(12) Patent Application Publication (10) Pub. No.: US 2016/0272711 A1 Sahin Et Al

US 20160272711A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2016/0272711 A1 Sahin et al. (43) Pub. Date: Sep. 22, 2016

(54) AGENTS FORTREATMENT OF CLAUDIN (86). PCT No.: PCT/EP2013/003.399 EXPRESSING CANCER DISEASES S371 (c)(1), (2) Date: May 13, 2015 (71) Applicants: Biontech AG, Mainz (DE); Ganymed (30) Foreign Application Priority Data Pharmaceuticals AG, Mainz (DE); TRON-Translationale Onkologie an Nov. 13, 2012 (EP) ...... PCT/EP2012/004712 der Universitatsm edizin der Johannes Jul. 30, 2013 (EP) ...... PCT/EP2013/002270 Gutenberg-Universitat Mainz, Mainz Publication Classification (DE) (51) Int. Cl. C07K 6/28 (2006.01) (72) Inventors: Ugur Sahin, Mainz (DE); Ozlem C07K 6/30 (2006.01) Tureci, Mainz (DE); Christiane Stadler, (52) U.S. Cl. Bensheim (DE); Julia Holland, Mainz CPC ...... C07K 16/2809 (2013.01); C07K 16/28 (DE); Hayat Bahr-Mahmud, Wiesbaden (2013.01); C07K 16/30 (2013.01); C07K (DE); Tim Beissert, Gross-Gerau (DE); 2317/31 (2013.01); C07K 2317/622 (2013.01); Laura Plum, Mainz (DE); Fabrice Le A6 IK 2039/505 (2013.01) Gall, Mainz (DE), Arne Jendretzki, (57) ABSTRACT Matist (E. Markus Fiedler, The present invention provides binding agents that contain a alle an der Saale (DE) binding domain that is specific for CD3 allowing binding to T cells and a binding domain that is specific for a tumor-asso (21) Appl. No.: 14/442,445 ciated claudin molecule and methods of using these binding

(22) PCT Filed: Nov.e -la?s12, 2013 agents or nucleic acids encoding therefor for treating cancer. Patent Application Publication Sep. 22, 2016 Sheet 1 of 54 US 2016/0272711 A1

Figure 1

A Bi-ScFw CLDN18.2x CD3

LL S. LL B Bi-scFW CD3X CLDN18.2

LL SL LL Patent Application Publication Sep. 22, 2016 Sheet 2 of 54 US 2016/0272711 A1

Figure 2

Cytolysis of NugC4 target cells (8h-24h Coincubation) 100 8h in 16h 90 24h 80 70 60 50 40

30 . 20

& 3 10

1BMAB no. 11 no.12 no, 13 no. 14 no.15 no.16 no.17 no. 18 no.19 no.20 no.35 Patent Application Publication Sep. 22, 2016 Sheet 3 of 54 US 2016/0272711 A1

Figure 3

A ------9 160 110 80

60 - 1BIMAB (54 kD) 50 40

kD 80

60 -1BiMAB (54 kD)

50 40

20 WB: anti-His

Patent Application Publication Sep. 22, 2016 Sheet 5 of 54 US 2016/0272711 A1

Figure 4

C Human TL

g-a-m APC ctrl anti-His +g-a-m APC ctrl 20 15 H - -20 ng/ml 1BMAB 10 -20Ongirn? 1BMAB 5 2ug/ml 1BMAB O s S s 3. s So APC S 3 S & S 8 SS & S)S s S S

CLDN18.2 negative cell line (PA-1)

: manti-His +g-a-m APC ctrl ---Onglm BMAB - -100ngm 1BMAB - - pg/ml BIMAB - - - g-a-h APC(mCLDN182ab) ctrl -10 uglimlmCLDN182ab Patent Application Publication Sep. 22, 2016 Sheet 6 of 54 US 2016/0272711 A1

Figure 5

Patent Application Publication Sep. 22, 2016 Sheet 7 of 54 US 2016/0272711 A1

Figure 6

Activation of TL. (24h coincubation) totalTL activation 100- is CD25+ O CD69+ ZZ CD25ICD69++ 8O

S 60 - 92g 40

nglml BiMAB 0 1 10 100 1000 O 0.001 0.01 0. O 100 000 H- - hu TL NugC4+hu TL

B Activation of TL. (48h coincubation) L total TL activation 100- is CD25 CD69-- CD25/CD69--- 80 - H

S 60 " 92 S 40 s 2 20- s 2

OJs & an L .2 : . : 2 nglml 1 BiMAB 0 10 100 1000 O 0.001 0.01 0. 1 1 0 100 1000

hu T. NugC4 + huTL Patent Application Publication Sep. 22, 2016 Sheet 8 of 54 US 2016/0272711 A1

Figure 7

A C-values of CLDN18.2 expression. various tumor ceilines Cancer type

Activation of TL B (144h coincubation)

100 90 total TL activation 80 CD25+ FO O CD69+ o 50 CD25CD69++ S 50

40 2 s 30 s 20 3 10- % 2 0- 2 s's9 S sis'$9.8 sis's S g’s's es'ss sis& go y N sS. S$ SS S SS S& Patent Application Publication Sep. 22, 2016 Sheet 9 of 54 US 2016/0272711 A1

Figure 8

1500 TL + 1 ng/ml 1BiMAB 150

OOO 1000 3. {)

500 unstaired T 50

O 1 3. O-Hi O 10 10 10 1.

FL1-h: Crse F-H: CFSE

25CO TL + NugG4 TL + 1 ng/ml 1BiMAB+ NugC4 SOO 2CO

s 1500 s 400

O O 50

O-Hi 1 in 0-h 2 O 1. 10 10 O O 1. 1.

F1-h; CFSE FL1-H CFSE

GrB expression by human TL

2so

s also g - TL+5ngmil BIMAB S s -Tl+NugC4 a HTL-NugG4+5ng/ml 1BIMAB 100 ------soo

1.we s s x t s as tss

anti-Gr-PE a. Patent Application Publication Sep. 22, 2016 Sheet 10 of 54 US 2016/0272711 A1

Figure 9

1BiMAB dose response Curve 100

80 -- 1BIMAB (24h) -- 1BIMAB(48h) EC50=11.2 pg/ml 2 60 tes d 5 3. SS 40

O O 2 4. 6 log10(pg/ml) Patent Application Publication Sep. 22, 2016 Sheet 11 of 54 US 2016/0272711 A1

Figure 10

A Day 6 post tumor cellinoculation Day 21 post tumor cellinoculation Day Oct P treatment Day 15 of IP treatment six 800 K sacticed 5 450 400 1W

k 4) 30 d 20 -ee- O es so

C ------era rt- -tat sy s s S s 8

Day 31 post tumor ceilinoculation Day 4 post tumor Celtinoculation Day 3 post P treatment Day 13 past IP treatment

segrificed 4. X sacfied

-H s-e- -ae O us ^ g ^ s s^ s & . S g RS fs e S S g * c s * cs

''' -- G3-PBMcIvehicle (n-13) -- G4-PBMCI BMAB (n=5) 100

900

800 700 600

500

400

300

200

100

6 8 9 10 1 2 13 415 1617 8 1920 224 25 26.27 2831 33 35 38 41 Daily IP treatment day 6-28 Time (days posthumor cellinoculation) Patent Application Publication Sep. 22, 2016 Sheet 12 of 54 US 2016/0272711 A1

Figure 10

Kaplan-Meier survival Curve

100 G1-PBSvehicle (n=4) 90 - - - G2-PBS1BIMAB (n=5) - G3-PBMCIvehicle (n=13) 80 - G4-PBMC 1BIMAB (n=15) p(0.0001

Daily IP treatment day 6-28 Time (days post tumor cellinoculation)

100 90

w 80 8 70 s 60 E 50 i-- SE 40- O 30 S s 20 10

O 1-- -- -T - & &S Ses SŠ S & SSs C 8 cy& cS8 * S$ Patent Application Publication Sep. 22, 2016 Sheet 13 of 54 US 2016/0272711 A1

Figure 11

A )

LL S. LL B Bi-scFv CD3x CLDN6 (6PHU3 )

LL SL LL Patent Application Publication Sep. 22, 2016 Sheet 14 of 54 US 2016/0272711 A1

Figure 12

Patent Application Publication Sep. 22, 2016 Sheet 15 of 54 US 2016/0272711 A1

Figure 13

Activation of human TL (44h coincubation) total activation CD25+ 100 CD69+ 90 CD25CD694+ 80

70 3 60 50 40 30 20 10 O kuku what nglml S is is s is 6PHU5 6PHU3 hu TL PA-1 +hu TL Patent Application Publication Sep. 22, 2016 Sheet 16 of 54 US 2016/0272711 A1

Figure 14

kD 2 3 4 5 6 7 8 9 10 11 260 160 10 80 60 - 6PHU3 (53 kD) 50 40 30 2O

kD 80

60 - 6PHU3 (53 kD) 50 40 30 20 WB anti-His Patent Application Publication Sep. 22, 2016 Sheet 17 of 54 US 2016/0272711 A1

Figure 15

PA-1 Cells

1 gm BiMAR

10 ugm 18 MAE

* -g-a-h AFC ctrl OugitimCLDN18.2ab

APC APC

7000 5000

s 3000 9 1000 1000 800 3. 600 a. S 400 200 O SS SS SSSS is So So S. $$$$.S^^s &Y&Y&Y&SNV N N NV N . SSs s $ N $S$ & S’sSis N'SS Ss' s s WS Patent Application Publication Sep. 22, 2016 Sheet 18 of 54 US 2016/0272711 A1

Figure 15

A OV-90 Cells

- " -g-a-m APC ctrl g-a-m APC ctrl 10 ng/ml 6PHU3 Tw-Ong/ml 1BIMAB 100 ng/ml 6PHU3 100 ng/ml 1BMAB 1 ugmlSPHU3 1 gm 1 BMAB 10 pg/ml&PHU3 g-a-h APC ctrl 10 ugmmCLDN6ab

1 10 10 O APC APC

2400 2000 234.56OOOOOO OOOOOOO --r- $$$$. SS S N NSN Patent Application Publication Sep. 22, 2016 Sheet 19 of 54 US 2016/0272711 A1

Figure 15

Human TL

30000

25000 s

anti-is-g-a-m PE ctrl 15000 E. 10000 1 ugim SPHU3 5000 5uglint SPHU3 O s S. 10 ugimi SPHU3 S & S S S & S & S 8 s'S ' ' ' s Patent Application Publication Sep. 22, 2016 Sheet 20 of 54 US 2016/0272711 A1

Figure 15

C CLDN6 negative cell line (NugC4)

g-a-m AFC ctr 1Ongirn BMAE

10Ongfml 1EMAE 1 g/ml 1BIMAB

10 uglrn 1 BMAB

g-a-h APC ctrl 10 uglin mCLDN18.2ab

APC APC

600 1400 era. 200 is 1000 Se 800 is 600 400 100 80 60 s Patent Application Publication Sep. 22, 2016 Sheet 21 of 54 US 2016/0272711 A1

Figure 16

Activation of TL (24h coincubation) 100 total TL activation st CD25+ O O CD69+ 8 CD25/CD69---- H + 60 s 92y 40 20 222 2 2 O : 2 2 nglml 6PHU3 O 1 1 0 100 1000 O 0.001 0.01 0.1 10 100 1000 H- H hu TL + 6PHU3 PA-1 + hu TL + 6PHU3

Activation of TL (48h coincubation) CD25CD69--- 100 total Tactivation CD25+ 80 CD69+ P 3 60 s 93 g 40

O 2 al A ng/ml 6PHU3 O 10 100 1000 0 0001 0.01 (0.1 1 10 100 1000 H- H hu T + 6PHU3 PA-1 + hu TL + 6PHU3 Patent Application Publication Sep. 22, 2016 Sheet 22 of 54 US 2016/0272711 A1

Figure 17

6PHU3 dose response Curve

100

80 -- 6PHU3 (24 h) g 60 -- 6PHU3 (48h) 2. EC50=8.9 pg/ml S.

SS 40

log10 (pg/ml) Patent Application Publication Sep. 22, 2016 Sheet 23 of 54 US 2016/0272711 A1

Figure 18

Day 20 postumor cellinoculation Day 34 post tumor cellinoculation Day 0 of IP treatment Day 14 of IP treatment S. 2000, ge - ' ' d sacrifia 1800

400 1500 m s tool Aa E 30a; 8 1200 8 5 1000 -e- g e s - - - - 200- e Boo s --- e. Boo

00 re- s 4. 4. p s t e 200 --- 0. o S. S XY y SS S- xy SY y s & vs. S s & ws s xs S s fs : 8 s sis ea is S is ifs' &s * : es 8 e 3. ss: c is 3. c 3.

Day 41 posthumor cellinoculation Day 45posttur or cellinoculation Day 21 of P treatment Day 25 of IP treatment aco-eee the sacrificed too. -- is a sacrified 800 180 -M.--

1600 Six ( 00 10 -Xa- -- e 120 s is 200 s is

E 1000 5 1000 s g 800 BOO - so 60 40 400 b 20 200 -ms r----- S S. Š Sy. &Sw S \ s & &s s as & s s & &S 8 S ; s SS S es ° R cy s 3. s Patent Application Publication Sep. 22, 2016 Sheet 24 of 54 US 2016/0272711 A1

Figure 18 B 2000

1800

1600

1400

1200

1000

600

400

200

13 20 24 27 31 34 38 41 45 Daily IP treatment day 20-45 Time (days post tumor cellinoculation)

Kaplan-Meier survival Curve G1-PBS/vehicle (n=8) -- G2-PBS/6PHU3 (n=8) - G3-PBMCNehicle (n=7) - G4-PBMC/6PHU3(n=7) -- G5-PBMC/BIMAB(n=8) p = 0.0002

O 5 10 15 O 25 30 35 40 Daily IP treatment day 20-45 Time (days post tumor cellinoculation) Patent Application Publication Sep. 22, 2016 Sheet 25 of 54 US 2016/0272711 A1

Figure 18

100 90 80 70 60 50 40 30 20 Patent Application Publication Sep. 22, 2016 Sheet 26 of 54 US 2016/0272711 A1

Figure 19

Patent Application Publication Sep. 22, 2016 Sheet 27 of 54 US 2016/0272711 A1

Figure 19

G3-PBMC/Vehicle

Patent Application Publication Sep. 22, 2016 Sheet 28 of 54 US 2016/0272711 A1

Figure 19

Patent Application Publication Sep. 22, 2016 Sheet 29 of 54 US 2016/0272711 A1

Figure 20

bi-SCFV CLDN18.2x CD3 ... His 2hBgUTRA120

bi-SCFw CD3X CLDN18.2 Caphagkozak Sec V. is: is 2hBgUTR A120

ap5'UTR nsP1-4 sgPSec His 3'UTR A120 Patent Application Publication Sep. 22, 2016 Sheet 30 of 54 US 2016/0272711 A1

Figure 21

Activation of TL. (48 h coincubation)

100 activated TL es. CD25+ 80 CD69+ P ZZ CD257CD69-H- a 60 s t 40 & SS 20

TL only protein bi-ScFw WT-RNA

Cytolysis of NugG4 target cells (48 h coincubation) 100

2 80

60 3, s 40 s' 20

O So Sy S So r y g S &SS sS. Q S. SS s'Sy &S) 's'S &S & &s s'Sy s protein bi-scFw VT-mRNA Patent Application Publication Sep. 22, 2016 Sheet 31 of 54 US 2016/0272711 A1

Figure 22

IVT-mRNA transfected NugC4+hu TL

s Patent Application Publication Sep. 22, 2016 Sheet 32 of 54 US 2016/0272711 A1

Figure 23

Activation of TL. (24 h coincubation) activated TL total : CD25+

40.0 1BIMAB IVT-mRNAug/ml)

Activation of TL (48 h coincubation) activated TL CD25+ CD69+ : CD251CD69++

1.2 4.0 12.0 40.0 1BIMAB IVT-mRNA tug/ml) Patent Application Publication Sep. 22, 2016 Sheet 33 of 54 US 2016/0272711 A1

Figure 24

Cytolysis of Nugc4 target cells 24h 100 D 48 h g 80 e g 60 s g d 40

st 20

O 0.4 1.2 4,0 12.0 40.0 1BIMAB IVT-mRNAug/ml) Patent Application Publication Sep. 22, 2016 Sheet 34 of 54 US 2016/0272711 A1

Figure 25

T cell proliferation 60 72h

2 8 40 a es 2 s 2 5 St. 20

O ------& as 8S. S. S. sys'sS N S S- «ssS S S NS S. S' S & SS & s e ------T cells T cells + CLDN18.2 positive target cells T cells + CDLN 18.2 negative target cells Patent Application Publication Sep. 22, 2016 Sheet 35 of 54 US 2016/0272711 A1

Figure 26

Activation of TL (48 h coincubation) activated TL A 400- CD25+ CD69+ 80- CD25ICD69++ P S.cxd 60

is 40

O a ET ratio 1:0 10:1 0.3:1 1:1 3:1 10:1 H H-e-on-H Ctrl VT-mRNA 1BMABVT. mRNA

B Cytolysis of NugC4 target cells 100- (48 h coincubation)

80 60 E, is 40

O E:T ratio 0:1 10:1 O: 0.3: 1:1 3: 10:1

CrVT-mRNA 1BMAB VT- mRNA Patent Application Publication Sep. 22, 2016 Sheet 36 of 54 US 2016/0272711 A1

Figure 27

Activation of TL. A (48 h coincubation) 100 activated T. CD25 - 80

ctrl VT-mRNA (ug/ml) 1BIMAB IVT-mRNA (ug/ml)

Cytolysis of NugG4 target Cells B (48 h coincubation) 80

80 240 80 240 H ------ctri IVT-mRNA (ug/ml) 1 BMAB IVT-mRNA (uglm Patent Application Publication Sep. 22, 2016 Sheet 37 of 54 US 2016/0272711 A1

Figure 28

Cytolysis of CLDN18.2 negative target cells (72 h coincubation) 100

gr 80 g . 60 s g 40 is 20

VT-mRNA 100 ng/ml protein Patent Application Publication Sep. 22, 2016 Sheet 38 of 54 US 2016/0272711 A1 Figure 29

2.25 1BIMAB VT-mRNA and replicon in BHK21 supernatant 2.00 1.75 150 1.25 1.00 0.75 0.50 0.25 0.00

- 1BIMAB (54 kD)

lane sample

BiMABVT-mRNA in SN

6 BIMABVT-replicon in cell lysate Mock Ctrl Cell lysate

0.1 ud purified 1BiMAB protein Patent Application Publication Sep. 22, 2016 Sheet 39 of 54 US 2016/0272711 A1

WB: anti-His

lane sample

0.1 UC purified BiMAB protein Patent Application Publication Sep. 22, 2016 Sheet 40 of 54 US 2016/0272711 A1

Figure 30

Mouse serum cytotox assay (48 h coincubation) 100

s 60 g9. s 3. 40

O 0.001 0.01 0.1 d2 d4 d7 d2 d4 d7 d2 d4 d7 1BiMAB days post injection protein ng/ml) H- H - mRNA mRNA + EEK replicon Patent Application Publication Sep. 22, 2016 Sheet 41 of 54 US 2016/0272711 A1

Figure 31

A bi-ScFw CLDN6x CD3 Caphagkozak Sec. Vesuvisy. His 2hBgUTRA120

bi-SCFw CD3X CLDN6 hAgkozak Se His 2nBgUTR A120

2. His 3'UTR A120 Patent Application Publication Sep. 22, 2016 Sheet 42 of 54 US 2016/0272711 A1

Figure 32

Bi-scFv IVT-mRNA transfected PA-1 + hu TL Patent Application Publication Sep. 22, 2016 Sheet 43 of 54 US 2016/0272711 A1

Figure 33

Activation of TL A (24 h coincubation) 100 activated TL CD25+ 80 CD69+ - CD69/CD25++

d t 92

hu TL hu TL + PA-1

Activation of TL (48 h coincubation) 100 activated TL CD25+

80 CD69+ - CD69/CD25++

Cs 60 t 92 s 2 40 s 20

O s & S. S. SY s

•S hu TL. hu TL + PA-1 Patent Application Publication Sep. 22, 2016 Sheet 44 of 54 US 2016/0272711 A1

Figure 34

Activation of TL (48 h coincubation) 50- activated TL CD25+ 40 CD69+ - CD69/CD25++

t cy

"C 3. S s

IVT-mRNA (ug/ml) - H hu TL. hu TL + PA-1 Patent Application Publication Sep. 22, 2016 Sheet 45 of 54 US 2016/0272711 A1

Figure 35

6RHU3 concentration-dependentCurve

-o- 24 h 100 -- 48 h EC50 (48 h) = 1945 ng/ml 80

2 60 s 40

O O 1 2 3 4 5 log10 (ng/ml) Patent Application Publication Sep. 22, 2016 Sheet 46 of 54 US 2016/0272711 A1

Figure 36

T cell proliferation 80

4. O

T cells T cells + CLDN6 positive target cells T cells + CDLN6 negative target cells Patent Application Publication Sep. 22, 2016 Sheet 47 of 54 US 2016/0272711 A1

Figure 37

4.0 6RHU3 VT-mRNA and replicon in BHK21 supernatant 3.5 3.0 2.5 2.0 15 10 0.5 0.0 (S. ess & sis ..$$. s S$ SS S. &s SS s w &S. S H------6PHU3 protein ng/ml) BHK21 -SN -

kD 1-2-3-4-3-6 8 - 19 80 60 -6RHU3/6PHU3 (53 kD) 50 40

30 20 WB anti-His

lane sample

6 Mock ctrl SN 8 6RHU3VT-mRNA in celysate 9 6RHU3IVT-replicon in cell lysate

0.1 UCOUrified 6PHU3Orotein Patent Application Publication Sep. 22, 2016 Sheet 48 of 54 US 2016/0272711 A1

lane sample

0.1 UC purified 6PHU3 protein Patent Application Publication Sep. 22, 2016 Sheet 49 of 54 US 2016/0272711 A1

Figure 38

Mouse serum Cytotox assay (48 h Coincubation) 100

0.001 0.01 0.1 1 mRNA mRNA+EBK replicon - 6PHU3 protein ng/ml) Patent Application Publication Sep. 22, 2016 Sheet 50 of 54 US 2016/0272711 A1

Figure 39 a

Cytolysis of NugG4 target cells a8

}:}}}}}}}} sae000s

concentration concentrator

Weriant identification Patent Application Publication Sep. 22, 2016 Sheet 51 of 54 US 2016/0272711 A1

Figure 39 b

60% is

50%

40%

30%

20%

concentration concentration concentration concentration concentration concentration concentratio concentration ng/mi) ng/ml) rigor rigin rig?rn Engfm ngril Eng/ml SS2 S53 SS1.4 SS15 SS44 SSS SSAS SSa waiiant identification Patent Application Publication Sep. 22, 2016 Sheet 52 of 54 US 2016/0272711 A1

Figure 39 c

Cytolysis of NugC4 target cells 24h 48th

80% -

40%

20% i 10%

concentration concentration concentration concentration concentration concentration concentration concentration Ingmi ng/ml) rigfrn (ng/ml Engmi Eng/ml) (ng/ml) ng/ml) i 5520 5521 SS SS3 SSS2 SSS3 S554 SSSS Wariant identification - Patent Application Publication Sep. 22, 2016 Sheet 53 of 54 US 2016/0272711 A1

Figure 39 d

Cytolysis of NugCA target cells

O% T------r 90% 80% a

60%

40% . 30% i. 20% .

10%

concentration concertation concentratio concentration concentration i concertration concentration concentration Ingfrn Ingm (ngfml ngfm ingriml Eng/ml) ng/ml) ng/mi) 5528 S529 S530 SSS SSS 5563 Wariant identification Patent Application Publication Sep. 22, 2016 Sheet 54 of 54 US 2016/0272711 A1

Figure 40

Intra-assay comparison of EC50 values obtained in A luciferase cytotoxic assay with anti-CLDN6 bi-scFw proteins

Donor 1, 24h Donor 1, 48h

5456 54.62 5458 54.60 Variant identification

intra-assay comparison of EC50 values obtained in B luciferase cytotoxic assay with anti-CLDN6 bi-scFv proteins

s 2 Donor 2, 24h Donor 2, 48h 1

O 5.454 5.456 54.62 5458 54.60 54.64 Variant identification

C intra-assay comparison of EC50 values obtained in luciferase cytotoxic assay with anti-CLDN6 bi-scFv proteins 4

3 +

E. 2 -- Donor 3, 24h

Donor 3, 48h 1

5454. 5456 54.62 5458 54.60 54.64 Variant identification US 2016/0272711 A1 Sep. 22, 2016

AGENTS FORTREATMENT OF CLAUDIN cells by various means can eradicate even large tumors and a EXPRESSING CANCER DISEASES number of T cell therapies have recently made significant 0001 Claudins are integral membrane proteins located progress in treating various cancer indications. within the tight junctions of epithelia and endothelia. Clau 0007. It has been an object of the invention to provide dins are predicted to have four transmembrane segments with novel agents and methods for the therapy of cancer diseases. two extracellular loops, and N- and C-termini located in the 0008. The solution of the problem underlying the inven cytoplasm. The claudin (CLDN) family of transmembrane tion is based on the concept of generating a binding agent that proteins plays a critical role in the maintenance of epithelial contains a binding domain that is specific for a tumor-asso and endothelial tight junctions and might also play a role in ciated claudin molecule, i.e. cancer cells. The other binding the maintenance of the cytoskeleton and in cell signaling. domain is specific for CD3 allowing binding to T cells and 0002. The claudin 18 (CLDN18) molecule is an integral allows to pull the T cells into the complex, thus making it transmembrane protein (tetraspanin) having four membrane possible to target the cytotoxic effect of the T cells to the spanning hydrophobic regions and two extracellular loops cancer cells. Formation of this complex can induce signalling (loop 1 embraced by hydrophobic region 1 and hydrophobic in cytotoxic T cells, either on its own or in combination with region 2; loop2 embraced by hydrophobic regions 3 and 4). accessory cells, which leads to the release of cytotoxic media CLDN18 exists in two different splice variants, which are tOrS. described in mouse and in human (Niimi, Mol. Cell. Biol. 0009 We report for the first time that binding agents tar 21:7380-90, 2001). The splice variants (Genbank accession geting claudin and CD3 can induce potent T cell-mediated number: splice variant 1 (CLDN18.1): NP 057453, lysis and are effective in treating tumor diseases. NM 016369, and splice variant 2 (CLDN18.2): SUMMARY OF THE INVENTION NM_001002026, NP_001002026) have a molecular weight of approximately 27.9/27.72 kD. The splice variants 0010. In one aspect the invention relates to a binding agent CLDN18.1 and CLDN18.2 differ in the N-terminal portion comprising at least two binding domains, wherein a first which comprises the first transmembrane (TM) region and binding domain binds to claudin and a second binding loop 1, whereas the primary protein sequence of the C-termi domain binds to CD3. The binding agent of the invention may nus is identical. bind to a cytotoxic cell (by engaging the CD3 receptor) and a 0003. In normal tissues, there is no detectable expression cancer cell expressing CLDN to be destroyed as a target. ofCLDN18.2 with exception of stomach where CLDN18.2 is 0011. In one embodiment the binding agent is a bispecific expressed exclusively on short-lived differentiated gastric molecule such as a bispecific antibody, in particular a bispe epithelial cells. CLDN18.2 is maintained in the course of cific single chain antibody. In one embodiment said claudin is malignant transformation and thus frequently displayed on expressed in a cancer cell. In one embodiment said claudin is the Surface of human gastric cancer cells. Moreover, this expressed on the Surface of a cancer cell. In one embodiment pan-tumoral antigen is ectopically activated at significant said claudin is selected from the group consisting of claudin levels in esophageal, pancreatic and lung adenocarcinomas. 18.2 and claudin 6. In one embodiment said first binding The CLDN18.2 protein is also localized in lymph node domain binds to an extracellular domain of said claudin. In metastases of gastric cancer adenocarcinomas and in distant one embodiment said first binding domain binds to native metastases especially into the ovary (so-called Krukenberg epitopes of CLDN present on the surface of living cells. In tumors). one embodiment said first binding domain binds to the first 0004 CLDN6 is expressed in a series of different human extracellular loop of CLDN. In one embodiment said second cancer cells while expression in normal tissues is limited to binding domain binds to the epsilon-chain of CD3. In one placenta. embodiment said CD3 is expressed on the surface of a T cell. 0005. The differential expression of claudins such as In one embodiment binding of said binding agent to CD3 on CLDN18.2 and CLDN6 between cancer and normal cells, T cells results in proliferation and/or activation of said T cells, their membrane localization and their absence from the vast wherein said activated T cells preferably release cytotoxic majority of toxicity relevant normal tissues makes these mol factors, e.g. perforins and granzymes, and initiate cytolysis ecules attractive targets for cancer immunotherapy and the and apoptosis of cancer cells. In one embodiment said bind use of antibody-based therapeutics for targeting claudins in ing to claudin and/or said binding to CD3 is a specific bind cancer therapy promises a high level of therapeutic specific 1ng. ity. 0012. In one embodiment the binding agent is in the for 0006. Approaches using the potential of T cells for the mat of a full-length antibody or an antibody fragment. In one treatment of cancer include vaccination with tumor-derived embodiment the binding agent comprises four antibody Vari proteins, RNA or peptide antigen, infusion of tumor-derived, able domains with at least two binding domains, wherein at ex-vivo expanded T cells (called adoptive transfer), T cell least one binding domain binds to claudin and at least one receptor gene transfer or direct engagement of T cells by bi binding domain binds to CD3. In one embodiment the bind or trispecific antibodies. Likewise, many stimulants of T cell ing agent comprises a variable domain of a heavy chain of an responses are clinically tested in combination or as mono immunoglobulin (VH) with a specificity for a claudinantigen therapy, such as ligands for Toll-like receptors, antibodies (VH(CLDN)), a variable domain of a light chain of an immu blocking CTLA-4 on T cells, immune stimulatory cytokines, noglobulin (VL) with a specificity for a claudin antigen (VL or antibodies neutralizing molecules involved in immune (CLDN)), a variable domain of a heavy chain of an immuno escape of cancer cells such as TGF-beta or B7-H1. The globulin (VH) with a specificity for CD3 (VH(CD3)), and a intense development of T cell-based therapies is motivated by variable domain of a light chain of an immunoglobulin (VL) the observation that patients appear to live significantly with a specificity for CD3 (VL(CD3)). longer if their tumors are infiltrated by T cells. Moreover, 0013. In one embodiment the binding agent is in the for numerous mouse models have shown that engagement of T mat of a diabody that comprises a heavy chain variable US 2016/0272711 A1 Sep. 22, 2016

domain connected to a light chain variable domain on the 0021. In one embodiment said VH(CD3) comprises an same polypeptide chain Such that the two domains do not pair. amino acid sequence represented by SEQ ID NO: 95, or a In one embodiment the diabody comprises two polypeptide fragment thereof or a variant of said amino acid sequence or chains, wherein one polypeptide comprises VH(CLDN) and fragment and the VL(CD3) comprises an amino acid VL(CD3) and the other polypeptide chain comprises sequence represented by SEQ ID NO: 96 or a fragment VH(CD3) and VL(CLDN). thereof or a variant of said amino acid sequence or fragment. 0014. In one embodiment the binding agent is in the for 0022. In one aspect the binding agent of the invention is in mat of a bispecific single chain antibody that consists of two the formatofa bispecific single chain antibody that comprises schv molecules connected via a linker peptide, wherein the two scFv molecules connected via a linker peptide, wherein heavy chain variable regions (VH) and the corresponding the heavy chain variable regions (VH) and the corresponding light chain variable regions (VL) are preferably arranged, light chain variable regions (VL) are arranged, from N-ter from N-terminus to C-terminus, in the order VH(CLDN)-VL minus to C-terminus, in the order VH(CLDN)-VL(CLDN)- (CLDN)-VH(CD3)-VL(CD3), VH(CD3)-VL(CD3)-VH VH(CD3)-VL(CD3). In one embodiment said VH(CD3) and (CLDN)-VL(CLDN) or VH(CD3)-VL(CD3)-VL(CLDN)- VL(CD3) are connected via a peptide linker consisting of 15 VH(CLDN). In one embodiment said heavy chain variable to 20, preferably 15 or 20 amino acids, preferably glycine regions (VH) and the corresponding light chain variable and/or serine, and preferably are connected via a peptide regions (VL) are connected via a long peptide linker, prefer linker comprising the amino acid sequence (GGGGS)4. In ably, a peptide linker comprising the amino acid sequences one embodiment said VH(CLDN) and VL(CLDN) are con (GGGGS)3 or VE(GGGGS)2GGVD. In one embodiment nected via a peptide linker consisting of 15 to 20, preferably said two VH-VL or VL-VH scEw units are connected via a 15 or 20 amino acids, preferably glycine and/or serine, and short peptide linker, preferable a peptide linker comprising preferably are connected via a peptide linker comprising the the amino acid sequence SGGGGS or GGGGS. amino acid sequence (GGGGS)4. In one embodiment said 0015. In one embodiment said CLDN is CLDN18.2 and two VH-VL scFv units are connected via a linker peptide said VH(CLDN) comprises an amino acid sequence repre comprising the amino acid sequence SGGGGS. One or both sented by SEQID NO: 8 or a fragment thereof or a variant of of said two VH-VL scFv units may comprise one or more said amino acid sequence or fragment and the VL(CLDN) interface disulfide bridges. comprises an amino acid sequence represented by SEQ ID 0023. In one aspect the binding agent of the invention is in NO: 15 or a fragment thereof or a variant of said amino acid the formatofa bispecific single chain antibody that comprises sequence or fragment. two scFv molecules connected via a linker peptide, wherein 0016. In one embodiment said CLDN is CLDN18.2 and the heavy chain variable regions (VH) and the corresponding said VH(CLDN) comprises an amino acid sequence repre light chain variable regions (VL) are arranged, from N-ter sented by SEQID NO: 6 or a fragment thereof or a variant of minus to C-terminus, in the order VL(CLDN)-VH(CLDN)- said amino acid sequence or fragment and the VL(CLDN) VH(CD3)-VL(CD3). In one embodiment said VH(CD3) and comprises an amino acid sequence represented by SEQ ID VL(CD3) are connected via a peptide linker consisting of 15 NO: 11 or a fragment thereof or a variant of said amino acid to 20, preferably 15 or 20 amino acids, preferably glycine sequence or fragment. and/or serine, and preferably are connected via a peptide 0017. In one embodiment said CLDN is CLDN6 and said linker comprising the amino acid sequence (GGGGS)4. In VH(CLDN) comprises an amino acid sequence represented one embodiment said VL(CLDN) and VH(CLDN) are con by SEQID NO: 22 or a fragment thereof or a variant of said nected via a peptide linker consisting of 20 to 25, preferably amino acid sequence or fragment and the VL(CLDN) com 20 or 25 amino acids, preferably glycine and/or serine, and prises an amino acid sequence represented by SEQID NO. 23 preferably are connected via a peptide linker comprising the amino acid sequence (GGGGS)5. In one embodiment said or a fragment thereofor a variant of said amino acid sequence VL-VH and VH-VL scEw units are connected via a linker or fragment. peptide comprising the amino acid sequence SGGGGS. One 0018. In one embodiment said CLDN is CLDN6 and said or both of said two VL-VH or VH-VL schv units may com VH(CLDN) comprises an amino acid sequence represented prise one or more interface disulfide bridges. by SEQID NO: 22 or a fragment thereof or a variant of said 0024. In one aspect the binding agent of the invention is in amino acid sequence or fragment and the VL(CLDN) com the formatofa bispecific single chain antibody that comprises prises an amino acid sequence represented by SEQID NO: two scFv molecules connected via a linker peptide, wherein 97, 98, 99 or 100, or a fragment thereof or a variant of said the heavy chain variable regions (VH) and the corresponding amino acid sequence or fragment. light chain variable regions (VL) are arranged, from N-ter 0019. In one embodiment said VH(CD3) comprises an minus to C-terminus, in the order VH(CLDN)-VL(CLDN)- amino acid sequence represented by SEQ ID NO:36, 94 or VL(CD3)-VH(CD3). Preferably, said VL(CD3)-VH(CD3) 95, or a fragment thereof or a variant of said amino acid ScFv unit comprises one or more interface disulfide bridges. sequence or fragment and the VL(CD3) comprises an amino In one embodiment said VL(CD3) and VH(CD3) are con acid sequence represented by SEQ ID NO: 37 or 96 or a nected via a peptide linker consisting of 20 to 25, preferably fragment thereof or a variant of said amino acid sequence or 20 or 25 amino acids, preferably glycine and/or serine, and fragment. preferably are connected via a peptide linker comprising the 0020. In one embodiment said VH(CD3) comprises an amino acid sequence (GGGGS)5. In one embodiment said amino acid sequence represented by SEQ ID NO: 36 or a VH(CLDN) and VL(CLDN) are connected via a peptide fragment thereof or a variant of said amino acid sequence or linker consisting of 15 to 20, preferably 15 or 20 amino acids, fragment and the VL(CD3) comprises an amino acid preferably glycine and/or serine, and preferably are con sequence represented by SEQ ID NO: 37 or a fragment nected via a peptide linker comprising the amino acid thereof or a variant of said amino acid sequence or fragment. sequence (GGGGS)4. In one embodiment said VH-VL and US 2016/0272711 A1 Sep. 22, 2016

VL-VH schv units are connected via a linker peptide com 0028. In one embodiment of the above aspect, said CLDN prising the amino acid sequence SGGGGS. Said is CLDN6. Preferably said VH(CLDN) comprises an amino VH(CLDN)-VL(CLDN) scFv unit may comprise one or acid sequence represented by SEQID NO: 22 or a fragment more interface disulfide bridges. thereof or a variant of said amino acid sequence or fragment. 0025. In one aspect the binding agent of the invention is in Preferably said VL(CLDN) comprises an amino acid the formatofa bispecific single chain antibody that comprises sequence represented by SEQ ID NO: 98, 99 or 100 or a two scFv molecules connected via a linker peptide, wherein fragment thereof or a variant of said amino acid sequence or the heavy chain variable regions (VH) and the corresponding fragment. Most preferably, said VL(CLDN) comprises an light chain variable regions (VL) are arranged, from N-ter amino acid sequence represented by SEQ ID NO: 99 or a minus to C-terminus, in the order VL(CLDN)-VH(CLDN)- fragment thereof or a variant of said amino acid sequence or VL(CD3)-VH(CD3). Preferably, said VL(CD3)-VH(CD3) fragment. In one embodiment said VH(CD3) comprises an ScFv unit comprises one or more interface disulfide bridges. amino acid sequence represented by SEQ ID NO: 95, or a In one embodiment said VL(CD3) and VH(CD3) are con fragment thereof or a variant of said amino acid sequence or nected via a peptide linker consisting of 20 to 25, preferably fragment and the VL(CD3) comprises an amino acid 20 or 25 amino acids, preferably glycine and/or serine, and sequence represented by SEQ ID NO: 96 or a fragment preferably are connected via a peptide linker comprising the thereof or a variant of said amino acid sequence or fragment. amino acid sequence (GGGGS)5. In one embodiment said 0029. In one embodiment said CLDN is CLDN18.2 and VL(CLDN) and VH(CLDN) are connected via a peptide said binding agent of the invention comprises an amino acid linker consisting of 20 to 25, preferably 20 or 25 amino acids, sequence selected from the group consisting of SEQID NOs: preferably glycine and/or serine, and preferably are con 38, 39, 40 and 41 or a fragment or variant thereof. nected via a peptide linker comprising the amino acid 0030. In one embodiment said CLDN is CLDN18.2 and sequence (GGGGS)5. In one embodiment said two VL-VH said binding agent of the invention comprises an amino acid ScFv units are connected via a linker peptide comprising the sequence selected from the group consisting of SEQID NOs: amino acid sequence SGGGGS. Said VL(CLDN)-VH 103,66, 67, 68, 69,70, 71, 72,73, 74, 75, 76, 77,78, 79, 80, (CLDN) schv unit may comprise one or more interface dis 81, 82, 83, 84, 85, 86, 87, 88, 89, 90,91, 92 and 93 or a ulfide bridges. fragment or variant thereof. In one embodiment, said CLDN 0026. In one embodiment of any of the above aspects, said is CLDN18.2 and said binding agent comprises an amino acid CLDN is CLDN18.2. Preferably said VH(CLDN) comprises sequence selected from the group consisting of SEQID NOs: an amino acid sequence represented by SEQID NO: 8 or a 103,66, 67,68, 69, 70, 71, 72,73, 74, 75, 76, 77,78, 79,80, fragment thereof or a variant of said amino acid sequence or 81, 82, 83, 84, 85, 86, 87, 88, 89, 90,91, 92 and 93 or a fragment and the VL(CLDN) comprises an amino acid fragment or variant thereof, wherein said amino acid sequence represented by SEQ ID NO: 15 or a fragment sequence lacks secretion signals such as N-terminal Secretion thereof or a variant of said amino acid sequence or fragment. signals, in particular the sequence according to SEQID NO: Alternatively, said VH(CLDN) comprises an amino acid 51 and/or lacks His-tags Such as C-terminal His-tags, in par sequence represented by SEQID NO: 6 or a fragment thereof ticular the sequence Gly-Gly-Ser-(His) or (His) if present. or a variant of said amino acid sequence or fragment and the 0031. In one embodiment said CLDN is CLDN6 and said VL(CLDN) comprises an amino acid sequence represented binding agent of the invention comprises an amino acid by SEQID NO: 11 or a fragment thereof or a variant of said sequence selected from the group consisting of SEQID NOs: amino acid sequence or fragment. In one embodiment said 42, 43, 44 and 45 or a fragment or variant thereof. VH(CD3) comprises an amino acid sequence represented by 0032. In one embodiment said CLDN is CLDN6 and said SEQ ID NO: 95 or a fragment thereof or a variant of said binding agent of the invention comprises an amino acid amino acid sequence or fragment and the VL(CD3) com sequence selected from the group consisting of SEQID NOs: prises an amino acid sequence represented by SEQID NO: 96 101, 102, 60, 61, 62, 63, 64 and 65 or a fragment or variant or a fragment thereofor a variant of said amino acid sequence thereof. In one embodiment said CLDN is CLDN6 and said or fragment. binding agent comprises an amino acid sequence selected 0027. In one aspect the binding agent of the invention is in from the group consisting of SEQID NOs: 101, 102, 60, 61. the formatofa bispecific single chain antibody that comprises 62, 63, 64 and 65 or a fragment or variant thereof, wherein two scFv molecules connected via a linker peptide, wherein said amino acid sequence lacks secretion signals such as the heavy chain variable regions (VH) and the corresponding N-terminal Secretion signals, in particular the sequence light chain variable regions (VL) are arranged, from N-ter according to SEQID NO: 51 and/or lacks His-tags such as minus to C-terminus, in the order VH(CLDN)-VL(CLDN)- C-terminal His-tags, in particular the sequence Gly-Gly-Ser VH(CD3)-VL(CD3) or in the order VH(CD3)-VL(CD3)-VH (His) or (His) if present. (CLDN)-VL(CLDN). In one embodiment said VH(CLDN) 0033. In one embodiment said cancer cells expressing and VL(CLDN) are connected via a peptide linker consisting CLDN18.2 are cancer cells of a cancer selected from the of 15 to 20, preferably 15 or 20 amino acids, preferably group consisting of gastric cancer, esophageal cancer, pan glycine and/or serine, and preferably are connected via a creatic cancer, lung cancer Such as non Small cell lung cancer peptide linker comprising the amino acid sequence (GGGGS) (NSCLC), breast cancer, ovarian cancer, colon cancer, 3. In one embodiment said VH(CD3) and VL(CD3) are con hepatic cancer, head-neck cancer, cancer of the gallbladder nected via a peptide linker consisting of 15 to 20, preferably and the metastasis thereof, a Krukenberg tumor, peritoneal 15 or 20 amino acids, preferably glycine and/or serine, and metastasis and/or lymph node metastasis. preferably are connected via a peptide linker comprising the 0034. In one embodiment said cancer cells expressing amino acid sequence GGGGS(GGS)3GGGS. In one embodi CLDN6 are cancer cells of a cancer selected from the group ment said two VH-VL scFv units are connected via a linker consisting of urinary bladder cancer, ovarian cancer, in par peptide comprising the amino acid sequence SGGGGS. ticular ovarian adenocarcinoma and ovarianteratocarcinoma, US 2016/0272711 A1 Sep. 22, 2016

lung cancer, including Small cell lung cancer (SCLC) and carcinosarcoma, bile duct cancer, cancer of the urinary blad non-Small cell lung cancer (NSCLC), in particular Squamous der, in particular transitional cell carcinoma and papillary cell lung carcinoma and adenocarcinoma, gastric cancer, carcinoma, kidney cancer, in particular renal cell carcinoma breast cancer, hepatic cancer, pancreatic cancer, skin cancer, including clear cell renal cell carcinoma and papillary renal in particular basal cell carcinoma and squamous cell carci cell carcinoma, colon cancer, Small bowel cancer, including noma, malignant melanoma, head and neck cancer, in par cancer of the ileum, in particular Small bowel adenocarci ticular malignant pleomorphic adenoma, sarcoma, in particu noma and adenocarcinoma of the ileum, testicular embryonal lar synovial sarcoma and carcinosarcoma, bile duct cancer, carcinoma, placental choriocarcinoma, cervical cancer, tes cancer of the urinary bladder, in particular transitional cell ticular cancer, in particular testicular seminoma, testicular carcinoma and papillary carcinoma, kidney cancer, in par teratoma and embryonic testicular cancer, uterine cancer, ticular renal cell carcinoma including clear cell renal cell germ cell tumors such as a teratocarcinoma or an embryonal carcinoma and papillary renal cell carcinoma, colon cancer, carcinoma, in particular germ cell tumors of the testis, and the Small bowel cancer, including cancer of the ileum, in particu metastatic forms thereof. lar Small bowel adenocarcinoma and adenocarcinoma of the 0044. In one aspect, the invention provides a binding agent ileum, testicular embryonal carcinoma, placental choriocar or nucleic acid coding therefor or a host cell as described cinoma, cervical cancer, testicular cancer, in particular tes hereinforuse in the methods of treatment described herein. In ticular seminoma, testicular teratoma and embryonic testicu one embodiment, the invention provides a pharmaceutical lar cancer, uterine cancer, germ cell tumors such as a composition as described herein for use in the methods of teratocarcinoma or an embryonal carcinoma, in particular treatment described herein. germ cell tumors of the testis, and the metastatic forms 0045. According to the invention, CLDN18.2 preferably thereof. has the amino acid sequence according to SEQID NO: 1 and 0035. In one embodiment the binding agent has an N-ter CLDN6 preferably has the amino acid sequence according to minal secretion signal and/or a C-terminal histidin epitope SEQID NO: 2 or 3. tag, preferable a six histidin epitope tag. 0046. Other features and advantages of the instant inven 0036. In one aspect the invention relates to a recombinant tion will be apparent from the following detailed description nucleic acid which encodes a binding agent of the invention. and claims. In one embodiment the recombinant nucleic acid is in the form of a vector. In one embodiment the recombinant nucleic BRIEF DESCRIPTION OF THE DRAWINGS acid is RNA. 0047 FIG. 1. Modular scheme illustrating the design of 0037. In one aspect the invention relates to a host cell recombinant bi-scFv proteins targeting TAA CLDN18.2. comprising a recombinant nucleic acid of the invention. 0048. Design of the bi-scFvs in (A) N-terminal and (B) 0038. In one aspect the invention relates to the binding C-terminal position regarding the anti-TAA variable regions. agent of the invention, the recombinant nucleic acid of the Anti-CLDN18.2 V, and V, regions are generated from the invention or the host cell of the invention for use in therapy, in sequence of a monoclonal CLDN18.2 antibody (mCLDN18. particular for use in treating or preventing cancer. 2ab). Anti-CD3 stands comprehensive for V and V regions 0039. In one aspect the invention relates to a pharmaceu generated from the sequences of the following monoclonal tical composition comprising the binding agent of the inven CD3 antibodies: UCHT1-HU (humanized mAB), UCHT1, tion, the recombinant nucleic acid of the invention or the host CLB-T3, TR66, 145-2C11. Bi-scFv indicates bispecific cell of the invention. single chain variable fragment; His, hexahistidyl-tag. HU, 0040. In one aspect the invention relates to a method of humanized; LL., long linker (15-18 amino acids); Sec, Secre treating or preventing a cancer disease comprising adminis tion signal; SL, short linker (5-6 amino acids); TAA, tumor tering to a patient the pharmaceutical composition of the associated antigen; V. Variable region of the heavy (H) and invention. light (L) chain of the antibody. 0041. In one embodiment cells of said cancer express a 0049 FIG. 2. Effect of domain orientation and anti-CD3 claudin to which said binding agent is capable of binding. schv selection on specific target cell lysis: 5'-moLDN18.2ab 0042. In one embodiment said claudin is CLDN18.2 and V-V, TR66V-V-3' bi-scFvs 1BiMAB and no. 15 are the said cancer is selected from the group consisting of gastric most potent variants. cancer, esophageal cancer, pancreatic cancer, lung cancer 0050. Several bi-scFV variants directed against Such as non Small cell lung cancer (NSCLC), breast cancer, CLDN18.2 and CD3 were transiently expressed in HEK293T ovarian cancer, colon cancer, hepatic cancer, head-neck can cells and small-scale purified with Ni-NTA columns for the cer, cancer of the gallbladder and the metastasis thereof, a comparison of their potency in a cytotox assay. CLDN18.2 Krukenberg tumor, peritoneal metastasis and/or lymph node endogenously expressing NugC4 cells which stably express metastasis. luciferase were taken as target cells. Human T cells and target 0043. In one embodiment said claudin is CLDN6 and said cells were incubated in an E:T ratio of 5:1 with 5 ng/ml of cancer is selected from the group consisting of urinary blad each bi-scFv protein in a 96-well format. As negative controls der cancer, ovarian cancer, in particular ovarian adenocarci no. 35 targeting a non-expressed TAA, no. 11, and no. noma and ovarian teratocarcinoma, lung cancer, including 16—both targeting murine but not human T cells—were Small cell lung cancer (SCLC) and non-Small cell lung cancer taken. Each test sample was plated sixfold, the control sample (NSCLC), in particular squamous cell lung carcinoma and for L, was plated ninefold. Coincubation times before adenocarcinoma, gastric cancer, breast cancer, hepatic can analysis were 8 h, 16 h, and 24 h. After addition of luciferin cer, pancreatic cancer, skin cancer, in particular basal cell Solution at the given time points, the luminescence was mea carcinoma and squamous cell carcinoma, malignant mela sured in an Infinite M200 TECAN reader. Specific target cell noma, head and neck cancer, in particular malignant pleomor lysis was calculated by normalization to samples with control phic adenoma, sarcoma, in particular synovial sarcoma and bi-scFv no. 35 (L). The most potent bi-scFV proteins— US 2016/0272711 A1 Sep. 22, 2016

1BiMAB and no. 15—share the domain orientation and the scope with 200x magnification. White arrowheads point to T anti-CD3 origin of mABTR66 but differ in their codon opti cell clusters on target cells. TL indicates T lymphocyte. mization (HS and CHO, respectively) and the long linker 0056 FIG. 6.1 BiMAB mediates T cell activation in a dose sequences. CHO indicates Chinese Hamster Ovary; mAB, dependent manner. monoclonal antibody; HU, humanized; TAA, tumor associ 0057 CLDN18.2 endogenously expressing NugC4 cells ated antigen. were incubated for 24 h and 48 h with escalating concentra 0051 FIG. 3. Coomassie gel and western blot analysis of tions of bi-scFv protein 1BiMAB (0.001-1000 ng/ml) and bi-scFv protein 1BiMAB. human T cells in an effector to target ratio of 5:1 in duplicates 0052 Supernatant without FCS of monoclonal HEK293 in a 24-well format. As control human T cells were incubated cells stably expressing 1BiMAB was purified via Ni-NTA with 1-1000 ng/ml 1BiMAB without NugC4 target cells to affinity chromatography (IMAC). Aliquots of different puri verify the target dependent activation of T cells mediated by 1BiMAB. After 24h (A) and 48 h (B) T cells were harvested fication steps were loaded to 4-12% Bis-Tris gels. (A) Coo and labeled with anti-CD3-FITC, anti-CD25-PE, and anti massie Staining of cell Supernatant, flow through and eight CD69-APC and analyzed by flow cytometry. TL indicates T fractions of the eluate. Fractions of the first eluted peak were lymphocyte. discarded, fractions of the second eluted peak were pooled for further studies, dialyzed against PBS and subsequently 0058 FIG. 7. 1 BiMAB mediates strictly target dependent against 200 mMarginine buffer. (Lane 1: HEK293/1BiMAB T cell activation even after long term incubation with SN: lane 2: IMAC flow through fraction; lanes 3-4: Fractions CLDN18.2 high, low, and non-expressing cell lines. of elution peak 1 (discarded); lanes 5-10: Fractions of elution 0059 (A) RT-PCR data generated from total RNA of six peak 2 (pooled)) (B) Western blot analysis of 0.5 lug of tumor cell lines are shown. Ct-values of CLDN18.2 expres 1BiMAB from three independent purifications (lane 1, 2, 3). sion normalized to housekeeping gene HPRT has been cal Detection was performed with primary monoclonal anti-His culated from two independent experiments. Breast cancer cell and secondary peroxidase conjugated anti-mouse antibody. line MCF7 (grey bar) was chosen as negative CLDN18.2- IMAC indicates immobilized metal affinity chromatography: expressing control cell line. (B) Cancer cell lines from (A) PBS, phosphate buffered saline; SN, supernatant; WB, west were incubated for 144 h with 5 ng/ml bi-scFv protein ern blot. 1BiMAB with or without human T cells in an effector to target ratio of 5:1 in duplicates in a 6-well format. T cells were 0053 FIG. 4. Bi-scFv protein 1BiMAB binds efficiently labeled with anti-CD3-FITC, anti-CD25-PE and anti-CD69 and specifically to CLDN18.2-expressing target cells and APC to analyze total T cell population (CD3), early activation human T cells. (CD69), and late activation (CD25) of T cells by flow cytom 0054 (A) 2.5x10 CLDN18.2 endogenously expressing etry. TL indicates T lymphocyte. NugC4 cells were incubated with 50 g/ml 1BiMAB or 10 0060 FIG. 8. 1 BiMAB induces T cell proliferation and ug/ml mCLDN18.2ab as positive control and the correspond Granzyme Bupregulation only in the presence of CLDN18.2 ing APC-conjugated secondary antibodies. Control stainings positive target cells. included secondary APC-conjugated antibodies alone (g-a-h. 0061 (A) Human T cells were CFSE stained and culti g-a-m), anti-His and g-a-m APC, or 1 BiMAB and g-a-m vated alone (TL) or in the presence of 1 ng/ml 1BiMAB APC. Analysis was performed via flow cytometry. MFI of (TL+1 ng/ml 1BiMAB), NugC4 cells (TL+NugC4), or APC signal was calculated by FlowJo software. (B) 1x10 NugC4 cells and 1 ng/ml 1BiMAB (TL+1 ng/ml 1BiMAB+ CLDN18.2 endogenously expressing NugC4 cells were NugC4) for 120h. A 5:1 effector to target ratio was selected. stained with escalating 1BiMAB concentrations (20 pg/ml Decrease of CFSE signal indicating T cell proliferation was 20 ug/ml), anti-His and g-a-m APC. As negative control cells analyzed by flow cytometry. (B) Human T cells were incu were incubated with anti-His and g-a-m APC. As positive bated with or without NugC4 target cells and with or without controlmCLDN18.2abandg-a-haPC was used. MFI of APC 5 ng/ml bi-scFv 1BiMAB protein. Effector to target ratio was signal was calculated by FlowJo software. (C) 1x10' human of 5:1 in a 6-well format. After 96 h of coincubation T cells T cells were incubated with escalating 1 BiMAB concentra were harvested and intracellularly stained with anti-GrB-PE tions (2 ng/ml-2 ug/ml), anti-His and g-a-mAPC. As negative and analyzed by flow cytometry. MFI of anti-GrB-PE signal control cells were incubated with anti-His and g-a-m APC or was calculated by FlowJo software. The signal of unstained g-a-m APC alone. MFI of APC signal was calculated by sample TL+NugC4+5 ng/ml 1BiMAB was subtracted from FlowJo software. (D) 1x10 CLDN18.2 negative PA-1 cells all samples. CFSE indicates carboxyfluorescein succinimidyl were incubated with escalating 1 BiMAB concentrations (10 ester; GrB, Granzyme B; MFI, mean fluorescence intensity; ng/ml-10 ug/ml), anti-His and g-a-m APC. As negative con PE, phycoerythrin; TL, T lymphocytes. trol, cells were stained with anti-His and g-a-m APC org-a-h 0062 FIG. 9. EC50 of 1BiMAB for specific target cell APC alone. 10 ug/ml mCLDN18.2ab and g-a-h APC were lysis after 48 h is approximately 10 pg/ml. used to confirm CLDN18.2 negativity of cells. G-a-h indi 0063 CLDN18.2 endogenously expressing NugC4 cells cates goat-anti-human; g-a-m, goat-anti mouse; MFI, mean which stably express luciferase were incubated for 24 h and fluorescence intensity; TL, T lymphocyte. 48 h with bi-scFv protein 1BiMAB in escalating concentra 0055 FIG. 5. Bi-scEv protein 1BiMAB leads to T cell tions (0.001-1000 ng/ml) with human T cells in an effector to clustering on CLDN18.2 positive target cells. CLDN18.2 target ratio of 5:1 in triplicates in a 96-well format. As mini endogenously expressing NugC4 cells were incubated for 24 mum lysis (L) control effector and target cells were plated h with 1 ng/ml and 1 g/ml 1BiMAB and human T cells in an without bi-scFv 1BiMAB. Maximum lysis (L.) for the effector to target ratio of 5:1 in 6-well plates. T cells alone normalization to spontaneous luminescence counts was (TL), target cells alone (NugC4) and human T cells with achieved by addition of Triton X-100 to control wells con target cells (-ctrl) were chosen as control samples. After 24h taining effector and target cells in the absence of bi-scFV samples were photographed with a Nikon Eclipse Timicro shortly prior to luciferin addition. After addition of luciferin US 2016/0272711 A1 Sep. 22, 2016

solution the luminescence was measured in an Infinite M200 to target ratio of 5:1 in duplicates in a 6-well format. As Tecan microplate reader after 24 h and 48 h. Specific target control human T cells were incubated with 100 and 200 ng/ml cell lysis was calculated by the formula: % specific lysis=1- 6PHU5 or 6PHU3 without target cells. After 44h T cells were (luminescences, t-L)/(Ln-L)x100. Values harvested and labeled with anti-CD3-FITC, anti-CD25-PE, were plotted against log 10 of 1 BiMAB concentration. EC50 and anti-CD69-APC. Dose-dependent T cell activation was indicates the half maximal effective concentration; L. lysis. analyzed by flow cytometry. Hu indicates human; TL, T lym 0064 FIG. 10. 1 BiMAB shows therapeutic in vivo effi phocyte. cacy in an advanced SC tumor model. 0072 FIG. 14. Coomassiegel and western blot analysis of 0065. NOD.Cg-Prkdscid IL2rgtm1 Wil/SZJ (NSG) mice 6PHU3 protein. were injected SC with 1x107 HEK293 stably expressing (0073 Supernatant without FCS of polyclonal HEK293 CLDN18.2. Five days later 2x107 human PBMC effector cells stably expressing 6PHU3 was purified via Ni-NTA cells were injected IP to groups G3 and G4, control groups affinity chromatography (IMAC). Aliquots of different puri (G1 and G2) received PBS only. Daily IP application of 5ug fication steps were loaded to 4-12% Bis-Tris gels. (A) Coo bi-scFv protein 1BiMAB per animal or vehicle as control massie staining of cell Supernatant, flow through and nine started at the following day. Therapy was administered for 22 fractions of eluate. Fractions of the first eluted peak were days, tumor Volume was measured using a caliper and calcu discarded, fractions of the second and third eluted peaks were lated by the formula mm-length mmxwidth mmx(width pooled for further studies, dialyzed against PBS and subse mm/2). (A) The tumor Volume of single mice and the median quently against 200 mMarginine buffer. (Lane 1: HEK293/ per group is shown for treatment days 0 and 15 (upper row), 6PHU3 SN: lane 2: IMAC flow through fraction; lanes 3-5: and 3 and 13 days after the end of treatment (bottom row). (B) Fractions of elution peak 1 (discarded); lanes 6-11: Fractions The mean tumor Volume of the two treatment groups ofelution peaks 2 and 3 (pooled)) (B) Western blot analysis of engrafted with human effector cells is shown. Dashes indicate 0.5 ms of 6PHU3 from two independent purifications. Detec sacrificed animals. (C) Kaplan-Meier survival curve present tion was performed with primary monoclonal anti-His and ing all groups from the day of tumor inoculation to day 41. secondary peroxidase conjugated anti-mouse antibody. Animals were sacrificed as soon as the tumor Volume IMAC indicates immobilized metal affinity chromatography: exceeded 500 mm. After day 41 all remaining animals were PBS; phosphate buffered saline; SN, supernatant; WB, west sacrificed to analyze the engraftment of human effector cells ern blot. in the spleens of mice. (D) Splenocytes of all mice were isolated and stained with anti-CD45-APC and anti-CD3 (0074 FIG. 15. Bi-scFv protein 6PHU3 binds efficiently FITC to detect human T cells by flow cytometry. Median and specifically to CLDN6-expressing target cells and human engraftment is shown in a boxplot diagram. G indicates T cells. group; IP intraperitoneal; PBMC, peripheral blood mono (0075 (A) 1x10 CLDN6 endogenously expressing PA-1 nuclear cells; PBS, phosphate buffered saline; SC, subcuta and OV-90 cells were incubated with escalating concentra OUS. tions of 6PHU3 or control bi-scFv 1BiMAB (10 ng/ml-10 0066 FIG. 11. Modular scheme illustrating the design of ug/ml) and 10 ug/ml mCLDN6ab or control maB recombinant bi-scFv proteins targeting TAA CLDN6. mCLDN18.2ab with the corresponding APC-conjugated sec 0067. Design of the bi-sch vs in (A) N-terminal and (B) ondary antibodies. Control stainings were secondary APC C-terminal position regarding the anti-TAA variable regions. conjugated antibodies alone (g-a-h, g-a-m). Analysis was Anti-CLDN6 V and V, regions are generated from the performed via flow cytometry. MFI of APC signal was cal sequence of a monoclonal CLDN6 antibody (mCLDN6ab). culated by FlowJo software. (B) 5x10 human T cells were Anti-CD3 VandV, regions are generated from the sequence incubated with escalating 6PHU3 concentrations (100 ng/ml of the monoclonal CD3 antibody TR66. Bi-scFv indicates 10 ug/ml), anti-His and g-a-m PE. As negative control cells bispecific single chain variable fragment; His, hexahistidyl were incubated with anti-His and g-a-m PE, or g-a-m PE tag, LL, long linker (15-18 amino acids); Sec, Secretion sig alone. MFI of PE signal was calculated by FlowJo software. nal; SL, short linker (5 amino acids); TAA, tumor associated (C) 1x10 CLDN6 negative NugC4 cells were incubated with antigen; V. Variable region of the heavy (H)and light (L) chain escalating 6PHU3 and 1BiMAB concentrations (10 ng/ml-10 of the antibody. ug/ml), anti-His and g-a-m APC. As negative control cells 0068 FIG. 12. Bi-scEv proteins 6PHU5 and 6PHU3 lead were incubated with g-a-mAPC alone. 10 ug/ml mCLDN6ab to T cell clustering on CLDN6 positive target cells. and g-a-h APC were used to confirm CLDN6 negativity of 0069 CLDN6 endogenously expressing PA-1 cells were cells. As positive control mCLDN18.2ab and g-a-h APC was incubated for 24 h with 50 ng/ml 6PHU5 or 6PHU3 and used. MFI of APC signal was calculated by FlowJo software. human T cells in an effector to target ratio of 5:1 in 6-well APC indicates allophycocyanin; g-a-h, goat-anti-human; g-a- plates. T cells alone (TL), target cells alone (PA-1) and human m, goat-anti-mouse; mAB, monoclonal antibody; MFI, mean T cells with target cells (-ctrl) were chosen as control fluorescence intensity: PE, phycoerythrin: TL, T lymphocyte. samples. After 24h samples were photographed with a Nikon 0076 FIG. 16. 6PHU3 mediates T cell activation in a dose Eclipse T, microscope with 200x magnification. White dependent manner. arrowheads point to T cell clusters on target cells. TL indi 0077 CLDN6 endogenously expressing PA-1 cells were cates T lymphocyte. incubated for 24 h and 48 h with escalating concentrations of 0070 FIG. 13. Effect of domain orientation on efficacy: bi-scFv protein 6PHU3 (0.001-1000 ng/ml) and human T bi-scFv protein 6PHU3 is slightly more efficient in inducing cells in an effector to target ratio of 5:1 in duplicates in a T cell activation than 6PHU5. 24-well format. As control human T cells were incubated with 0071 CLDN6 endogenously expressing PA-1 cells were 1-1000 ng/ml 6PHU3 without PA-1 target cells to verify the incubated for 44 h with escalating concentrations (5-200 target dependent activation of T cells mediated by 6PHU3. ng/ml) of 6PHU5 or 6PHU3 and human T cells in an effector After 24h (A) and 48 h(B) T cells were harvested and labeled US 2016/0272711 A1 Sep. 22, 2016

with anti-CD3-FITC, anti-CD25-PE, and anti-CD69-APC ing, lower rows the CD3 staining. Images were taken with a and analyzed by flow cytometry. TL indicates T lymphocyte. Mirax scanner. (A) and (B) show the PBS control groups G1 0078 FIG. 17. EC50 of 6PHU3 for specific target cell lysis and G2 that received no human effector cells and vehicle or after 48 h is approximately 10 pg/ml. bi-scFv 6PHU3, respectively, (C) shows control group G3 0079 CLDN6 endogenously expressing PA-1 cells which that received human effector cells and vehicle as treatment, stably express luciferase were incubated for 24 h and 48 h. (D) shows group G4 that received human effector cells and with 6PHU3 protein in escalating concentrations (0.001 bi-scFv 6PHU3 as treatment, and (E) shows control group G5 1000 ng/ml) with human T cells in an effector to target ratio that received human effector cells and control bi-scFv of 5:1 in triplicates in a 96-well format. As minimum lysis 1BiMAB. Positive signals appear as red staining. Black control (L) effector and target cells were plated without arrowheads point to examples of CD3 signals. IP indicates bi-scFv 6PHU3. Maximum lysis (L) for the normalization intraperitoneal; PBMC, peripheral blood mononuclear cells; to spontaneous luminescence counts was achieved by addi PBS, phosphate buffered saline; SC, subcutaneous. tion of Triton X-100 to control wells containing effector and 0085 FIG. 20. Schematic illustration of IVT-RNA mol target cells in the absence of bi-scFv shortly prior to luciferin ecules encoding bi-scFv antibodies targeting TAA CLDN18. addition. After addition of luciferin solution the lumines 2 cence was measured in an Infinite M200 Tecan microplate I0086 Scheme of in vitro transcribed RNA sequences reader after 24 h and 48 h. Specific target cell lysis was encoding anti-CLDN18.2 bi-schv antibodies. (A) IVT calculated by the formula: % specific lysis=1-(luminescen mRNA in 5’- and 3'-position regarding the anti-TAA variable cees, st-L)/(Ln-L)x100. Values were plotted regions. (B) IVT alphaviral replicon in 5'-position regarding against log 10 of 6PHU3 concentration. EC50 indicates the the anti-TAA variable regions. Anti-CLDN18.2 V and V, half maximal effective concentration; L. lysis. regions were generated from the sequence of a monoclonal 0080 FIG. 18.6PHU3 shows therapeutic in vivo efficacy CLDN18.2 antibody (mCLDN18.2ab). “Cap' is uniformly in an advanced SC tumor model. used for ARCA, beta-S-ARCA (D1) or beta-S-ARCA (D2). I0081) NOD.Cg-Prkde IL2rg"'''/SzJ (NSG) mice In (A) “anti-CD3” stands comprehensively for V, and V, were injected SC with 1x10" PA-1 endogenously expressing regions generated from the sequences of the following mono CLDN6. 15 days later 2x107 human PBMC were injected IP clonal CD3 antibodies: UCHT1-HU (humanized mAB), to groups G3 and G4, control groups (G1 and G2) received UCHT1, CLB-T3, TR66, 145-2C11, in (B) “anti-CD3 PBS only. Daily IP application of 5 lug 6PHU3 per animal or describes only V, and V, from TR66. A indicates adenine: control bi-scFv 1BiMAB or vehicle alone as control started bi-scFv, bispecific single chain variable fragment; hAg, five days after PBMC injection. Therapy was administered human alpha globin 5'-UTR; hBg, human beta globin for 25 days, tumor Volume was measured using a caliper and 3'-UTR: His, hexahistidyl-tag; IVT, in vitro transcribed; LL. calculated by the formula mm-length mmxwidth mmx long linker (15-18 amino acids); nsP1-4, non-structural pro (width mm/2). (A) The tumor volume of single mice and the teins 1-4: Sec, secretion signal; SgP. Subgenomic promoter; median per group is shown for treatment days 0 and 14 (upper SL, short linker (5-6 amino acids); TAA, tumor associated row), and 21 and 25 (bottom row). (B) The mean tumor antigen; UTR, untranslated region; V. Variable region of the Volume of all treatment groups is shown. Dashes indicate heavy (H) and light (L) chain of the antibody. sacrificed animals. (C) A Kaplan-Meier survival curve of all 0087 FIG. 21. Effect of domain orientation and anti-CD3 groups from the day of tumor inoculation till day 45 is shown. ScFv selection on target dependent T cell activation and spe Animals were sacrificed at a tumor volume >1500mm. After cific target cell lysis. day 45 all remaining animals were sacrificed to analyze the I0088 CLDN18.2 endogenously expressing NugC4 cells engraftment of human effector cells in the spleens of mice. were transiently transfected with several bi-scFv variants (D) Splenocytes of all mice were isolated and stained with directed against CLDN18.2 and CD3 for the comparison of anti-CD45-APC and anti-CD3-FITC to detect human T cells their potency in a cytotox assay. Per variant, 5x10' NugC4 by flow cytometry. Median engraftment is shown in a boxplot cells were electroporated with 20 ug/ml IVT-mRNA. Trans diagram. IP indicates intraperitoneal; PBMC, peripheral fected target cells were counted, 1x10 cells seeded per blood mononuclear cells; PBS, phosphate buffered saline; 6-well plate and incubated with human cytotoxic T cells SC, Subcutaneous. (CD8" selected T cells) in an E:T ratio of 5:1. As negative 0082 FIG. 19. Enhanced T cell infiltration into SC PA-1 controls a bi-scFv IVT-mRNA targeting a non-expressed tumors in response to 6PHU3 treatment. TAA (ctrl), and the parental IgG mAB chCLDN18.2ab (ctrl 0.083 NSG mice were injected SC with 1x107 PA-1 IgG) targeting CLDN18.2 but not T cells were chosen. endogenously expressing CLDN6. 15 days later 2x107 1BiMAB protein served as positive control in a concentration human PBMC were injected IP to groups G3 and G4, control of 5 ng/ml. As background dead cell reference, electroporated groups (G1 and G2) received PBS only. Daily IP application target cells were seeded without T cells and, as background of 5 ug 6PHU3 per animal or control bi-scFv 1BiMAB or activation reference, T cells were seeded without target cells. vehicle alone as control started five days after PBMC injec Each sample was seeded in duplicate. After 48 h T cells and tion. Tumors were dissected at a size of 1500 mm3 or at the target cells were harvested and labeled with anti-CD3-FITC, end of the experiment, and conserved in 4% buffered form anti-CD25-PE, anti-CD69-APC and 7-AAD for live-dead aldehyde solution for paraffin embedding. staining and analyzed by flow cytometry. (A) TAA-dependent 0084 Paraffin embedded tumor tissues of SC PA-1 tumors bi-scFv mediated T cell activation was observed with all were Subjected to immunohistochemical stainings. Consecu anti-CLDN18.2 bi-sch v variants. (B) Specific target cell lysis tive sections were stained either with polyclonal primary was determined by subtraction of 7-AAD reference popula antibody anti-Claudin 6 or anti-human CD3. Primary anti tion from 7-AAD sample target cell population. The bi-scFV bodies were detected using secondary HRP-conjugated anti antibodies leading to a marginal higher target cell lysis— rabbitantibodies. Upper rows of A-E show the CLDN6 stain 1BiMAB and no. 5 share the domain orientation and the US 2016/0272711 A1 Sep. 22, 2016

anti-CD3 origin of mABTR66 but differ in their codon opti ence of CLDN18.2 Human T cells were CFSE stained for the mization (HS and CHO, respectively) and the long linker assay. T cells were cultivated without target cells (T cells) in sequences. Bi-ScFv indicates bispecific single chain variable combination with 5 g/ml OKT3 and 2 g/ml CCD28 as fragment: ctrl, control; IgG, immunoglobuline G., IVT, in positive activation control (+ctrl), with 5 ng/ml non-targeting vitro transcribed; mRNA, messenger RNA; TL, T lympho control bi-scFv (-ctrl protein) or with 5 ng/ml 1BiMAB pro cyte. tein (1BiMAB protein). T cells and NugC4 target cells over I0089 FIG. 22. Coincubation of target cells transfected expressing CLDN18.2 were incubated together (T cells-- with 1 BiMAB IVT-mRNA and human T cells leads to T cell CLDN18.2 positive target cells) without anything (mock) or clustering. with 5 ng/ml 1BiMAB protein (1BiMAB protein). To test 0090 CLDN18.2 endogenously expressing NugC4 cells IVT-mRNA, NugC4 cells were transfected with 20 ug/ml were transiently transfected by electroporation with 80 ug/ml 1BiMAB IVT-mRNA (1BiMAB mRNA) or a bi-scFv IVT 1BiMAB IVT-mRNA and coincubated with human cytotoxic mRNA targeting a non-expressed TAA (-ctrl mRNA) and T cells (CD8" selected T cells) in an effector to target ratio of incubated with T cells. In addition, NugC4 cells transfected 5:1 in 96-well plates. As negative control sample NugC4 with a bi-scFv IVT-mRNA targeting a non-expressed TAA target cells transfected with a bi-scFv IVT-mRNA targeting a were combined with 5 ng/ml 1BiMAB protein (-ctrl mRNA non-expressed TAA (-ctrl) coincubated with human cyto 1BiMAB protein). As further specificity control, samples toxic T cells were used (upper row, left). The bottom row with the CLDN18.2-non expressing target cell line MDA shows NugC4 cells transfected with control bi-scFv (left) or MB-231 together with T cells were included (T cells-- 1BiMAB IVT-mRNA (right) without human T cells. After 24 CLDN18.2 negative target cells). MDA-MB-231 were either h of coincubation samples were photographed with a Nikon used untreated and incubated without anything (mock), with Eclipse Timicroscope in 200x magnification. White arrow 5 ng/ml control bi-scFv protein (-ctrl protein) or 5 ng/ml heads point to T cell clusters on target cells. CTL indicates 1BiMAB protein (1BiMAB protein) or MDA-MB-231 were cytotoxic T lymphocyte, ctrl, control; hu, human. transfected with 20 g/ml 1BiMAB IVT-mRNA (1BiMAB 0091 FIG. 23.1BiMAB secreted by target cells after IVT mRNA) or a bi-schv IVT-mRNA targeting a non-expressed mRNA transfection mediates T cell activation in a concentra TAA (-ctrl mRNA). The assay was performed in a 5:1 effec tion dependent manner. tor to target ratio in 96-wells, with each sample in triplicate 0092 CLDN18.2 endogenously expressing NugC4 cells and incubation times of 72 h. Decrease of CFSE signal indi were transiently transfected by electroporation with a total of cating T cell proliferation was analyzed by flow cytometry, 40 pg/ml IVT-mRNA containing 0,4-40 g/ml 1BiMABIVT calculated by FlowJo software and plotted as % proliferating mRNA plus appropriate amounts of luciferase IVT-mRNA. T cells. CFSE indicates carboxyfluorescein succinimidyl Transfected target cells were coincubated with human cyto ester: IVT, in vitro transcribed; mRNA, messenger RNA. toxic T cells (CD8" selected T cells) in an effector to target 0096 FIG. 26. T cell activation and T cell-mediated target ratio of 5:1 in 6-well plates in duplicates. As T cell activation cell lysis in response to 1BiMAB secretion starts with an reference human T cells were coincubated with NugC4 target effector to target ratio of 0.3:1. cells transfected with 40 ug/ml luciferase IVT-mRNA (0.0 0097 CLDN18.2 endogenously expressing NugC4 cells ug/ml 1BiMAB IVT-mRNA). After 24 h (A) and 48 h (B) T were transiently transfected by electroporation with 40 ug/ml cells were harvested and labeled with anti-CD3-FITC, anti 1BiMAB IVT-mRNA. Transfected target cells were coincu CD25-PE, and anti-CD69-APC and analyzed by flow cytom bated with human cytotoxic T cells (CD8" selected T cells) in etry. Graphs demonstrate percentage of positively stained the indicated effector to target ratios from 0.3:1 to 10:1 in cytotoxic human T cells as determined with Flow Jo software. 6-well plates in duplicates. As references human T cells were IVT indicates in vitro transcribed; mRNA, messenger RNA; cultured in the absence of target cells (A) 1:0) and target cells TL, T lymphocyte. transfected with control IVT-mRNA were cultured in the 0093 FIG. 24.1 BiMAB secreted by target cells after IVT absence of effector cells ((B) 0:1). As negative control human mRNA transfection leads to a concentration dependent target T cells were coincubated with NugC4 target cells transfected cell lysis. with 40 ug/ml luciferase IVT-mRNA (ctrl IVT-mRNA) in an 0094 CLDN18.2 endogenously expressing NugC4 cells E:T ratio of 10:1 ((A) and (B) ctrl IVT-mRNA 10:1). After 48 were transiently transfected by electroporation with a total of h cells were harvested and labeled with anti-CD3-FITC, anti 40 g/ml IVT-mRNA containing 0.4-40 ug/ml 1BiMAB IVT CD25-PE, anti-CD69-APC and propidium iodide (PI) for mRNA plus appropriate amounts of luciferase IVT-mRNA or life/dead staining and analyzed by flow cytometry. (A) shows with 40 ug/ml luciferase IVT-mRNA only as reference the percentage of positively stained cytotoxic human T cells. sample. Transfected target cells were seeded with human (B) demonstrates the percentage of dead (PI) target cells. All cytotoxic T cells (CD8" selected T cells) in an effector to values were determined via FlowJo software. E:T indicates target ratio of 5:1 or without effector cells to determine the effector to target: IVT, in vitro transcribed; mRNA, messen percentage of background dead target cells by each individual ger RNA; TL, T lymphocyte. electroporation. All samples were cultured in 6-well plates in (0098 FIG. 27. Human cytotoxic T cells are able to serve as duplicates. After 24h (A) and 48 h(B) T cells were harvested, bi-scFv IVT-mRNA recipient and producer cells labeled with propidium iodide (PI) for life/dead staining and (0099 Human cytotoxic T cells were freshly isolated from analyzed by flow cytometry. The percentage of dead (PI) PBMCs by CD8 positive selection and subsequently tran target cells was determined via FlowJo software. Values were siently transfected by electroporation with 80 or 240 ug/ml further normalized to each individual background sample and 1BiMAB IVT-mRNA. Transfected effector cells were coin to the reference sample. IVT indicates in vitro transcribed: cubated with NugC4 target cells endogenously expressing mRNA, messenger RNA; TL, T lymphocyte. CLDN18.2 in an effector to target ratio of 5:1 in 6-well plates 0095 FIG. 25. T cell proliferation is specifically induced in duplicates. As reference untreated human T cells were in response to 1BiMAB secretion by target cells in the pres cultured with target cells. As negative control human T cells US 2016/0272711 A1 Sep. 22, 2016

transfected with 80 or 240 g/mleGFP control IVT-mRNA control were separated via SDS-PAGE. Western Blot analysis were coincubated with NugC4 target cells. After 48 h cells was performed with primary monoclonal anti-His and sec were harvested and labeled with anti-CD3-FITC, anti-CD25 ondary peroxidase conjugated anti-mouse antibody. Ctrl indi PE, anti-CD69-APC and propidium iodide (PI) for life/dead cates control; mAB, monoclonal antibody, SN, Supernatant; staining and analyzed by flow cytometry. (A) shows the per WB, Western blot. centage of positively stained cytotoxic human T cells. In (B) 0105 FIG. 30. Injection of 1BiMAB bi-scFv IVT-mRNA the percentage of dead (PI) target cells normalized to the or -replicon RNA leads to in vivo production and detectable reference sample is plotted. All values were determined via 1BiMAB bi-scFv molecules in mice FlowJo software. Ctrl indicates control; IVT in vitro tran 0106 10 ug 1BiMAB IVT-mRNA with or without EBK scribed; mRNA, messenger RNA; TL, T lymphocyte. IVT-mRNA or 10 ug 1BiMAB IVT-replicon was IM injected 0100 FIG. 28. CLDN18.2 negative target cells transfected into NSG mice. Serum from blood, collected 2, 4 and 7 days with 1 BiMAB IVT-mRNA are not lysed by T cells post injection was applied in an in vitro cytotox assay. 0101 CLDN18.2 negative cell line PA-1 stably expressing CLDN18.2 and luciferase stably expressing NugC4-LVT luciferase served as target cell line. 5x10 PA-1/luc cells were CLDN18.2/luc target cells were coincubated with human T transfected by electroporation with a total of 40 ug/ml IVT cells in an E:T ratio of 30:1 with 20 sample serum for 48 h. mRNA. 4 and 40 g/ml 1BiMAB IVT-mRNA or 6RHU3 Standard 1 BiMAB protein control, L, and L. contained targeting endogenously expressed CLDN6 as positive control 20 ul NSG mock serum. EBK indicates vaccinia virus protein were transfected. As bi-scFv negative control, 40 g/ml of cocktail E3, B-18R, K3: IM, intramuscular. bi-scFv IVT-mRNA targeting a non-expressed TAA (-ctrl) 01.07 FIG. 31. Schematic illustration of IVT-RNA mol was transfected. This IVT-mRNA served also as fill-up RNA ecules encoding bi-scFv antibodies targeting TAA CLDN6. in the 4 ug/ml IVT-mRNA samples (IVT-mRNA 4 ug/ml 0.108 Scheme of in vitro transcribed RNA sequences 1BiMAB, IVT-mRNA 4 ug/ml 6RHU3). Protein control encoding anti-CLDN6 bi-sch V antibodies. (A) IVT mRNA in samples with 1 BiMAB and 6PHU3 in combination with bi 5'- and 3'-position regarding the anti-TAA variable regions. schv negative control transfected PA-1/luc cells and effector (B) IVT alphaviral replicon in 3'-position regarding the anti cells were included. TAA variable regions. Anti-CLDN6 V and V, regions are 0102 Transfected target cells were seeded with human generated from the sequence of a monoclonal CLDN6 anti cytotoxic T cells (Pan T cells) in an effector to target ratio of body (mCLDN6ab). “Cap' is uniformly used for ARCA, 5:1. All samples were seeded in triplicates in a 96-well format beta-S-ARCA (D1) or beta-S-ARCA (D2). Anti-CD3 Vand and coincubated for 72 h. As minimum lysis control (L) V regions are generated from the sequence of the mono each individual transfected target cell sample was seeded clonal CD3 antibody TR66. A indicates adenine; bi-scFv, without effector cells. Maximum lysis (L) for the normal bispecific single chain variable fragment; hAg, human alpha ization to spontaneous luminescence counts was achieved by globin 5'-UTR; hBg, human beta globin 3'-UTR: His, hexa addition of Triton X-100 to control wells containing effector histidyl-tag; IVT, in vitro transcribed; LL., long linker (15-18 and non-treated target cells (L.) or non-treated target cells amino acids); nsP1-4, non-structural proteins 1-4; Sec, Secre alone (L) prior to luciferin addition. 30 min after addition tion signal; sgP. Subgenomic promoter, SL, short linker (5-6 of luciferin solution the luminescence was measured in an amino acids); TAA, tumor associated antigen; UTR, untrans Infinite M200 Tecan microplate reader. Specific target cell lated region; V. Variable region of the heavy (H) and light (L) lysis was calculated by the formula: % specific lysis=1- chain of the antibody. (luminescences, sample-mai)/(Lnin test samplema 2)|X 0109 FIG. 32. Coincubation of target cells transfected 100. Ctrl indicates control; IVT in vitro transcribed; mRNA, with anti-CLDN6 bi-scFv IVT-mRNA and human T cells messenger RNA. leads to T cell clustering. (0103 FIG. 29. Proof of 1BiMAB production by mamma 0110 CLDN6 endogenously expressing PA-1 cells were lian cells transfected with bi-schv IVT-mRNA or -replicon transiently transfected by electroporation with 20 ug/ml RNA 6RHU5 or 6RHU3 IVT-mRNA and coincubated with human 0104 (A)5x10 BHK21 cells were transiently transfected T cells (Pan T cells) in an effector to target ratio of 5:1 in by electroporation with 40 ug/ml of 1BiMAB IVT-mRNA 6-well plates. As negative control sample PA-1 target cells or replicon RNA. As mock control cells were electropo transfected with a bi-scFv IVT-mRNA targeting a non-ex rated without RNA. 18 h post transfection supernatant and pressed TAA (-ctrl) coincubated with human T cells were cells were harvested. Cells were lysed and supernatants were used (upper row, left photo). The middle row shows untreated subjected to ~50-fold concentration. Untreated and concen PA-1 cells and human T cells without protein as negative trated supernatants were analyzed by ELISA using Ni-NTA control (mock, left photo) or with 50 lug/ml purified anti plates, anti-chCLDN18.2ab idiotypic mAB and a secondary CLDN6 bi-scEv proteins 6PHU5 (middle) or 6PHU3 (right) AP-conjugated antibody. Purified 1BiMAB protein in a dilu as positive controls. The bottom row shows untreated PA-1 tion row ranging from 2.3 to 37.5 ng/ml in steps of 2 was used cells (left) and human T cells alone (right). After 24 h of as standard. (B) Concentrated Supernatant, cell lysates of (A) coincubation samples were photographed with a Nikon and 0.1 ug purified 1BiMAB protein as positive control were Eclipse Timicroscope in 200x magnification. White arrow separated via SDS-PAGE. Western Blot analysis was per heads point to T cell clusters on target cells. Bi-scFv indicates formed with primary monoclonal anti-His and secondary per bispecific single chain variable fragment: ctrl, control; hu. oxidase conjugated anti-mouse antibody. (C) 5x10 BHK21 human; IVT, in vitro transcribed; mRNA, messenger RNA; cells were transiently transfected by electroporation with 40 TL, T lymphocyte. ug/ml of 1BiMAB or no. 25 IVT-mRNA. As mock control 0111 FIG. 33. Effect of domain orientation on efficacy: cells were electroporated without RNA. 48 h post transfection target cell transfection with anti-CLDN6 bi-scFv 6RHU3 Supernatant was harvested and Subjected to 40-fold concen leads to higher percentages of activated T cells than with tration. SN and 0.1 ug purified 1BiMAB protein as positive 6RHUS. US 2016/0272711 A1 Sep. 22, 2016

0112 CLDN6 endogenously expressing PA-1 cells were treated target cells shortly prior to luciferin addition. 30 min transiently transfected with the two bi-sch v variants 6RHU5 after addition of luciferin Solution the luminescence was mea and 6RHU3 directed against CLDN6 and CD3 for the com sured in an Infinite M200 Tecan microplate reader after 24h parison of their potency in a T cell activation assay. Per variant and 48 h. Specific target cell lysis was calculated by the 5x10° PA-1 cells were electroporated with 20 g/ml IVT formula:% specific lysis-1-(luminescences, -L)/ mRNA. Transfected target cells were re-counted, 1x10 cells (L, -L)x100. Values were plotted against log seeded per 6-well plate and incubated with human cytotoxic 10 of6RHU3 concentration. EC50 indicates the half maximal T cells (CD8" selected T cells) in an E:T ratio of 5:1. As effective concentration; L. lysis. negative controls untreated target cells (hu TL+PA-1 0117 FIG. 36. T cell proliferation is specifically induced untreated) and target cells transfected with a bi-scFv IVT in response to 6RHU3 secretion by target cells in the presence mRNA targeting a non-expressed TAA (hu TL+PA-1-ctrl) of CLDN6. were chosen. 6PHU5 protein served as positive control in a 0118 Human T cells were CFSE stained for the assay. T concentration of 50 ng/ml (hu TL+PA-1 protein ctrl). Further, cells were cultivated without target cells (T cells) in combi T cells were seeded without target cells with or without nation with 5 lug/ml OKT3 and 2 ug/ml CCD28 as positive 6PHU5 protein as background activation reference. Each activation control (+ctrl), with 5 ng/ml non-targeting control sample was seeded in duplicate. Analysis was performed after bi-scFv (-ctrl protein) or with 5 ng/ml 6PHU3 protein 24 h and 48 h.: T cells were harvested and labeled with anti (6PHU3 protein). T cells and PA-1 target cells endogenously CD3-FITC, anti-CD25-PE, anti-CD69-APC and 7-AAD for expressing CLDN6 were incubated together (T cells-- live-dead staining and analyzed by flow cytometry. TAA CLDN6 positive target cells) without anything (mock) or dependent bi-scFv mediated T cell activation was observed with 5 ng/ml 6PHU3 protein (6PHU3 protein). To test IVT with both anti-CLDN6 bi-sch v variants after 24h (A) and 48 mRNA, PA-1 cells were transfected with 20 pg/ml 6RHU3 h (B) of coincubation. Bi-schv 6RHU3 transfection led to IVT-mRNA (6RHU3 mRNA) or a bi-scFv IVT-mRNA tar approximately 20% higher T cell activation in both time geting a non-expressed TAA (-ctrl mRNA) and incubated points. Bi-ScFV indicates bispecific single chain variable frag with T cells. In addition, PA-1 cells transfected with a bi-scFv ment: ctrl, control; hu, human, IVT, in vitro transcribed; IVT-mRNA targeting a non-expressed TAA were combined mRNA, messenger RNA; TL, T lymphocyte. with 5 ng/ml 6PHU3 protein (-ctrl mRNA+6PHU3 protein). 0113 FIG. 34.6RHU3 secretion mediates T cell activa As further specificity control, samples with the CLDN6-non tion in a concentration dependent manner. expressing target cell line MDA-MB-231 together with T 0114 CLDN6 endogenously expressing PA-1 cells were cells were included (T cells +CLDN6 negative target cells). transiently transfected by electroporation with a total of 20 MDA-MB-231 were either used untreated and incubated ug/ml IVT-mRNA containing 0.2-20 lug/ml 6RHU3 IVT without anything (mock), with 5 ng/ml control bi-scFv pro mRNA plus appropriate amounts of a bi-scFv IVT-mRNA tein (-ctrl protein) or 5 ng/ml 6PHU3 protein (6PHU3 pro targeting a non-expressed TAA. Transfection of 20 ug/ml tein) or MDA-MB-231 were transfected with 20 ug/ml bi-scFv IVT-mRNA targeting a non-expressed TAA (0.0 6RHU3 IVT-mRNA (6RHU3 mRNA) or a bi-scFv IVT ug/ml 6RHU3 IVT-mRNA) served as specificity control. mRNA targeting a non-expressed TAA (-ctrl mRNA). The Transfected target cells were coincubated with human cyto assay was performed in a 5:1 effector to target ratio in toxic T cells (Pan T cells) in an effector to target ratio of 5:1 96-wells, with each sample in triplicate and incubation times in 6-well plates in duplicates. As T cell activation reference of 72 h. Decrease of CFSE signal indicating T cell prolifera human T cells were cultured alone without 6PHU5 protein tion was analyzed by flow cytometry, calculated by Flow Jo (hu TL-) or with 6PHU5 protein (hu TL protein ctrl). As software and plotted as % proliferating T cells. CFSE indi negative control T cells were coincubated with untreated cates carboxyfluorescein succinimidyl ester; IVT, in vitro PA-1 target cells (hu TL+PA-1-ctrl). 6PHU5 protein served transcribed; mRNA, messenger RNA. as positive control in a concentration of 50 ng/ml (hu 0119 FIG.37. Proof of 6RHU3 translation by mammalian TL+PA-1 protein ctrl). After 48 h T cells were harvested and cells transfected with bi-scFv IVT-mRNA or -replicon RNA labeled with anti-CD3-FITC, anti-CD25-PE, and anti-CD69 0120 (A)5x10 BHK21 cells were transiently transfected APC and analyzed by flow cytometry. Graphs demonstrate by electroporation with 40 ug/ml of 6RHU3 IVT-mRNA percentages of positively stained human T cells as determined or replicon RNA. Transfection of 40 g/ml no. 25 IVT via FlowJo software. Bi-scFv indicates bispecific single chain mRNA was included as extra sample. As mock ctrl cells were variable fragment: ctrl, control; hu, human; IVT, in vitro electroporated without RNA. 18 h post transfection superna transcribed; mRNA, messenger RNA: TL, T lymphocyte. tant and cells were harvested. Cells were lysed and superna 0115 FIG. 35. EC50 of 6RHU3 for specific target cell tants were subjected to ~50-fold concentration. Untreated lysis after 48 h is approximately 200 ng/ml. and concentrated Supernatants were analyzed by ELISA 0116 CLDN6 endogenously expressing PA-1 cells which using Ni-NTA plates, anti-mCLDN6ab idiotypic mAB and a stably express luciferase were transiently transfected by elec secondary AP-conjugated antibody. Purified 6PHU3 protein troporation with a total concentration of 13.3 ug/ml bi-scFV in a dilution row ranging from 2.3 to 150 ng/ml in steps of 2 IVT-mRNA containing 0.004-13.3 g/ml 6RHU3 and an was used as standard. (B) Concentrated Supernatant and cell appropriate amount of a bi-scFv IVT-mRNA targeting a non lysates of (A) and 0.1 g purified 6PHU3 protein as positive expressed TAA. Transfected target cells were seeded with control were separated via SDS-PAGE. Western Blot analysis human T cells in an effector to target ratio of 5:1 in triplicates was performed with primary monoclonal anti-His and sec in a 96-well format. As minimum lysis control (L) each ondary peroxidase conjugated anti-mouse antibody. (C) individual transfected target cell sample was seeded without 5x10'BHK21 cells were transiently transfected by electropo effector cells. Maximum lysis (L) for the normalization to ration with 40 ug/ml of 6RHU3 or no. 25 IVT-mRNA. As spontaneous luminescence counts was achieved by addition mock control cells were electroporated without RNA. 48 h. of Triton X-100 to control wells containing effector and non post transfection Supernatant was harvested and Subjected to US 2016/0272711 A1 Sep. 22, 2016

40-fold concentration. SN and 0.1 ugpurified 6PHU3 protein of TritonX-100 to control wells containing effector and target as positive control were separated via SDS-PAGE. Western cells in the absence of bi-scFv shortly prior to luciferin addi Blot analysis was performed with primary monoclonal anti tion. 30 min after addition of luciferin solution the lumines His and secondary peroxidase conjugated anti-mouse anti cence was measured in an Infinite M200 Tecan microplate body. Ctrl indicates control; mAB, monoclonal antibody; SN. reader after 24 h and 48 h of target and effector cell incuba supernatant; WB, Western blot. tion. Specific target cell lysis was calculated by the formula: 0121 FIG.38. Injection of 6RHU3 bi-scEv IVT-mRNA or % specific lysis-1-(luminescences, t-L)/(Ln -replicon RNA leads to in vivo translation and detectable L)x100. EC50 indicates the half maximal effective con bi-scFv molecules in mice centration; L. lysis; NA, not applicable. 0122) 10 ug 6RHU3 IVT-mRNA with or without EBK IVT-mRNA or 10 ug 6RHU3 IVT-replicon was IM injected DETAILED DESCRIPTION OF THE INVENTION into NSG mice. Serum from blood, collected 7 days post I0127. Although the present invention is described in detail injection was applied in an in vitro cytotox assay. CLDN6 below, it is to be understood that this invention is not limited endogenously and luciferase stably expressing PA-1/luctar to the particular methodologies, protocols and reagents get cells were coincubated with human T cells in an E:T ratio described herein as these may vary. It is also to be understood of 30:1 with 20 ul sample serum for 48 h. Standard 6PHU3 that the terminology used herein is for the purpose of describ protein control, L, and L. contained 20 Jul NSG mock ing particular embodiments only, and is not intended to limit serum. EBK indicates vaccinia virus protein cocktail E3, the scope of the present invention which will be limited only B-18R, K3: IM, intramuscular. by the appended claims. Unless defined otherwise, all tech (0123 FIG. 39. Cytotoxic results of anti-CLDN18.2 bi nical and Scientific terms used herein have the same meanings schv proteins containing the sclv anti-CD3 binding domain as commonly understood by one of ordinary skill in the art. at the C-terminal part of the protein. I0128. In the following, the elements of the present inven 0.124 Bi-scFV variants directed against CLDN18.2 and tion will be described. These elements are listed with specific CD3 were transiently expressed in CHO cells and purified embodiments, however, it should be understood that they may with Protein-L resin for the comparison of their potency in a be combined in any manner and in any number to create cytotoxic assay. CLDN18.2 endogenously expressingNugC4 additional embodiments. The variously described examples cells which stably express luciferase were taken as target and preferred embodiments should not be construed to limit cells. Human T cells and target cells were incubated in an E:T the present invention to only the explicitly described embodi ratio of 5:1 with 5000, 1000, 200 and 40 ng/ml of each of the ments. This description should be understood to support and bi-scFv proteins in a 96-well format. Each test sample was encompass embodiments which combine the explicitly plated threefold, the control sample for was plated threefold. described embodiments with any number of the disclosed Coincubation times before analysis were 24h and 48 h. After and/or preferred elements. Furthermore, any permutations addition of luciferin Solution at the given time points, the and combinations of all described elements in this application luminescence was measured in an. Infinite M200 TECAN should be considered disclosed by the description of the reader. Specific target cell lysis was calculated for each con present application unless the context indicates otherwise. centration and reported. I0129. Preferably, the terms used herein are defined as a. The variable domains of the anti-CD3 are in the VH-VL described in "A multilingual glossary of biotechnological domain order and separated by the LL4 peptide linker. terms: (IUPAC Recommendations). H. G. W. Leuenberger, b. The variable domains of the anti-CD3 are in the VH-VL B. Nagel, and H. Kölbl., Eds. Helvetica Chimica Acta, order and separated by the LL4 peptide linker. The schv CH-4010 Basel, Switzerland, (1995). anti-CD3 contains an interface disulfide bridge between the 0.130. The practice of the present invention will employ, VH and VL domains. unless otherwise indicated, conventional methods of chemis c. The variable domains of the anti-CD3 are in the VL-VH try, biochemistry, cell biology, immunology, and recombi order and separated by the LL5 peptide linker. nant DNA techniques which are explained in the literature in d. The variable domains of the anti-CD3 are in the VL-VH the field (cf. e.g., Molecular Cloning. A Laboratory Manual, order and separated by the LL5 peptide linker. The schv 2" Edition, J. Sambrook et al. eds., Cold Spring Harbor anti-CD3 contains an interface disulfide bridge between the Laboratory Press, Cold Spring Harbor 1989). VL and VH domains. I0131 Throughout this specification and the claims which 0.125 FIG. 40. Intra-assay comparison of EC50 values follow, unless the context requires otherwise, the word “com obtained in luciferase cytotoxic assay with anti-CLDN6 bi prise', and variations such as "comprises' and "comprising. schv proteins. will be understood to imply the inclusion of a stated member, 0126 Luciferase cytotoxic assays were performed with integer or step or group of members, integers or steps but not three different donors for T cell preparation. The calculated the exclusion of any other member, integer or step or group of EC50 values, calculated with the 6 tested anti-CLDN6 bi members, integers or steps although in some embodiments schv proteins after 24 h and 48 h incubation, are reported for Such other member, integer or step or group of members, each independent assay (A, B and C). CLDN6 endogenously integers or steps may be excluded, i.e. the Subject-matter expressing PA-1 cells were incubated for 24 h and 48 h with consists in the inclusion of a stated member, integer or step or escalating concentrations (0.025-50000 ng/ml for A and B, group of members, integers or steps. The terms “a” and “an 0.0025-5000 ng/ml for C) of anti-CLDN6 bi-scFv proteins and “the' and similar reference used in the context of describ and human T cells in an effector to target ratio of 5:1 in ing the invention (especially in the context of the claims) are triplicates in a 96-well format. As minimum lysis control to be construed to cover both the singular and the plural, (L) effector and target cells were plated without bi-scFV unless otherwise indicated herein or clearly contradicted by proteins. Maximum lysis (L) for the normalization to context. Recitation of ranges of values herein is merely spontaneous luminescence counts was achieved by addition intended to serve as a shorthand method of referring individu US 2016/0272711 A1 Sep. 22, 2016 ally to each separate value falling within the range. Unless (NSCLC), in particular squamous cell lung carcinoma and otherwise indicated herein, each individual value is incorpo adenocarcinoma, gastric cancer, breast cancer, hepatic can rated into the specification as if it were individually recited cer, pancreatic cancer, skin cancer, in particular basal cell herein. All methods described herein can be performed in any carcinoma and squamous cell carcinoma, malignant mela suitable order unless otherwise indicated herein or otherwise noma, head and neck cancer, in particular malignant pleomor clearly contradicted by context. The use of any and all phic adenoma, sarcoma, in particular synovial sarcoma and examples, or exemplary language (e.g., “such as'), provided carcinosarcoma, bile duct cancer, cancer of the urinary blad herein is intended merely to better illustrate the invention and der, in particular transitional cell carcinoma and papillary does not pose a limitation on the Scope of the invention carcinoma, kidney cancer, in particular renal cell carcinoma otherwise claimed. No language in the specification should be including clear cell renal cell carcinoma and papillary renal construed as indicating any non-claimed element essential to cell carcinoma, colon cancer, Small bowel cancer, including the practice of the invention. cancer of the ileum, in particular Small bowel adenocarci 0132) Several documents are cited throughout the text of noma and adenocarcinoma of the ileum, testicular embryonal this specification. Each of the documents cited herein (includ carcinoma, placental choriocarcinoma, cervical cancer, tes ing all patents, patent applications, scientific publications, ticular cancer, in particular testicular seminoma, testicular manufacturer's specifications, instructions, etc.), whether teratoma and embryonic testicular cancer, uterine cancer, supra or infra, are hereby incorporated by reference in their germ cell tumors such as a teratocarcinoma or an embryonal entirety. Nothing herein is to be construed as an admission carcinoma, in particular germ cell tumors of the testis, and the that the invention is not entitled to antedate such disclosure by metastatic forms thereof. In one embodiment, the cancer dis virtue of prior invention. ease associated with CLDN6 expression is selected from the 0.133 Claudins are a family of proteins that are the most group consisting of ovarian cancer, lung cancer, metastatic important components of tightjunctions, where they establish ovarian cancer and metastatic lung cancer. Preferably, the the paracellular barrier that controls the flow of molecules in ovarian cancer is a carcinoma or an adenocarcinoma. Prefer the intercellular space between cells of an epithelium. Clau ably, the lung cancer is a carcinoma or an adenocarcinoma, dins are transmembrane proteins spanning the membrane 4 and preferably is bronchiolar cancer Such as a bronchiolar times with the N-terminal and the C-terminal end both carcinoma or bronchiolar adenocarcinoma. located in the cytoplasm. The first extracellular loop, termed 0.137 The term “CLDN'as used herein means claudinand EC1 or ECL1, consists on average of 53 amino acids, and the includes CLDN18.2 and CLDN6. Preferably, a claudin is a second extracellular loop, termed EC2 or ECL2, consists of human claudin. around 24 amino acids. Cell Surface proteins of the claudin 0.138. The term “CLDN18 relates to claudin 18 and family, such as CLDN6 and CLDN18.2, are expressed in includes any variants, including claudin 18 splice variant 1 tumors of various origins, and are particularly Suited as target (claudin 18.1 (CLDN18.1)) and claudin 18 splice variant 2 structures in connection with antibody-mediated cancer (claudin 18.2 (CLDN18.2)). immunotherapy due to their selective expression (no expres (0.139. The term “CLDN18.2 preferably relates to human sion in a toxicity relevant normal tissue) and localization to CLDN18.2, and, in particular, to a protein comprising, pref the plasma membrane. erably consisting of the amino acid sequence according to 0134. In the context of the present invention, the preferred SEQ ID NO: 1 of the sequence listing or a variant of said claudins are CLDN6 and CLDN18.2. CLDN6 and amino acid sequence. The first extracellular loop of CLDN18.2 have been identified as differentially expressed in CLDN18.2 preferably comprises amino acids 27 to 81, more tumor tissues, with the only normal tissues expressing preferably amino acids 29 to 78 of the amino acid sequence CLDN18.2 being stomach and the only normal tissue shown in SEQ ID NO: 1. The second extracellular loop of expressing CLDN6 being placenta. CLDN18.2 preferably comprises amino acids 140 to 180 of 0135 CLDN18.2 is selectively expressed in normal tis the amino acid sequence shown in SEQID NO: 1. Said first Sues in differentiated epithelial cells of the gastric mucosa. and second extracellular loops preferably form the extracel CLDN18.2 is expressed in cancers of various origins such as lular portion of CLDN18.2. pancreatic carcinoma, esophageal carcinoma, gastric carci 0140. The term “CLDN6' preferably relates to human noma, bronchial carcinoma, breast carcinoma, and ENT CLDN6, and, in particular, to a protein comprising, prefer tumors. CLDN18.2 is a valuable target for the prevention ably consisting of the amino acid sequence of SEQID NO: 2 and/or treatment of primary tumors, such as gastric cancer, or SEQID NO: 3 of the sequence listing or a variant of said esophageal cancer, pancreatic cancer, lung cancer Such as non amino acid sequence. The first extracellular loop of CLDN6 Small cell lung cancer (NSCLC), ovarian cancer, colon can preferably comprises amino acids 28 to 80, more preferably cer, hepatic cancer, head-neck cancer, and cancers of the amino acids 28 to 76 of the amino acid sequence shown in gallbladder, and metastases thereof, in particular gastric can SEQID NO: 2 or the amino acid sequence shown in SEQID cer metastasis such as Krukenberg tumors, peritoneal NO:3. The second extracellular loop of CLDN6 preferably metastasis, and lymph node metastasis. comprises amino acids 138 to 160, preferably amino acids 0.136) CLDN6 has been found to be expressed, for 141 to 159, more preferably amino acids 145 to 157 of the example, in ovarian cancer, lung cancer, gastric cancer, breast amino acid sequence shown in SEQ ID NO: 2 or the amino cancer, hepatic cancer, pancreatic cancer, skin cancer, mela acid sequence shown in SEQID NO: 3. Said first and second nomas, head neck cancer, sarcomas, bile duct cancer, renal extracellular loops preferably form the extracellular portion cell cancer, and urinary bladder cancer. CLDN6 is a particu of CLDN6. larly preferred target for the prevention and/or treatment of 0.141. The term “variant according to the invention refers, ovarian cancer, in particular ovarian adenocarcinoma and in particular, to mutants, splice variants, conformations, iso ovarian teratocarcinoma, lung cancer, including Small cell forms, allelic variants, species variants and species lung cancer (SCLC) and non-Small cell lung cancer homologs, in particular those which are naturally present. An US 2016/0272711 A1 Sep. 22, 2016

allelic variant relates to an alteration in the normal sequence example, a part of a structure such as an amino acid sequence of a gene, the significance of which is often unclear. Complete or protein refers to a continuous element of said structure. A gene sequencing often identifies numerous allelic variants for portion, a part or a fragment of a structure preferably com a given gene. A species homolog is a nucleic acid or amino prises one or more functional properties of said structure. For acid sequence with a different species of origin from that of a example, a portion, a part or a fragment of an epitope or given nucleic acid or amino acid sequence. The term “vari peptide is preferably immunologically equivalent to the ant' shall encompass any posttranslationally modified vari epitope or peptide it is derived from. A part or fragment of a ants and conformation variants. protein sequence preferably comprises a sequence of at least 0142. The second target molecule of the binding agents 6, in particular at least 8, at least 12, at least 15, at least 20, at described herein is CD3 (cluster of differentiation 3). The least 30, at least 50, or at least 100 consecutive amino acids of CD3 complex denotes an antigen that is expressed on mature the protein sequence. human T-cells, thymocytes and a subset of natural killer cells 0151. According to the invention, CLDN18.2 is not sub as part of the multimolecular T-cell receptor (TCR) complex. stantially expressed in a cell if the level of expression is lower The T-cell co-receptor is a protein complex and is composed compared to expression in stomach cells or stomach tissue. of four distinct chains. In mammals, the complex contains a Preferably, the level of expression is less than 10%, preferably CD3y chain, a CD38 chain, and two CDRe chains. These less than 5%, 3%, 2%, 1%, 0.5%, 0.1% or 0.05% of the chains associate with a molecule known as the T-cell receptor expression in stomach cells or stomach tissue or even lower. (TCR) and the -chain to generate an activation signal in T Preferably, CLDN18.2 is not substantially expressed in a cell lymphocytes. The TCR, -chain, and CD3 molecules if the level of expression exceeds the level of expression in together comprise the TCR complex. non-cancerous tissue other than stomach by no more than 0143. The human CD3 epsilon is indicated in GenBank 2-fold, preferably 1.5-fold, and preferably does not exceed Accession No. NM 000733 and comprises SEQID NO: 4. the level of expression in said non-cancerous tissue. Prefer The human CD3 gamma is indicated in GenBank Accession ably, CLDN18.2 is not substantially expressed in a cell if the No. NM000073. The human CD3 delta is indicated in Gen level of expression is below the detection limit and/or if the Bank Accession No. NM 000732. CD3 is responsible for the level of expression is too low to allow binding by CLDN18. signal transduction of the TCR. As described by Lin and 2-specific antibodies added to the cells. Weiss, Journal of Cell Science 114, 243-244 (2001), activa 0152. According to the invention, CLDN18.2 is expressed tion of the TCR complex by binding of MHC-presented spe in a cell if the level of expression exceeds the level of expres cific antigen epitopes results in the phosphorylation of immu sion in non-cancerous tissue other than stomach preferably by noreceptor tyrosine-based activation motifs (ITAMs) by Src more than 2-fold, preferably 10-fold, 100-fold, 1000-fold, or family kinases, triggering recruitment of further kinases 10000-fold. Preferably, CLDN18.2 is expressed in a cell if the which results in T cell activation including Ca" release. level of expression is above the detection limit and/or if the Clustering of CD3 on T cells, e.g. by immobilized anti-CD3 level of expression is high enough to allow binding by antibodies, leads to T cell activation similar to the engage CLDN18.2-specific antibodies added to the cells. Preferably, ment of the T cell receptor, but independent from its clone CLDN18.2 expressed in a cell is expressed or exposed on the typical specificity. surface of said cell. 0144. As used herein, “CD3” includes human CD3 and 0153. According to the invention, CLDN6 is not substan denotes an antigen that is expressed on human T cells as part tially expressed in a cell if the level of expression is lower of the multimolecular T cell receptor complex. compared to expression in placenta cells or placentatissue. 0145 With respect to CD3, the binding agent of the inven Preferably, the level of expression is less than 10%, preferably tion preferably recognizes the epsilon-chain of CD3, particu less than 5%, 3%, 2%, 1%, 0.5%, 0.1% or 0.05% of the lar, it recognizes an epitope that corresponds to the first 27 expression in placenta cells or placentatissue or even lower. N-terminal amino acids of CD3 epsilon or functional frag Preferably, CLDN6 is not substantially expressed in a cell if ments of this 27 amino acid stretch. the level of expression exceeds the level of expression in 0146 According to the invention, the term “claudin posi non-cancerous tissue other than placenta by no more than tive cancer or similar terms means a cancer involving cancer 2-fold, preferably 1.5-fold, and preferably does not exceed cells expressing a claudin, preferably on the Surface of said the level of expression in said non-cancerous tissue. Prefer cancer cells. ably, CLDN6 is not substantially expressed in a cell if the 0147 “Cell surface' is used in accordance with its normal level of expression is below the detection limit and/or if the meaning in the art, and thus includes the outside of the cell level of expression is too low to allow binding by CLDN6 which is accessible to binding by proteins and other mol specific antibodies added to the cells. ecules 0154 According to the invention, CLDN6 is expressed in 0148. A claudin is expressed on the surface of cells if it is a cell if the level of expression exceeds the level of expression located at the Surface of said cells and is accessible to binding in non-cancerous tissue other than placenta preferably by by claudin-specific antibodies added to the cells. more than 2-fold, preferably 10-fold, 100-fold, 1000-fold, or 014.9 The term “extracellular portion” in the context of the 10000-fold. Preferably, CLDN6 is expressed in a cell if the present invention refers to a part of a molecule Such as a level of expression is above the detection limit and/or if the protein that is facing the extracellular space of a cell and level of expression is high enough to allow binding by preferably is accessible from the outside of said cell, e.g., by CLDN6-specific antibodies added to the cells. Preferably, antigen-binding molecules such as antibodies located outside CLDN6 expressed in a cell is expressed or exposed on the the cell. Preferably, the term refers to one or more extracel surface of said cell. lular loops or domains or a fragment thereof. 0155 According to the invention, the term “disease' 0150. The terms “part” or “fragment” are used inter refers to any pathological state, including cancer, in particular changeably herein and refer to a continuous element. For those forms of cancer described herein. Any reference herein US 2016/0272711 A1 Sep. 22, 2016

to cancer or particular forms of cancer also includes cancer ubiquitous nature of glands within the body. While each gland metastasis thereof. In a preferred embodiment, a disease to be may not be secreting the same Substance, as long as there is an treated according to the present application involves cells exocrine function to the cell, it is considered glandular and its expressing claudin (CLDN) such as CLDN18.2 and/or malignant form is therefore named adenocarcinoma. Malig CLDN6. nant adenocarcinomas invade other tissues and often metas 0156 “Diseases associated with cells expressing CLDN' tasize given enough time to do so. Ovarian adenocarcinoma is or similar expressions means according to the invention that the most common type of ovarian carcinoma. It includes the CLDN is expressed in cells of a diseased tissue or organ. In serous and mucinous adenocarcinomas, the clear cell adeno one embodiment, expression of CLDN in cells of a diseased carcinoma and the endometrioid adenocarcinoma. tissue or organ is increased compared to the state in a healthy 0.161. By “metastasis” is meant the spread of cancer cells tissue or organ. An increase refers to an increase by at least from its original site to another part of the body. The forma 10%, in particular at least 20%, at least 50%, at least 100%, at tion of metastasis is a very complex process and depends on least 200%, at least 500%, at least 1000%, at least 10000% or detachment of malignant cells from the primary tumor, inva even more. In one embodiment, expression is only found in a sion of the extracellular matrix, penetration of the endothelial diseased tissue, while expression in a healthy tissue is basement membranes to enter the body cavity and vessels, repressed. According to the invention, diseases associated and then, after being transported by the blood, infiltration of with cells expressing CLDN include cancer diseases. Further target organs. Finally, the growth of a new tumor at the target more, according to the invention, cancer diseases preferably site depends on angiogenesis. Tumor metastasis often occurs are those wherein the cancer cells express CLDN. even after the removal of the primary tumor because tumor O157. As used herein, a “cancer disease' or “cancer cells or components may remain and develop metastatic includes a disease characterized by aberrantly regulated cel potential. In one embodiment, the term “metastasis' accord lular growth, proliferation, differentiation, adhesion, and/or ing to the invention relates to “distant metastasis” which migration. By “cancer cell' is meant an abnormal cell that relates to a metastasis which is remote from the primary grows by a rapid, uncontrolled cellular proliferation and con tumor and the regional lymph node system. In one embodi tinues to grow after the stimuli that initiated the new growth ment, the term “metastasis' according to the invention relates cease. Preferably, a “cancer disease' is characterized by cells to lymph node metastasis. One particular form of metastasis expressing CLDN and a cancer cell expresses CLDN. A cell which is treatable using the therapy of the invention is expressing CLDN preferably is a cancer cell, preferably of metastasis originating from gastric cancer as primary site. In the cancers described herein. preferred embodiments such gastric cancer metastasis is 0158. The term "cancer according to the invention com Krukenberg tumors, peritoneal metastasis and/or lymph node prises leukemias, seminomas, melanomas, teratomas, lym metastasis. phomas, neuroblastomas, gliomas, rectal cancer, endometrial cancer, kidney cancer, adrenal cancer, thyroid cancer, blood 0162 Krukenberg tumor is an uncommon metastatic cancer, skin cancer, cancer of the brain, cervical cancer, intes tumor of the ovary accounting for 1% to 2% of all ovarian tinal cancer, liver cancer, colon cancer, stomach cancer, intes tumors. Prognosis of Krukenberg tumor is still very poor and tine cancer, head and neck cancer, gastrointestinal cancer, there is no established treatment for Krukenberg tumors. lymph node cancer, esophagus cancer, colorectal cancer, pan Krukenberg tumor is a metastatic signet ring cell adenocar creas cancer, ear, nose and throat (ENT) cancer, breast cancer, cinoma of the ovary. Stomach is the primary site in most prostate cancer, cancer of the uterus, ovarian cancer and lung Krukenberg tumor cases (70%). Carcinomas of colon, appen cancer and the metastases thereof. Examples thereofare lung dix, and breast (mainly invasive lobular carcinoma) are the carcinomas, mamma carcinomas, prostate carcinomas, colon next most common primary sites. Rare cases of Krukenberg carcinomas, renal cell carcinomas, cervical carcinomas, or tumor originating from carcinomas of the gallbladder, biliary metastases of the cancertypes or tumors described above. The tract, pancreas, Small intestine, ampulla of Vater, cervix, and term cancer according to the invention also comprises cancer urinary bladderfurachus have been reported. metaStaSeS. 0163. By “treat is meant to administer a compound or 0159. According to the invention, a "carcinoma’ is a composition or a combination of compounds or compositions malignant tumor derived from epithelial cells. This group to a Subject in order to prevent or eliminate a disease, includ represents the most common cancers, including the common ing reducing the size of a tumor or the number of tumors in a forms of breast, prostate, lung and colon cancer. Subject; arrest or slow a disease in a Subject; inhibit or slow 0160 Adenocarcinoma is a cancer that originates in the development of a new disease in a Subject, decrease the glandular tissue. This tissue is also part of a larger tissue frequency or severity of symptoms and/or recurrences in a category known as epithelial tissue. Epithelial tissue includes Subject who currently has or who previously has had a dis skin, glands and a variety of other tissue that lines the cavities ease; and/or prolong, i.e. increase the lifespan of the Subject. and organs of the body. Epithelium is derived embryologi cally from ectoderm, endoderm and mesoderm. To be classi 0164. In particular, the term “treatment of a disease' fied as adenocarcinoma, the cells do not necessarily need to includes curing, shortening the duration, ameliorating, pre be part of a gland, as long as they have secretory properties. venting, slowing down or inhibiting progression or worsen This form of carcinoma can occur in some higher mammals, ing, or preventing or delaying the onset of a disease or the including humans. Well differentiated adenocarcinomas tend symptoms thereof. to resemble the glandular tissue that they are derived from, 0.165. In the context of the present invention, terms such as while poorly differentiated may not. By staining the cells “protect”, “prevent”, “prophylactic”, “preventive', or “pro from a biopsy, a pathologist will determine whether the tumor tective' relate to the prevention or treatment or both of the is an adenocarcinoma or some other type of cancer. Adeno occurrence and/or the propagation of a disease in a subject carcinomas can arise in many tissues of the body due to the and, in particular, to minimizing the chance that a subject will US 2016/0272711 A1 Sep. 22, 2016 develop a disease or to delaying the development of a disease. bodies. Each heavy chain is comprised of a heavy chain For example, a person at risk for cancer would be a candidate variable region (abbreviated hereinas VH) and a heavy chain for therapy to prevent cancer. constant region. Each light chain is comprised of a light chain 0166 By “being at risk” is meanta subject that is identified variable region (abbreviated herein as VL) and a light chain as having a higher than normal chance of developing a dis constant region. The VH and VL regions can be further sub ease, in particular cancer, compared to the general popula divided into regions of hyperVariability, termed complemen tion. In addition, a subject who has had, or who currently has, tarity determining regions (CDR), interspersed with regions a disease, in particular cancer, is a subject who has an that are more conserved, termed framework regions (FR). increased risk for developing a disease, as such a subject may Each VH and VL is composed of three CDRs and four FRs, continue to develop a disease. Subjects who currently have, or arranged from amino-terminus to carboxy-terminus in the who have had, a cancer also have an increased risk for cancer following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. metaStases. The variable regions of the heavy and light chains contain a (0167. The term "patient’ means according to the invention binding domain that interacts with an antigen. The constant a Subject for treatment, in particular a diseased subject, regions of the antibodies may mediate the binding of the including human beings, nonhuman primates or anotherani immunoglobulin to host tissues or factors, including various mals, in particular mammals such as cows, horses, pigs, cells of the immune system (e.g., effector cells) and the first sheeps, goats, dogs, cats or rodents such as mice and rats. In component (Cld) of the classical complement system. a particularly preferred embodiment, a patient is a human (0173 The term "monoclonal antibody” as used herein being. refers to a preparation of antibody molecules of single 0168 “Target cell' shall mean any undesirable cell such as molecular composition. A monoclonal antibody displays a a cancer cell. In preferred embodiments, the target cell single binding specificity and affinity. In one embodiment, the expresses CLDN. monoclonal antibodies are produced by a hybridoma which (0169. The term "antigen” relates to an agent such as a includes a B cell obtained from a non-human animal, e.g., protein or peptide comprising an epitope against which an mouse, fused to an immortalized cell. immune response is directed and/or is to be directed. In a (0174 The term “recombinant antibody”, as used herein, preferred embodiment, an antigen is a tumor-associated anti includes all antibodies that are prepared, expressed, created gen, such as CLDN18.2 or CLDN6, i.e., a constituent of or isolated by recombinant means, such as (a) antibodies cancer cells which may be derived from the cytoplasm, the isolated from an animal (e.g., a mouse) that is transgenic or cell Surface and the cell nucleus, in particular those antigens transchromosomal with respect to the immunoglobulingenes which are produced, preferably in large quantity, intracellular or a hybridoma prepared therefrom, (b) antibodies isolated or as surface antigens on cancer cells. from a host cell transformed to express the antibody, e.g., (0170 In the context of the present invention, the term from a transfectoma, (c) antibodies isolated from a recombi "tumor-associated antigen' preferably relates to proteins that nant, combinatorial antibody library, and (d) antibodies pre are under normal conditions specifically expressed in a lim pared, expressed, created or isolated by any other means that ited number of tissues and/or organs or in specific develop involve splicing of immunoglobulin gene sequences to other mental stages and are expressed or aberrantly expressed in DNA sequences. one or more tumor or cancer tissues. In the context of the (0175. The term “human antibody”, as used herein, is present invention, the tumor-associated antigen is preferably intended to include antibodies having variable and constant associated with the cell surface of a cancer cell and is prefer regions derived from human germline immunoglobulin ably not or only rarely expressed in normal tissues. sequences. Human antibodies may include amino acid resi (0171 The term "epitope” refers to an antigenic determi dues not encoded by human germline immunoglobulin nant in a molecule, i.e., to the part in a molecule that is sequences (e.g., mutations introduced by random or site recognized by the immune system, for example, that is rec specific mutagenesis in vitro or by somatic mutation in vivo). ognized by an antibody. For example, epitopes are the dis (0176) The term "humanized antibody” refers to a mol crete, three-dimensional sites on an antigen, which are rec ecule having an antigen binding site that is substantially ognized by the immune system. Epitopes usually consist of derived from an immunoglobulin from a non-human species. chemically active surface groupings of molecules such as wherein the remaining immunoglobulin structure of the mol amino acids or Sugar side chains and usually have specific ecule is based upon the structure and/or sequence of a human three dimensional structural characteristics, as well as spe immunoglobulin. The antigen binding site may either com cific charge characteristics. Conformational and non-confor prise complete variable domains fused onto constant domains mational epitopes are distinguished in that the binding to the or only the complementarity determining regions (CDR) former but not the latter is lost in the presence of denaturing grafted onto appropriate framework regions in the variable Solvents. An epitope of a protein preferably comprises a con domains. Antigenbinding sites may be wild-type or modified tinuous or discontinuous portion of said protein and is pref by one or more amino acid substitutions, e.g. modified to erably between 5 and 100, preferably between 5 and 50, more resemble human immunoglobulins more closely. Some forms preferably between 8 and 30, most preferably between 10 and of humanized antibodies preserve all CDR sequences (for 25 amino acids in length, for example, the epitope may be example a humanized mouse antibody which contains all six preferably 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, CDRs from the mouse antibody). Other forms have one or 22, 23, 24, or 25 amino acids in length. more CDRs which are altered with respect to the original (0172. The term "antibody” refers to a glycoprotein com antibody. prising at least two heavy (H) chains and two light (L) chains (0177. The term "chimeric antibody” refers to those anti inter-connected by disulfide bonds. The term “antibody” bodies wherein one portion of each of the amino acid includes monoclonal antibodies, recombinant antibodies, sequences of heavy and light chains is homologous to corre human antibodies, humanized antibodies and chimeric anti sponding sequences in antibodies derived from a particular US 2016/0272711 A1 Sep. 22, 2016 species or belonging to a particular class, while the remaining monovalent fragments consisting of the VL, VH, CL and CH segment of the chain is homologous to corresponding domains; (ii) F(ab')2 fragments, bivalent fragments compris sequences in another. Typically the variable region of both ing two Fab fragments linked by a disulfide bridge at the hinge light and heavy chains mimics the variable regions of anti region; (iii) Fd fragments consisting of the VH and CH bodies derived from one species of mammals, while the con domains; (iv) Fv fragments consisting of the VL and VH stant portions are homologous to sequences of antibodies domains of a single arm of an antibody, (v) dAb fragments derived from another. One clear advantage to Such chimeric (Ward et al., (1989) Nature 341:544-546), which consist of a forms is that the variable region can conveniently be derived VH domain; (vi) isolated complementarity determining from presently known sources using readily available B-cells regions (CDR), and (vii) combinations of two or more iso or hybridomas from non-human host organisms in combina lated CDRs which may optionally be joined by a synthetic tion with constant regions derived from, for example, human linker. Furthermore, although the two domains of the Fv cell preparations. While the variable region has the advantage fragment, VL and VH, are coded for by separate genes, they of ease of preparation and the specificity is not affected by the can be joined, using recombinant methods, by a synthetic Source, the constant region being human, is less likely to elicit linker that enables them to be made as a single protein chain an immune response from a human Subject when the antibod in which the VL and VH regions pair to form monovalent ies are injected than would the constant region from a non molecules (known as single chain FV (ScFV); see e.g., Bird et human source. However the definition is not limited to this al. (1988) Science 242: 423-426; and Huston et al. (1988) particular example. Proc. Natl. Acad. Sci. USA85:5879-5883). Such single chain 0.178 Antibodies may be derived from different species, antibodies are also intended to be encompassed within the including but not limited to mouse, rat, rabbit, guinea pig and term “antigen-binding fragment of an antibody. A further human. example is binding-domain immunoglobulin fusion proteins 0179 Antibodies described herein include IgA such as comprising (i) a binding domain polypeptide that is fused to IgA1 or IgA2, IgG1, IgG2, IgG3, IgG4, IgE, IgM, and Ig) an immunoglobulin hinge region polypeptide, (ii) an immu antibodies. In various embodiments, the antibody is an IgG1 noglobulin heavy chain CH2 constant region fused to the antibody, more particularly an IgG1, kappa or IgG1, lambda hinge region, and (iii) an immunoglobulin heavy chain CH3 isotype (i.e. IgG1, K, w), an IgG2a antibody (e.g. IgG2a, K. W). constant regionfused to the CH2 constant region. The binding an IgG2b antibody (e.g. IgG2b, K, w), an IgG3 antibody (e.g. domain polypeptide can be a heavy chain variable region or a IgG3, K, w) or an IgG4 antibody (e.g. IgG4, K, w). light chain variable region. The binding-domain immunoglo 0180. As used herein, a "heterologous antibody” is bulin fusion proteins are further disclosed in US 2003/ defined in relation to a transgenic organism producing Suchan 0118592 and US 2003/0133939. These antibody fragments antibody. This term refers to an antibody having an amino are obtained using conventional techniques known to those acid sequence or an encoding nucleic acid sequence corre with skill in the art, and the fragments are screened for utility sponding to that found in an organism not consisting of the in the same manner as are intact antibodies. transgenic organism, and being generally derived from a spe 0.184 The term “binding domain characterizes in con cies other than the transgenic organism. nection with the present invention a structure, e.g. of an 0181. As used herein, a "heterohybrid antibody” refers to antibody, which binds to/interacts with a given target struc an antibody having light and heavy chains of different organ ture/antigen/epitope. Thus, the binding domain according to ismal origins. For example, an antibody having a human the invention designates an “antigen-interaction-site'. heavy chain associated with a murine light chain is a hetero 0185. Allantibodies and derivatives of antibodies such as hybrid antibody. antibody fragments as described herein for the purposes of 0182. The antibodies described herein are preferably iso the invention are encompassed by the term “antibody’. The lated. An "isolated antibody” as used herein, is intended to term “antibody derivatives' refers to any modified form of an refer to an antibody which is substantially free of other anti antibody, e.g., a conjugate of the antibody and another agent bodies having different antigenic specificities (e.g., an iso or antibody, or an antibody fragment. Furthermore, the anti lated antibody that specifically binds to CLDN18.2 is sub bodies and derivatives of antibodies as described herein are stantially free of antibodies that specifically bind antigens useful for producing binding agents of the invention Such as other than CLDN18.2). An isolated antibody that specifically antibody fragments. binds to an epitope, isoform or variant of human CLDN18.2 0186 Naturally occurring antibodies are generally mono may, however, have cross-reactivity to other related antigens, specific, i.e. they bind to a single antigen. The present inven e.g., from other species (e.g., CLDN18.2 species homologs). tion provides binding agents binding to a cytotoxic cell (by Moreover, an isolated antibody may be substantially free of engaging the CD3 receptor) and a cancer cell (by engaging other cellular material and/or chemicals. In one embodiment CLDN). The binding agents of the present invention are at of the invention, a combination of "isolated monoclonal least bispecific or multispecific Such as trispecific, tetraspe antibodies relates to antibodies having different specificities cific and so on. and being combined in a well defined composition or mixture. 0187. The binding agent of the invention may be in the 0183 The terms “antigen-binding portion' of an antibody format of an antibody molecule or of an antibody-like mol (or simply "binding portion') or “antigen-binding fragment' ecule or of a protein scaffold with antibody-like properties or of an antibody (or simply "binding fragment') or similar of a cyclic peptide with at least two binding specificities. terms refer to one or more fragments of an antibody that retain Thus, the binding agent may comprise one or more antibodies the ability to specifically bind to an antigen. It has been shown as described herein or fragments thereof. that the antigen-binding function of an antibody can be per 0188 According to the invention, a bispecific molecule, in formed by fragments of a full-length antibody. Examples of particular a bispecific protein, such as a bispecific antibody is binding fragments encompassed within the term “antigen a molecule that has two different binding specificities and binding portion' of an antibody include (i) Fab fragments, thus may bind to two different types of antigen such as CLDN US 2016/0272711 A1 Sep. 22, 2016 and CD3. Particularly, the term “bispecific antibody” as used advantageously be separated by a synthetic polypeptide herein refers to an antibody comprising two antigen-binding linker, whereas the respective SclvS may advantageously be sites, a first binding site having affinity for a first antigen or separated by a short polypeptide spacer as described above. epitope and a second binding site having binding affinity for 0193 According to one embodiment of the invention, the a second antigen or epitope distinct from the first. In particu first binding domain of the bispecific antibody comprises one lar, a bispecific antibody is an artificial protein that is com antibody variable domain, preferably a VHH domain. posed of fragments of two different antibodies (said frag According to one embodiment of the invention, the first bind ments of two different antibodies forming two binding ing domain of the bispecific antibody comprises two antibody domains) and consequently binds to two different types of variable domains, preferably a scFv, i.e. VH-VL or VL-VH. antigen. A bispecific antibody according to the invention is According to one embodiment of the invention, the second engineered to simultaneously bind to an immune cell. Such as binding domain of the bispecific antibody comprises one an immune effector cell, in particular a T cell Such as a antibody variable domain, preferably a VHH domain. cytotoxic cell (by binding to CD3) and a target cell like a According to one embodiment of the invention, the second cancer cell (by binding to the tumor-associated antigen binding domain of the bispecific antibody comprises two CLDN) to be destroyed. antibody variable domains, preferably a schv, i.e. VH-VL or 0189 The term “bispecific antibody' also includes dia VL-VH. In its minimal form, the total number of antibody bodies. Diabodies are bivalent, bispecific antibodies in which variable regions in the bispecific antibody according to the VH and VL domains are expressed on a single polypeptide invention is thus only two. For example, such an antibody chain, but using a linker that is too short to allow for pairing could comprise two VH or two VHH domains. between the two domains on the same chain, thereby forcing 0194 According to one embodiment of the invention, the the domains to pair with complementary domains of another first binding domain and the second binding domain of the chain and creating two antigen binding sites (see e.g., Hol bispecific antibody each comprise one antibody variable liger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90: 6444 domain, preferably a VHH domain. According to one 6448; Poljak, R. J., et al. (1994) Structure 2: 1121-1123). embodiment of the invention, the first binding domain and the 0190. “Multispecific binding agents’ are molecules which second binding domain of the bispecific antibody each com have more than two different binding specificities. prise two antibody variable domains, preferably a schv, i.e. 0191 Particularly preferred according to the invention are VH-VL or VL-VH. In this embodiment, the binding agent of bispecific antibodies including bispecific antibody frag the invention preferably comprises (i) a heavy chain variable ments, in particular bispecific single chain antibodies includ domain (VH) of a CLDN antibody, (ii) a light chain variable ing bispecific single chain antibody fragments. The term domain (VL) of a CLDN antibody, (iii) a heavy chain variable “bispecific single chain antibody' denotes a single polypep domain (VH) of a CD3 antibody and (iv) a light chain variable tide chain comprising two binding domains. In particular, the domain (VL) of a CD3 antibody. term “bispecific single chain antibody” or “single chain 0.195 Bispecific full-length antibodies may be obtained bispecific antibody' or related terms in accordance with the by covalently linking two monoclonal antibodies or by con present invention preferably mean antibody constructs result ventional hybrid-hybridoma techniques. Covalent linking of ing from joining at least two antibody variable regions in a two monoclonal antibodies is described in Anderson, Blood single polypeptide chain devoid of the constant and/or Fc 80 (1992), 2826-34. In the context of this invention, one of the portion(s) present in full immunoglobulins. antibodies is specific for CLDN and the other one for CD3. 0.192 For example, a bispecific single chain antibody may 0196. In one embodiment, the bispecific binding agent is be a construct with a total of two antibody variable regions, in the format of an antibody-like molecule with a heavy chain for example two VH regions, each capable of specifically containing two consecutive N-terminal variable domains binding to a separate antigen, and connected with one another with different specificities and a light chain with two consecu through a short polypeptide spacer Such that the two antibody tive variable domains with different specificities resulting in variable regions with their interposed spacer exist as a single four binding domains with two different specificities (Wu et contiguous polypeptide chain. Another example of a bispe al., Nat. Biotechnology, 2007, 25(11)), wherein one specific cific single chain antibody may be a single polypeptide chain ity is CD3 and the other specificity is CLDN. with three antibody variable regions. Here, two antibody vari 0.197 In a preferred embodiment, the bispecific binding able regions, for example one VH and one VL, may make up agent of the invention is in the format of an antibody frag an Schv, wherein the two antibody variable regions are con ment. nected to one another via a synthetic polypeptide linker, the 0.198. In one embodiment, the bispecific molecules latter often being genetically engineered so as to be mini according to the invention comprises two Fab regions, one mally immunogenic while remaining maximally resistant to being directed against CLDN and the other being directed proteolysis. This schv is capable of specifically binding to a against CD3. In one embodiment, the molecule of the inven particular antigen, and is connected to a further antibody tion is an antigenbinding fragment (Fab)2 complex. The Fab2 variable region, for example a VH region, capable of binding complex is composed of two Fab fragments, one Fab frag to a different antigen than that bound by the scFv. Yet another ment comprising a Fv domain, i.e. VH and VL domains, example of a bispecific single chain antibody may be a single specific for a CD3 antigen, and the other Fab fragment com polypeptide chain with four antibody variable regions. Here, prising a Fv domain specific for CLDN. Each of the Fab the first two antibody variable regions, for example a VH fragments may be composed of two single chains, a VL-CL region and a VL region, may form one ScFv capable of bind module and a VH-CH module. Alternatively, each of the ing to one antigen, whereas the second VH region and VL individual Fab fragments may be arranged in a single chain, region may form a second ScFv capable of binding to another preferably, VL-CL-CH-VH, and the individual variable and antigen. Within a single contiguous polypeptide chain, indi constant domains may be connected with a peptide linker. In vidual antibody variable regions of one specificity may general, the individual single chains and Fab fragments may US 2016/0272711 A1 Sep. 22, 2016

be connected via disulfide bonds, adhesive domains, chemi ment the bispecific molecule is a minibody, preferably, a cally linked and/or peptide linker. The bispecific molecule minibody comprising two single VH-VL-C chains that are may also comprise more than two Fab fragments, in particu connected with each other via the constant domains (C) of lar, the molecule may be a Fab3, Fab4, or a multimeric Fab each chain. According to this aspect, the corresponding vari complex with specificity for 2, 3, 4, or more different anti able heavy chain regions (VH), corresponding variable light gens. The invention also includes chemically linked Fabs. chain regions (VL) and constant domains (C) are arranged, 0199. In one embodiment, the binding agent according to from N-terminus to C-terminus, in the order VH(CLDN)-VL the invention includes various types of bivalent and trivalent (CLDN)-(C) and VH(CD3)-VL(CD3)-C, wherein C is pref. single-chain variable fragments (scEvs), fusion proteins erably a CH3 domain. Pairing of the constant domains results mimicking the variable domains of two antibodies. A single in formation of the minibody. chain variable fragment (sclv) is a fusion protein of the 0203. According to another particularly preferred aspect, variable regions of the heavy (VH) and light chains (VL) of the bispecific binding agent of the invention is in the format of immunoglobulins, connected with a short linker peptide of a bispecific single chain antibody construct, whereby said ten to about 25 amino acids. The linker is usually rich in construct comprises or consists of at least two binding glycine for flexibility, as well as serine or threonine for solu domains, whereby one of said domains binds to CLDN and a bility, and can either connect the N-terminus of the VH with second domain binds to CD3. Such molecules, also termed the C-terminus of the VL, or vice versa. Divalent (or bivalent) “bispecific T cell engagers' (BiTEs: the term BiTE only single-chain variable fragments (di-scFVs, bi-scFVs) can be refers to bi-specific molecules of which one arm is specific for engineered by linking two scEvs. This can be done by pro CD3) consist of two scFv molecules connected via a linker ducing a single peptide chain with two VH and two VL peptide. regions, yielding tandem Sclvs. The invention also includes multispecific molecules comprising more than two scEvs 0204 As used herein, a “bispecific single chain antibody' binding domains. This makes it possible that the molecule denotes a single polypeptide chain comprising two binding comprises either multiple antigen specificities and is a trispe domains. Each binding domain comprises one variable region cific, tetraspecific, or multispecific molecule, or the molecule from an antibody heavy chain (“VH region'), wherein the VH is a bispecific molecule comprising more than one scFv bind region of the first binding domain specifically binds to the ing domain with specificity for the same antigen. In particu CLDN, and the VH region of the second binding domain lar, the molecule of the invention may be a multispecific specifically binds to CD3. The two binding domains are optionally linked to one another by a short polypeptide single chain Fv. spacer. A non-limiting example for a polypeptide spacer is 0200 Another possibility is the creation of scFvs with linker peptides that are too short for the two variable regions Gly-Gly-Gly-Gly-Ser (G-G-G-G-S) and repeats thereof. to fold together (about five amino acids), forcing SchvS to Each binding domain may additionally comprise one variable dimerize. This type is known as diabodies. Still shorter link region from an antibody light chain (“VL region'), the VH ers (one or two amino acids) lead to the formation of trimers, region and VL region within each of the first and second so-called triabodies or tribodies. Tetrabodies have also been binding domains being linked to one another via a polypep produced. They exhibit an even higher affinity to their targets tide linker long enough to allow the VH region and VL region than diabodies. of the first binding domain and the VH region and VL region 0201 A particularly preferred example of a bispecific of the second binding domain to pair with one another. antibody fragment is a diabody (Kipriyanov, Int. J. Cancer 77 0205 According to this aspect, the corresponding variable (1998), 763-772), which is a small bivalent and bispecific heavy chain regions (VH) and the corresponding variable antibody fragment. Diabodies comprise a heavy chain vari light chain regions (VL) are arranged, from N-terminus to able domain (VH) connected to a light chain variable domain C-terminus, in the order VH(CLDN)-VL(CLDN)-VH(CD3)- (VL) on the same polypeptide chain (VH-VL) connected by a VL(CD3), VH(CD3)-VL(CD3)-VH(CLDN)-VL(CLDN) or peptide linker that is too short to allow pairing between the VH(CD3)-VL(CD3)-VL(CLDN)-VH(CLDN). It is, how two domains on the same chain. This forces pairing with the ever, also envisaged that the bispecific single chain antibodies complementary domains of another chain and promotes the of the invention comprise other domain arrangements, such as assembly of a dimeric molecule with two functional antigen VL(CLDN)-VH(CLDN)-VH(CD3)-VL(CD3), VL(CLDN)- binding sites. To construct bispecific diabodies of the inven VH(CLDN)-VL(CD3)-VH(CD3), VH(CLDN)-VL(CLDN)- tion, the V-domains of an anti-CD3 antibody and an anti VL(CD3)-VH(CD3), VL(CD3)-VH(CD3)-VH(CLDN)-VL CLDN antibody may be fused to create the two chains (CLDN), VL(CD3)-VH(CD3)-VL(CLDN)-VH(CLDN). VH(CD3)-VL(CLDN), VH(CLDN)-VL(CD3). Each chain 0206. A long linker generally connects the corresponding by itself is not able to bind to the respective antigen, but variable heavy chain regions (VH) and the corresponding recreates the functional antigen binding sites of an anti-CD3 variable light chain regions (VL) to create a scFv binding antibody and an anti-CLDN antibody on pairing with the domain while a short linker generally connects two scEv other chain. To this end, a peptide linker that is too short to binding domains. The linker is generally designed to provide allow pairing between the two domains on the same chain is flexibility and protease resistance, and preferably, the linker used. The two scFv molecules, with a linker between heavy comprises glycine and/or serine amino acid residues. Short chain variable domain and light chain variable domain that is peptide linkers may consist of 12 or less such as 11, 10,9,8, too short for intramolecular dimerization, are co-expressed 7, 6, 5, 4, 3 or 2 amino acids, and preferably, 5 or 6 amino and self assemble to form bi-specific molecules with the two acids. Short peptide linkers preferably comprise the amino binding sites at opposite ends. acid sequences SGGGGS or GGGGS. Long peptide linkers 0202 In one embodiment, the multispecific molecule may consist of 12 or more, such as 15 to 25 or 15 to 20 or 15 according to the invention comprises variable (VH, VL) and to 18 amino acids. Long peptide linkers preferably comprise constant domains (C) of immunoglobulins. In one embodi the amino acid sequences (GGGGS)3 or VE(GGSGGS) US 2016/0272711 A1 Sep. 22, 2016

2GGVD. Further long peptide linkers may comprise the dione, mitoxantrone, mithramycin, actinomycin D, 1-dehy amino acid sequences (GGGGS)4, (GGGGS)5 or GGGGS drotestosterone, glucocorticoids, procaine, tetracaine, (GGS)3GGGS. lidocaine, propranolol, and puromycin and analogs or 0207 Binding agents according to the invention may also homologs thereof. Suitable therapeutic agents for forming comprises an amino acid sequence for facilitating secretion of conjugates include, but are not limited to, antimetabolites the molecule, such as a N-terminal Secretion signal, and/or (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cyt one or more epitope tags facilitating binding, purification or arabine, fludarabin, 5-fluorouracil decarbazine), alkylating detection of the molecule. agents (e.g., mechlorethamine, thioepa chlorambucil, mel 0208 Preferably, the secretion signal is a signal sequence phalan, carmustine (BSNU) and lomustine (CCNU), cyclo (e.g. selected from any one of SEQID NOS:51, 52,53,54,55) phosphamide, buSulfan, dibromomannitol, Streptozotocin, that allows a Sufficient passage through the Secretory pathway mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) and/or secretion of the binding agent into the extracellular cisplatin), anthracyclines (e.g., daunorubicin (formerly environment. Preferably, the secretion signal sequence is daunomycin) and doxorubicin), antibiotics (e.g., dactinomy cleavable and is removed from the mature binding agent. The cin (formerly actinomycin), bleomycin, mithramycin, and secretion signal sequence preferably is chosen with respect to anthramycin (AMC), and anti-mitotic agents (e.g., Vincristine the cellor organism wherein the binding agent is produced in. and vinblastine). In a preferred embodiment, the therapeutic 0209. The amino acid sequence of an epitope tag may be agent is a cytotoxic agent or a radiotoxic agent. In another introduced to any position within the amino acid sequence of embodiment, the therapeutic agent is an immunosuppressant. the binding agent, and may take the shape of a loop within the In yet another embodiment, the therapeutic agentis GM-CSF. encoded protein structure, or it may be N-terminally or C-ter In a preferred embodiment, the therapeutic agent is doxoru minally fused to the binding agent. Preferably, the epitope tag bicin, cisplatin, bleomycin, Sulfate, carmustine, chloram is C-terminally fused to the binding agent. The epitope tag bucil, cyclophosphamide or ricin A. may contain a cleavage site that allows a removal of the tag 0214 Binding agents also can be conjugated to a radioiso from the binding agent. Said epitope tag can be any kind of tope, e.g., iodine-131, yttrium-90 or indium-111, to generate epitope tag that is functional under native and/or denaturing cytotoxic radiopharmaceuticals. conditions, preferable a histidin tag, most preferable a tag 0215 Techniques for conjugating Such therapeutic moiety comprising six histidins. to antibodies are well known, see, e.g., Arnon et al., “Mono 0210. The bispecific binding agent of the invention may clonal Antibodies For Immunotargeting Of Drugs. In Cancer contain, in addition to said first and second binding domain, a Therapy”, in Monoclonal Antibodies And Cancer Therapy, further binding domain which serves e.g. to enhance selec Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); tivity for tumor cells. This can be achieved e.g. by providing Hellstrom et al., “Antibodies For Drug Delivery', in Con binding domains that bind to other antigens expressed on trolled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. tumor cells. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, “Antibody Car 0211. In the context of the present invention, the binding riers Of Cytotoxic Agents. In Cancer Therapy: A Review', in agents generated are preferably capable of eliciting immune Monoclonal Antibodies 84: Biological And Clinical Appli effector functions as described herein. Preferably, said cations, Pincheraetal. (eds.), pp. 475-506 (1985): 'Analysis, immune effector functions are directed against cells carrying Results, And Future Prospective Of The Therapeutic Use Of the tumor-associated antigen CLDN on their surface. Radiolabeled Antibody In Cancer Therapy”, in Monoclonal 0212. The term “immune effector functions” in the con Antibodies For Cancer Detection And Therapy, Baldwin et al. text of the present invention includes any functions mediated (eds.), pp. 303-16 (Academic Press 1985), and Thorpe et al., by components of the immune system that result e.g. in the “The Preparation And Cytotoxic Properties Of Antibody inhibition of tumor growth and/or inhibition of tumor devel Toxin Conjugates. Immunol. Rev., 62: 119-58 (1982). opment, including inhibition of tumor dissemination and 0216. The term “binding according to the invention pref metastasis. Preferably, immune effector functions result in erably relates to a specific binding. killing of tumor cells. Such functions comprise complement 0217. According to the present invention, an agent such as dependent cytotoxicity (CDC), antibody-dependent cell-me an antibody is capable of binding to a predetermined target if diated cytotoxicity (ADCC), antibody-dependent cell-medi it has a significant affinity for said predetermined target and ated phagocytosis (ADCP), induction of apoptosis in the cells binds to said predetermined target in standard assays. "Affin carrying the tumor-associated antigen, cytolysis of the cells ity” or “binding affinity” is often measured by equilibrium carrying the tumor-associated antigen, and/or inhibition of dissociation constant (K). Preferably, the term “significant proliferation of the cells carrying the tumor-associated anti affinity” refers to the binding to a predetermined target with a gen. Binding agents may also exert an effect simply by bind dissociation constant (Ki) of 10 M or lower, 10 M or ing to tumor-associated antigens on the Surface of a cancer lower, 107M or lower, 10 M or lower, 10 M or lower, cell. For example, antibodies may block the function of the 10' Mor lower, 10' M or lower, or 10'’M or lower. tumor-associated antigen or induce apoptosis just by binding 0218. An agent is not (substantially) capable of binding to to the tumor-associated antigen on the Surface of a cancer cell. a target if it has no significant affinity for said target and does 0213. The binding agents described herein may be conju not bind significantly, in particular does not bind detectably, gated to a therapeutic moiety or agent, such as a cytotoxin, a to said target in standard assays. Preferably, the agent does not drug (e.g., an immunosuppressant) or a radioisotope. A cyto detectably bind to said target if present in a concentration of toxin or cytotoxic agent includes any agent that is detrimental up to 2, preferably 10, more preferably 20, in particular 50 or to and, in particular, kills cells. Examples include taxol. 100 ug/ml or higher. Preferably, an agent has no significant cytochalasin B, gramicidin D, ethidium bromide, emetine, affinity for a target if it binds to said target with a K that is at mitomycin, etoposide, tenoposide, Vincristine, vinblastine, least 10-fold, 100-fold, 10-fold, 10-fold, 10-fold, or 10° colchicin, doxorubicin, daunorubicin, dihydroxy anthracin fold higher than the K, for binding to the predetermined US 2016/0272711 A1 Sep. 22, 2016 20 target to which the agent is capable of binding. For example, ranged immunoglobulin (antibody) gene locus can be if the K for binding of an agent to the target to which the identified by comparison to germline DNA; a rearranged agent is capable of binding is 107M, the K for binding to a locus will have at least one recombined heptamer/nonamer target for which the agent has no significant affinity would be homology element. at least 10 M, 10 M, 10 M, 10 M, 10 M, or 10 M. 0225. The term “unrearranged’ or “germline configura 0219. An agent such as an antibody is specific for a pre tion” as used herein in reference to a V segment refers to the determined target if it is capable of binding to said predeter configuration wherein the V segment is not recombined so as mined target while it is not capable of binding to other targets, to be immediately adjacent to a D or J segment. i.e. has no significant affinity for other targets and does not significantly bind to other targets in standard assays. Accord 0226. In one embodiment, a binding agent of the invention ing to the invention, an agent is specific for CLDN if it is has the ability of binding to CLDN18.2, i.e. the ability of capable of binding to CLDN but is not (substantially) capable binding to an epitope present in CLDN18.2, preferably an of binding to other targets. Preferably, an agent is specific for epitope located within the extracellular domains of CLDN18. CLDN if the affinity for and the binding to such other targets 2, in particular the first extracellular loop, preferably amino does not significantly exceed the affinity for or binding to acid positions 29 to 78 of CLDN18.2. In particular embodi CLDN-unrelated proteins such as bovine serum albumin ments, an agent having the ability of binding to CLDN18.2 (BSA), casein, human serum albumin (HSA) or non-claudin binds to an epitope on CLDN18.2 which is not present on transmembrane proteins such as MHC molecules or transfer CLDN18.1. rin receptor or any other specified polypeptide. Preferably, an 0227. An agent having the ability of binding to CLDN18.2 agent is specific for a predetermined target if it binds to said preferably binds to CLDN18.2 but not to CLDN18.1. Prefer target with a K, that is at least 10-fold, 100-fold, 10-fold, ably, an agent having the ability of binding to CLDN18.2 is 10-fold, 10-fold, or 10-fold lower than the K, for binding specific for CLDN18.2. Preferably, an agent having the abil to a target for which it is not specific. For example, if the K, ity of binding to CLDN18.2 binds to CLDN18.2 expressed on for binding of an agent to the target for which it is specific is the cell surface. In particular preferred embodiments, an 107 M, the K for binding to a target for which it is not agent having the ability of binding to CLDN18.2 binds to specific would be at least 10 M, 10 M, 10 M, 10 M, native epitopes of CLDN18.2 present on the surface of living 10 M, or 10 M. cells. 0220 Binding of an agent to a target can be determined 0228. In a preferred embodiment, an agent having the experimentally using any suitable method; see, for example, ability of binding to CLDN18.2 comprises a heavy chain Berzofsky et al., “Antibody-Antigen Interactions' In Funda variable region (VH) comprising an amino acid sequence mental Immunology, Paul, W. E., Ed., Raven Press New York, selected from the group consisting of SEQID NOs: 5, 6, 7, 8, NY (1984), Kuby, Janis Immunology, W. H. Freeman and 9, 10, and a fragment thereof. Company New York, NY (1992), and methods described 0229. In a preferred embodiment, an agent having the herein. Affinities may be readily determined using conven ability of binding to CLDN18.2 comprises a light chain vari tional techniques, such as by equilibrium dialysis; by using able region (VL) comprising anamino acid sequence selected the BIAcore 2000 instrument, using general procedures out from the group consisting of SEQID NOs: 11, 12, 13, 14, 15, lined by the manufacturer, by radioimmunoassay using radio 16, 17, 18, 19, and a fragment thereof. labeled target antigen; or by another method known to the skilled artisan. The affinity data may be analyzed, for 0230. In certain preferred embodiments, an agent having example, by the method of Scatchard et al., Ann N.Y. Acad. the ability of binding to CLDN18.2 comprises a combination ScL, 51:660 (1949). The measured affinity of a particular of heavy chain variable region (VH) and light chain variable antibody-antigen interaction can vary if measured under dif region (VL) selected from the following possibilities (i) to ferent conditions, e.g., Salt concentration, pH. Thus, measure (ix): ments of affinity and other antigen-binding parameters, e.g., (i) the VH comprises an amino acid sequence represented by K, ICs, are preferably made with standardized solutions of SEQID NO: 5 or a fragment thereof and the VL comprises an antibody and antigen, and a standardized buffer. amino acid sequence represented by SEQ ID NO: 12 or a 0221. As used herein, “isotype” refers to the antibody fragment thereof, class (e.g., IgM or IgG1) that is encoded by heavy chain (ii) the VH comprises an amino acid sequence represented by constant region genes. SEQID NO: 6 or a fragment thereof and the VL comprises an 0222. As used herein, “isotype switching refers to the amino acid sequence represented by SEQ ID NO: 11 or a phenomenon by which the class, or isotype, of an antibody fragment thereof, changes from one Ig class to one of the other Ig classes. (iii) the VH comprises an amino acid sequence represented by 0223) The term “naturally occurring as used herein as applied to an object refers to the fact that an object can be SEQID NO: 7 or a fragment thereof and the VL comprises an found in nature. For example, a polypeptide or polynucleotide amino acid sequence represented by SEQ ID NO: 13 or a sequence that is present in an organism (including viruses) fragment thereof, that can be isolated from a source in nature and which has not (iv) the VH comprises an amino acid sequence represented by been intentionally modified by man in the laboratory is natu SEQID NO:9 or a fragment thereof and the VL comprises an rally occurring. amino acid sequence represented by SEQ ID NO: 16 or a 0224. The term “rearranged as used herein refers to a fragment thereof, configuration of a heavy chain or light chain immunoglobulin (v) the VH comprises an amino acid sequence represented by locus wherein a V segment is positioned immediately adja SEQID NO: 8 or a fragment thereof and the VL comprises an cent to a D-J or J segment in a conformation encoding essen amino acid sequence represented by SEQ ID NO: 15 or a tially a complete VH or VL domain, respectively. A rear fragment thereof, US 2016/0272711 A1 Sep. 22, 2016

(vi) the VH comprises an amino acid sequence represented by 0236. In one embodiment, a binding agent of the invention SEQID NO: 10 or a fragment thereof and the VL comprises has the ability of binding to CLDN6, i.e. the ability of binding an amino acid sequence represented by SEQID NO: 14 or a to an epitope present in CLDN6, preferably an epitope fragment thereof, located within the extracellular domains of CLDN6, in par (vii) the VH comprises an amino acid sequence represented ticular the first extracellular loop, preferably amino acid posi by SEQ ID NO: 10 or a fragment thereof and the VL com tions 28 to 76 of CLDN6 or the second extracellular loop, prises an amino acid sequence represented by SEQID NO: 17 preferably amino acid positions 141 to 159 of CLDN6. In or a fragment thereof, particular embodiments, an agent having the ability of bind (viii) the VH comprises an amino acid sequence represented ing to CLDN6 binds to an epitope on CLDN6 which is not by SEQ ID NO: 10 or a fragment thereof and the VL com present on CLDN9. Preferably, an agent having the ability of prises an amino acid sequence represented by SEQID NO: 18 binding to CLDN6 binds to an epitope on CLDN6 which is or a fragment thereof, not present on CLDN4 and/or CLDN3. Most preferably, an (ix) the VH comprises an amino acid sequence represented by agent having the ability of binding to CLDN6 binds to an SEQID NO: 10 or a fragment thereof and the VL comprises epitope on CLDN6 which is not present on a CLDN protein an amino acid sequence represented by SEQID NO: 19 or a other than CLDN6. fragment thereof. 0237. An agent having the ability of binding to CLDN6 0231. In a particularly preferred embodiment, an agent preferably binds to CLDN6 but not to CLDN9 and preferably having the ability of binding to CLDN18.2 comprises the does not bind to CLDN4 and/or CLDN3. Preferably, an agent following combination of heavy chain variable region (VH) having the ability of binding to CLDN6 is specific for and light chain variable region (VL): CLDN6. Preferably, an agent having the ability of binding to the VH comprises an amino acid sequence represented by CLDN6 binds to CLDN6 expressed on the cell surface. In SEQID NO: 8 or a fragment thereof and the VL comprises an particular preferred embodiments, an agent having the ability amino acid sequence represented by SEQ ID NO: 15 or a of binding to CLDN6 binds to native epitopes of CLDN6 fragment thereof. present on the Surface of living cells. 0232. In a further particularly preferred embodiment, an 0238. In a preferred embodiment, an agent having the agent having the ability of binding to CLDN18.2 comprises ability of binding to CLDN6 comprises a heavy chain vari the following combination of heavy chain variable region able region (VH) comprising an amino acid sequence (VH) and light chain variable region (VL): selected from the group consisting of SEQID NOS: 20, 22. the VH comprises an amino acid sequence represented by 24, 26, and a fragment thereof. SEQID NO: 6 or a fragment thereof and the VL comprises an 0239. In a preferred embodiment, an agent having the amino acid sequence represented by SEQ ID NO: 11 or a ability of binding to CLDN6 comprises a light chain variable fragment thereof. region (VL) comprising an amino acid sequence selected 0233. The term “fragment” refers, in particular, to one or from the group consisting of SEQID NOS: 21, 23, 25, 27, 28. more of the complementarity-determining regions (CDRs), 29, 97,98,99, 100, and a fragment thereof. preferably at least the CDR3 variable region, of the heavy 0240. In certain preferred embodiments, an agent having chain variable region (VH) and/or of the light chain variable the ability of binding to CLDN6 comprises a combination of region (VL). In one embodiment said one or more of the heavy chain variable region (VH) and light chain variable complementarity-determining regions (CDRs) are selected region (VL) selected from the following possibilities (i) to from a set of complementarity-determining regions CDR1. (xi): CDR2 and CDR3. In a particularly preferred embodiment, (i) the VH comprises an amino acid sequence represented by the term “fragment” refers to the complementarity-determin SEQID NO: 20 or a fragment thereof and the VL comprises ing regions CDR1, CDR2 and CDR3 of the heavy chain an amino acid sequence represented by SEQID NO: 21 or a variable region (VH) and/or of the light chain variable region fragment thereof, (VL). (ii) the VH comprises an amino acid sequence represented by 0234. In one embodiment a binding agent comprising one SEQID NO: 22 or a fragment thereof and the VL comprises or more CDRs, a set of CDRs or a combination of sets of an amino acid sequence represented by SEQID NO: 23 or a CDRs as described herein comprises said CDRs together with their intervening framework regions. Preferably, the portion fragment thereof, will also include at least about 50% of either or both of the first (iii) the VH comprises an amino acid sequence represented by and fourth framework regions, the 50% being the C-terminal SEQID NO: 24 or a fragment thereof and the VL comprises 50% of the first framework region and the N-terminal 50% of an amino acid sequence represented by SEQID NO: 25 or a the fourth framework region. Construction of binding agents fragment thereof, made by recombinant DNA techniques may result in the (iv) the VH comprises an amino acid sequence represented by introduction of residues N- or C-terminal to the variable SEQID NO: 26 or a fragment thereof and the VL comprises regions encoded by linkers introduced to facilitate cloning or an amino acid sequence represented by SEQID NO: 27 or a other manipulation steps, including the introduction of link fragment thereof, ers to join variable regions of the invention to further protein (v) the VH comprises an amino acid sequence represented by sequences including immunoglobulin heavy chains, other SEQID NO: 22 or a fragment thereof and the VL comprises variable domains (for example in the production of diabodies) an amino acid sequence represented by SEQID NO: 21 or a or protein labels. fragment thereof, 0235. In one embodiment a binding agent comprising one (vi) the VH comprises an amino acid sequence represented by or more CDRs, a set of CDRs or a combination of sets of SEQID NO: 22 or a fragment thereof and the VL comprises CDRs as described herein comprises said CDRs in a human an amino acid sequence represented by SEQID NO: 28 or a antibody framework. fragment thereof, US 2016/0272711 A1 Sep. 22, 2016 22

(vii) the VH comprises an amino acid sequence represented region (VL). In one embodiment said one or more of the by SEQ ID NO: 22 or a fragment thereof and the VL com complementarity-determining regions (CDRs) are selected prises an amino acid sequence represented by SEQID NO: 29 from a set of complementarity-determining regions CDR1. or a fragment thereof, CDR2 and CDR3. In a particularly preferred embodiment, (viii) the VH comprises an amino acid sequence represented the term “fragment” refers to the complementarity-determin by SEQ ID NO: 22 or a fragment thereof and the VL com ing regions CDR1, CDR2 and CDR3 of the heavy chain prises an amino acid sequence represented by SEQID NO: 97 variable region (VH) and/or of the light chain variable region or a fragment thereof, (VL). (ix) the VH comprises an amino acid sequence represented by 0247. In one embodiment a binding agent comprising one SEQID NO: 22 or a fragment thereof and the VL comprises or more CDRs, a set of CDRs or a combination of sets of an amino acid sequence represented by SEQID NO: 98 or a CDRs as described herein comprises said CDRs together with fragment thereof, their intervening framework regions. Preferably, the portion (X) the VH comprises an amino acid sequence represented by will also include at least about 50% of either or both of the first SEQID NO: 22 or a fragment thereof and the VL comprises and fourth framework regions, the 50% being the C-terminal an amino acid sequence represented by SEQID NO: 99 or a 50% of the first framework region and the N-terminal 50% of fragment thereof, the fourth framework region. Construction of binding agents (xi) the VH comprises an amino acid sequence represented by made by recombinant DNA techniques may result in the SEQID NO: 22 or a fragment thereof and the VL comprises introduction of residues N- or C-terminal to the variable an amino acid sequence represented by SEQID NO: 100 or a regions encoded by linkers introduced to facilitate cloning or fragment thereof. other manipulation steps, including the introduction of link 0241. In a particularly preferred embodiment, an agent ers to join variable regions of the invention to further protein having the ability of binding to CLDN6 comprises the fol sequences including immunoglobulin heavy chains, other lowing combination of heavy chain variable region (VH) and variable domains (for example in the production of diabodies) light chain variable region (VL): or protein labels. the VH comprises an amino acid sequence represented by 0248. In one embodiment a binding agent comprising one SEQID NO: 22 or a fragment thereof and the VL comprises or more CDRs, a set of CDRs or a combination of sets of an amino acid sequence represented by SEQID NO: 23 or a CDRs as described herein comprises said CDRs in a human fragment thereof. antibody framework. 0242. In a further particularly preferred embodiment, an 0249 Anti-CD3 antibodies which are useful for providing agent having the ability of binding to CLDN6 comprises the binding agents according to the invention include but are not following combination of heavy chain variable region (VH) limited to UCHT1-HS (humanized mAB), UCHT1-MM and light chain variable region (VL): (murine mAB), CLB-T3, TR66, 145-2C11. the VH comprises an amino acid sequence represented by 0250. UCHT1 is a monoclonal IgG1 anti-CD3 mono SEQID NO: 22 or a fragment thereof and the VL comprises clonal antibody which detects CD3 in human and primate an amino acid sequence represented by SEQID NO: 97 or a sample types. CLB-T3 is a mouse monoclonal anti-CD3 anti fragment thereof. body which is directed against the CD3 antigen and reacts 0243 In a further particularly preferred embodiment, an with 80-90% human peripheral T lymphocytes and medullary agent having the ability of binding to CLDN6 comprises the thymocytes. TR66 is a mouse IgG1 monoclonal anti-CD3 following combination of heavy chain variable region (VH) antibody which recognizes the epsilon-chain of human CD3. and light chain variable region (VL): 145-2C11 is an armenian hamster monoclonal anti-mouse the VH comprises an amino acid sequence represented by CD3 antibody. SEQID NO: 22 or a fragment thereof and the VL comprises (0251 Preferably, the VH and VL regions of the CD3 an amino acid sequence represented by SEQID NO: 98 or a binding domain are derived from antibodies/antibody mol fragment thereof. ecules and antibody-like molecules which are capable of 0244. In a further particularly preferred embodiment, an specifically recognizing the human CD3 in the context of agent having the ability of binding to CLDN6 comprises the other TCR subunits as present on activated primary human T following combination of heavy chain variable region (VH) cells expressing the TCR in its native configuration. The VH and light chain variable region (VL): and VL regions derived from an antibody specific for the the VH comprises an amino acid sequence represented by CD3-epsilon chain are most preferred and said (parental) SEQID NO: 22 or a fragment thereof and the VL comprises antibodies should be capable of specifically binding epitopes an amino acid sequence represented by SEQID NO: 99 or a reflecting the native or near-native structure or a conforma fragment thereof. tional epitope of human CD3 presented in the context of the 0245. In a further particularly preferred embodiment, an TCR complex. In a preferred embodiment of the invention, agent having the ability of binding to CLDN6 comprises the the VH and VL regions of the CD3-binding domain are following combination of heavy chain variable region (VH) derived from a CD3 specific antibody selected from the group and light chain variable region (VL): consisting of UCHT1-HS, UCHT1-MM, CLB-T3 and TR66, the VH comprises an amino acid sequence represented by preferably TR66. SEQID NO: 22 or a fragment thereof and the VL comprises 0252. In a preferred embodiment, an agent having the an amino acid sequence represented by SEQID NO: 100 or a ability of binding to CD3 comprises a heavy chain variable fragment thereof. region (VH) comprising an amino acid sequence selected 0246 The term “fragment” refers, in particular, to one or from the group consisting of SEQID NOs: 30, 32, 34, 36,94, more of the complementarity-determining regions (CDRs), 95, and a fragment thereof. preferably at least the CDR3 variable region, of the heavy 0253) In a preferred embodiment, an agent having the chain variable region (VH) and/or of the light chain variable ability of binding to CD3 comprises a light chain variable US 2016/0272711 A1 Sep. 22, 2016 region (VL) comprising an amino acid sequence selected the VH comprises an amino acid sequence represented by from the group consisting of SEQID NOs: 31, 33,35,37.96, SEQID NO: 95 or a fragment thereof and the VL comprises and a fragment thereof. an amino acid sequence represented by SEQID NO: 96 or a 0254. In certain preferred embodiments, an agent having fragment thereof. the ability of binding to CD3 comprises a combination of 0258. The term “fragment” refers, in particular, to one or heavy chain variable region (VH) and light chain variable more of the complementarity-determining regions (CDRs), region (VL) selected from the following possibilities (i) to preferably at least the CDR3 variable region, of the heavy (ix): chain variable region (VH) and/or of the light chain variable (i) the VH comprises an amino acid sequence represented by region (VL). In one embodiment said one or more of the SEQID NO:30 or a fragment thereof and the VL comprises complementarity-determining regions (CDRs) are selected an amino acid sequence represented by SEQID NO:31 or a from a set of complementarity-determining regions CDR1. fragment thereof, CDR2 and CDR3. In a particularly preferred embodiment, (ii) the VH comprises an amino acid sequence represented by the term “fragment” refers to the complementarity-determin SEQID NO:32 or a fragment thereof and the VL comprises ing regions CDR1, CDR2 and CDR3 of the heavy chain an amino acid sequence represented by SEQID NO:33 or a variable region (VH) and/or of the light chain variable region fragment thereof, (VL). (iii) the VH comprises an amino acid sequence represented by 0259. In one embodiment a binding agent comprising one SEQID NO:34 or a fragment thereof and the VL comprises or more CDRs, a set of CDRs or a combination of sets of an amino acid sequence represented by SEQID NO:34 or a CDRs as described herein comprises said CDRs together with fragment thereof, their intervening framework regions. Preferably, the portion (iv) the VH comprises an amino acid sequence represented by will also include at least about 50% of either or both of the first SEQID NO:36 or a fragment thereof and the VL comprises and fourth framework regions, the 50% being the C-terminal an amino acid sequence represented by SEQID NO:37 or a 50% of the first framework region and the N-terminal 50% of fragment thereof, the fourth framework region. Construction of binding agents (v) the VH comprises an amino acid sequence represented by made by recombinant DNA techniques may result in the SEQID NO: 94 or a fragment thereof and the VL comprises introduction of residues N- or C-terminal to the variable an amino acid sequence represented by SEQID NO:37 or a regions encoded by linkers introduced to facilitate cloning or fragment thereof, other manipulation steps, including the introduction of link (vi) the VH comprises an amino acid sequence represented by ers to join variable regions of the invention to further protein SEQID NO: 95 or a fragment thereof and the VL comprises sequences including immunoglobulin heavy chains, other an amino acid sequence represented by SEQID NO:37 or a variable domains (for example in the production of diabodies) fragment thereof, or protein labels. (vii) the VH comprises an amino acid sequence represented 0260. In one embodiment a binding agent comprising one by SEQ ID NO:36 or a fragment thereof and the VL com or more CDRs, a set of CDRs or a combination of sets of prises an amino acid sequence represented by SEQID NO: 96 CDRs as described herein comprises said CDRs in a human or a fragment thereof, antibody framework. (viii) the VH comprises an amino acid sequence represented 0261 According to the invention, a preferred binding by SEQ ID NO: 94 or a fragment thereof and the VL com agent targeting CLDN18.2 comprises an amino acid prises an amino acid sequence represented by SEQID NO: 96 sequence selected from the group consisting of SEQID NOs: or a fragment thereof, 38, 39, 40 and 41 or a variant thereof. (ix) the VH comprises an amino acid sequence represented by 0262 According to the invention, a further preferred bind SEQID NO: 95 or a fragment thereof and the VL comprises ing agent targeting CLDN18.2 comprises an amino acid an amino acid sequence represented by SEQID NO: 96 or a sequence selected from the group consisting of SEQID NOs: fragment thereof. 103,66, 67, 68, 69,70, 71, 72,73, 74, 75, 76, 77,78, 79, 80, 0255. In a particularly preferred embodiment, an agent 81, 82, 83, 84, 85, 86, 87, 88, 89, 90,91, 92 and 93 or a having the ability of binding to CD3 comprises the following fragment or variant thereof. In one embodiment, said amino combination of heavy chain variable region (VH) and light acid sequence lacks secretion signals such as N-terminal chain variable region (VL): secretion signals, in particular the sequence according to SEQ the VH comprises an amino acid sequence represented by ID NO: 51 and/or lacks His-tags such as C-terminal His-tags, SEQID NO:36 or a fragment thereof and the VL comprises in particular the sequence Gly-Gly-Ser-(His) or (His), if an amino acid sequence represented by SEQID NO:37 or a present. fragment thereof. 0263. According to the invention, a preferred binding 0256 In a further particularly preferred embodiment, an agent targeting CLDN6 comprises an amino acid sequence agent having the ability of binding to CD3 comprises the selected from the group consisting of SEQID NOs: 42, 43,44 following combination of heavy chain variable region (VH) and 45 or a variant thereof. and light chain variable region (VL): 0264. According to the invention, a further preferred bind the VH comprises an amino acid sequence represented by ing agent targeting CLDN6 comprises an amino acid SEQID NO: 94 or a fragment thereof and the VL comprises sequence selected from the group consisting of SEQID NOs: an amino acid sequence represented by SEQID NO:37 or a 101, 102, 60, 61, 62, 63, 64 and 65 or a fragment or variant fragment thereof. thereof. In one embodiment said amino acid sequence lacks 0257. In a further particularly preferred embodiment, an secretion signals such as N-terminal Secretion signals, in par agent having the ability of binding to CD3 comprises the ticular the sequence according to SEQID NO: 51 and/or lacks following combination of heavy chain variable region (VH) His-tags such as C-terminal His-tags, in particular the and light chain variable region (VL): sequence Gly-Gly-Ser-(His) or (His), if present. US 2016/0272711 A1 Sep. 22, 2016 24

0265. It is to be understood that the binding agents stitution and/or alteration of one or more nucleotides. Such described herein may be delivered to a patient by administer alterations can include addition of non-nucleotide material, ing a nucleic acid such as RNA encoding the agent and/or by such as to the end(s) of a RNA or internally, for example at administering a host cell comprising a nucleic acid such as one or more nucleotides of the RNA. Nucleotides in RNA RNA encoding the agent. Thus, a nucleic acid encoding a molecules can also comprise non-standard nucleotides, such binding agent when administered to a patient may be present as non-naturally occurring nucleotides or chemically synthe in naked form or in a suitable delivery vehicle such as in the sized nucleotides or deoxynucleotides. These altered RNAs form of liposomes or viral particles, or within a host cell. The can be referred to as analogs or analogs of naturally-occurring nucleic acid provided can produce the agent over extended RNA time periods in a Sustained manner mitigating the instability 0271 According to the present invention, the term “RNA at least partially observed for therapeutic antibodies, in par includes and preferably relates to “mRNA which means ticular bispecific antibodies. Nucleic acids to be delivered to “messenger RNA and relates to a “transcript which may be a patient can be produced by recombinant means. If a nucleic produced using DNA as template and encodes a peptide or acid is administered to a patient without being present within protein. mRNA typically comprises a 5' nontranslated region a host cell, it is preferably taken up by cells of the patient for (5'-UTR), a protein or peptide coding region and a 3' non expression of the binding agent encoded by the nucleic acid. translated region (3'-UTR). mRNA has a limited halftime in If a nucleic acid is administered to a patient while being cells and in vitro. Preferably, mRNA is produced by in vitro present within a host cell, it is preferably expressed by the transcription using a DNA template. In one embodiment of host cell within the patient so as to produce the binding agent the invention, the RNA is obtained by in vitro transcription or encoded by the nucleic acid. chemical synthesis. The in vitro transcription methodology is 0266 The term “recombinant in the context of the known to the skilled person. For example, there is a variety of present invention means “made through genetic engineer in vitro transcription kits commercially available. ing'. Preferably, a “recombinant object such as a recombi 0272. In one embodiment of the present invention, RNA is nant nucleic acid in the context of the present invention is not self-replicating RNA. Such as single stranded self-replicating occurring naturally. RNA. In one embodiment, the self-replicating RNA is single 0267. The term “naturally occurring as used herein refers stranded RNA of positive sense. In one embodiment, the to the fact that an object can be found in nature. For example, self-replicating RNA is viral RNA or RNA derived from viral a peptide or nucleic acid that is present in an organism (in RNA. In one embodiment, the self-replicating RNA is cluding viruses) and can be isolated from a source in nature alphaviral genomic RNA or is derived from alphaviral and which has not been intentionally modified by man in the genomic RNA. In one embodiment, the self-replicating RNA laboratory is naturally occurring. is a viral gene expression vector. In one embodiment, the 0268. The term “nucleic acid', as used herein, is intended virus is Semliki forest virus. In one embodiment, the self to include DNA and RNA such as genomic DNA, cDNA, replicating RNA contains one or more transgenes at least one mRNA, recombinantly produced and chemically synthesized of said transgenes encoding the binding agent described molecules. A nucleic acid may be single-stranded or double herein. In one embodiment, if the RNA is viral RNA or stranded. RNA includes in vitro transcribed RNA (IVT RNA) derived from viral RNA, the transgenes may partially or com or synthetic RNA. pletely replace viral sequences such as viral sequences encod 0269 Nucleic acids may be comprised in a vector. The ing structural proteins. In one embodiment, the self-replicat term “vector” as used herein includes any vectors known to ing RNA is in vitro transcribed RNA. the skilled person including plasmid vectors, cosmid vectors, 0273. The genome of alphaviruses is single stranded RNA phage vectors such as lambda phage, viral vectors such as of positive sense (SSRNA(+)) that encodes two open reading adenoviral or baculoviral vectors, or artificial chromosome frames (ORF) for large polyproteins. The ORF at the 5'-end of vectors such as bacterial artificial chromosomes (BAC), yeast the genome encodes the non-structural proteins nSP1 to nSP4 artificial chromosomes (YAC), or P1 artificial chromosomes (nsP1-4), which are translated and processed to an RNA (PAC). Said vectors include expression as well as cloning dependent RNA-polymerase (replicase); the ORF at the vectors. Expression vectors comprise plasmids as well as 3'-end encodes the structural proteins—capsid and glycopro viral vectors and generally contain a desired coding sequence teins. Both ORFs are separated by the so called subgenomic and appropriate DNA sequences necessary for the expression promoter (SGP), which governs the transcription of the struc of the operably linked coding sequence in a particular host tural ORF. When exploited as gene vectors, the structural organism (e.g., bacteria, yeast, plant, insect, or mammal) or in proteins behind the SGP are commonly replaced by trans in vitro expression systems. Cloning vectors are generally genes. In order to package Such vectors into viral particles, the used to engineer and amplify a certain desired DNA fragment structural proteins are commonly expressed in trans from and may lack functional sequences needed for expression of helper constructs. Alphaviruses replicate in the cytoplasm of the desired DNA fragments. infected cells exclusively at the RNA level. After infection, 0270. In the context of the present invention, the term the ssRNA(+) genome acts as mRNA for the translation of the “RNA relates to a molecule which comprises ribonucleotide nsP1234 poly-protein precursor which is at early stages of the residues and preferably being entirely or Substantially com viral life cycle autoproteolytically processed to the fragments posed of ribonucleotide residues. “Ribonucleotide' relates to nsP123 and nsP4. Fragments nsP123 and nsP4 form the a nucleotide with a hydroxyl group at the 2'-position of a (-)strand replicase complex that transcribes (-)stranded B-D-ribofuranosyl group. The term includes double stranded RNA from the genomic RNA template. At later stages, the RNA, single stranded RNA, isolated RNA such as partially nsP1234 polyprotein is completely cleaved to the single pro purified RNA, essentially pure RNA, synthetic RNA, recom teins which assemble to the (+)Strand replicase complex that binantly produced RNA, as well as modified RNA that differs synthesizes new (+)Stranded genomes, as well as Subgenomic from naturally occurring RNA by the addition, deletion, sub transcripts that code the structural proteins or transgenes. US 2016/0272711 A1 Sep. 22, 2016

Subgenomic RNA as well as new genomic RNA is capped post-transcriptionally using capping enzymes, for example, and poly-adenylated and thus recognized as mRNA after capping enzymes of vaccinia virus. target cells infection. Only new genomic RNA contains a 0280. The RNA may comprise further modifications. For packaging signal which ensures exclusive packaging of example, a further modification of the RNA used in the genomic RNA into budding virions. The attractiveness of present invention may be an extension or truncation of the alphaviral replicons for vectorology is based on the positive naturally occurring poly(A)tail or an alteration of the 5'- or orientation of the capped and poly-adenylated RNA genome. 3'-untranslated regions (UTR) such as introduction of a UTR Translatable replicon RNA can easily be synthesized in vitro, which is not related to the coding region of said RNA, for whereby capping may beachieved with cap-analoga added to example, the insertion of one or more, preferably two copies the in vitro transcription reaction and poly-A tails may be of a 3'-UTR derived from a globin gene, such as alpha2 encoded as poly-T tracks on the plasmid templates. In vitro globin, alpha1-globin, beta-globin, preferably beta-globin, transcribed (IVT) replicons are transfected by conventional more preferably human beta-globin. transfection techniques and even low amounts of starting IVT 0281. Therefore, in order to increase stability and/or RNA are multiplied rapidly. Within a few hours after transfer, expression of the RNA used according to the present inven transgenes which are placed downstream of the SGP are tion, it may be modified so as to be present in conjunction with transcribed to very high copy numbers of about 40.000 to a poly-A sequence, preferably having a length of 10 to 500, 200.000 copies of subgenomic RNA per cell, thus it is not more preferably 30 to 300, even more preferably 65 to 200 Surprising that recombinant proteins are strongly expressed. and especially 100 to 150 adenosine residues. In an especially Dependent on the specific aim, IVT replicons may be trans preferred embodiment the poly-A sequence has a length of fected directly into target cells, or packaged into alphaviral approximately 120 adenosine residues. In addition, incorpo particles with helper vectors that provide structural genes in ration of two or more 3'-nontranslated regions (UTR) into the trans. Transfer into the skin or muscles leads to high and 3'-non translated region of an RNA molecule can result in an Sustained local expression, paralleled by a strong induction of enhancement in translation efficiency. In one particular humoral and cellular immune response embodiment the 3'-UTR is derived from the human B-globin 0274. In order to increase expression and/or stability of the gene. RNA used according to the present invention, it may be modi (0282 Preferably, RNA ifdelivered to, i.e. transfected into, fied, preferably without altering the sequence of the a cell, in particular a cell present in Vivo, expresses the pro expressed peptide or protein. tein, peptide or antigen it encodes. 0275. The term “modification' in the context of RNA as 0283. The term “transfection relates to the introduction used according to the present invention includes any modifi of nucleic acids, in particular RNA, into a cell. For purposes cation of RNA which is not naturally present in said RNA. of the present invention, the term “transfection' also includes 0276. In one embodiment of the invention, the RNA used the introduction of a nucleic acid into a cell or the uptake of a according to the invention does not have uncapped 5'-triph nucleic acid by such cell, wherein the cell may be present in osphates. Removal of such uncapped 5'-triphosphates can be a subject, e.g., a patient. Thus, according to the present inven achieved by treating RNA with a phosphatase. tion, a cell for transfection of a nucleic acid described herein can be present in vitro or in vivo, e.g. the cell can form part of 0277. The RNA according to the invention may have an organ, a tissue and/or an organism of a patient. According modified naturally occurring or synthetic ribonucleotides in to the invention, transfection can be transient or stable. For order to increase its stability and/or decrease cytotoxicity. For Some applications of transfection, it is sufficient if the trans example, in one embodiment, in the RNA used according to fected genetic material is only transiently expressed. Since the invention 5-methylcytidine is substituted partially or the nucleic acid introduced in the transfection process is completely, preferably completely, for cytidine. Alternatively usually not integrated into the nuclear genome, the foreign or additionally, in one embodiment, in the RNA used accord nucleic acid will be diluted through mitosis or degraded. Cells ing to the invention pseudouridine is Substituted partially or allowing episomal amplification of nucleic acids greatly completely, preferably completely, for uridine. reduce the rate of dilution. If it is desired that the transfected 0278. In one embodiment, the term “modification” relates nucleic acid actually remains in the genome of the cell and its to providing an RNA with a 5'-cap or 5'-cap analog. The term daughter cells, a stable transfection must occur. RNA can be “5'-cap’ refers to a cap structure found on the 5'-end of an transfected into cells to transiently express its coded protein. mRNA molecule and generally consists of a guanosine nucle (0284. The term “stability” of RNA relates to the “half-life” otide connected to the mRNA via an unusual 5' to 5' triphos of RNA. “Half-life” relates to the period of time which is phate linkage. In one embodiment, this guanosine is methy needed to eliminate half of the activity, amount, or number of lated at the 7-position. The term “conventional 5'-cap' refers molecules. In the context of the present invention, the half-life to a naturally occurring RNA 5'-cap, preferably to the 7-me of an RNA is indicative for the stability of said RNA. The thylguanosine cap (m7G). In the context of the present inven half-life of RNA may influence the “duration of expression tion, the term “5'-cap' includes a 5'-cap analog that resembles of the RNA. It can be expected that RNA having a long the RNA cap structure and is modified to possess the ability to half-life will be expressed for an extended time period. stabilize RNA if attached thereto, preferably in vivo and/or in 0285. In the context of the present invention, the term a cell. “transcription relates to a process, wherein the genetic code 0279 Providing an RNA with a 5'-cap or 5'-cap analog in a DNA sequence is transcribed into RNA. Subsequently, may be achieved by in vitro transcription of a DNA template the RNA may be translated into protein. According to the in the presence of said 5'-cap or 5'-cap analog, wherein said present invention, the term “transcription' comprises “in 5'-cap is co-transcriptionally incorporated into the generated vitro transcription', wherein the term “in vitro transcription RNA strand, or the RNA may be generated, for example, by in relates to a process wherein RNA, in particular mRNA, is in vitro transcription, and the 5'-cap may be attached to the RNA vitro synthesized in a cell-free system, preferably using US 2016/0272711 A1 Sep. 22, 2016 26 appropriate cell extracts. Preferably, cloning vectors are geous because they overcome the immunological barrier applied for the generation of transcripts. These cloning vec which otherwise results in rejection. tors are generally designated as transcription vectors and are 0293. The term “allogeneic' is used to describe anything according to the present invention encompassed by the term that is derived from different individuals of the same species. “vector'. Two or more individuals are said to be allogeneic to one 0286 . The term “translation” according to the invention another when the genes at one or more loci are not identical. relates to the process in the ribosomes of a cell by which a 0294 The term 'syngeneic' is used to describe anything Strand of messenger RNA directs the assembly of a sequence that is derived from individuals or tissues having identical of amino acids to make a peptide or protein. genotypes, i.e., identical twins or animals of the same inbred 0287. The term “expression' is used according to the strain, or their tissues. invention in its most general meaning and comprises the 0295 The term "heterologous is used to describe some production of RNA and/or peptides or proteins, e.g. by tran thing consisting of multiple different elements. As an scription and/or translation. With respect to RNA, the term example, the transfer of one individual’s bone marrow into a “expression” or “translation” relates in particular to the pro different individual constitutes a heterologous transplant. A duction of peptides or proteins. It also comprises partial heterologous gene is a gene derived from a source other than expression of nucleic acids. Moreover, expression can be the subject. transient or stable. According to the invention, the term 0296. The term "peptide' according to the invention com expression also includes an “aberrant expression” or 'abnor prises oligo- and polypeptides and refers to Substances com mal expression'. prising two or more, preferably 3 or more, preferably 4 or 0288 “Aberrant expression” or "abnormal expression' more, preferably 6 or more, preferably 8 or more, preferably means according to the invention that expression is altered, 9 or more, preferably 10 or more, preferably 13 or more, preferably increased, compared to a reference, e.g. a state in preferably 16 more, preferably 21 or more and up to prefer a Subject not having a disease associated with aberrant or ably 8, 10, 20, 30, 40 or 50, in particular 100 amino acids abnormal expression of a certain protein, e.g., a tumor anti joined covalently by peptide bonds. The term “protein refers gen. An increase in expression refers to an increase by at least to large peptides, preferably to peptides with more than 100 10%, in particular at least 20%, at least 50% or at least 100%, amino acid residues, but in general the terms "peptides' and or more. In one embodiment, expression is only found in a “proteins are synonyms and are used interchangeably diseased tissue, while expression in a healthy tissue is herein. repressed. 0297. The teaching given herein with respect to specific 0289. The term “specifically expressed’ means that a pro amino acid sequences, e.g. those shown in the sequence list tein is essentially only expressed in a specific tissue or organ. ing, is to be construed so as to also relate to variants of said For example, a tumor antigen specifically expressed in gastric specific sequences resulting in sequences which are function mucosa means that said protein is primarily expressed in ally equivalent to said specific sequences, e.g. amino acid gastric mucosa and is not expressed in other tissues or is not sequences exhibiting properties identical or similar to those expressed to a significant extentin other tissue or organ types. of the specific amino acid sequences. One important property Thus, a protein that is exclusively expressed in cells of the is to retain binding to a target or to Sustain effector functions. gastric mucosa and to a significantly lesser extent in any other 0298 Preferably, a sequence which is a variant with tissue. Such as testis, is specifically expressed in cells of the respect to a specific sequence, when it replaces the specific gastric mucosa. In some embodiments, a tumor antigen may sequence in an antibody retains binding of said antibody to also be specifically expressed under normal conditions in CLDN and/or CD3 and preferably functions of said antibody more than one tissue type or organ, such as in 2 or 3 tissue as described herein, e.g. CDC mediated lysis or ADCC medi types or organs, but preferably in not more than 3 different ated lysis. tissue or organ types. In this case, the tumor antigen is then 0299 For example, the sequences shown in the sequence specifically expressed in these organs. For example, ifa tumor listing can be modified so as to remove one or more, prefer antigen is expressed under normal conditions preferably to an ably all free cysteine residues, in particular by replacing the approximately equal extent in lung and stomach, said tumor cysteine residues by amino acids other than cysteine, prefer antigen is specifically expressed in lung and stomach. ably serine, alanine, threonine, glycine, tyrosine, leucine or methionine, most preferably alanine or serine. For example, 0290 According to the invention, the term "RNA encod the cysteine at position 103 of the sequence shown in SEQID ing' means that RNA, if present in the appropriate environ NO:36 of the sequence listing or the corresponding cysteine ment, preferably within a cell, can be expressed to produce a in a sequence comprising said sequence may be modified in protein or peptide it encodes. this way. Further cysteines which can be modified this way 0291 Some aspects of the invention rely on the adoptive are the cysteines at position 178 of SEQID NO: 42, at posi transfer of host cells which are transfected in vitro with a tion 197 of SEQID NO:43, at position 427 of SEQID NO:44 nucleic acid such as RNA encoding a binding agent described or at position 446 of SEQID NO: 45. herein and transferred to recipients such as patients, prefer 0300. It will be appreciated by those skilled in the art that ably after ex vivo expansion from low precursor frequencies in particular the sequences of the CDR, hypervariable and to clinically relevant cell numbers. The host cells used for variable regions can be modified without losing the ability to treatment according to the invention may be autologous, allo bind CLDN and/or CD3. For example, CDR regions will be geneic, or Syngeneic to a treated recipient. either identical or highly homologous to the regions of anti 0292. The term “autologous is used to describe anything bodies specified herein. By “highly homologous' it is con that is derived from the same subject. For example, “autolo templated that from 1 to 5, preferably from 1 to 4, such as 1 to gous transplant” refers to a transplant of tissue or organs 3 or 1 or 2 substitutions may be made in the CDRs. In addi derived from the same Subject. Such procedures are advanta tion, the hypervariable and variable regions may be modified US 2016/0272711 A1 Sep. 22, 2016 27 so that they show Substantial homology with the regions of for example, using Align, using standard settings, preferably antibodies specifically disclosed herein. EMBOSS::needle, Matrix: Blosum62, Gap Open 10.0, Gap 0301 For the purposes of the present invention, “variants' Extend 0.5. of an amino acid sequence comprise amino acid insertion 0307 “Sequence similarity indicates the percentage of variants, amino acid addition variants, amino acid deletion amino acids that either are identical or that represent conser variants and/or amino acid substitution variants. Amino acid vative amino acid substitutions. “Sequence identity” between deletion variants that comprise the deletion at the N-terminal two amino acid sequences indicates the percentage of amino and/or C-terminal end of the protein are also called N-termi acids that are identical between the sequences. nal and/or C-terminal truncation variants. 0308 The term “percentage identity” is intended to denote 0302 Amino acid insertion variants comprise insertions a percentage of amino acid residues which are identical of single or two or more amino acids in aparticular amino acid between the two sequences to be compared, obtained after the sequence. In the case of amino acid sequence variants having best alignment, this percentage being purely statistical and an insertion, one or more amino acid residues are inserted into the differences between the two sequences being distributed a particular site in an amino acid sequence, although random randomly and over their entire length. Sequence comparisons insertion with appropriate Screening of the resulting product between two amino acid sequences are conventionally carried is also possible. out by comparing these sequences after having aligned them 0303 Amino acid addition variants comprise amino- and/ optimally, said comparison being carried out by segment or or carboxy-terminal fusions of one or more amino acids. Such by “window of comparison” in order to identify and compare as 1, 2, 3, 5, 10, 20, 30, 50, or more amino acids. local regions of sequence similarity. The optimal alignment 0304 Amino acid deletion variants are characterized by of the sequences for comparison may be produced, besides the removal of one or more amino acids from the sequence, manually, by means of the local homology algorithm of Smith such as by removal of 1, 2, 3, 5, 10, 20, 30, 50, or more amino and Waterman, 1981, Ads App. Math. 2, 482, by means of the acids. The deletions may be in any position of the protein. local homology algorithm of Neddleman and Wunsch, 1970, 0305 Amino acid substitution variants are characterized J. Mol. Biol. 48, 443, by means of the similarity search by at least one residue in the sequence being removed and method of Pearson and Lipman, 1988, Proc. Natl Acad. Sci. another residue being inserted in its place. Preference is given USA 85,2444, or by means of computer programs which use to the modifications being in positions in the amino acid these algorithms (GAP, BESTFIT. FASTA, BLAST P. sequence which are not conserved between homologous pro BLAST N and TFASTA in Wisconsin Genetics Software teins or peptides and/or to replacing amino acids with other Package, Genetics Computer Group, 575 Science Drive, ones having similar properties. Preferably, amino acid Madison, Wis.). changes in protein variants are conservative amino acid 0309 The percentage identity is calculated by determin changes, i.e., Substitutions of similarly charged or uncharged ing the number of identical positions between the two amino acids. A conservative amino acid change involves Sub sequences being compared, dividing this number by the num stitution of one of a family of amino acids which are related in ber of positions compared and multiplying the result obtained their side chains. Naturally occurring amino acids are gener by 100 so as to obtain the percentage identity between these ally divided into four families: acidic (aspartate, glutamate), two sequences. basic (lysine, arginine, histidine), non-polar (alanine, Valine, 0310. The binding agents of the invention can be produced leucine, isoleucine, proline, phenylalanine, methionine, tryp either intracellularly (e.g. in the cytosol, in the periplasma or tophan), and uncharged polar (glycine, asparagine, in inclusion bodies) and then isolated from the host cells and glutamine, cysteine, serine, threonine, tyrosine) amino acids. optionally further purified; or they can be produced extracel Phenylalanine, tryptophan, and tyrosine are sometimes clas lularly (e.g. in the medium in which the host cells are cul sified jointly as aromatic amino acids. tured) and then isolated from the culture medium and option 0306 Preferably the degree of similarity, preferably iden ally further purified. Methods and reagents used for the tity between a given amino acid sequence and an amino acid recombinant production of polypeptides. Such as specific sequence which is a variant of said given amino acid sequence Suitable expression vectors, transformation or transfection will be at least about 60%, 65%, 70%, 80%, 81%, 82%, 83%, methods, selection markers, methods of induction of protein 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, expression, culture conditions, and the like, are known in the 94%. 95%, 96%,97%.98%, or 99%. The degree of similarity art. Similarly, protein isolation and purification techniques or identity is given preferably for an amino acid region which are well known to the skilled person. is at least about 10%, at least about 20%, at least about 30%, 0311. The term “cell' or “host cell” preferably relates to an at least about 40%, at least about 50%, at least about 60%, at intact cell, i.e. a cell with an intact membrane that has not least about 70%, at least about 80%, at least about 90% or released its normal intracellular components such as about 100% of the entire length of the reference amino acid enzymes, organelles, or genetic material. An intact cell pref sequence. For example, if the reference amino acid sequence erably is a viable cell, i.e. a living cell capable of carrying out consists of 200 amino acids, the degree of similarity or iden its normal metabolic functions. Preferably said term relates tity is given preferably for at least about 20, at least about 40, according to the invention to any cell which can be transfected at least about 60, at least about 80, at least about 100, at least with an exogenous nucleic acid. Preferably, the cell when about 120, at least about 140, at least about 160, at least about transfected with an exogenous nucleic acid and transferred to 180, or about 200 amino acids, preferably continuous amino a recipient can express the nucleic acid in the recipient. The acids. In preferred embodiments, the degree of similarity or term “cell includes bacterial cells; other useful cells are yeast identity is given for the entire length of the reference amino cells, fungal cells or mammalian cells. Suitable bacterial cells acid sequence. The alignment for determining sequence simi include cells from gram-negative bacterial strains such as larity, preferably sequence identity can be done with art strains of Escherichia coli, Proteus, and Pseudomonas, and known tools, preferably using the best sequence alignment, gram-positive bacterial strains such as strains of Bacillus, US 2016/0272711 A1 Sep. 22, 2016 28

Streptomyces, Staphylococcus, and Lactococcus. Suitable Cl). Preferably these uncloaked Cld binding sites convert the fungal cell include cells from species of Trichoderma, Neu previously low-affinity Cld-IgG interaction to one of high rospora, and Aspergillus. Suitable yeast cells include cells avidity, which triggers a cascade of events involving a series from species of Saccharomyces (For example Saccharomyces of other complement proteins and leads to the proteolytic cerevisiae), Schizosaccharomyces (for example Schizo sac release of the effector-cell chemotactic/activating agents C3a charomyces pombe), Pichia (for example Pichia pastoris and and C5a. Preferably, the complement cascade ends in the Pichia methanolicd), and Hansenula. Suitable mammalian formation of a membrane attack complex, which creates cells include for example CHO cells, BHK cells, HeLa cells, pores in the cell membrane that facilitate free passage of COS cells, 293 HEK and the like. However, amphibian cells, water and solutes into and out of the cell. insect cells, plant cells, and any other cells used in the art for 0317 Antibodies described herein for e.g. providing VL the expression of heterologous proteins can be used as well. and VH regions can be produced by a variety of techniques, Mammalian cells are particularly preferred for adoptive including conventional monoclonal antibody methodology, transfer, Such as cells from humans, mice, hamsters, pigs, e.g., the standard Somatic cell hybridization technique of goats, and primates. The cells may be derived from a large Kohler and Milstein, Nature 256: 495 (1975). Although number of tissue types and include primary cells and cell lines Somatic cell hybridization procedures are preferred, in prin Such as cells of the immune system, in particular antigen ciple, other techniques for producing monoclonal antibodies presenting cells such as dendritic cells and T cells, stem cells can be employed, e.g., viral or oncogenic transformation of Such as hematopoietic stem cells and mesenchymal stem cells B-lymphocytes or phage display techniques using libraries of and other cell types. An antigen-presenting cell is a cell that antibody genes. displays antigen in the context of major histocompatibility 0318. The preferred animal system for preparing hybrido complex on its Surface. T cells may recognize this complex mas that secrete monoclonal antibodies is the murine system. using their T cell receptor (TCR). Hybridoma production in the mouse is a very well established 0312 “Reduce”, “decrease' or “inhibit as used herein procedure. Immunization protocols and techniques for isola means an overall decrease or the ability to cause an overall tion of immunized splenocytes for fusion are known in the art. decrease, preferably of 5% or greater, 10% or greater, 20% or Fusion partners (e.g., murine myeloma cells) and fusion pro greater, more preferably of 50% or greater, and most prefer cedures are also known. ably of 75% or greater, in the level, e.g. in the level of expres 0319. Other preferred animal systems for preparing hybri sion or in the level of proliferation of cells. domas that secrete monoclonal antibodies are the rat and the 0313 Terms such as “increase” or "enhance' preferably rabbit system (e.g. described in Spieker-Polet et al., Proc. relate to an increase or enhancement by about at least 10%, Natl. Acad. Sci. U.S.A. 92:9348 (1995), see also Rossi et al., preferably at least 20%, preferably at least 30%, more pref Am. J. Clin. Pathol. 124; 295 (2005)). erably at least 40%, more preferably at least 50%, even more 0320 In yet another preferred embodiment, human mono preferably at least 80%, and most preferably at least 100%, at clonal antibodies can be generated using transgenic or tran least 200%, at least 500%, at least 1000%, at least 10000% or Schromosomal mice carrying parts of the human immune CW. O. system rather than the mouse system. These transgenic and transchromosomic mice include mice known as HuMAb Antibody-Dependent Cell-Mediated Cytotoxicity mice and KM mice, respectively, and are collectively referred 0314 ADCC describes the cell-killing ability of effector to herein as “transgenic mice. The production of human cells as described herein, in particular lymphocytes, which antibodies in Such transgenic mice can be performed as preferably requires the target cell being marked by an anti described in detail for CD20 in WO2004 0356O7 body. 0321. Yet another strategy for generating monoclonal anti 0315 ADCC preferably occurs when antibodies bind to bodies is to directly isolate genes encoding antibodies from antigens on tumor cells and the antibody Fc domains engage lymphocytes producing antibodies of defined specificity e.g. Fc receptors (FcR) on the surface of immune effector cells. see Babcock et al., 1996; A novel strategy for generating Several families of Fc receptors have been identified, and monoclonal antibodies from single, isolated lymphocytes specific cell populations characteristically express defined Fc producing antibodies of defined specificities. For details of receptors. ADCC can be viewed as a mechanism to directly recombinant antibody engineering See also Welschof and induce a variable degree of immediate tumor destruction that Kraus, Recombinant antibodies for cancer therapy ISBN-0- leads to antigen presentation and the induction of tumor 89603-918-8 and Benny K. C. Lo Antibody Engineering directed T-cell responses. Preferably, in vivo induction of ISBN 1-58829-092-1. ADCC will lead to tumor-directed T-cell responses and host 0322 To generate antibodies, mice can be immunized derived antibody responses. with carrier-conjugated peptides derived from the antigen sequence, i.e. the sequence against which the antibodies are to be directed, an enriched preparation of recombinantly Complement-Dependent Cytotoxicity expressed antigen or fragments thereof and/or cells express 0316 CDC is another cell-killing method that can be ing the antigen, as described. Alternatively, mice can be directed by antibodies. IgM is the most effective isotype for immunized with DNA encoding the antigen or fragments complement activation. IgG1 and IgG3 are also both very thereof. In the event that immunizations using a purified or effective at directing CDC via the classical complement enriched preparation of the antigen do not resultinantibodies, activation pathway. Preferably, in this cascade, the formation mice can also be immunized with cells expressing the anti of antigen-antibody complexes results in the uncloaking of gen, e.g., a cell line, to promote immune responses. multiple Cld binding sites in close proximity on the C2 0323. The immune response can be monitored over the domains of participating antibody molecules Such as IgG course of the immunization protocol with plasma and serum molecules (Cld is one of three Subcomponents of complement samples being obtained by tail vein or retro.orbital bleeds. US 2016/0272711 A1 Sep. 22, 2016 29

Mice with sufficient titers of immunoglobulin can be used for constant region of human heavy and light chain (e.g. as fusions. Mice can be boosted intraperitonealy or intrave described by Kraus et al., in Methods in Molecular Biology nously with antigen expressing cells 3 days before sacrifice series, Recombinant antibodies for cancer therapy ISBN-0- and removal of the spleen to increase the rate of specific 89603-918-8). In a preferred embodiment chimeric antibod antibody secreting hybridomas. ies are generated by joining human kappa-light chain con 0324. To generate hybridomas producing monoclonal stant region to murine light chain variable region. In an also antibodies, splenocytes and lymph node cells from immu preferred embodiment chimeric antibodies can be generated nized mice can be isolated and fused to an appropriate immor by joining human lambda-light chain constant region to talized cell line. Such as a mouse myeloma cell line. The murine light chain variable region. The preferred heavy chain resulting hybridomas can then be screened for the production constant regions for generation of chimeric antibodies are of antigen-specific antibodies. Individual wells can then be IgG1, IgG3 and IgG4. Other preferred heavy chain constant screened by ELISA for antibody secreting hybridomas. By regions for generation of chimeric antibodies are IgG2, IgA, Immunofluorescence and FACS analysis using antigen Ig) and IgM. expressing cells, antibodies with specificity for the antigen can be identified. The antibody secreting hybridomas can be Humanization replated, screened again, and if still positive for monoclonal 0329 Antibodies interact with target antigens predomi antibodies can be subcloned by limiting dilution. The stable nantly through amino acid residues that are located in the six Subclones can then be cultured in vitro to generate antibody in heavy and light chain complementarity determining regions tissue culture medium for characterization. (CDRs). For this reason, the amino acid sequences within 0325 Antibodies also can be produced in a host cell trans CDRs are more diverse between individual antibodies than fectoma using, for example, a combination of recombinant sequences outside of CDRs. Because CDR sequences are DNA techniques and gene transfection methods as are well responsible for most antibody-antigen interactions, it is pos known in the art (Morrison, S. (1985) Science 229: 1202). sible to express recombinant antibodies that mimic the prop 0326 For example, in one embodiment, the gene(s) of erties of specific naturally occurring antibodies by construct interest, e.g., antibody genes, can be ligated into an expres ing expression vectors that include CDR sequences from the sion vector Such as a eukaryotic expression plasmid such as specific naturally occurring antibody grafted onto framework used by the GS gene expression system disclosed in WO sequences from a different antibody with different properties 87/04462, WO 89/01036 and EP338841 or other expression (see, e.g., Riechmann, L. et al. (1998) Nature 332: 323-327; systems well known in the art. The purified plasmid with the Jones, P. etal. (1986) Nature 321:522-525; and Queen, C. et cloned antibody genes can be introduced in eukaryotic host al. (1989) Proc. Natl. Acad. Sci. U.S.A. 86: 10029-10033). cells such as CHO cells, NS/O cells, HEK293T cells or Such framework sequences can be obtained from public DNA HEK293 cells or alternatively other eukaryotic cells like plant databases that include germline antibody gene sequences. derived cells, fungal or yeast cells. The method used to intro These germline sequences will differ from mature antibody duce these genes can be methods described in the art such as gene sequences because they will not include completely electroporation, lipofectine, lipofectamine or others. After assembled variable genes, which are formed by V (D)Jjoin introduction of these antibody genes in the host cells, cells ing during B cell maturation. Germline gene sequences will expressing the antibody can be identified and selected. These also differ from the sequences of a high affinity secondary cells represent the transfectomas which can then be amplified repertoire antibody at individual evenly across the variable for their expression level and upscaled to produce antibodies. region. Recombinant antibodies can be isolated and purified from 0330. The ability of antibodies and other binding agents to these culture Supernatants and/or cells. bind an antigen can be determined using standard binding 0327. Alternatively, the cloned antibody genes can be assays (e.g., ELISA, Western Blot, Immunofluorescence and expressed in other expression systems, including prokaryotic flow cytometric analysis). cells. Such as microorganisms, e.g. E. coli. Furthermore, the 0331. To purify antibodies, selected producer cell lines antibodies can be produced in transgenic non-human ani can be grown in two-liter spinner-flasks for recombinant anti mals, such as in milk from sheep and rabbits or in eggs from body purification. Alternatively, antibodies can be produced hens, or in transgenic plants; see e.g. Verma, R., et al. (1998) in dialysis based bioreactors. Supernatants can be filtered J. Immunol. Meth. 216: 165-181; Pollock, et al. (1999) J. and, if necessary, concentrated before affinity chromatogra Immunol. Meth. 231: 147-157; and Fischer, R., et al. (1999) phy with protein L-sepharose. Eluted IgG can be checked by Biol. Chem. 380: 825-839. gel electrophoresis and high performance liquid chromatog raphy to ensure purity. The buffer Solution can be exchanged Chimerization into PBS, and the concentration can be determined by OD280 0328 Nonlabeled murine antibodies are highly immuno using the respective extinction coefficient. The recombinant genic in man when repetitively applied leading to reduction of antibodies can be aliquoted and stored at -80° C. the therapeutic effect. The main immunogenicity is mediated 0332. In order to demonstrate binding of monoclonal anti by the heavy chain constant regions. The immunogenicity of bodies to living cells expressing antigen, flow cytometry can murine antibodies in man can be reduced or completely be used. Cell lines expressing naturally or after transfection avoided if respective antibodies are chimerized or human antigen and negative controls lacking antigen expression ized. Chimeric antibodies are antibodies, the different por (grown understandard growth conditions) can be mixed with tions of which are derived from different animal species, such various concentrations of monoclonal antibodies in hybri as those having a variable region derived from a murine doma Supernatants or in PBS containing 1% FBS, and can be antibody and a human immunoglobulin constant region. Chi incubated at 4° C. for 30 min. After washing, the APC- or merisation of antibodies is achieved by joining of the variable Alexa647-labeled anti IgG antibody can bind to antigen regions of the murine antibody heavy and light chain with the bound monoclonal antibody under the same conditions as the US 2016/0272711 A1 Sep. 22, 2016 30 primary antibody staining. The samples can be analyzed by binding agents to prevent formation of tumors or tumor flow cytometry with a FACS instrument using light and side related symptoms. Binding agents can be administered to scatter properties to gate on single, living cells. In order to tumor-bearing mice to determine the therapeutic efficacy of distinguish antigen-specific monoclonal antibodies from respective binding agents to reduce tumor growth, metastasis non-specific binders in a single measurement, the method of ortumor related symptoms. Application of binding agents can co-transfection can be employed. Cells transiently trans be combined with application of other Substances as cysto fected with plasmids encoding antigen and a fluorescent static drugs, growth factor inhibitors, cell cycle blockers, marker can be stained as described above. Transfected cells angiogenesis inhibitors orantibodies to determine synergistic can be detected in a different fluorescence channel than anti efficacy and potential toxicity of combinations. To analyze body-stained cells. As the majority of transfected cells toxic side effects mediated by binding agents animals can be express both transgenes, antigen-specific monoclonal anti inoculated with binding agents or control reagents and thor bodies bind preferentially to fluorescence marker expressing oughly investigated for symptoms possibly related to CLDN cells, whereas non-specific antibodies bind in a comparable binding agent therapy. ratio to non-transfected cells. An alternative assay using fluo 0338 Mapping of epitopes recognized by binding agents rescence microscopy may be used in addition to or instead of can be performed as described in detail in "Epitope Mapping the flow cytometry assay. Cells can be stained exactly as Protocols (Methods in Molecular Biology) by Glenn E. Mor described above and examined by fluorescence microscopy. ris ISBN-089603-375-9 and in “Epitope Mapping: A Practi 0333. In order to demonstrate binding of monoclonal anti cal Approach Practical Approach Series, 248 by Olwyn M. bodies to living cells expressing antigen, immunofluores R. Westwood, Frank C. Hay. cence microscopy analysis can be used. For example, cell 0339. The compounds and agents described herein may be lines expressing either spontaneously or after transfection administered in the form of any Suitable pharmaceutical com antigen and negative controls lacking antigen expression are position. grown in chamber slides understandard growth conditions in DMEM/F 12 medium, supplemented with 10% fetal calf 0340. The pharmaceutical compositions of the invention serum (FCS), 2 mM L-glutamine, 100 IU/ml penicillin and are preferably sterile and contain an effective amount of the 100 g/ml streptomycin. Cells can then be fixed with metha binding agents described herein and optionally of further nol or paraformaldehyde or left untreated. Cells can then be agents as discussed herein to generate the desired reaction or reacted with monoclonal antibodies against the antigen for 30 the desired effect. min. at 25°C. After washing, cells can be reacted with an 0341 Pharmaceutical compositions are usually provided Alexa555-labelled anti-mouse IgG secondary antibody (Mo in a uniform dosage form and may be prepared in a manner lecular Probes) under the same conditions. Cells can then be known perse. A pharmaceutical composition may e.g. be in examined by fluorescence microscopy. the form of a solution or Suspension. 0334 Cell extracts from cells expressing antigen and 0342 A pharmaceutical composition may comprise salts, appropriate negative controls can be prepared and Subjected buffer Substances, preservatives, carriers, diluents and/or to sodium dodecyl sulfate (SDS) polyacrylamide gel electro excipients all of which are preferably pharmaceutically phoresis. After electrophoresis, the separated antigens will be acceptable. The term “pharmaceutically acceptable” refers to transferred to nitrocellulose membranes, blocked, and probed the non-toxicity of a material which does not interact with the with the monoclonal antibodies to be tested. IgG binding can action of the active component of the pharmaceutical com be detected using anti-mouse IgG peroxidase and developed position. with ECL substrate. 0343 Salts which are not pharmaceutically acceptable 0335 Antibodies can be further tested for reactivity with may be used for preparing pharmaceutically acceptable salts antigen by Immunohistochemistry in a manner well known to and are included in the invention. Pharmaceutically accept the skilled person, e.g. using paraformaldehyde or acetone able salts of this kind comprise in a non limiting way those fixed cryosections or paraffin embedded tissue sections fixed prepared from the following acids: hydrochloric, hydrobro with paraformaldehyde from non-cancer tissue or cancertis mic, Sulfuric, nitric, phosphoric, maleic, acetic, Salicylic, cit Sue Samples obtained from patients during routine Surgical ric, formic, malonic, Succinic acids, and the like. Pharmaceu procedures or from mice carrying Xenografted tumors inocu tically acceptable salts may also be prepared as alkali metal lated with cell lines expressing spontaneously or after trans salts or alkaline earth metal salts. Such as Sodium salts, potas fection antigen. For immunostaining, antibodies reactive to sium salts or calcium salts. antigen can be incubated followed by horseradish-peroxidase 0344 Suitable buffer substances for use in a pharmaceu conjugated goat anti-mouse or goat anti-rabbit antibodies tical composition include acetic acid in a salt, citric acid in a (DAKO) according to the vendors instructions. salt, boric acid in a salt and phosphoric acid in a salt. 0345 Suitable preservatives for use in a pharmaceutical Preclinical Studies composition include benzalkonium chloride, chlorobutanol, 0336 Binding agents described herein also can be tested paraben and thimerosal. in an in vivo model (e.g. in immune deficient mice carrying 0346. An injectible formulation may comprise a pharma Xenografted tumors inoculated with cell lines expressing ceutically acceptable excipient such as Ringer Lactate. CLDN to determine their efficacy in controlling growth of 0347 The term “carrier refers to an organic or inorganic CLDN-expressing tumor cells. component, of a natural or synthetic nature, in which the 0337. In vivo studies after xenografting CLDN-expressing active component is combined in order to facilitate, enhance tumor cells into immunocompromised mice or other animals or enable application. According to the invention, the term can be performed using binding agents described herein. “carrier also includes one or more compatible solid or liquid Binding agents can be administered to tumor free mice fol fillers, diluents or encapsulating Substances, which are Suit lowed by injection of tumor cells to measure the effects of the able for administration to a patient. US 2016/0272711 A1 Sep. 22, 2016

0348 Possible carrier substances for parenteral adminis 0356. The pharmaceutical compositions and methods of tration are e.g. Sterile water, Ringer, Ringer lactate, sterile treatment described according to the invention may also be Sodium chloride solution, polyalkylene glycols, hydroge used for immunization or vaccination to prevent a disease nated naphthalenes and, in particular, biocompatible lactide described herein. polymers, lactide? glycolide copolymers or polyoxyethylene? polyoxy-propylene copolymers. 0357 The pharmaceutical composition of the invention may be administered together with Supplementing immunity 0349 The term “excipient' when used herein is intended enhancing Substances such as one or more adjuvants and may to indicate all Substances which may be present in a pharma comprise one or more immunity-enhancing Substances to ceutical composition and which are not active ingredients further increase its effectiveness, preferably to achieve a syn Such as, e.g., carriers, binders, lubricants, thickeners, Surface ergistic effect of immunostimulation. The term “adjuvant” active agents, preservatives, emulsifiers, buffers, flavoring relates to compounds which prolongs or enhances or accel agents, or colorants. erates an immune response. Various mechanisms are possible 0350. The agents and compositions described herein may in this respect, depending on the various types of adjuvants. be administered via any conventional route, such as by For example, compounds which allow the maturation of the parenteral administration including by injection or infusion. DC, e.g. lipopolysaccharides or CD40 ligand, form a first Administration is preferably parenterally, e.g. intravenously, class of suitable adjuvants. Generally, any agent which influ intraarterially, Subcutaneously, intradermally or intramuscu ences the immune system of the type of a "danger signal” larly. (LPS, GP96, dsRNA etc.) or cytokines, such as GM-CSF, can 0351 Compositions suitable for parenteral administration be used as an adjuvant which enables an immune response to usually comprise a sterile aqueous or nonaqueous preparation be intensified and/or influenced in a controlled manner. CpG of the active compound, which is preferably isotonic to the oligodeoxynucleotides can optionally also be used in this blood of the recipient. Examples of compatible carriers and context, although their side effects which occur under certain Solvents are Ringer Solution and isotonic sodium chloride circumstances, as explained above, are to be considered. Par Solution. In addition, usually sterile, fixed oils are used as ticularly preferred adjuvants are cytokines, such as monok Solution or Suspension medium. ines, lymphokines, interleukins or chemokines, e.g. IL-1, 0352. The agents and compositions described herein are IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, administered in effective amounts. An "effective amount INFO, INF-Y, GM-CSF, LT-C, or growth factors, e.g. hCH. refers to the amount which achieves a desired reaction or a Further known adjuvants are aluminium hydroxide, Freund's desired effect alone or together with further doses. In the case adjuvant or oil such as Montanide(R), most preferred Mon of treatment of a particular disease or of a particular condi tanide(R) ISA51. Lipopeptides, such as Pam3Cys, are also tion, the desired reaction preferably relates to inhibition of the Suitable for use as adjuvants in the pharmaceutical composi course of the disease. This comprises slowing down the tion of the present invention. progress of the disease and, in particular, interrupting or reversing the progress of the disease. The desired reaction in 0358. The agents and compositions provided herein may a treatment of a disease or of a condition may also be delay of be used alone or in combination with conventional therapeu the onset or a prevention of the onset of said disease or said tic regimens such as Surgery, irradiation, chemotherapy and/ condition. or bone marrow transplantation (autologous, Syngeneic, allo geneic or unrelated). 0353. An effective amount of an agent or composition described herein will depend on the condition to be treated, 0359 Treatment of cancer represents a field where com the severeness of the disease, the individual parameters of the bination strategies are especially desirable since frequently patient, including age, physiological condition, size and the combined action of two, three, four or even more cancer weight, the duration of treatment, the type of an accompany drugs/therapies generates Synergistic effects which are con ing therapy (if present), the specific route of administration siderably stronger than the impact of a monotherapeutic and similar factors. Accordingly, the doses administered of approach. Thus, in another embodiment of the present inven the agents described herein may depend on various of Such tion, a cancer treatment which utilizes immune- or vaccina parameters. In the case that a reaction in a patient is insuffi tion-based mechanisms such as the methods and pharmaceu cient with an initial dose, higher doses (or effectively higher tical compositions of the present invention may be effectively doses achieved by a different, more localized route of admin combined with various other drugs and/or methods targeting istration) may be used. similar or other specific mechanisms. Among those are e.g. combinations with conventional tumor therapies, multi 0354. The agents and compositions described herein can epitope strategies, additional immunotherapy, and treatment be administered to patients, e.g., in Vivo, to treat or prevent a approaches targeting angiogenesis or apoptosis (for review variety of disorders such as those described herein. Preferred see e.g. Andersen et al. 2008: Cancer treatment: the combi patients include human patients having disorders that can be nation of vaccination with other therapies. Cancer Immunol corrected or ameliorated by administering the agents and ogy Immunotherapy, 57(11): 1735-1743.) Sequential admin compositions described herein. This includes disorders istration of different agents may inhibit cancer cell growth at involving cells characterized by an altered expression pattern different check points, while other agents may e.g. inhibit of CLDN Such as CLDN18.2 and/or CLDN6. neo-angiogenesis, Survival of malignant cells or metastases, 0355 For example, in one embodiment, agents described potentially converting cancer into a chronic disease. The fol herein can be used to treat a patient with a cancer disease, e.g., lowing list provides some non-limiting examples of anti a cancer disease such as described herein characterized by the cancer drugs and therapies which can be used in combination presence of cancer cells expressing CLDN. with the present invention: US 2016/0272711 A1 Sep. 22, 2016 32

1. Chemotherapy present invention are e.g. fractionation (radiation therapy delivered in a fractionated regime, e.g. daily fractions of 1.5 to 0360 Chemotherapy is the standard of care for multiple 3Gy given over several weeks), 3D conformal radiotherapy types of cancer. The most common chemotherapy agents act (3DCRT, delivering radiation to the gross tumor volume), by killing cells that divide rapidly, one of the main properties intensity modulated radiation therapy (IMRT computer-con of cancer cells. Thus, a combination with conventional che motherapeutic drugs such as e.g. alkylating agents, antime trolled intensity modulation of multiple radiation beams), tabolites, anthracyclines, plant alkaloids, topoisomerase image guided radiotherapy (IGRT, a technique comprising inhibitors, and other antitumour agents which either affect pre-radiotherapy imaging which allows for correction), and cell division or DNA synthesis may significantly improve the stereotactic body radiation therapy (SRBT, delivers very high therapeutic effects of the present invention by clearing Sup individual doses of radiation over only a few treatment frac pressor cells, reboot of the immune system, by rendering tions). For a radiation therapy review see Baskar et al. 2012: tumor cells more Susceptible to immune mediated killing, or Cancer and radiation therapy: current advances and future by additional activation of cells of the immune system. A directions. Int. J MedSci. 9(3): 193-199. synergistic anti-cancer action of chemotherapeutic and vac cination-based immunotherapeutic drugs has been demon 4. Antibodies strated in multiple studies (see e.g. Quoix et al. 2011: Thera 0363 Antibodies (preferably monoclonal antibodies) peutic vaccination with TG4010 and first-line chemotherapy achieve their therapeutic effect against cancer cells through in advanced non-Small-cell lung cancer: a controlled phase various mechanisms. They can have direct effects in produc 2B trial. Lancet Oncol. 12(12): 1125-33; see also Liseth et al. ing apoptosis or programmed cell death. They can block 2010: Combination of intensive chemotherapy and antican components of signal transduction pathways such as e.g. cer vaccines in the treatment of human malignancies: the growth factor receptors, effectively arresting proliferation of hematological experience. J Biomed Biotechnol. 2010: tumor cells. In cells that express monoclonal antibodies, they 6920979; see also Hirooka et al 2009: A combination therapy can bring about anti-idiotype antibody formation. Indirect of gemcitabine with immunotherapy for patients with inop effects include recruiting cells that have cytotoxicity, Such as erable locally advanced pancreatic cancer. Pancreas 38(3): monocytes and macrophages. This type of antibody-mediated e69-74). There are hundreds of chemotherapeutic drugs avail cell kill is called antibody-dependent cell mediated cytotox able which are basically suitable for combination therapies. icity (ADCC). Antibodies also bind complement, leading to Some (non-limiting) examples of chemotherapeutic drugs direct cell toxicity, known as complement dependent cytotox which can be combined with the present invention are carbo icity (CDC). Combining surgical methods with immuno platin (Paraplatin), cisplatin (Platinol, Platinol-AQ), cyclo therapeutic drugs or methods is an Successful approach, as phosphamide (Cytoxan, Neosar), docetaxel (Taxotere), e.g. demonstrated in Gadri et al. 2009: Synergistic effect of doxorubicin (Adriamycin), erlotinib (Tarceva), etoposide dendritic cell vaccination and anti-CD20 antibody treatment (VePesid), fluorouracil (5-FU), gemcitabine (Gemzar), ima in the therapy of murine lymphoma. J Immunother. 32(4): tinib mesylate (Gleevec), irinotecan (Camptosar), methotrex 333-40. The following list provides some non-limiting ate (Folex, Mexate, Amethopterin), paclitaxel (Taxol, Abrax examples of anti-cancer antibodies and potential antibody ane), Sorafinib (Nexavar), Sunitinib (Sutent), topotecan targets (in brackets) which can be used in combination with (Hycamtin), Vincristine (Oncovin, Vincasar PFS), and vin the present invention: Abagovomab (CA-125), Abciximab blastine (Velban). (CD41), Adecatumumab (EpCAM), Afutuzumab (CD20), Alacizumab pegol (VEGFR2), Altumomab pentetate (CEA), 2. Surgery Amatuximab (MORAb-009), Anatumomab mafenatox 0361 Cancer surgery—an operation to remove the (TAG-72), Apolizumab (HLA-DR), Arcitumomab (CEA), tumor—remains the foundation of cancer treatment. Surgery Bavituximab (phosphatidylserine), Bectumomab (CD22), can be combined with other cancer treatments in order to Belimumab (BAFF), Bevacizumab (VEGF-A), Bivatuzumab delete any remaining tumor cells. Combining Surgical meth mertansine (CD44 v6), Blinatumomab (CD19), Brentuximab Vedotin (CD30 TNFRSF8), Cantuzumab mertansin (mucin ods with Subsequent immunotherapeutic treatment is a prom CanAg), Cantuzumab ravtansine (MUC1), Capromab pen ising approach which has been demonstrated countless times. detide (prostatic carcinoma cells), Carlumab (CNT0888), Catumaxomab (EpCAM, CD3), Cetuximab (EGFR), Citatu 3. Radiation Zumab bogatox (EpCAM), Cixutumumab (IGF-1 receptor), 0362 Radiation therapy remains an important component Claudiximab (Claudin), Clivatuzumab tetraxetan (MUC1), of cancer treatment with approximately 50% of all cancer Conatumumab (TRAIL-R2), Dacetuzumab (CD40), Dalotu patients receiving radiation therapy during their course of Zumab (insulin-like growth factor I receptor), Denosumab illness. The main goal of radiation therapy is to deprive cancer (RANKL), Detumomab (B-lymphoma cell), Drozitumab cells of their multiplication (cell division) potential. The (DR5), Ecromeximab (GD3 ganglioside), Edrecolomab (Ep types of radiation used to treat cancer are photons radiation CAM), Elotuzumab (SLAMF7), Enavatuzumab (PDL192), (X-rays and gamma rays) and particle radiations (electron, Ensituximab (NPC-1C), Epratuzumab (CD22), Ertumax proton and neutron beams.) There are two ways to deliver the omab (HER2/neu, CD3), Etaracizumab (integrin CVB3), Far radiation to the location of the cancer. External beam radia letuzumab (folate receptor 1), FBTA05 (CD20), Ficlatu tion is delivered from outside the body by aiming high-energy Zumab (SCH 900105), Figitumumab (IGF-1 receptor), rays (photons, protons or particle radiation) to the location of FlanVotumab (glycoprotein 75), Fresolimumab (TGF-B), the tumor. Internal radiation or brachytherapy is delivered Galiximab (CD80), Ganitumab (IGF-I), Gemtuzumab ozo from inside the body by radioactive sources, sealed in cath gamicin (CD33), Gevokizumab (IL-1B), Girentuximab (car eters or seeds directly into the tumor site. Radiation therapy bonic anhydrase 9 (CA-IX)), Glembatumumab vedotin (GP techniques which are applicable in combination with the NMB), Ibritumomab tiuxetan (CD20), Icrucumab (VEGFR US 2016/0272711 A1 Sep. 22, 2016

1), Igovoma (CA-125), Indatuximab ravitansine (SDC1), (TRAMP) and death receptor-6 (DR6). Especially CD40/ Intetumumab (CD51), Inotuzumab ozogamicin (CD22), CD40L and OX40/OX40L are important targets for com Ipilimumab (CD152), Iratumumab (CD30), Labetuzumab bined immunotherapy because of their direct impact on T cell (CEA), Lexatumumab (TRAIL-R2), Libivirumab (hepatitis survival and proliferation. For a review see Lechner et al. B surface antigen), Lintuzumab (CD33), Lorvotuzumab mer 2011: Chemokines, costimulatory molecules and fusion pro tansine (CD56), Lucatumumab (CD40), Lumiliximab teins for the immunotherapy of solid tumors. Immunotherapy (CD23), Mapatumumab (TRAIL-R1), Matuzumab (EGFR), 3 (11), 1317-1340. Mepolizumab (IL-5), Milatuzumab (CD74), Mitumomab (GD3 ganglioside), Mogamulizumab (CCR4), Moxetumo 6. Bacterial Treatments mab pasudotox (CD22), Nacolomab tafenatox (C242 anti gen), Naptumomab estafenatox (5T4), Narnatumab (RON), 0365 Researchers have been using anaerobic bacteria, Necitumumab (EGFR), Nimotuzumab (EGFR), Nivolumab Such as Clostridium novyi, to consume the interior of oxygen (IgG4), Ofatumumab (CD20), Olaratumab (PDGF-R C.), poor tumours. These should then die when they come in Onartuzumab (human scatter factor receptor kinase), Opor contact with the tumour's oxygenated sides, meaning they tuzumab monatox (EpCAM), Oregovomab (CA-125), would be harmless to the rest of the body. Another strategy is Oxelumab (OX-40), Panitumumab (EGFR), Patritumab to use anaerobic bacteria that have been transformed with an (HER3), Pemtumoma (MUC1), Pertuzumab (HER2/neu), enzyme that can convert a non-toxic prodrug into a toxic drug. Pintumomab (adenocarcinoma antigen), Pritumumab (vi With the proliferation of the bacteria in the necrotic and mentin), Racotumomab (N-glycolylneuraminic acid), hypoxic areas of the tumour, the enzyme is expressed solely Radretumab (fibronectin extra domain-B), Rafivirumab (ra in the tumour. Thus, a systemically applied prodrug is bies virus glycoprotein), Ramucirumab (VEGFR2), Rilotu metabolised to the toxic drug only in the tumour. This has mumab (HGF), Rituximab (CD20), Robatumumab (IGF-1 been demonstrated to be effective with the nonpathogenic receptor), Samalizumab (CD200), Sibrotuzumab (FAP), Sil anaerobe Clostridium sporogenes. tuximab (IL-6), Tabalumab (BAFF), Tacatuzumab tetraxetan (alpha-fetoprotein), Taplitumomab paptox (CD19), Tenatu 7. Kinase Inhibitors momab (tenascin C), Teprotumumab (CD221), Ticilimumab (CTLA-4), Tigatuzumab (TRAIL-R2), TNX-650 (IL-13), 0366 Another large group of potential targets for comple Tositumomab (CD20), Trastuzumab (HER2/neu), TRBS07 mentary cancer therapy comprises kinase inhibitors, because (GD2), Tremelimumab (CTLA-4), Tucotuzumab celmoleu the growth and survival of cancer cells is closely interlocked kin (EpCAM), Ublituximab (MS4A1), Urelumab (4-1BB), with the deregulation of kinase activity. To restore normal Volocliximab (integrin C.531). Votumumab (tumor antigen kinase activity and therefor reduce tumor growth a broad range of inhibitors is in used. The group of targeted kinases CTA A16.88), Zalutumumab (EGFR), Zanolimumab (CD4). comprises receptor tyrosine kinases e.g. BCR-ABL, B-Raf, 5. Cytokines, Chemokines, Costimulatory Molecules, Fusion EGFR, HER-2/ErbB2, IGF-IR, PDGFR-O, PDGFR-B, c-Kit, Proteins Flt-4, Flt3, FGFR1, FGFR3, FGFR4, CSF1R, c-Met, RON, c-Ret, ALK, cytoplasmic tyrosine kinases e.g. c-SRC, c-YES, 0364 Combined usage of the antigen-coding pharmaceu Abl, JAK-2, serine/threonine kinases e.g. ATM, Aurora A & tical compositions of the present invention with cytokines, B, CDKs, mTOR, PKCi, PLKs, b-Raf, S6K, STK11/LKB1 chemokines, costimulatory molecules and/or fusion proteins and lipid kinases e.g. PI3K. SK1. Small molecule kinase thereof to evoke beneficial immune modulation or tumor inhibitors are e.g. PHA-73.9358, Nilotinib, Dasatinib, and inhibition effects is another embodiment of the present inven PD166326, NSC 743411, Lapatinib (GW-572016), Caner tion. In order to increase the infiltration of immune cells into tinib (CI-1033), Semaxinib (SU5416), Vatalanib (PTK787/ the tumor and facilitate the movement of antigen-presenting ZK222584), Sutent (SU11248), Sorafenib (BAY 43-9006) cells to tumor-draining lymph nodes, various chemokines and Leflunomide (SU101). For more information see e.g. with C, CC, CXC and CX3C structures might be used. Some Zhang et al. 2009: Targeting cancer with small molecule of the most promising chemokines are e.g. CCR7 and its kinase inhibitors. Nature Reviews Cancer 9, 28-39. ligands CCL19 and CCL21, furthermore CCL2, CCL3, CCL5, and CCL16. Otherexamples are CXCR4, CXCR7 and 8. Toll-Like Receptors CXCL12. Furthermore, costimulatory or regulatory mol ecules such as e.g. B7 ligands (B7.1 and B7.2) are useful. Also 0367 The members of the Toll-like receptor (TLRs) fam useful are other cytokines Such as e.g. interleukins especially ily are an important link between innate and adaptive immu (e.g. IL-1 to IL 17), interferons (e.g. IFNalpha1 to IFNalpha8, nity and the effect of many adjuvants rely on the activation of IFNalpha10, IFNalpha13, IFNalpha14, IFNalpha16, IFNal TLRs. A large number of established vaccines against cancer pha17, IFNalpha21, IFNbeta1, IFNW, IFNE1 and IFNK), incorporate ligands for TLRs for boosting vaccine responses. hematopoietic factors, TGFs (e.g. TGF-C. TGF-3, and other Besides TLR2, TLR3, TLR4 especially TLR7 and TLR 8 members of the TGF family), finally members of the tumor have been examined for cancer therapy in passive immuno necrosis factor family of receptors and their ligands as well as therapy approaches. The closely related TLR7 and TLR8 other stimulatory molecules, comprising but not limited to contribute to antitumor responses by affecting immune cells, 4-1 BB, 4-1BB-L, CD137, CD137L, CTLA-4GITR, GITRL, tumor cells, and the tumor microenvironment and may be Fas, Fas-L, TNFR1, TRAIL-R1, TRAIL-R2, p75NGF-R, activated by nucleoside analogue structures. All TLRs have DR6, LT.beta.R. RANK, EDAR1, XEDAR, Fn 114, Troy/ been used as Stand-alone immunotherapeutics or cancer vac Trade, TAJ, TNFRII, HVEM, CD27, CD30, CD40, 4-1 BB, cine adjuvants and may be synergistically combined with the OX40, GITR, GITRL, TACI, BAFF-R, BCMA, RELT, and formulations and methods of the present invention. For more CD95 (Fas/APO-1), glucocorticoid-induced TNFR-related information see Van Duinet al. 2005: Triggering TLR signal protein, TNF receptor-related apoptosis-mediating protein ing in vaccination. Trends in Immunology, 27(1):49-55. US 2016/0272711 A1 Sep. 22, 2016 34

9. Angiogenesis Inhibitors viruses such as e.g. the hepatitis B virus or other virus families 0368. In addition to therapies which target immune modu including Parvoviridae (e.g. adeno-associated virus), Retro latory receptors affected by tumor-mediated escape mecha viridae (e.g. HIV), and Flaviviridae (e.g. Hepatitis C virus). nisms and immune Suppression there are therapies which For a general review see Sorensen and Thompsen 2007: target the tumor environment. Angiogenesis inhibitors pre Virus-based immunotherapy of cancer: what do we know and vent the extensive growth of blood vessels (angiogenesis) that where are we going? APMIS 115(11): 1177-93; virus-like tumors require to Survive. The angiogenesis promoted by particles against cancer are reviewed in Buonaguro et al. tumor cells to meet their increasing nutrient and oxygen 2011: Developments in virus-like particle-based vaccines for demands for example can be blocked by targeting different infectious diseases and cancer. Expert Rev Vaccines 10(11): molecules. Non-limiting examples of angiogenesis-mediat 1569-83; and in Galen et al. 2010: Virus-like particles as ing molecules orangiogenesis inhibitors which may be com vaccine antigens and adjuvants: application to chronic dis bined with the present invention are soluble VEGF (VEGF ease, cancer immunotherapy and infectious disease preven isoforms VEGF121 and VEGF165, receptors VEGFR1, tive strategies. Procedia in Vaccinology 2 (2), 128-133. VEGFR2 and co-receptors Neuropilin-1 and Neuropilin-2) 1 12. Multi-Epitope Strategies and NRP-1, angiopoietin 2, TSP-1 and TSP-2, angiostatin 0371. The use of multi epitopes shows promising results and related molecules, endostatin, vasostatin, calreticulin, for vaccination. Fast sequencing technologies combined with platelet factor-4, TIMP and CDAI, Meth-1 and Meth-2, IFN intelligent algorithms systems allow the exploitation of the C. -B and -y, CXCL10, IL-4, -12 and -18, prothrombin (krin tumor mutanome and may provide multi epitopes for indi gle domain-2), antithrombin III fragment, prolactin, VEGI. vidualized vaccines which can be combined with the present SPARC, osteopontin, maspin, can statin, proliferin-related invention. For more information see 2007: Vaccination of protein, restin and drugs like e.g. bevacizumab, itraconazole, metastatic colorectal cancer patients with matured dendritic carboxyamidotriazole, TNP-470, CM 101, IFN-C, platelet cells loaded with multiple major histocompatibility complex factor-4, Suramin, SU5416, thrombospondin, VEGFR class I peptides. J Immunother 30: 762-772; furthermore antagonists, angiostatic Steroids--heparin, cartilage-derived Castle et al. 2012: Exploiting the mutanome for tumor vacci angiogenesis Inhibitory factor, matrix metalloproteinase inhibitors, 2-methoxyestradiol, tecogalan, tetrathiomolyb nation. Cancer Res 72 (5):1081-91. date, thalidomide, thrombospondin, prolactina VB3 inhibi 13. Adoptive T Cell Transfer tors, linomide, tasquinimod, For review see Schoenfeld and 0372 For example, a combination of a tumor antigen vac Dranoff 2011: Anti-angiogenesis immunotherapy. Hum Vac cination and T cell transfer is described in: Rapoport et al. cin. (9):976-81. 2011: Combination immunotherapy using adoptive T-cell transfer and tumor antigenvaccination on the basis of hTERT 10. Small Molecule Targeted Therapy Drugs and survivin after ASCT for myeloma. Blood 117(3):788-97. 0369 Small molecule targeted therapy drugs are generally 14. Peptide-Based Target Therapies inhibitors of enzymatic domains on mutated, overexpressed, 0373) Peptides can bind to cell surface receptors or or otherwise critical proteins within the cancer cell. Promi affected extracellular matrix surrounding the tumor. Radio nent and non-limiting examples are the tyrosine kinase nuclides which are attached to these peptides (e.g. RGDs) inhibitors imatinib (Gleevec/Glivec) and gefitinib (Iressa). eventually kill the cancer cell if the nuclide decays in the The use of Small molecules e.g. Sunitinib malate and/or sor vicinity of the cell. Especially oligo- or multimers of these afenib tosylate targeting some kinases in combination with binding motifs are of great interest, since this can lead to vaccines for cancer therapy is also described in previous enhanced tumor specificity and avidity. For non-limiting patent application US2009004213. examples see Yamada 2011: Peptide-based cancer vaccine therapy for prostate cancer, bladder cancer, and malignant 11. Virus-Based Vaccines glioma. Nihon Rinsho 69(9): 1657-61. 0370. There are a number of virus-based cancer vaccines 15. Other Therapies available or under development which can be used in a com 0374. There are numerous other cancer therapies which bined therapeutic approach together with the formulations of can be combined with the formulations and methods of the the present invention. One advantage of the use of such viral present invention in order to create synergistic effects. Non vectors is their intrinsic ability to initiate immune responses, limiting examples are treatments targeting apoptosis, hyper with inflammatory reactions occurring as a result of the viral thermia, hormonal therapy, telomerase therapy, insulin poten infection creating the danger signal necessary for immune tiation therapy, gene therapy and photodynamic therapy. activation. An ideal viral vector should be safe and should not 0375. The present invention is further illustrated by the introduce an anti-vector immune response to allow for boost following examples which are not be construed as limiting the ing antitumour specific responses. Recombinant viruses Such as Vaccinia viruses, herpes simplex viruses, adenoviruses, Scope of the invention. adeno-associated viruses, retroviruses and avipox viruses EXAMPLES have been used in animal tumour models and based on their Example 1 encouraging results, human clinical trials have been initiated. Especially important virus-based vaccines are virus-like par Generation and Testing of Bispecific Binding Agents ticles (VLPs), small particles that contain certain proteins Targeting CLDN18.2 and CD3 from the outer coat of a virus. Virus-like particles do not 0376 a. Sequence Origin, Design of Bi-scFv Constructs, contain any genetic material from the virus and cannot cause and Cloning into Expression Vectors an infection but they can be constructed to present tumor 0377 Bispecific tandem single chain antibody constructs antigens on their coat. VLPs can be derived from various (bi-scFV) containing binding domains specific for the human US 2016/0272711 A1 Sep. 22, 2016

T cell receptor component CD3 and human tumor associated 0379 DNA cloning and expression vector construction antigens (TAA) were prepared. The corresponding variable was carried out according to standard procedures (Green/ heavy chain regions (V) and the corresponding variable Sambrook, Molecular Cloning, 2012) well known by the light chain regions (V) for each construct were specifically skilled person. Briefly, the leadoff bi-sch v DNA sequences arranged from N- to C-terminus in consecutive order: were provided with a 5' HindIII and a 3' XhoI restriction site (HindIII and Xbal in case of bi-scFv 1BiMAB) for cloning N-V cCAAW182 -V, cCAAW182 -V-1s-V,c3 c3re-C into expression plasmids. A secretion signal sequence was (1BiMAB, 18PHU5, no. 11-15) introduced at the 5' end upstream of the bi-scFv sequence for "ro -V, CD3.V. CLDN18.2-V, CLDN18.2-C (18PHU3, protein secretion from cellular cytoplasm into the culture no. 16-20 medium. A sequence coding for a 15 to 18 amino acid flexible glycine-serine peptide linker was inserted to join the V and 0378 Table 1 summarizes all bi-scFv constructs specific V, domains for the composition of the single chain variable for the TAA CLDN18.2 and PLAC1 that were generated in antibody fragments (scFv) of which one binds to CD3 and the the course of the invention. The bi-scFv constructs were gen other to the TAA. To form a bispecific single chain antibody, erated by gene synthesis by GeneArtAG (GeneArt/Life Tech the two scFv domain sequences were connected by a nologies GmbH, Regensburg, Germany) using the V and V. sequence coding for a short peptide linker (GGGGS). sequences of the corresponding antibodies. Codon optimiza Together with this linker sequence a BamHI restriction site tions such as Homo sapiens (HS), Mus musculus (MM), or was introduced for scFv domain exchanges for the cloning of Chinese Hamster Ovary (CHO) were implemented by Gene upcoming bi-scFV constructs. In-depth, 5'scFv-domains Arts GeneOptimizer R software, and are listed in Table 1. could be exchanged by HindIII and BamHI restriction and Information on specificity, sequence origin from monoclonal 3'scFv-domains by BamHI and XhoI restriction. For con antibodies (mAB), codon usage, additional sequence features struct schemata see also FIG. 1. and references of all applied domains are summarized in 0380 All used bi-scFv antibody constructs were cloned Table 2. Variable domain sequence origin of the respective into the standard mammalian expression vector pcDNATM3. CD3 antibodies are listed in Table 2. Due to the high homol 1/myc-His (+) (Invitrogen/Life Technologies GmbH, Darm ogy of human and mouse TAAS, the same anti-TAAV, and stadt, Germany). The C-terminal 6xHis-tag served for metal V, sequences could be used for the generation of bi-scEv affinity purification of the protein and for detection analysis. constructs for mouse assays, but in combination with the V, All constructs were verified by sequencing via MWG’s single V, sequences of the mouse specific anti-CD3 antibody clone read sequence service (Eurofins MWG Operon, Ebersberg, 145-2C11. Germany). TABLE 1. Summary of TAA and CD3 specific bispecific single chain antibody constructs Internal name TAA Specificity 5'-V-V. 3'-V-V. Codon usage 1BiMAB CLDN18.2 human mCLDN18.2ab TR66 HS no.11 CLDN18.2 murine mCLDN18.2ab 145-2C11 CHO no.12 CLDN18.2 human mCLDN18.2ab, UCHT1-HU CHO no.13 CLDN18.2 human mCLDN18.2ab UCHT1 CHO no.14 CLDN18.2 human mCLDN18.2ab CLB-T3 CHO no.15 CLDN18.2 human mCLDN18.2ab TR66 CHO no.16 CLDN18.2 murine 145-2C11 mCLDN18.2ab CHO no.17 CLDN18.2 human UCHT1-HU CLDN18.2ab CHO no.18 CLDN18.2 human UCHT1 mCLDN18.2ab CHO no.19 CLDN18.2 human CLB-T3 mCLDN18.2ab CHO no.20 CLDN18.2 human TR66 mCLDN18,2ab CHO 18PHUS CLDN18.2 human mCLDN18.2ab TR66 HS 18PHU3 CLDN18.2 human TR66 mCLDN18.2ab HS 18PMUS CLDN18.2 murine mCLDN18.2ab 145-2C11 MM 18PMU3 CLDN18.2 murine 145-2C11 mCLDN18.2ab MM control bi-scFw no.35 PLAC1 8 78H11 TR66 CHO

CHO, Chinese Hamster Ovary; HS, Homo sapiens; HU, humanized; MM, Mus

TABLE 2 Summary of bi- scFv construct information CD3 binding moiety Internal mAB Species TAA binding moiety Species Short ale origin reactivity TAA mAB origin reactivity 5'-V-V. 3'-V-W. linker

1BiMAB TR66 human CLDN18.2 mCLDN18.2ao human, mCLDN18.2ao TR66 GGGGS murine US 2016/0272711 A1 Sep 22, 2016 36

TABLE 2- Continued Summary of bi- scFv construct information no. 11 145 - 2C11 murine mCLDN18.2ao human, mCLDN18.2ao 145 - 2C11 SGGGGS murine no. 12 UCHT1-HU human mCLDN18.2ao human, mCLDN18.2ao UCHT1-HU SGGGGS murine no. 13 UCHT1 human mCLDN18.2ao human, mCLDN18.2ao UCHT1 SGGGGS murine no. 14 human mCLDN18.2ao human, mCLDN18.2ao CLB-T3 SGGGGS murine no. 15 TR66 human mCLDN18.2ao human, mCLDN18.2ao TR66 SGGGGS murine no. 16 145 - 2C11 murine mCLDN18.2ao human, 145 - 2C11 mCLDN18.2ao SGGGGS murine no. 17 UCHT1-HU la mCLDN18.2ao human, UCHT1-HU mCLDN18.2ao SGGGGS murine no. 18 UCHT1 la mCLDN18.2ao human, UCHT1 mCLDN18.2ao SGGGGS murine no. 19 la mCLDN18.2ao human, CLB-T3 mCLDN18.2ao SGGGGS murine no. 2 O TR66 la mCLDN182 alo human, TR66 mCLDN18.2ao SGGGGS murine

18PHUS TR66 la mCLDN18.2ao human, mCLDN18.2ao TR66 SGGGGS murine

18PHU3 TR66 la mCLDN18.2ao human, TR66 mCLDN18.2ao SGGGGS murine

18PMUS 145 - 2C11 murine mCLDN18.2ao human, mCLDN18.2ao 145 - 2C11 SGGGGS murine

18PMU3 145 - 2C11 murine mCLDN18.2ao human, 145 - 2C11 mCLDN18.2ao SGGGGS murine no. 35 TR66 human PLAC1 human, 78H11 TR66 SGGGGS murine

Anti-CD3 Internal 5'-long 3'-long Codon mAB ale linker linker Secretion signal usage reference 1BiMAB (GGGGS) VE (GGSGGS) GWSCIILFLWATATGWHS HS Lanzavecchia & Scheidegger, Eur J. Immunol. 1987 no. 11 (GGGGS) (GGGGS) GWSCIILFLWATATGWHS CHO Leo et al. Proc Natl Acad Sci., 1987 no. 12 (GGGGS) (GGGGS) GWSCIILFLWATATGWHS CHO Shalaby et al., J Exp Med 1992 no. 13 (GGGGS) (GGGGS) GWSCIILFLWATATGWHS CHO Beverley et al., Eur J Immunol. 1981 no. 14 (GGGGS) (GGGGS) GWSCIILFLWATATGWHS CHO Van Lier et al., Immunology 1989 no. 15 (GGGGS) (GGGGS) GWSCIILFLWATATGWHS CHO Lanzavecchia & Scheidegger, Eur J. Immunol. 1987 no. 16 (GGGGS) (GGGGS) NSGLOLVFFWLTLKGIQG CHO Leo et al. Proc Natl Acad Sci., 1987 no. 17 (GGGGS) (GGGGS) GWSCIILFLWATATGWHS CHO Shalaby et al., J Exp Med 1992 US 2016/0272711 A1 Sep. 22, 2016 37

TABLEH 2 - continued Summary of bi- scFv construct information no. 18 (GGGGS) (GGGGS) NSGLOLVF FWLTLKGIQG CHO Beverley et al., Eur J Immunol. 1981 no. 19 (GGGGS) (GGGGS) NFGLSLIF LALILKGVOC CHO Van Lier at al., Immunology 1989 no. 2 O (GGGGS) (GGGGS) EWSWIFLF LSWTTGWHS CHO Lanzavecchia & Scheidegger, Eur J. Immunol. 1987

18PHUS (GGGGS) VE (GGSGGS) GWSCIILF LWATATGWHS HS Lanzavecchia & Scheidegger, GGWD Eur J. Immunol. 1987

18PHU3 VE (GGSGGS) (GGGGS) GWSCIILF LWATATGWHS HS Lanzavecchia & Scheidegger, GGWD Eur J. Immunol. 1987

18PMUS (GGGGS) VE (GGSGGS) GWSCIILF LWATATGWHS M Leo et al. Proc Natl Acad GGWD Sci., 1987 18PMU3 VE (GGSGGS) (GGGGS) NSGLOLVF FWLTLKGIQG M Leo et a Proc Natl Acad GGWD Sci., 1987 no. 35 (GGGGS) (GGGGS) GWLWNLLF LMAAAQSAQA CHO Lanzavecchia & Scheidegger, Eur J. Immunol. 1987

CHO indicates Chinese Hamster Ovary; HS, Homo sapiens; mAB, monoclonal antibody; MM, Mus musculus; TAA, tumor associated antigen. b. Generation of Stable Producer Cell Lines DMEM medium without FCS or antibiotics were added. 4 ug 0381 To generate stable producer cell clones of oflinearized DNA of the constructs described under Example CLDN18.2 specific bi-scFv proteins the human embryonic 1...a were diluted in 0.25 ml plain DMEM/F-12 medium and kidney cell line HEK293 (ATCCCRL-1573) and the Chinese mixed gently. In a second reaction tube, 2.5 ul Lipofectamine Hamster Ovary cell line CHO-K1 (ATCC CCL-61) were 2000 (Invitrogen/Life Technologies GmbH, Darmstadt, Ger used. many) were diluted in 0.25 ml plain DMEM/F 12 medium, mixed gently and incubated for 5 min at RT. DNA mix and HEK293 Transfection Lipofectamine mix were combined in a 1:1 ratio, mixed gen tly and incubated for 20 min at RT. The DNA/Lipofectamine 0382 1x107 HEK293 cells were plated two days prior to 2000 complexes were added dropwise to the cells, cell culture transfection on 14.5 cm tissue culture dishes in 20 ml com dishes were gently rotated and then incubated at 37°C., 5% plete DMEM medium (DMEM/F-12 GlutaMax supple CO. 6 h after transfection the medium was changed to com mented with 10% heat inactivated FBS and 0.5% penicillin plete DMEM/F-12 medium. Cells were splitted the following streptomycin; all reagents from Gibco? Life Technologies day in a 1:10 ratio. Selection of transfected cells started 48 h. GmbH, Darmstadt, Germany). Before transfection, cells after transfection with G418 sulfate (Gibco/Life Technolo were washed with DPBS supplemented with 2 mM EDTA, gies GmbH, Darmstadt, Germany) in a final concentration of then 20 ml of plain DMEM medium without FBS or antibi 0.5 mg/ml. G418 was added permanently to the culture otics were added. 20 lug of linearized DNA of the constructs medium for cell culturing. described under Example 1.a were diluted in 0.5 ml plain DMEM/F-12 medium. 75ul of 1 mg/ml linear PEI solution c. Selection of HEK293 as Producer Cells (Polyethylenimine: Polysciences Europe GmbH, Eppelheim, 0384 Expression of bi-scFv proteins by stably transfected Germany) were added to the diluted DNA and rigorously HEK293 and CHO-K1 cell lines described under Example 1.b was characterized by immunofluorescence staining to vortexed. After 15 min incubation at RT, the DNA/PEI com detect bi-scFv expression according to standard procedures plexes were added dropwise to the cells, cell culture dishes (Current Protocols in Immunology, 2012). Briefly, 2x10 were gently rotated and then incubated at 37°C., 5% CO. 24 cells were grown on glass slides for 24 hand then permealized h after transfection the medium was changed. Selection of with 2% PFA. DPBS supplemented with 5% BSA and 0.2% transfected cells started 48 h after transfection with G418 Saponin was used as blocking buffer. After washing with sulfate (Gibco/Life Technologies GmbH, Darmstadt, Ger DPBS and blocking with blocking buffer, cells were incu many) in a final concentration of 0.8 mg/ml. G418 was added bated with primary antibody Anti-HIS Epitope-Tag (Dianova permanently to the culture medium for cell culturing. GmbH, Hamburg, Germany) diluted 1:500 in blocking buffer for 30 minat RT. After washing with blocking buffer, second CHO-K1 Transfection ary Cy3-conjugated goat-anti-mouse IgG (H+L) antibody 0383) 1x10 CHO-K1 cells were plated one day prior to (Jackson ImmunoResearch Europe, Suffolk, England) transfection on 6-well tissue culture plates in 2 ml complete diluted 1:500 in blocking buffer was added and incubated for DMEM medium (DMEM/F-12 GlutaMax supplemented 3 hat RT. After washing with blocking buffer and HO, cells with 10% heat inactivated FBS, without antibiotics; all were embedded in DAKO-mounting medium (Dako, Carpin reagents from Gibco/Life Technologies GmbH, Darmstadt, teria, Calif., USA) supplemented with Hoechst 33342 dye Germany). Before transfection, cells were washed with (Pierce/Thermo Fisher Scientific, Rockford, Ill., USA). DPBS supplemented with 2 mM EDTA, then 1.5 ml of plain Slides were investigated and photographed with a Nikon US 2016/0272711 A1 Sep. 22, 2016

Eclipse Ti fluorescence microscope for the presence of bi in Protein Science, 2012). Briefly, filtered cell culture super schv positive cells (data not shown). HEK293 cells showed natant was loaded onto a His Trap FF 5 ml column connected an overall better expression of bi-scFv proteins than CHO-K1 to an AKTA Purifier 10 FPLC system (both GE Healthcare cells and were therefore chosen as producer cell line. Life Sciences, Munich, Germany). PBS washing buffer con d. Production and Detection of Bi-ScFv Protein 1BiMAB tained 10 mM imidazol, PBS elution buffer contained 500 with HEK293 Clone H28 mM NaCl, 50 mM NaH2PO and 250 mM imidazol, pH of 0385 Bi-scEv 1BiMAB was chosen as first bi-scFv pro both buffers was adjusted to 7.4. Elution was performed by a tein to be produced, purified and used for the establishment of stepwise gradient. Eluted bi-scFv protein 1BiMAB was various assays. For this purpose, clonal cell lines of HEK293 immediately dialyzed against 1xPBS using a Slide-A-Lyzer bulk cells stably expressing 1BiMAB (see Example 1.b) were G2 Dialysis Cassette 10K MWCO (Pierce/Thermo Fisher produced by single cell sorting using a FACSAria cell sorter Scientific, Rockford, Ill., USA). After dialysis against (BD Biosciences, Heidelberg, Germany). After expansion of 1xPBS, bi-scFv was dialyzed againstan HO based 200 mM nearly 40 clonal lines, the best producer clone was selected by arginine buffer (L-Arginin-monohydrochloride; Roth, immunofluorescence as described under Example 1.c. Karlsruhe, Germany). Selected producer clone #28 was expanded and cultured in a 0388 Bi-scFv concentration was determined by measure 10-layer Cell Factory (Nunc, Roskilde, Denmark) in DMEM/ ment at 280 nm with a NanoDrop 2000c under consideration F-12 GlutaMax supplemented with 10% FBS, 0.5% penicil of the extinction coefficient and the molecular weight of lin-streptomycin and 0.8 mg/ml G418 (all reagents from bi-scFv protein 1BiMAB determined via the ProtParam tool Gibco/Life Technologies GmbH, Darmstadt, Germany) (http://web.expasy.org/protparam/). Purified protein was ali according to the manufacturer's guidelines. At confluent quoted and stored at -80° C. for long time storage or kept at stage, cells were washed with DPBS and medium was 4°C. for immediate use. Quality and purity of bi-schv protein changed to DMEM/F-12 medium with antibiotics but without 1BiMAB was tested by Coomassie staining and western blot FBS. Cell supernatant containing bi-scFv protein 1BiMAB analysis as described under Example 1.d (see also FIGS. 3A was harvested every 3-5 days for up to 4 weeks. Supernatant and B). A BSA standard dilution was included in the Coo was filtered with 500 ml Steritop Filter Units (Merck Milli massie procedure to roughly confirm the concentration mea pore, Billerica, Mass., USA) and stored at 4°C. until FPLC purification. sured by NanoDrop (data not shown). 0386 Before FPLC-purification, presence of bi-scFv in f. Establishment of an ELISA Assay the cell culture Supernatant was tested by polyacrylamid gel 0389 For the quantification of 1BiMAB in cell culture electrophoresis followed by coomassie staining and western supernatant of HEK293 cells, a specific ELISA assay had to blot analysis performed by standard (Current Protocols in be established. For this purpose, supernatant from Example Protein Science, 2012). The supernatant was concentrated 1.d and purified bi-scFv protein 1BiMAB described under 5x-10x by Centricon Centrifugal Filter Devices—10K Example 1.e was used. BSA pre-blocked Ni-NTA plates MWCO (Merck Millipore, Billerica, Mass., USA) according (Thermo Fisher Scientific, Rockford, Ill., USA) were used to to the manufacturer's protocol. Concentrated and non-con immobilize bi-scFv protein 1BiMAB via its 6xHis-tag. All centrated supernatants were separated on NuPAGE Novex washing steps were conducted three times with 200 ul 4-12% Bis-Tris Gels (Invitrogen/Life Technologies GmbH, 1xRBS/0.05% Tween (washing buffer) per well and all steps Darmstadt, Germany). Subsequently, the gels were stained were executed at room temperature. As standard, purified with Coomassie Brilliant Blue solution according to standard 1BiMAB protein was used, diluted in 1xpBS within the range procedures to detect bi-scFv protein 1BiMAB between 50 of 10-500 ng/ml. Supernatants were diluted 1:10 in 1xRBS. and 60 kD and other proteins contained in the cell culture 100 ul of diluted protein or supernatant were transferred to supernatant. Western blot analysis was performed to specifi each well and incubated for one hour while shaking. After cally detect bi-sch c protein 1BiMAB via its 6xHis-tag. washing, an anti-idiotypic antibody against the V-V, Briefly, after blotting proteins on PVDF membrane and domains of mCLDN18.2ab was diluted to a final concentra blocking with PBST/3% milk powder, the membrane was tion of 0.5 g/ml in 1xRBS/3% BSA. 100 ul of the anti incubated for 1 h at 4°C. with primary antibody Anti-HIS mCLDN18.2absolution were added per well and incubated Epitope-Tag (Dianova GmbH, Hamburg, Germany) diluted for one hour while shaking. Afterwashing, an AP-conjugated 1:500 in blocking buffer. After washing with blocking buffer, anti-mouse-Fc antibody (Jackson ImmunoResearch Europe, membranes were incubated with Fc-specific secondary per Suffolk, England) was diluted to a final concentration of 300 oxidase-conjugated goat-anti-mouse IgG antibody (Sigma ng/ml in 1xRBS/3% BSA. 100 ul of this secondary antibody Aldrich, Germany) diluted 1:10000 in blocking buffer for 1 h solution were added per well and incubated for an additional at 4°C. After washing with blocking buffer, the signals were hour while shaking. As negative controls, secondary antibody visualized by SuperSignal West Femto Chemiluminescent only, 1BiMAB plus secondary antibody, and anti Substrate (Pierce/Thermo Fisher Scientific, Rockford, Ill., mCLDN18.2ab plus secondary antibody were used. In addi USA) and recorded by an ImageOuant LAS 4000 Imager (GE tion, HEK293 cell supernatant without bi-scFv protein was Healthcare Life Sciences, Munich, Germany). Signals of bi included in the assay. Finally, 50 ul AP substrate solution (1.5 sch v were detected between 50 and 60 kD as compared to the mg pNPP per ml substrate buffer, AppliChem GmbH, Darm internal molecular weight standard (see FIGS. 3A and B). stadt, Germany) were added per well after washing. After 5, e. Purification and Quantification of Bi-scFv Protein 15, and 30 min incubation in the dark absorption at 405 nm. 1BiMAB with an excitation wavelength of 492 nm was measured with (0387 Cell culture supernatant of HEK293 clone #28 con an Infinite M200 Tecan microplate-reader (Tecan, taining bi-scFv protein 1BiMAB (described under Example Männedorf, Switzerland). Concentration of bi-scFv protein 1.d) was subjected to immobilized metal affinity chromatog from Supernatant was determined by calculation against the raphy (IMAC) using standard procedures (Current Protocols standard row (data not shown). US 2016/0272711 A1 Sep. 22, 2016 39 g. Transient Transfection of CLDN18.2-Specific Bi-scFV ration (MACS) from PBMCs by Pan T Cell Isolation Kit II Proteins for Comparison Studies (Miltenyi Biotec, Teterow, Germany) according to the manu 0390 To transiently generate preferably high amounts of facturer's guidelines. CLDN18.2 specific bi-scFv proteins the human embryonic 0394) 1x10 NugC4 cells were seeded per well into tissue kidney cell line HEK293T (ATCCCRL-11268) was used for culture 6-well plates. Humancells were prepared as described transfection. 1x107 HEK293T cells were plated two days above and added in an effector to target (E:T) ratio of 5:1. prior to transfection on 14.5 cm tissue culture dishes in 20 ml RPMI 1640 medium supplemented with 5% heat inactivated complete DMEM medium (DMEM/F-12 GlutaMax supple human AB serum, 0.5% penicillin-streptomycin, 1 xNEAA mented with 10% heat inactivated FBS and 0.5% penicillin and 1 mM sodium pyruvate (Gibco/Life Technologies streptomycin; all reagents from Gibco? Life Technologies GmbH, Darmstadt, Germany) was used for all cells and the GmbH, Darmstadt, Germany). Before transfection, cells final volume per well was adjusted to 2 ml per well. Control were washed with DPBS supplemented with 2 mM EDTA, samples comprised target or T cells alone with and without then 20 ml of plain DMEM medium without FBS or antibi bi-scFv protein. Tissue culture plates were subsequently otics were added. 20 ug of the circular DNA constructs incubated at 37° C., 5% CO. The assay was continuously 1BiMAB, no. 11-20, and no. 35 (described under Example observed with a Willovert S inverted microscope (Hund, Wet 1.b) were diluted in 0.5 ml plain DMEM/F-12 medium. 75ul Zlar, Germany) from 6 h to 48 h of coincubation. Significant of 1 mg/ml linear PEI solution (Polyethylenimine: Poly effects in terms of T cell clustering on target cells, formation sciences Europe GmbH, Eppelheim, Germany) were added to of an immunologic synapse and target cell killing in the the diluted DNA and rigorously vortexed. After 15 min incu presence of bi-scFv protein 1BiMAB were seen at 24 h. After bation at RT, the DNA/PEI complexes were added dropwise 48 h viable target cells could hardly be found. Pictures were to the cells, cell culture dishes were gently rotated and then taken at 24 h with a Nikon Eclipse TS100 inverted micro incubated at 37°C., 5% CO for 24 h. After a medium change scope (Nikon, Japan). See also FIG. 5. with plain DMEM/F-12 cells were incubated for another 48 h. 0395. This assay was further on included as visibility con at 33° C., 5% CO. Cell supernatant was harvested after trol in all cytotox assays in various well formats. incubation and sterile filtered with 0.2 um Minisart syringe b. Target-Dependent T Cell Activation by Bi-scFv Protein filters (Sigma-Aldrich, Germany). Subsequently, bi-scFV 1BiMAB proteins were Small-scale purified from cell culture Superna 0396 For the detection of a specific activation of human T tants by Ni-NTA spin columns according to the manufactur cells by bi-scFv proteins a flow cytometric assay was estab er's protocol (Qiagen, Hilden, Germany). Bi-scFv protein lished. For the detection of T cell activation, the early activa concentrations were estimated by an ELISA as described tion marker CD69 and the late activation marker CD25 were under Example 1.f and verified by western blot analysis as selected for staining by fluorescence-conjugated antibodies. described under Example 1.e (data not shown). Purified pro For the detection of human T cells in the mixture of target and teins were stored at 4°C. for immediate use. T cells, CD3 on T cells was stained. Example 2 0397. The assay set-up from above was chosen (Example 2.a). Briefly, NugC4 target cells were seeded with human T Establishment of Functional Assays to Monitor cells in an E:T ratio of 5:1 in 2 ml complete medium and Specific T Cell Activation and Target Cell Lysis by bi-scFv protein 1BiMAB was added in a concentration within the range of 0.001-1000 ng/ml. Control samples contained Redirected T Cells Mediated by Bi-scFv Proteins target or T cells alone with and without bi-scFv protein 0391) FPLC-purified bi-scFv protein 1BiMAB was used 1BiMAB. After 24h and/or 48 h depending on the result of to establish in vitro assays to monitor the capability of bi-scFV the visibility control—all cells were harvested by gentle proteins to specifically redirect human effector cells to TAA scraping with Cell Scrapers (Sarstedt AG & Co, Nürmbrecht, positive target cells. The aim was to visualize the effects and Germany) and transferred to 5 ml round bottom tubes (BD to quantify the activation of human T cells and the specific Falcon, Heidelberg, Germany). Cells were centrifuged and target cell lysis. washed with DPBS. For cell staining Mouse Anti-Human a. Microscopic Analysis of T Cells Redirected to Target Cells CD3-FITC, Mouse Anti-Human CD69-APC, and Mouse by Bi-scFv Protein Anti-Human CD25-PE (all antibodies BD Biosciences, 0392 For the visualization of bi-scFv protein functional Heidelberg, Germany) were used. Cell pellets were resus ity, an assay to show the redirection of effector cells to pended in 50 ul FACS-buffer (DPBS supplemented with 5% CLDN18.2-expressing target cells by bi-scFv proteins via FBS) containing the fluorescence-conjugated antibodies. microscope had to be established. For this purpose, the gastric After incubation for 20 min at 4°C. in the dark, samples were carcinoma cell line NugC4 that endogenously expresses rela washed with 4 ml DPBS and cell pellets were resuspended in tively high levels of human CLDN18.2 (Sahin U. et al., Clin 200 ul FACS buffer containing propidium iodide (PI) or Cancer Res. 2008 Dec. 1; 14(23):7624-34) was used as target 7-AAD (both Sigma Aldrich, Germany) in a final dilution of cell line. 1:1000 for the detection of dead cells. Samples were kept on 0393 Human effector cells were freshly isolated from ice and dark throughout the measurement. Establishment of human blood from healthy donors according to standard pro the assay was performed with a FACSCalibur, later measure cedures (Current Protocols in Immunology, 2012): briefly, ments were performed with a FACSCanto II flow cytometer blood was diluted with DPBS, layered on Ficoll-Paque Plus (both BD Biosciences, Heidelberg, Germany). Analysis was (GE Healthcare Life Sciences, Munich, Germany) and cen evaluated by FlowJo software (Tree Star, San Carlos, Calif., trifuged. Peripheral blood mononuclear cells (PBMCs) were USA). collected from the interphase, washed with cold DPBS 0398. As shown in FIGS.6A and B, no 1 BiMAB mediated supplemented with 2 mM EDTA and counted. Human T cells T cell activation is detectable in the absence of target cells were Subsequently separated by magnetic-activated cell sepa underlining the strict target dependency of bi-scFv function US 2016/0272711 A1 Sep. 22, 2016 40 ality. A significant T cell activation in the presence of target were implemented e.g. by varying bi-scFv concentrations, cells occurred with only 0.01 ng/ml 1BiMAB after 24 h. bi-scFv proteins, E:T ratios, or effector cells (CD8+, CD4+ T Maximum efficiency was reached using 100 ng/ml 1BiMAB. cells, PBMCs). 0399 Besides the study of T cell activation, this assay also allows the qualitative analysis of bi-scFv mediated effects on Example 3 target cell killing by gating on the target cell population and estimating the percentage of PI- or 7-AAD-positive target Selection of a CLDN18.2-Specific Bi-scEv Lead cells (no data shown). All analyses were performed with Candidate FlowJo software (Tree Star, San Carlos, Calif., USA). 0406 Luciferase Cytotox Assay with Various CLDN18.2- c. Luciferase Cytotox Assay Specific Bi-scFv Proteins for the Selection of the Most Potent Bi-scFv Variant 0400. To determine subtle differences in the target cell 0407 All 10 CHO-codon optimized constructs (no. killing potential of bi-scFv proteins directed against 11-20) specific for the TAA CLDN18.2 were tested in com CLDN18.2 and CD3, a highly sensitive assay had to be devel parison to the human codon optimized bi-scFv protein oped. The aim was, to establish an assay with which the target 1BiMAB in a luciferase cytotox assay with NugC4 target cell killing could be quantitatively monitored in a high cells that endogenously express CLDN18.2 and ectopically throughput fashion. To achieve this, a luciferase cytotox assay express luciferase (see also Example 2.c). Characteristics of was chosen. Herewith the measurement of luciferase-expres used bi-scFv proteins are specified in Table 2. Bi-scFv no. 35 sion by viable target cells allows to indirectly determine the specific for TAA PLAC1 was used as isotype control because target cell lysis mediated by cytotoxic effector cells in the PLAC1 is not expressed by NugC4 cells. Binding activity to presence of antibody. CD3 on human T cells had been proven in a FACS binding 04.01 First, NugC4 cells (described above) were trans assay (data not shown). All bi-scFv proteins were generated duced with a lentiviral vector carrying firefly luciferase, an as described under Example 1.g. and used for a cytotox assay EGFP reporter gene and an antibiotic selection marker. After set up as described under Example 2.c. antibiotic selection of transduced cells, EGFP high express 0408 All bi-scFv proteins were used in a final concentra ing cells were sorted by a FACSAria cell sorter (BD Bio tion of 5 ng/ml. For the determination of L, control bi-scEv Sciences, Heidelberg, Germany), analyzed for high luciferase protein no.35 was seeded with target and T cells ninefold, test expression and Subsequently expanded for further studies. samples were plated sixfold. Per time point one plate was 0402 Human effector cells were prepared as described prepared for analysis. under Example 2.a. Establishment of the assay was per 04.09. The specific lysis at each analyzed time point (8 h, formed within the range of 1-100 ng/ml of the bi-schv protein 16 h, 24 h) was plotted against the used bi-scFv proteins. 1BiMAB, whereby a concentration of 5 ng/ml was found to Bi-scFv proteins 1BiMAB (SEQID NO:39) and no. 15 (SEQ result in highly efficient and reproducible effects and was ID NO: 41)—which are constructed in the same orientation further used as standard concentration. NugC4 cells stably and contain the same anti-CD3 sequence (TR66) and differ expressing luciferase (described above) were used as target only in their codon usage on nucleic acid level and in the cells. 1x10" target cells were seeded per well into white flat linker sequences—proved to be the most potent antibodies in bottom 96-well plates. Human T cells (prepared as described mediating target cell lysis (see FIG.2). Because 1 BiMAB and under Example 2.a) were added in an E:T ratio of 5:1. The no. 15 are equal in their efficiency, the so far better investi medium described above (Example 2.a) was used and the gated bi-scFv protein 1BiMAB was selected for all following final volume per well was adjusted to 100 ul. Test samples and assays. Constructs 18PHU3 and 18PHU5 (see Table 1 and 2) control samples were plated at least in triplicates. were compared at a later time point to 1BiMAB. Efficiency of 18PHU5 was equivalent to 1BiMAB, 18PHU3 was less 0403 Cell culture microplates were incubated for 24 hand potent (data not shown). 48 hat 37°C., 5% CO. For analysis, 50ll of a water solution containing 1 mg/ml luciferin (BD Monolight, BD Bio Example 4 sciences, Heidelberg, Germany) and 50 mM HEPES were added per well and plates subsequently incubated for 30 min Binding Capacity of Bi-scFv Protein 1BiMAB in the dark at 37° C. Luminescence arising from oxidation of luciferin by luciferase expressing viable cells was measured Establishment of a FACS-Based Binding Assay in a microplate-reader (Infinite M200. Tecan, Mannedorf, Switzerland). Percentage of specific target cell lysis was cal 0410. To assess the binding capacity of the CLDN18.2 and culated by the following formula: % specific lysis-1-(lumi the CD3-targeting moieties of bi-scFv proteins a flow cyto nescences, t-L)/(Ln-L)x100, whereas "L" metric assay was established. CLDN18.2 endogenously indicates lysis. L, refers to the minimum lysis in the expressing NugC4 cells were used to investigate the anti absence of bi-scEv and L to the maximum lysis (equal to CLDN18.2 site and human T cells were used to investigate the spontaneous luminescence counts) in the absence of bi-scFV anti-CD3 site. achieved by addition of Triton X-100 (2% final concentra 0411 For the investigation of the anti-CLDN18.2 binding tion). capacity, NugC4 cells were trypsinized, washed with com plete RPMI 1640 medium and subsequently with DPBS. All 0404 Potential direct effects of bi-scFv proteins on target washing steps were conducted by centrifugation at 1200 rpm cells independent of effector cells were determined by plating for 6 min at 4°C. 2.5x10 NugC4 cells were transferred to 5 target cells without human T cells including all controls such ml round bottom tubes and incubated with 50 lug/ml FPLC as Limi, and Lima. purified 1BiMAB protein in FACS-buffer for 30 min at 4°C. 04.05 This assay was used for further studies to investigate Cells were washed with 2 ml FACS-buffer and subsequently the specific T cell mediated lysis of target cells. Modifications incubated with 3.3 ug/ml of monoclonal antibody Anti-HIS US 2016/0272711 A1 Sep. 22, 2016

Epitope-Tag (Dianova GmbH, Hamburg, Germany) for 30 a. CLDN18.2 RT-PCR of Cancer Cell Lines min at 4°C. After washing with 2 ml FACS-buffer, the cell pellet was incubated with an APC-conjugated goat-anti 0415 Total RNA was extracted from the carcinoma cell mouse secondary antibody (Jackson. ImmunoResearch lines mentioned above by RNEasy Mini Kit procedure Europe, Suffolk, England) in a 1:200 dilution in FACS-buffer according to the manufacturer's protocol (Quiagen, Hilden, for 20 min at 4°C. in the dark. Cells were washed twice with Germany). 5ug of RNA were used for cDNA synthesis with 2 ml FACS-buffer and finally resuspended in 150 ul FACS SuperScript II Reverse Transcriptase (Life Technologies buffer supplemented with 1 g/ml PI (Sigma Aldrich, Ger GmbH, Darmstadt, Germany). many) to counterstain dead cells. Another staining with the 0416 RT-PCR analyses was run on an ABI Prism 7300 same procedure was included using 50 g/ml 1BiMAB and RealTime PCR System (Applied Biosystems/Life Technolo APC-conjugated goat-anti-mouse secondary antibody gies GmbH, Darmstadt, Germany) using Sybr Green dye and (1:200) but without Anti-HIS Epitope-Tagantibody. Negative the following primers: control samples included secondary goat-anti-mouse APC antibody alone, monoclonal antibody Anti-HIS Epitope-Tag plus secondary goat-anti-mouse APC antibody. As positive CLDN182: control 10 g/ml monoclonal CLDN18.2-specific antibody for mCLDN18.2ab stained with secondary goat-anti-human TGGCTCTGTGTCGACACTGTG.; APC antibody (Jackson ImmunoResearch Europe, Suffolk, rew England) and its secondary antibody only control were imple GTGTACATGTTAGCTGTGGAC mented. HPRT: 0412 Samples were measured with a FACSCalibur flow for cytometer (BD Biosciences, Heidelberg, Germany) and ana TGACACTGGCAAAACAATGCA; lyzed by Flow Jo Software (Tree Star, San Carlos, Calif., USA). Strong signals were detected by sequential staining rew with 1 BiMAB, Anti-HIS Epitope-Tag and goat-anti-mouse GGTCCTTTTCACCAGCAAGCT APC. Signal intensity was comparable to positive control mCLDN18.2ab with goat-anti-human APC. A low direct 0417 Delta Ct was calculated by subtraction of the Ct binding of goat-anti-mouse APC to 1 BiMAB was observed in value of the housekeeping gene HPRT from the Ct-value of the sample stained with 1BiMAB and goat-anti-mouse APC CLDN18.2 (for results see FIG. 7A). without Anti-HIS Epitope-Tag (see FIG. 4A). For all further b. Exclusive T Cell Activation in the Presence of CLDN18.2 FACS-binding assays to investigate the binding capacity of bi-scFv proteins the sequential staining protocol with bi 0418. A cytotoxic assay was set up as described under Example 2.a. The carcinoma cell lines examined for schv, Anti-HIS Epitope-Tag and goat-anti-mouse APC was CLDN18.2 transcripts under Example 5...a via quantitative used (see FIGS. 4B, C, and D). To rule out an unspecific RT-PCR were used as target cells. The concentration of bi binding of 1 BiMAB, target cells that do not express schv protein 1BiMAB in this assay was set to 5 ng/ml. Target CLDN18.2 as verified by RT-PCR (data not shown) were cells were seeded with human T cells and 1BiMAB in dupli subjected to the FACS-based binding assay. No unspecific cates to analyze T cell activation. To monitor any potential binding of 1 BiMAB was detected as shown in FIG. 4D. alloreactivity of T cells against target cells independently of 0413 For investigation of the binding capacity of the anti bi-scF protein 1BiMAB, target and T cells were seeded with CD3 arm of bi-scEv protein 1BiMAB, human T cells were out 1BiMAB in duplicates. Cells were continuously sighted used. 1x10' T cells prepared as described in Example 2.a through a microscope to observe T cell clustering and target were transferred to 5 ml round bottom tubes and incubated cell binding. In the case of the high CLDN18.2-expressing with FPLC-purified 1BiMAB protein within a range of cell line NugC4, significant effects occurred after 24 h; after 0.002-2 ug/ml in FACS-buffer for 30 min at 4° C. Further 48 h viable target cells were hardly visible. In the case of the staining procedure was as described above. Control samples low CLDN18.2-expressing cell line DanC, first effects were included secondary goat-anti-mouse APC antibody alone and seen after 96 h and significant effects after 120 h. With the monoclonal antibody Anti-HIS Epitope-Tag plus secondary CLDN18.2 negative cell lines no effects indicating any T cell goat-anti-mouse APC antibody. Measurement and analysis activation could be seen even after 144 h. T cells of all were performed as described above. A significant signal was samples were analyzed after 144h of coincubation with target obtained with 2 ug/ml 1BiMAB (see FIG. 4C). cells via flow cytometry as described under Example 2...a for Example 5 the early T cell activation marker CD69 and the late activation marker CD25, counterstained with CD3 for the T cell popu Investigation of Highly Specific, Target Dependent T lation and PI for dead cells. Intriguingly, up to 100% of the T cells coincubated with NugC4 and 1BiMAB were CD25 Cell Activation by Bi-scFv 1BiMAB positive but CD69 negative indicating a longterm activation 0414 Cancer cell lines that endogenously express high or of T cells when CD69 downregulation already occurred. low levels of CLDN18.2 and cancer cell lines that do not Roughly 75% of T cells coincubated with DanC and express CLDN18.2 were chosen to prove the strict target 1BiMAB were activated, of which about 40% simultaneously dependency of bi-scFv protein 1BiMAB in an in vitro cytotox expressed CD25 and CD69 indicating a T cell activation that assay. The chosen cell lines were of the two predominant is still ongoing. T cells coincubated with the CLDN18.2 carcinoma types that express CLDN18.2: gastric (NugC4. negative cell lines did not show any sign of T cell activation MKN7, SNU-1) and pancreatic (DanG, KP-4) carcinoma. induction: neither CD69 nor CD25 expression was signifi Breast carcinoma cell line MCF7 was used as negative con cantly elevated compared to the levels of samples without trol. 1BiMAB (see also FIG. 7B). US 2016/0272711 A1 Sep. 22, 2016 42

Example 6 Example 7

Investigation of Bi-scFv Protein 1BiMAB Induced T Determination of EC50 of Bi-ScFv Protein 1BiMAB Cell Function in an In Vitro Cytotox Assay Luciferase Cytotox Assay 0419 a. Induction of T Cell Proliferation 0424 For the determination of the half maximal effective 0420 T cell proliferation is an indicator of T cell activa dose of bi-scFv protein 1BiMAB, a titration row of 1 BiMAB tion. To show T cell proliferation in response to bi-scFV was tested in an in vitro luciferase cytotox assay, mainly as protein 1BiMAB in the presence of CLDN18.2 positive target described under Example 2.c. cells, a flow cytometric assay was used. Briefly, 1x10' human 0425 Stably luciferase-expressing NugC4 cells described T cells isolated as described under Example 2...a were stained under Example 2.c were incubated with human T cells and in the dark at 37° C. for 10 min with 0.5uM carboxyfluores bi-scFv protein 1BiMAB concentrations within the range of 1 cein diacetate succinimidyl ester (CelTrace CFSE, Invitro ug/ml to 1 ug/ml (in steps of 10) or without 1 BiMAB to gen/Life Technologies GmbH, Germany) dissolved in DPBS. determine the L values. Luminescence of viable cells was Staining was stopped by addition of 5 volumes of cold com measured with an Infinite M200 Tecan plate reader 24 h and plete RPMI 1640 medium. Cells were kept on ice for 5 min 48 h after assay set up. Specific target cell lysis was calculated and washed 3 times with complete RPMI medium (5% heat by the formula exemplified under Example 2.c. inactivated human AB serum, 0.5% penicillin-streptomycin, 0426 Maximum lysis was reached after 48 h with 1-10 ng/ml 1BiMAB. The determined EC50 after 48 h in this assay 1xNEAA and 1 mM sodium pyruvate) and were subsequently is approximately 10 pg/ml (see also FIG.9). Outcome of this resuspended to 1x10 cells per ml. A cytotox assay as assay strongly depends on the potency of the human T cells described under Example 2.b was set up with CLDN18.2 which varies according to the immune status of the donor as endogenously expressing NugC4 cells and human T cells as also reported by others (e.g. Lutterbuese, Ret al., Proc. Natl. effector cells. 50 UIL-2 per ml medium were added to the Acad. Sci. USA. 2010 Jul.13: 107(28): 12605-10). In addition cells. Samples included T cells alone, T cells with 1 ng/ml to that, the used target cell line NugC4 shows varying expres 1BiMAB, T cells and NugC4 cells, and T cells with 1 ng/ml sion of CLDN18.2 also influencing the outcome. Thus, an 1BiMAB and NugC4 cells. After 120h of coincubation, the T EC50 value variation of bi-schv protein 1BiMAB in a range cells were harvested, collected in 5 ml round bottom tubes, within 10-300 pg/ml has been observed during the course of washed and Stained with a 1:1000 7-AAD DPBS solution to this invention. counterstain dead cells for 15 min at 4°C. After washing with DPBS, cells were resuspended in FACS-buffer and analyzed Example 8 with a FACSCanto II (BD Biosciences, Heidelberg, Ger many). Efficacy in a Mouse Xenograft Model 0421 Proliferation of T cells was detected by decreasing 0427. To investigate the therapeutic potential of bi-scFv CFSE-signal only in the presence of target cells and bi-scFV protein 1BiMAB in vivo, the mouse strain NOD.Cg-Prkd' protein 1BiMAB (see also FIG. 8A). IL2rg"''/Sz) or short NSG (Jackson laboratory, Bar Har bour, Me., USA) was chosen. For the described study the b. Induction of Serine Protease Granzyme B engraftment of human effector cells and human T lympho cytes in mice is indispensable to study the effects of T cell 0422 To demonstrate the upregulation of proteolytic mol engaging bi-scFv in vivo. Because of the complete lack of B-. ecules after T cell activation mediated by bi-scFv protein T- and NK cells the mouse strain NSG is suitable for this kind 1BiMAB in the presence of CLDN18.2 positive target cells, of Xenograft studies. A mouse model with mainly engrafted the detection of serine protease Granzyme B via flow cyto human T cells after PBMC injection was established as part of metric analysis was elected. A cytotox assay as described the invention. under Example 2.b was set up with CLDN18.2 endogenously a. Late Onset Treatment of Advanced Highly CLDN18.2 expressing NugC4 cells and human T cells as effector cells. Expressing Tumors in Mice with Bi-scFv Protein 1BiMAB Samples included T cells alone, T cells with 5 ng/ml 0428. In the exemplified study, 40 female NSG mice at the 1BiMAB, T cells and NugC4 cells, and T cells with 5 ng/ml age of 8 weeks were subcutaneously inoculated with 1x107 1BiMAB and NugC4 cells. After 96 h of coincubation, the T HEK293 cells stably expressing high levels of human cells were harvested, collected in 5 ml round bottom tubes, CLDN18.2 (HEK293-CLDN18.2). 5 days after tumor cell washed and Stained with a 1:1000 7-AAD DPBS solution to inoculation mice were stratified according to their tumor Vol counterstain dead cells for 15 min at 4°C. After washing with ume into treatment groups, mice without tumor growth were DPBS, cells were fixed with 100 ul Cytoperm/Cytofix solu excluded. At the same day peripheral blood mononuclear tion for 20 min at RT. Cells were washed with 1x Perm/Wash cells (PBMCs) were isolated from human blood of healthy and Subsequently stained with PE-conjugated Mouse Anti donors by Ficoll density gradient technique as described Human Granzyme B antibody for 20 min at RT. After wash under Example 2.a and used as effector cells in vivo. 2x107 ing, cells were resuspended in FACS-buffer and analyzed PBMCs diluted in 300 ul DPBS were injected intraperito neally at the day of isolation to the experimental treatment with a FACSCanto II (all reagents and FACS machine BD groups designated with “PBMC. With “PBS” designated Biosciences, Heidelberg, Germany). treatment groups received 300 ul plain DPBS intraperito 0423 Granzyme Bupregulation in T cells was detected neally instead and served as control without human effector only in the presence of target cells and bi-scFv protein cells. With the “PBS' control groups the investigation of a 1BiMAB (see also FIG. 8B). potential effect on tumor growth by 1 BiMAB itself or any US 2016/0272711 A1 Sep. 22, 2016

potential side effects which are caused by 1 BiMAB or vehicle splenocyte samples was thawed at one time, all cells were and not by human effector cells against mouse tissue (i.e. washed twice with warm DPBS and 1x10° splenocytes per graft-versus-host reaction exerted by human effector cells sample were incubated with fluorescence-conjugated anti against murine tissue) could be examined. Group “PBS/ve bodies for 20 min at 4°C. in the dark to detect the engraftment hicle' comprised 4 mice (n=4), “PBS/1BiMAB” 5 mice of human cells by anti-CD45 staining and the percentage of (n=5), “PBMC/vehicle” 13 mice (n=13) and “PBMC/ human T cells by anti-CD3, anti-CD4, and anti-CD8 staining. 1BiMAB' 15 mice (n=15). The therapy was started 1 day Flow cytometric analysis was conducted with a FACSCalibur after DPBS or PBMC application: groups “PBS/1BiMAB” (BD Biosciences, Heidelberg, Germany). Human T cell and “PBMC/1 BiMAB” received intraperitoneally 5 purified engraftment in both “PBMC groups could be confirmed by bi-scFv protein 1BiMAB diluted in 200 ul of DPBS per high percentage of CD45-CD3 double positive splenocytes as animal. Groups “PBS/vehicle' and “PBMC/vehicle' shown in FIG. 10D. received intraperitoneally 200 ul of vehicle buffer (200 mM Example 9 L-Arginin-monohydrochloride dissolved in HO, sterile fil Generation and Testing of Bispecific Binding Agents tered) diluted in DPBS. Treatment groups are summarized in Targeting CLDN6 and CD3 Table 3. Therapy was conducted on a daily basis for 22 days. 0432 a. Sequence Origin, Design of Bi-scFv Constructs, Twice per week tumor dimensions were measured with a and Cloning into Expression Vectors digital calibrated caliper and the tumor Volume calculated 0433. The bispecific tandem single chain antibody con according to the formula mm-lengthxwidth:X(width/2). structs (bi-scFV) contained binding domains specific for the FIGS. 10A and B exemplify the inhibition of tumor growth human T cell receptor component CD3 and human tumor and the elimination of tumor burden in half of the mice of the associated antigens (TAA). The corresponding variable “PBMC/1 BiMAB' group only by the antibody in the pres heavy chain regions (V) and the corresponding variable ence of human effector cells. Mice were sacrificed by cervical light chain regions (V) are for each construct specifically dislocation when the tumor volume exceeded 500 mm or in arranged from N- to C-terminus in consecutive order: case of severe morbidity (graft-Versus-host symptoms were N.V. CLDN6-vacLDN6.V. CD3 .vc CDs -C (6PHU5, SEQ observed in some mice). ID NO: 43) N.V. CD3 .vc CDs v. CLDN6-vaCLDN6C (6PHU3, SEQ TABLE 3 ID NO: 45) 0434 Table 4 summarizes all bi-scFv constructs specific Treatment groups for the TAA CLDN6 that were generated in the course of the invention. The CLDN18.2 specific bi-scFv construct Treatment # of mice Effector Bi-ScFw Igbi-scFV 1BiMAB was used as control antibody. The bi-scFv con group (G) (n) cells protein protein mouse structs were generated by gene synthesis by GeneArt AG G1 4 (GeneArt/Life Technologies GmbH, Regensburg, Germany) G2 5 1BiMAB 5 using the V and V, Sequences of the corresponding antibod G3 13 PBMC ies. Codon optimizations such as Homo sapiens (HS) or Mus G4 15 PBMC 1BiMAB 5 musculus (MM) were implemented by GeneArts GeneOpti mizer R software, and are listed in Table 5. Information on b. Determination of Therapy Influence on Body Weight specificity, sequence origin from monoclonal antibodies 0429. The body weight of each mouse was examined twice (mAB), codon usage, additional sequence features and refer per week using a laboratory scale. No mouse in any group ences of all applied domains are Summarized in Table 5. showed weight loss over the time of treatment (data not Variable domain sequence origin of the respective CD3 anti shown). Some mice in both “PBMC groups showed symp bodies are listed in Table 5. Due to the high homology of human and mouse TAAS, the same anti-TAA V, and V, toms of a graft-versus-host reaction 4 weeks after PBMC sequences could be used for the generation of bi-scFv con injection and several days after the end of treatment. Effects structs for mouse assays, but in combination with the V, V, by 1BiMAB itself on body weight or any other side effects sequences of the mouse specific anti-CD3 antibody clone concerning the health of the mice were not observed. 145-2C11. c. Tissue Conservation and Splenocyte Isolation 0435 DNA cloning and expression vector construction 0430. After killing of mice, tumors were dissected and the was carried out according to standard procedures (Sambrook, tissue was immediately fixed in 10 ml Roti-Histofix.4% (Carl 1989) well known by the skilled person. Briefly, the bi-scFv Roth, Karlsruhe, Germany) for immunohistochemical analy DNA sequences were provided with a 5' HindIII and a 3' sis. Moreover, spleens were dissected to detect the engraft BamHI restriction for cloning into expression plasmids. A ment of human cells by flow cytometric analysis. Splenocyte secretion signal sequence was introduced at the 5' end isolation was performed immediately after spleen dissection upstream of the bi-scFv sequence for protein secretion from by mashing the spleens through a 70 um cell strainer placed cellular cytoplasm into the culture medium. A sequence cod ing for a 15 to 18 amino acid flexible glycine-serine peptide into a 50 ml reaction tube with a sterile plunger of a 3-5 ml linker was inserted to join the V and V. domains for the Syringe and repeated flushing of the cell Strainer with warm composition of the single chain variable antibody fragments DPBS. Isolated splenocytes were centrifuged, DPBS (scFv) of which one binds to CD3 and the other to the TAA. decanted and the splenocyte pellets resuspended in 1 ml heat To form a bispecific single chain antibody, the two schv inactivated fetal bovine serum supplemented with 10% domain sequences were connected by a sequence coding for DMSO. Samples were immediately frozen at -80° C. and a short peptide linker (GGGGS). Together with this linker stored until splenocyte samples from all mice were complete. sequence a BamHI restriction site was introduced for scFV d. Analysis of Engraftment of Human T Lymphocytes in domain exchanges for the cloning of upcoming bi-scFV con Mouse Spleens structs. In-depth, 5'scFv-domains could be exchanged by 0431 Splenocytes from all mice were collected and frozen HindIII and BamHI restriction and 3'scFv-domains by as described under Example 8.c. The complete collection of BamHI and XhoI restriction. US 2016/0272711 A1 Sep. 22, 2016 44

0436 All used bi-schv antibody constructs were cloned b. Generation of Stable Producer Cell Lines into the standard mammalian expression vector pcDNATM3. 0437. To generate stable producer cell clones of CLDN6 1/myc-His (+) (Invitrogen/Life Technologies GmbH, Darm specific bi-scFv proteins the human embryonic kidney cell stadt, Germany). The C-terminal 6xHis-tag served for metal affinity purification of the protein and for detection analysis. line HEK293 (ATCC CRL-1573) was used. All constructs were verified by sequencing via MWG’s single 0438 1x107 HEK293 cells were plated two days prior to read sequence service (Eurofins MWG Operon, Ebersberg, transfection on 14.5 cm tissue culture dishes in 20 ml com Germany). For construct schemata see also FIG. 11. plete DMEM medium (DMEM/F-12 GlutaMax supple mented with 10% heat inactivated FBS and 0.5% penicillin TABLE 4 streptomycin; all reagents from Gibco/Life Technologies GmbH, Darmstadt, Germany). Before transfection, cells Summary of TAA and CD3 specific bispecific were washed with DPBS supplemented with 2 mM EDTA, single chain antibody constructs then 20 ml of plain DMEM medium without FBS or antibi Internal Codon otics were added. 20 lug of linearized DNA of the constructs l8le TAA Specificity 5'-V-V. 3'-V-V, usage pcDNA3.1/6PHU5 and pcDNA3.1/6PHU3 (described under 1BiMAB CLDN18.2 human mCLDN18.2ab TR66 HS Example 9.a) were diluted in 0.5 ml plain DMEM/F-12 6PHUS CLDN6 human mCLDN6ab TR66 HS medium. 75 ul of 1 mg/ml linear PEI solution (Polyethylen 6PHU3 CLDN6 human TR66 mCLDN6ab HS imine; Polysciences Europe GmbH, Eppelheim, Germany) 6PMUS CLDN6 murine mCLDN6ab 145-2C11 MM were added to the diluted DNA and rigorously vortexed. After 6PMU3 CLDN6 murine 145-2C11 mCLDN6ab MM 15 minincubation at RT, the DNA/PEI complexes were added HS, Homo sapiens; dropwise to the cells, cell culture dishes were gently rotated MM, Mus musculius; and then incubated at 37°C., 5% CO. 24 h after transfection TAA, tumor associated antigen, the medium was changed. Selection of transfected cells was started 48 h after transfection with G418 sulfate (Gibco/Life TABL 5 Summary of bi- scFv construct information CD3 binding moiety

Internal mAB Species TAA binding moiety Species Short

ale origin reactivity TAA mAB origin reactivity 5'-V-W. 3'-V-W linker

1BiMAB TR66 human CLDN182 mCLDN18 .2ao human, mCLDN18.2ao TR66 GGGGS murine

6PHUS TR66 human CLDN6 mCLDN6ao human, mCLDN6ao TR66 SGGGGS murine

6PHU3 TR66 human CLDN6 mCLDN6ao human, TR66 mCLDN6ao SGGGGS murine

6PMUS 145 - 2C11 murine CLDN6 mCLDN6ao human, mCLDN6ao 145 - 2C11 SGGGGS murine

6PMU3 145 - 2C11 murine CLDN6 mCLDN6ao human, 145 - 2C11 mCLDN6ao SGGGGS murine

Anti-CD3 Internal 5'-long 3'-long Codon mAB ale linker linker Secretion signal usage reference

1BiMAB (GGGGS) VE (GGSGGS) MGWSCIILFLWATATGWHS HS Lanzavecchia & Scheidegger, GGWD Eur J. Immunol. 1987

6PHUS (GGGGS) VE (GGSGGS) MGWSCIILFLWATATGWHS HS Lanzavecchia & Scheidegger, GGWD Eur J. Immunol. 1987

6PHU3 VE (GGSGGS) (GGGGS) MGWSCIILFLWATATGWHS HS Lanzavecchia & Scheidegger, GGWD Eur J. Immunol. 1987

6PMUS (GGGGS) VE (GGSGGS) MGWSCIILFLWATATGWHS MM Leo et al., Proc Natl Acad GGWD Sci., 1987

6PMU3 VE (GGSGGS) (GGGGS) MNSGLOLVFFWLTLKGIQG MM Leo et al., Proc Natl Acad Sci., 1987

HS, Homo sapiens; mAB, monoclonal antibody; MM, Mus musculus; TAA tumor associated antigen. US 2016/0272711 A1 Sep. 22, 2016

Technologies GmbH GmbH, Darmstadt, Germany) in a final 0443 Before FPLC-purification, presence of bi-sch v in concentration of 0.8 mg/ml. G418 was added permanently to the cell culture Supernatant was tested by polyacrylamid gel the culture medium for cell culturing. electrophoresis followed by coomassie staining and western c. Small-Scale Production of Bi-ScFv Proteins 6PHU5 and blot analysis performed by standard procedures as briefly 6PHU3 with Polyclonal HEK293 Cells described under Example 9.c. 0439 Bi-scEv proteins 6PHU5 and 6PHU3 were small e. Purification and Quantification of Bi-scEv Protein 6PHU3 scale produced and purified from polyclonal HEK293 cell 0444 Cell culture supernatant of polyclonal HEK293 Supernatants for in vitro comparison. cells containing bi-scFv protein 6PHU3 (described under 0440 Briefly, at confluent state, supernatant without FBS Example 9.b) was subjected to immobilized metal affinity was harvested from the polyclonal cell lines described under chromatography (IMAC) using standard procedures (Current Example 9.b and filtered with 0.2 um Minisart syringe filters Protocols in Protein Science, 2012). Briefly, cell culture (Sigma-Aldrich, Germany). Subsequently, bi-scFV proteins supernatant was loaded onto a His Trap FF 5 ml column were small-scale purified from cell culture supernatants by connected to an AKTA Purifier 10 FPLC system (both GE Ni-NTA spin columns according to the manufacturer's pro Healthcare Life Sciences, Munich, Germany). PBS washing tocol (Qiagen, Hilden, Germany). Bi-ScFv protein concentra buffer contained 10 mM imidazol, PBS elution buffer con tions were determined by measurement at 280 nm with a tained 500 mM. NaCl, 50 mM NaHPO and 250 mM imida NanoDrop 2000c under consideration of the extinction coef Zol, pH of both buffers was adjusted to 7.4. Elution was ficient and molecular weight—determined via the ProtParam performed by a stepwise gradient. Eluted bi-scFv protein tool (http://web.expasy.org/protparam/)—of bi-scFV protein 6PHU3 was immediately dialyzed against 1xPBS using a 6PHU5 and 6PHU3. Purified proteins were stored at 4°C. for Slide-A-Lyzer G2 Dialysis Cassette 10K MWCO (Pierce/ immediate use. Thermo Fisher Scientific, Rockford, Ill., USA). After PBS 0441 Bi-scFv proteins were tested by polyacrylamid gel dialysis, bi-scFv was dialyzed against a 200 mM arginine electrophoresis followed by coomassie staining and western buffer (L-Arginin-monohydrochloride; Roth, Karlsruhe, blot analysis performed by standard procedures (Current Pro Germany) based on H.O. tocols in Protein Science, 2012). Small-scale purified pro 0445 Bi-scFv concentration was determined by measure teins were separated on NuPAGENovex 4-12% Bis-Tris Gels ment at 280 nm with a NanoDrop 2000c under consideration (Invitrogen/Life Technologies GmbH, Darmstadt, Germany). of the extinction coefficient and molecular weight of bi-scFv Subsequently, the gels were stained with Coomassie Brilliant protein 6PHU3. Blue solution according to standard procedures (Current Pro 0446 Purified protein was aliquoted and stored at -80°C. tocols in Protein Science, 2012) to detect bi-scFv proteins for long time storage or kept at 4°C. for immediate use. 6PHU5, 6PHU3, and other proteins contained in the cell 0447 Quality and purity of bi-scFv protein 6PHU3 was culture supernatant. Western blot analysis was performed to tested by Coomassie Staining and western blot analysis as specifically detect bi-scFv proteins 6PHU5 and 6PHU3 via described under Example 9.c. A BSA standard dilution was their 6xHis-tag. Briefly, after blotting proteins on PVDF included in the Coomassie procedure to roughly confirm the membrane and blocking with PBST/3% milk powder, the concentration measured by NanoDrop (data not shown). membrane was incubated for 1 h at 4°C. with primary anti body Anti-HIS Epitope-Tag (Dianova GmbH, Hamburg, Ger Example 10 many) diluted 1:500 in blocking buffer. After washing with blocking buffer, membranes were incubated with Fc-specific Efficiency of CLDN6-Targeting Bi-scFv Candidates secondary peroxidase-conjugated goat-anti-mouse IgG anti 6PHU5 and 6PHU3 body (Sigma Aldrich, Germany) diluted 1:10000 in blocking 0448 a. Microscopic Analysis of T Cells Redirected to buffer for 1 h at 4°C. After washing with blocking buffer Target Cells by Bi-scEv Proteins 6PHU5 and 6PHU3 again, the signals were visualized by SuperSignal West Femto 0449. To visualize the redirection of effector cells to Chemiluminescent Substrate (Pierce/Thermo Fisher Scien CLDN6-expressing target cells by bi-scFv proteins via tific, Rockford, Ill., USA) and recorded by an ImageOuant microscopic analysis, an in vitro cytotox assay was per LAS 4000 Imager (GE Healthcare Life Sciences, Munich, formed. NiNTA column-purified bi-scEv proteins 6PHU3 Germany). Signals of bi-scFv proteins were detected between and 6PHU5 (see Example 9.c) were used to compare these 50 and 60 kD as compared to the internal molecular weight two variants according to their efficiency. As target cell line standard. the ovarian teratocarcinoma cell line PA-1 that endogenously d. Large Scale Production of Bi-scFv Protein 6PHU3 with expresses high levels of human CLDN6 was used. Polyclonal HEK293 Cells 0450 Human effector cells were freshly isolated from 0442. The polyclonal producer cell line was cultured in a human blood from healthy donors according to standard pro 10-layer Cell Factory (Nunc, Roskilde, Denmark) in DMEM/ cedures (Current Protocols in Protein Science, 2012): briefly, F-12 GlutaMax supplemented with 10% FBS, 0.5% penicil blood was diluted with DPBS, layered on Ficoll-Paque Plus lin-streptomycin and 0.8 mg/ml G418 (all reagents from (GE Healthcare Life Sciences, Munich, Germany) and cen Gibco/Life Technologies GmbH, Darmstadt, Germany) trifuged. Peripheral blood mononuclear cells (PBMCs) were according to the manufacturer's guidelines. At confluent collected from the interphase, washed with cold DPEBS stage, cells were washed with DPBS and medium was supplemented with 2 mM EDTA and counted. Human T cells changed to DMEM/F-12 medium with antibiotics but without were Subsequently separated by magnetic-activated cell sepa FBS. Cell supernatant containing bi-scFv protein 6PHU3 was ration (MACS) from PBMCs by Pan T Cell Isolation Kit II harvested every 3-5 days for up to 3 weeks. Supernatant was (Miltenyi Biotec, Teterow, Germany) according to the manu filtered with 500 ml Steritop Filter Units (Merck Millipore, facturer's guidelines. Billerica, Mass., USA) and stored at 4°C. until FPLC-puri 0451 1x10 PA-1 cells per well were seeded into tissue fication. culture 6-well plates. Humancells were prepared as described