinez-Sanchez ,​ Juan ​ ​ 1 2 ​ 1,3 ​ Caballero-Pérez ,​ Luis D. Alcaraz *​ & Alfredo Cruz-Ramirez *.​ ​ ​ ​ 1 Molecular​ & Developmental Complexity Group, Unit of Advanced Genomics, LANGEBIO-CINVESTAV, Irapuato, México. 2 Laboratorio​ de Genómica Ambiental, Departamento de Biología Celular, Facultad de Ciencias, Universidad Nacional Autónoma de México. Cd. Universitaria, 04510 Coyoacán, Mexico City, Mexico. 3 Escuela​ de Agronomía, Universidad de La Salle Bajío, León, Gto, Mexico. *Corresponding authors: [email protected], [email protected] ​ ​ ​ ● ​Our approach allowed the identification of a broader microbial diversity in Pulque ● We increased 4.4 times bacteria genera and 40 times fungal species detected in mead. ● Newly reported bacteria genera and fungal species associated to Pulque fermentation Abstract Some of the biggest non-three plants endemic to Mexico were called metl in the Nahua culture. ​ During colonial times they were renamed with the antillan word maguey. This was changed ​ ​ again by Carl von Linné who called them Agave (a greco-latin voice for admirable). For several ​ Mexican prehispanic cultures, Agave species were not only considered as crops, but also part ​ of their biocultural resources and cosmovision. Among the major products obtained from some Agave spp since pre-hispanic times is the alcoholic beverage called pulque or octli.
  • Probiotic Lactic Yeast® New Generation Probiotic Kluyveromyces B0399

    Probiotic Lactic Yeast® New Generation Probiotic Kluyveromyces B0399

    PROBIOTIC LACTIC YEAST® NEW GENERATION PROBIOTIC KLUYVEROMYCES B0399 PROBIOTIC LACTIC YEAST® NEW GENERATION PROBIOTIC KLUYVEROMYCES B0399®(Turval B0399®) Kluyveromyces marxianus fragilis B0399 “K. marxianus B0399® demonstrated a number of beneficial and strain specific properties desirable for application as a probiotic”, research done by University of Bologna, Italy and University of Reading, UK and published by the American Society for Microbiology in the scientific journal Applied Environmental Microbiology, 2012 Feb; 78 (4) APPROVALS AND RECOGNITIONS BY NATIONAL AND INTERNATIONAL AUTHORITIES: Turval is an official supplier of the Italian MInistry of Health Italian Army (Esercito Italiano) for animal use: Canadian Food Inspection Agency Scientific and Technologic Park (ZIU); University of Udine via J.Linussio, 51; 33100 Udine, Italy tel.+39 (0432)629731 fax.+39 (0432)603887 E-mail: [email protected] Web site: www.turval.com PROBIOTIC LACTIC YEAST® NEW GENERATION PROBIOTIC KLUYVEROMYCES B0399 HUMAN NUTRITION NUTRIRE IL PIANETA ENERGIA PER LA VITA FEEDING THE PLANET ENERGY FOR LIFE EUFYR [COOP, ITALY], THE FIRST COMMERCIALISED PROBIOTIC YOGURT CONTAINING KLUYVEROMYCES B0399®, WAS CHOSEN FOR THE UNIVERSAL EXHIBITION EXPO 2015 AS AN EXAMPLE OF LEADING INNOVATION IN FUNCTIONAL DAIRY PRODUCTS. NEW GENERATION PROBIOTYC YOGURT WITH PROBIOTIC LACTIC YEAST® COOP ITALY Web site: www.turval.com PROBIOTIC LACTIC YEAST® NEW GENERATION PROBIOTIC KLUYVEROMYCES B0399 PROBIOTIC LACTIC YEAST® BROUGHT MULTIPLE AWARDS TO YOGURTS PRODUCERS FOR THE MOST INNOVATIVE PRODUCT EUROPEAN AWARD IN 2014 "EUFYR POMEGRANATE", PRODUCED BY ONE OF THE BIGGEST ITALIAN RETAILERS, COOP – ITALY, WINS PRESTIGIOUS PLMA'S INTERNATIONAL "SALUTE TO EXCELLENCE" AWARD IN AMSTERDAM; EUFYR IS THE WINNER AMONG 16 EUROPEAN COUNTRIES FOR THE BEST INNOVATION IN PRIVATE LABEL Recognizing Innovation in Private Label Welcome to PLMA’s International Salute to Excellence Awards, honouring retailers for their commitment to their own brands and giving recognition to their innovative private label products.
  • Synthesis of Polyketides from Low Cost Substrates by the Thermotolerant Yeast Kluyveromyces Marxianus

    Synthesis of Polyketides from Low Cost Substrates by the Thermotolerant Yeast Kluyveromyces Marxianus

    ! ! "#$%&'()(!*+!,*-#.'%)/'(!+0*1!-*2!3*(%!(45(%06%'(!5#!%&'! %&'01*%*-'06$%!#'6(%!!"#$%&'()$*&+,)-'./-0#+, ! ! !"#$%&'%()!"**"+,-%."/$0110%2030+-%45"/0%2"660,,-%"/7%8"/)9%:'%."%4$13"!% ! !"#$%&'"(&)*+),-"'./$0)$(1)2.*'*0"/30$%)4(5.(""%.(5) 6(.7"%8.&9)*+),$0.+*%(.$:);%7.(":),<:)6=<) ! ! ",*%%"8#*(1.(5)$3&-*%) !01;)>?@ABCBDEFCDEFEE) <=#"$1;)(1$8.07$G3/.H"13) % % % ! >09%?@+76;!"#$%&'()*%+',!*-(./-0$,1!&-"%'*&*0"%$(/":)I90*8":)#*09J"&.1"8:)&%.$/"&./)$/.1) 0$/&*(") ! ! ! "! "#$%&'(%! !"#$%&'()$*&+,)-'./-0#+,$%!&!'()*$%$+,!+)+-)+./+0$)+&1!2/&%0!3)(!4$)4&%/5!-6/*$-&1!'()57-0$)+!57/!0)! $0%! (&'$5! ,()806! (&0/9! 6$,6! :;<! -2-1/! 317=9! &+5! 0)1/(&+-/! 0)! 1)8! '>! &+5! 6$,6! 0/*'/(&07(/?! @+1$A/! 12, *&'&%/+/-&3!!2,)-'./-0#+,,()8%!)+!1)8B-)%0!%74%0(&0/%!0)!-/11!5/+%$0$/%!06&0!/C7&1!)(!%7('&%%!5/+%$0$/%!$+! ,17-)%/9! 86$-6! -&+! 4/! 4/+/3$-$&1! 3)(! 70$1$D&0$)+! )3! 1$,+)-/1171)%$-! 4$)*&%%! E=21)%/F9! 4$)37/1! '()57-0$)+! 8&%0/!E,12-/()1F9!&+5!86/2!E1&-0)%/F?!G/!6&./!/.&17&0/5!!2,)-'./-0#+!3)(!06/!%2+06/%$%!)3!')12A/0$5/%9! 7%$+,! 0($&-/0$-! &-$5! 1&-0)+/! E:<HF! &%! 06/! '()57-0?! :6/! #B'2()+/! %2+06&%/! E#BIJF! 8&%! /='(/%%/5! )+! &! ;KLM<NJ!'1&%*$5!$+!06(//!5$33/(/+0!%0(&$+%9!&+5!06/!/33/-0%!)3!0/*'/(&07(/9!-&(4)+!%)7(-/9!&+5!-710$.&0$)+! %0(&0/,2!)+!:<H!1/./1%!8/(/!5/0/(*$+/5?!:6/!6$,6/%0!0$0/(!8&%!)40&$+/5!$+!5/3$+/5!"O!=21)%/!*/5$7*!&0! PQ!;9! 8$06! %74%0&+0$&1! 0$0/(%! &0! R"!;! &+5! RP!;?! :6/! $+0()57-0$)+! )3! &! 6$,6B%0&4$1$02! #BIJ! *70&+0! &+5! &! '()*)0/(! %74%0$070$)+! $+-(/&%/5! 0$0/(! RB3)15?! #BIJ! /='(/%%$)+! 3()*! &!
  • Rational Engineering of Kluyveromyces Marxianus to Create a Chassis for the Production of Aromatic Products Arun S

    Rational Engineering of Kluyveromyces Marxianus to Create a Chassis for the Production of Aromatic Products Arun S

    bioRxiv preprint doi: https://doi.org/10.1101/2020.08.12.247957; this version posted August 12, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Rational engineering of Kluyveromyces marxianus to create a chassis for the production of aromatic products Arun S. Rajkumar and John P. Morrissey* School of Microbiology / Centre for Synthetic Biology and Biotechnology / Environmental Research Institute / APC Microbiome Institute, University College Cork, Cork T12 K8AF, Ireland *To whom correspondence may be addressed: [email protected] Abstract The yeast Kluyveromyces marxianus offers unique potential for industrial biotechnology because of useful features like rapid growth, thermotolerance and a wide substrate range. As an emerging alternative platform, K. marxianus requires the development and validation of metabolic engineering strategies to best utilize its metabolism as a basis for bio-based production. To illustrate the synthetic biology strategies to be followed and showcase its potential, we describe a comprehensive approach to rationally engineer a metabolic pathway in K. marxianus. We use the phenylalanine biosynthetic pathway both as a prototype and because phenylalanine is a precursor for commercially valuable secondary metabolites. First, we modify and overexpress the pathway to be resistant to feedback inhibition so as to overproduce phenylalanine de novo from synthetic minimal medium. Second, we assess native and heterologous means to increase precursor supply to the biosynthetic pathway. Finally, we eliminate branch points and competing reactions in the pathway and rebalance precursors to redirect metabolic flux to a specific product, 2-phenylethanol (2-PE).
  • Intensive Multiple Sequential Batch Simultaneous Saccharification and Cultivation of K

    Intensive Multiple Sequential Batch Simultaneous Saccharification and Cultivation of K

    processes Article Intensive Multiple Sequential Batch Simultaneous Saccharification and Cultivation of Kluyveromyces marxianus SS106 Thermotolerant Yeast Strain for Single-Step Ethanol Fermentation from Raw Cassava Starch Kwanruthai Malairuang 1 , Morakot Krajang 1, Rapeepong Rotsattarat 2 and Saethawat Chamsart 3,* 1 Biological Sciences Program, Faculty of Science, Burapha University, Chonburi 20131, Thailand; [email protected] (K.M.); [email protected] (M.K.) 2 Department of Biotechnology, Faculty of Science, Burapha University, Chonburi 20131, Thailand; [email protected] 3 Department of Biology, Faculty of Science, Burapha University, Chonburi 20131, Thailand * Correspondence: [email protected]; Tel.: +6696-887-3878 Received: 29 June 2020; Accepted: 20 July 2020; Published: 27 July 2020 Abstract: We developed the intensive multiple sequential batch simultaneous saccharification and cultivation of the selected thermotolerant yeast strain for single-step ethanol production. The selection and high-cell-density inoculum production of thermotolerant yeast able to produce ethanol under the optimal conditions for single-step ethanol fermentation has become a necessity. In this study, the newly isolated Kluyveromyces marxianus SS106 could tolerate high temperatures (35–45 ◦C) and grow under a wide range of pH values (3.0–5.5), which are the optimum conditions of raw cassava starch hydrolyzing enzyme used in single-step ethanol fermentation. The high-cell-density concentration of K. marxianus SS106 was produced by a single batch and an intensive multiple sequential batch process in a 5-L stirred tank bioreactor using the simultaneous saccharification and cultivation (SSC) method. The single SSC process yielded the yeast cell biomass at a concentration of 39.30 g/L with a productivity 1 of 3.28 g/L/h and a specific growth rate of 0.49 h− .
  • Fungi P1: OTA/XYZ P2: ABC JWST082-FM JWST082-Kavanagh July 11, 2011 19:19 Printer Name: Yet to Come

    Fungi P1: OTA/XYZ P2: ABC JWST082-FM JWST082-Kavanagh July 11, 2011 19:19 Printer Name: Yet to Come

    P1: OTA/XYZ P2: ABC JWST082-FM JWST082-Kavanagh July 11, 2011 19:19 Printer Name: Yet to Come Fungi P1: OTA/XYZ P2: ABC JWST082-FM JWST082-Kavanagh July 11, 2011 19:19 Printer Name: Yet to Come Fungi Biology and Applications Second Edition Editor Kevin Kavanagh Department of Biology National University of Ireland Maynooth Maynooth County Kildare Ireland A John Wiley & Sons, Ltd., Publication P1: OTA/XYZ P2: ABC JWST082-FM JWST082-Kavanagh July 11, 2011 19:19 Printer Name: Yet to Come This edition first published 2011 © 2011 by John Wiley & Sons, Ltd. Wiley-Blackwell is an imprint of John Wiley & Sons, formed by the merger of Wiley’s global Scientific, Technical and Medical business with Blackwell Publishing. Registered Office: John Wiley & Sons Ltd, The Atrium, Southern Gate, Chichester, West Sussex, PO19 8SQ, UK Editorial Offices: 9600 Garsington Road, Oxford, OX4 2DQ, UK The Atrium, Southern Gate, Chichester, West Sussex, PO19 8SQ, UK 111 River Street, Hoboken, NJ 07030-5774, USA For details of our global editorial offices, for customer services and for information about how to apply for permission to reuse the copyright material in this book please see our website at www.wiley.com/ wiley-blackwell. The right of the author to be identified as the author of this work has been asserted in accordance with the UK Copyright, Designs and Patents Act 1988. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, electronic, mechanical, photocopying, recording or otherwise, except as permitted by the UK Copyright, Designs and Patents Act 1988, without the prior permission of the publisher.
  • 12. Kluyveromyces Marxianus Var. Marxianus

    12. Kluyveromyces Marxianus Var. Marxianus

    FEBS 24376 FEBS Letters 487 (2000) 71^75 Genomic Exploration of the Hemiascomycetous Yeasts: 12. Kluyveromyces marxianus var. marxianus Bertrand Llorentea;*, Alain Malpertuya, Gae«lle Blandina, Franc°ois Artiguenaveb, Patrick Winckerb, Bernard Dujona aUnite¨ de Ge¨ne¨tique Mole¨culaire des Levures, (URA 2171 du CNRS and UFR 927 Universite¨ Pierre et Marie Curie), Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15, France bGe¨noscope-Centre National de Se¨quenc°age, 2 rue Gaston Cre¨mieux P.O. Box 191, 91006 Evry Cedex, France Received 3 November 2000; accepted 9 November 2000 First published online 27 November 2000 Edited by Horst Feldmann genes encoding the inulinase [9], the L-glucosidase [10], the Abstract As part of the comparative genomics project `GEN- OLEVURES', we studied the Kluyveromyces marxianus var. pectin-degrading endopolygalacturonase Epg1p [11], the three marxianus strain CBS712 using a partial random sequencing glyceraldehyde-3-phosphate dehydrogenases Gap1p, Gap2p, strategy. With a 0.2Ugenome equivalent coverage, we identified Gap3p [12] and a pyruvate decarboxylase [9]. ca. 1300 novel genes encoding proteins, some containing The present analysis of 2491 Random Sequenced Tags spliceosomal introns with consensus splice sites identical to those (RSTs) totaling 2363 kb or 17% of the entire genome of K. of Saccharomyces cerevisiae, 28 tRNA genes, the whole rDNA marxianus allowed the identi¢cation of ca. 1300 novel nuclear repeat, and retrotransposons of the Ty1/2 family of S. cerevisiae genes encoding proteins, 28 novel nuclear tRNA genes and a with diverged Long Terminal Repeats. Functional classification novel class of retrotransposon belonging to the copia family.
  • Kinetic Analysis of Kluyveromyces Marxianus Yeast Strain

    Kinetic Analysis of Kluyveromyces Marxianus Yeast Strain

    Louisiana State University LSU Digital Commons LSU Master's Theses Graduate School 2004 Kinetic analysis of Kluyveromyces marxianus yeast strain Erika Guimaraes Madeira Reeves Louisiana State University and Agricultural and Mechanical College, [email protected] Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_theses Part of the Engineering Commons Recommended Citation Reeves, Erika Guimaraes Madeira, "Kinetic analysis of Kluyveromyces marxianus yeast strain" (2004). LSU Master's Theses. 917. https://digitalcommons.lsu.edu/gradschool_theses/917 This Thesis is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Master's Theses by an authorized graduate school editor of LSU Digital Commons. For more information, please contact [email protected]. KINETIC ANALYSIS OF KLUYVEROMYCES MARXIANUS YEAST STRAIN A Thesis Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Master of Science in Biological and Agricultural Engineering in The Department of Biological and Agricultural Engineering by Erika Guimarães Madeira Reeves B.S., Louisiana State University, 2001 May 2004 Dedicated to my sister, the late Camila Guimarães Madeira and my husband Edward Patrick Reeves for loving and supporting me throughout my life. ii ACKNOWLEDGEMENTS First and foremost, I would like to thank God for giving me the strength and persistence to complete this research. I would also like to acknowledge the many people whose advice and support was invaluable throughout the pursuit of this thesis. I want to express great thanks and appreciation to my major advisors Dr.
  • Towards Bio-Hybrid Energy Harvesting in the Real-World: Pushing the Boundaries of Technologies and Strategies Using Bio-Electrochemical and Bio-Mechanical Processes

    Towards Bio-Hybrid Energy Harvesting in the Real-World: Pushing the Boundaries of Technologies and Strategies Using Bio-Electrochemical and Bio-Mechanical Processes

    applied sciences Review Towards Bio-Hybrid Energy Harvesting in the Real-World: Pushing the Boundaries of Technologies and Strategies Using Bio-Electrochemical and Bio-Mechanical Processes Abanti Shama Afroz 1 , Donato Romano 1,2,* , Francesco Inglese 1 and Cesare Stefanini 1,2,3 1 The BioRobotics Institute, Scuola Superiore Sant’Anna, Viale Rinaldo Piaggio 34, 56025 Pontedera, Italy; [email protected] (A.S.A.); [email protected] (F.I.); [email protected] (C.S.) 2 Department of Excellence in Robotics & AI, Scuola Superiore Sant’Anna, Piazza Martiri della Libertà 33, 56127 Pisa, Italy 3 Healthcare Engineering Innovation Center (HEIC), Khalifa University, Abu Dhabi 127788, United Arab Emirates * Correspondence: [email protected] Abstract: Sustainable, green energy harvesting has gained a considerable amount of attention over the last few decades and within its vast field of resources, bio-energy harvesters have become promising. These bio-energy harvesters appear in a wide variety and function either by directly generating energy with mechanisms similar to living organisms or indirectly by extracting energy from living organisms. Presently this new generation of energy harvesters is fueling various low-power electronic devices while being extensively researched for large-scale applications. In this review we concentrate on Citation: Afroz, A.S.; Romano, D.; recent progresses of the three promising bio-energy harvesters: microbial fuel cells, enzyme-based Inglese, F.; Stefanini,
  • Efficient Growth of Kluyveromyces Marxianus Biomass Used As A

    Efficient Growth of Kluyveromyces Marxianus Biomass Used As A

    Löser et al. Energy, Sustainability and Society (2015) 5:2 DOI 10.1186/s13705-014-0028-2 ORIGINAL ARTICLE Open Access Efficient growth of Kluyveromyces marxianus biomass used as a biocatalyst in the sustainable production of ethyl acetate Christian Löser1*, Thanet Urit1,2, Erik Gruner1 and Thomas Bley1 Abstract Background: Whey is just turning from a waste of milk processing to a renewable raw material in biotechnology for producing single-cell protein, bio-ethanol, or ethyl acetate as an economic alternative. Conversion of whey-borne sugar into ethyl acetate requires yeast biomass as a biocatalyst. A high cell concentration results in a quick ester synthesis, but biomass growth means consumption of sugar at the expense of ester production. Efficient and cost-saving biomass production is thus a practical requirement. Whey is poor in nitrogen and has therefore to be supplemented with a bioavailable N source. Methods: Several aerobic growth tests were performed with Kluyveromyces marxianus DSM 5422 as a potent producer of ethyl acetate in whey-borne media supplemented with various N sources. Preliminary tests were done in shake flasks while detailed studies were performed in a stirred bioreactor. Results: Ammonium sulfate resulted in strong acidification due to remaining sulfate, but costly pH control increases the salt load, being inhibitory to yeasts and causing environmental impacts. Ammonium carbonate lessened acidification, but its supplement increased the initial pH to 7.5 and delayed growth. Urea as an alternative N source was easily assimilated by the studied yeast and avoided strong acidification (much less base was required for pH control). Urea was assimilated intracellularly rather than hydrolyzed extracellularly by urease.
  • Saccharomyces Cerevisiae and Kluyveromyces Marxianus

    Saccharomyces Cerevisiae and Kluyveromyces Marxianus

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE This is an open access article published under an ACS AuthorChoice License, which permits copying and redistribution of the article or any adaptations for non-commercial purposes. provided by Lirias Article pubs.acs.org/JAFC Saccharomyces cerevisiae and Kluyveromyces marxianus Cocultures Allow Reduction of Fermentable Oligo‑,Di‑, and Monosaccharides and Polyols Levels in Whole Wheat Bread Nore Struyf,*,†,‡ Jitka Laurent,† Joran Verspreet,† Kevin J. Verstrepen,‡ and Christophe M. Courtin† † Laboratory of Food Chemistry and Biochemistry, and Leuven Food Science and Nutrition Research Centre (LFoRCe), KU Leuven, Kasteelpark Arenberg 20, B-3001 Leuven, Belgium ‡ VIB Laboratory for Systems Biology & CMPG Laboratory for Genetics and Genomics, KU Leuven, Bio-Incubator, Gaston Geenslaan 1, B-3001 Leuven, Belgium *S Supporting Information ABSTRACT: Fermentable oligo-, di-, and monosaccharides and polyols (FODMAPs) are small molecules that are poorly absorbed in the small intestine and rapidly fermented in the large intestine. There is evidence that a diet low in FODMAPs reduces abdominal symptoms in approximately 70% of the patients suffering from irritable bowel syndrome. Wheat contains relatively high fructan levels and is therefore a major source of FODMAPs in our diet. In this study, a yeast-based strategy was developed to reduce FODMAP levels in (whole wheat) bread. Fermentation of dough with an inulinase-secreting Kluyveromyces marxianus strain allowed to reduce fructan levels in the final product by more than 90%, while only 56% reduction was ffi achieved when a control Saccharomyces cerevisiae strain was used. To ensure su cient CO2 production, cocultures of S.
  • Electrophoretic Isoenzyme Variation in Kluyveromyces Populations and Revision of Kluyverornyces Marxianus (Hansen) Van Der Walt

    Electrophoretic Isoenzyme Variation in Kluyveromyces Populations and Revision of Kluyverornyces Marxianus (Hansen) Van Der Walt

    INTERNATIONALJOURNAL OF SYSTEMATICBACTERIOLOGY, Jan. 1986, p. 94102 Vol. 36, No. 1 0020-7713/86/010094-09$02.0010 Copyright 0 1986, International Union of Microbiological Societies Electrophoretic Isoenzyme Variation in Kluyveromyces Populations and Revision of Kluyverornyces marxianus (Hansen) van der Walt DEBORAH GAYLE SIDENBERG AND MARC-ANDRE LACHANCE" Department of Plant Sciences, University of Western Ontario, London, Ontario, N6A 5B7, Canada Natural isolates of Kluyveromyces from a variety of habitats were compared on the basis of seven isoenzyme patterns. Some strains of Candida considered to be Kluyveromyces anamorphs, as well as one strain each of Candida sake, Saccharomyces cerevisiae, and Pichia JEuxuum, were also examined. The isoenzyme patterns readily substantiated the relationships between the anamorphs and their putative teleomorphs and the nonmember status of strains not belonging to the genus. A multivariate analysis of the electrophoretic patterns indicated that isolates belonging to the Kluy veromyces lactis and Kluy veromyces marxianus deoxyribonucleic acid reassociation groups are not phenotypically continuous with one another or with the former species Kluyveromyces dobzhanskii, and thus we propose to reinstate these taxa as separate species. Taxa previously described as Kluyveromyces thermotokrans and Kluyveromyces waltii also appeared to constitute reproductively isolated natural populations. When the results of isoenzyme electrophoresis were compared with deoxyribo- nucleic acid reassociation data and with mating compatibility patterns determined by other workers, we found that deoxyribonucleic acid relatedness gives a more accurate view of relationships among Kluyveromyces species. In 1984, the genus Kluyveromyces van der Walt emend. MATERIALS AND METHODS van der Walt underwent a major revision (15). Based on Microorganisms. The type strains of Kluyveromyces strain hybridization studies (5), Kluyveromyces bulgaricus, species (Table 1) were obtained from H.