DOCSLIB.ORG

Double-Stranded Templates

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Double-Stranded Templates Proc. Natl. Acad. Sci. USA Vol. 77, No. 7, pp. 4147-4151, July 1980 Cell Biology Transcription of tRNA genes in vivo: Single-stranded compared to double-stranded templates (eukaryotic gene transcription/oocyte injection/single-stranded DNA vector/DNA synthesis) RICCARDO CORTESE*t, RICHARD HARLAND, AND DOUGLAS MELTON MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 2QH, England Communicated by F. Sanger, April22, 1980 ABSTRACT The expression of cloned tRNA genes has been studied by injecting single-stranded and double-stranded DNA Ceti templates into Xenopus oocyte nuclei. In both forms the genes are faithfully transcribed after injection. Some single-stranded DNA is converted into double-stranded DNA in the oocyte nu- Cut with Taq I cleus. This conversion is necessary for the expression of the in- 750-bp fragment jected tRNA gene: no tRNA transcription is observed when DNA -tNA Gap fill synthesis is inhibited. We conclude that single-stranded DNA blunt ends does not serve as a template for faithful transcription of this 6 LI p!!" gene in injected oocytes. igate EcoRI I _i1I, , linkers Isolated cellular DNA behaves as a stable duplex. However, R R R R R Cut with during transcription only one strand is copied into RNA, and a, q:I3Gq~~~~~IsltLc L2-,LI W CL,tRNAhE~] FcoRI to accomplish this the DNA helix may be made locally unstable Isolate tRNA by cellular factors. Studies of eukaryotes in vitro show that RNA gene from gel polymerase II transcribes a denatured template better than a 280-bp fragment native template, and RNA polymerase III transcribes both Insert into mp2 equally well (1, 2). Obviously, transcription by purified poly- merase and a DNA template does not necessarily reflect what happens in the cell, where initiation and termination of a transcript could be determined by additional factors. Never- Transfect and isolate clones theless, if the signals for initiation and termination are recog- nized in denatured parts of the gene, then a single strand of the Two orientations gene might be expected to contain enough information for Double strand in cell correct initiation and termination of transcription. The possibility that single strands of a tRNA gene, which is tRNA tRNA normally transcribed by RNA polymerase III (1), support faithful transcription has been tested in vvo by injection of this gene into the nucleus of Xenopus oocytes. Xenopus oocytes contain everything necessary to assemble injected DNA into chromatin (3, 4), transcribe it faithfully (5-9), process the transcripts (9-11), and translate injected mRNA (12). Single-strand virion Pure sense (coding) or antisense (noncoding) single strands of a nematode tRNA gene were obtained by using a single- stranded cloning vector derived from bacteriophage M13 (13). The gene was injected into Xenopus oocytes in either single- stranded (ss) or double-stranded (ds) form. We conclude that Sense strand of &RNA gene Antisense strand of tRNA gene neither the-sense strand nor the antisense strand of the tRNA hybridizes to [3P3 tRNA does not hybridize to [32PltRNA gene alone contains enough information for correct transcrip- mCetlS mCetlA tion, but that a double-stranded template is necessary. FIG. 1. Construction of mCetlS and mCetlA clones. Conditions for enzyme reactions have been described (see ref. 9 for endonuclease and ligase reactions and ref. 14 for DNA polymerase I Klenow frag- MATERIALS AND METHODS menxt gap-filling reaction). Transfection was done as described (14). Bacterial and Bacteriophage Strains. The mp2 strain of T, Taq I cleavage site; R, EcoRI cleavage site. bacteriophage M13 was grown on Escherlchia coil K-12 71-18 performed according to Genetic Manipulation Advisory Group as described (13, 14). Ceti, a recombinant plasmid carrying a II single nematode tRNAPrO gene in ColEl, has been described guidelines: category experiment 5607/11/5. elsewhere (9). All manipulations with recombinant DNA were Abbreviations: ds, double-stranded; ss, single-stranded; araCTP, cy- tosine i6-D-arabinofuranoside 5'-triphosphate; bp, base pair. The publication costs of this article were defrayed in part by page * On leave from the Istituto di Chimica Biologica, II Facolta di Med- charge payment. This article must therefore be hereby marked "ad- icine e Chirurgia, University of Naples, Naples, Italy. vertisement" in accordance with 18 U. S. C. §1734 solely to indicate t Present address: European Molecular Biology Laboratory, 6900 this fact. Heidelberg, West Germany. 4147 Downloaded by guest on September 24, 2021 4148 Cell Biology: Cortese et al. Proc. Natl. Acad. Scd. USA 77 (1980) Preparation of ss DNA and ds DNA. ss DNA was prepared Preparation of 3P-Labeled DNA. A protocol identical to as follows: 10-ml cultures of infected cells in 1.6% Tryptone/1% the one described above was used to obtain labeled ss DNA. One yeast extract/5% (wt/vol) NaCl, pH 7.4, were grown to late millicurie (1 Ci = 3.7 X 1010 becquerels) of carrier-free [32P]- logarithmic phase. After centrifugation, the phage was pre- orthophosphate (Amersham) was added when cells reached an cipitated from the supernatant by addition of polyethylene OD6so . of 0.1. The specific activity obtained was more than glycol 6000 and NaCl, final concentrations of 4% (wt/vol) and 104 dpm/,ug of DNA. 32P-Labeled ds DNA used as marker was 0.5 M, respectively. After centrifugation at 30,000 X g for 20 prepared by nick translation (16). mn, the pellet was resuspended in 100 ,AI of standard saline Oocyte Microinjections. They were performed by the citrate (0.15 M NaCI/0.015 M Na citrate) and extracted with standard procedure described (17). RNA extractions and gel phenol followed by ether. The aqueous phase was brought to electrophoresis were done as before (9). DNA was extracted 0.3 M NaOAc and precipitated with ethanol. The pellet was according to Wyllie et al. (3). then resuspended in 10 Ml of H20 and used for injections. CaCI Equilibrium Density Gradient Centrifugation. ds DNA was prepared as follows: E. coil K-12 71-18 was Batches of 20 oocytes were injected with unlabeled DNA at 100 grown to an nm of 0.3 and then infected with mp2 and Mug/ml, [32P]dCTP at 2.5 mCi/ml, and BrdUTP at 7.5 mM and OD65o incubated for 4 hr at room temperature (at this concentration mp2 derivatives at a multiplicity of 10 plaque-forming units/ BrdUTP completely substitutes for dTTP in DNA; unpublished cell. After 3 hr the cells were harvested and the ds DNA (rep- observations). Oocytes were homogenized in 1.5 ml of 1% Na- licative form I) was purified as described (15). Alternatively, DodSO4/30 mM EDTA/20 mM Tris-HCl, pH 7.9/50 mM small-scale preparations of ds DNA were made by using the NaCI/500 Mg of predigested Pronase per ml, incubated at 370C bacterial pellet resulting from ss DNA preparations (see above). for 1 hr, extracted twice with phenol, and precipitated with Cells were lysed and a clear lysate was prepared as in ref. 15. ethanol. The pellet was resuspended in 100 ul of RNase A (100 The supernatant was then extracted with phenol and precipi- mg/ml) in 50 mM NaCl/10 mM TrisVHCI, pH 7.9/1 mM tated with ethanol. The resulting pellet was resuspended in 25 EDTA and incubated at 370C for 30 min. At this stage, aliquots Al of HaO. Occasionally, before injection, the DNA was filtered were electrophoresed on agarose gels to establish the purity and through glass wool. The purity and integrity of the DNA was integrity of the DNA. The solution was made up to 2.1 ml with checked by 0.8% agarose gel electrophoresis, as described 10 mM Tris-HCI, pH 7.9/1 mM EDTA and added to 2.9 g of (9). CsCl. By addition of further buffer, the refractive index was I i i 1- --! -- 1- -1i II +- ti I F' i -*o I- I "__ 9 L1- - --I E- FIG. 2. Analysis by electrophoresis on a 1% agarose gel of the fate of ss [32PJDNA injected into oocytes. Groups of 12 oocytes were injected with 50 ni of mCetlS [32P]DNA at 100 ,ug/ml. The injections were into either the nucleus or the cytoplasm. Incubation times were as shown. ds form I (closed circular supercoils), form II (nicked circles), and form III (linear molecules) markers and ss DNA markers are in lanes ds and ss, respectively. Downloaded by guest on September 24, 2021 Cell Biology: Cortese et al. Proc. Natl. Acad. Sci. USA 77 (1980) 4149 ( '; ': .:I 0 1.1 " 1.1 ... 40f * i ._0 .4W 0 A* 4 x-4 *N -t * x ftt -O.* a6a -_%F **, 10 20 30 Fraction FIG. 4. Isopycnic centrifugation of mCetlS DNA synthesized in a_*_ injected oocytes in the presence of the density label, BrdUTP. Groups of 20 oocytes were injected with mCetlS ss DNA (-) or with mCetlS ds DNA (o). Incubation was for 4 hr. HH, HL, and LL correspond to marker heavy-heavy and heavy-light strands and unsubstituted DNA, respectively, run in parallel gradients. Density in g/cm3 (A). K-12 71-18), clones carrying inserts into the EcoRI site can be identified as white plaques, whereas the intact vector forms blue plaques (2). Phage mp2, like the parental M1S, does not kill the host cell. The (+)strand of the virus is continuously secreted into the medium as a filamentous virion containing circular ss DNA. In these same cells, however, there are always many copies of FIG. 3. Autoradiogram of 10% polyacrylamide gel electrophoresis. the supercoiled ds replicative form. Restriction enzyme digest (lanes 1 and 2 with Hpa II; lanes 3 and 4 In a previous paper (9) we described a recombinant plasmid with Taq I) ofds DNA extracted from injected oocytes (Inj.) and from control mCetlS-infected E.
Load more

Recommended publications
  • Resistance to HIV (Exercise)
    1 Evolution in fast motion – Resistance to HIV (Exercise) Resistance to HIV In the early 1990s, a number of studies revealed that some people – although they had repeatedly contact with HIV – did not become carriers of HIV or, in the case of a confirmed HIV-infection, showed a delayed onset of the disease (AIDS) (a delay of several years was reported). First attempts to explain these phenomena were observed a few years later, when scientists identified important co-receptor molecules on the surface of the host cells, which are essential for HIV to infect the host cell. Scientists assumed that resistant persons may carry an aberrant version of the co-receptor molecule, which makes it impossible for the virus to enter the host cell. Such a co-receptor is the chemokine co-receptor CCR5, which is normally involved in the host’s immune answer (Dean & O’Brien, 1998). In order to test their hypothesis, the scientists sequenced the genes which code for the co- receptor CCR5. They investigated more than 700 samples from HIV-infected patients and compared them with the CCR5-sequences from more than 700 healthy persons. The results of the DNA-sequencing revealed mutations in the CCR5-gene in HIV-infected persons with a delayed onset of AIDS, as well as in some samples of healthy persons (but not in HIV- patients with typical onset of AIDS) (Samson et al., 1996). Exercises 1. In material 1, you can find two CCR5-gene-sequences selected from the data set of the scientists. Compare the sequences and a. find out where the mutation is (identify the position and label it in both! sequences).
    [Show full text]
  • Lecture 1 1. to Understand the Flow of Biochemical Information from DNA to RNA to Proteins and Ultimately to Biochemical And
    Lecture 1 1. To understand the flow of biochemical information from DNA to RNA to proteins and ultimately to biochemical and cellular function and dysfunction (disease) Central Dogma: DNARNAProteinPhenotype NucleotidegeneDNAchromosomegenome - In reality it is much more complex DNA sequence RNA sequence Protein sequence Protein structure Protein function RNA structure RNA function Know: - Structure of DNA/RNA and proteins - Intermolecular interactions: o Hydrogen bonds o Disulfur bonds o Ion bonds o Polar bonds - Main aspects of the central dogma o Translation (at the ribosome) o Transcription o Genetic code DNA structure: - Sugar-phosphate backbone - 4 bases o A/G = purines o T/C = pyrimidines o A-T and G-C - 5’-3’ antiparallel (always read 5’3’) o Addition occurs at the 3’ end o 5’ position to commence reading depends on promotor o Reading frame depends on promotor - Coding and template strand: o Depends on the position of the promotor RNA structure: - U replaces T - Self-complementarity = annealing of strand to itself - tRNA/mRNA/pre-RNA - Spliced (exons remain) to form mature RNA Therefore 6: - 3 from the codon from the top 5’ end, 3 from the codon from the bottom 5’ end. Protein Structure: Chemical Properties Depends on N or C-terminus, peptide bonds and side chains - Non-polar aliphatic - Polar but uncharged - Aromatic - Positively charged - Negatively charged pKa = pH at which the protein has a charge of zero. Alpha-helices: side chains point sideways Beta-helices: - Parallel and anti-parallel to produce alternate the direction the side chains point - In reality, there is a combination of parallel and anti-parallel side chains - Different bonds between NH and CO groups in each direction of side chain Sample Question 1.
    [Show full text]
  • IGA 8/E Chapter 8
    8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? Answer: The arrows for genes 1 and 2 indicate the direction of transcription, which is always 5 to 3. The two genes are transcribed from opposite DNA strands, which are antiparallel, so the genes must be transcribed in opposite directions to maintain the 5 to 3 direction of transcription. 2. In Figure 8-5, draw the “one gene” at much higher resolution with the following components: DNA, RNA polymerase(s), RNA(s). Answer: At the higher resolution, the feathery structures become RNA transcripts, with the longer transcripts occurring nearer the termination of the gene. The RNA in this drawing has been straightened out to illustrate the progressively longer transcripts. 3. In Figure 8-6, describe where the gene promoter is located. Chapter Eight 271 Answer: The promoter is located to the left (upstream) of the 3 end of the template strand. From this sequence it cannot be determined how far the promoter would be from the 5 end of the mRNA. 4. In Figure 8-9b, write a sequence that could form the hairpin loop structure. Answer: Any sequence that contains inverted complementary regions separated by a noncomplementary one would form a hairpin. One sequence would be: ACGCAAGCUUACCGAUUAUUGUAAGCUUGAAG The two bold-faced sequences would pair and form a hairpin. The intervening non-bold sequence would be the loop. 5. How do you know that the events in Figure 8-13 are occurring in the nucleus? Answer: The figure shows a double-stranded DNA molecule from which RNA is being transcribed.
    [Show full text]
  • Comparative Analyses of Long Non-Coding RNA in Lean and Obese Pigs
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 25), pp: 41440-41450 Research Paper Comparative analyses of long non-coding RNA in lean and obese pigs Lin Yu1, Lina Tai1, Lifang Zhang1, Yi Chu1, Yixing Li1 and Lei Zhou1 1State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, College of Animal Science and Technology, Guangxi University, Nanning, P.R. China Correspondence to: Yixing Li, email: [email protected] Lei Zhou, email: [email protected] Keywords: lncRNA, pig, obesity, QTL Received: April 28, 2017 Accepted: May 15, 2017 Published: May 26, 2017 Copyright: Yu et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Objectives: Current studies have revealed that long non-coding RNA plays a crucial role in fat metabolism. However, the difference of lncRNA between lean (Duroc) and obese (Luchuan) pig remain undefined. Here, we investigated the expressional profile of lncRNA in these two pigs and discussed the relationship between lncRNA and fat deposition. Materials and Methods: The Chinese Luchuan pig has a dramatic differences in backfat thickness as compared with Duroc pig. In this study, 4868 lncRNA transcripts (including 3235 novel transcripts) were identified. We determined that patterns of differently expressed lncRNAs and mRNAs are strongly tissue-specific. The differentially expressed lncRNAs in adipose tissue have 794 potential target genes, which are involved in adipocytokine signaling pathways, the PI3k-Akt signaling pathway, and calcium signaling pathways.
    [Show full text]
  • LESSON 4 Using Bioinformatics to Analyze Protein Sequences
    LESSON 4 Using Bioinformatics to 4 Analyze Protein Sequences Introduction In this lesson, students perform a paper exercise designed to reinforce the student understanding of the complementary nature of DNA and how that complementarity leads to six potential protein reading frames in any given DNA sequence. They also gain familiarity with the circular format codon table. Students then use the bioinformatics tool ORF Finder to identify the reading frames in their DNA sequence from Lesson Two and Lesson Three, and to select Class Time the proper open reading frame to use in a multiple sequence alignment with 2 class periods (approximately 50 their protein sequences. In Lesson Four, students also learn how biological minutes each). anthropologists might use bioinformatics tools in their career. Prior Knowledge Needed • DNA contains the genetic information Learning Objectives that encodes traits. • DNA is double stranded and At the end of this lesson, students will know that: anti-parallel. • Each DNA molecule is composed of two complementary strands, which are • The beginning of a DNA strand is arranged anti-parallel to one another. called the 5’ (“five prime”) region and • There are three potential reading frames on each strand of DNA, and a total the end of a DNA strand is called the of six potential reading frames for protein translation in any given region of 3’ (“three prime”) region. the DNA molecule (three on each strand). • Proteins are produced through the processes of transcription and At the end of this lesson, students will be able to: translation. • Amino acids are encoded by • Identify the best open reading frame among the six possible reading frames nucleotide triplets called codons.
    [Show full text]
  • Base Paring Rules for Transcription
    Base Paring Rules For Transcription Jerry window-shop his Jon traversings unduly or shortly after Giff vacillated and nerves turbulently, Silvanintoxicated labialised and camouflaged. unofficially if attentionalSynchronistic Martin Moore compel twigging, or puzzling. his clapboard curses leasing grindingly. Since the template strand will contain base pairs that bond precisely with the. Dna Base Pair Worksheet Teachers Pay Teachers. Most images show 17 base pairs The coding strand turns gray page then disappears leaving the template strand see strands above Anti-codons in the template. DNA Base Pairing Worksheet 1 CGTAAGCGCTAATTA 2. One strand whereas the DNA duplex the template strand is transcribed into a segment of mRNA shown according to the prior base-pairing rules used in DNA. As surgery the damage of DNA replication base-pairing rules apply However. Base pairs refer them the sets of hydrogen-linked nucleobases that window up nucleic acids DNA and RNA. Students begin by replicating a DNA strand and transcribing the DNA strand into RNA Then they create base pairing rules and search the. Topic 27 DNA Replication Transcription and Translation. Transcribe the DNA strand until the complementary base pairs. Therefore translation of the messenger RNA transcribed from this mutant. DNA RNA Transcription and Translation Protein Synthesis. The base-pairing rules summarize which The template strand despite the DNA contains the gene and is being transcribed pairs of nucleotides are complementary. Transcription Translation & Protein Synthesis Gene. The cell's DNA contains the instructions for carrying out the work of border cell. Rules of Base Pairing A with T the purine adenine A always pairs with the pyrimidine thymine T C with G the pyrimidine cytosine C always.
    [Show full text]
  • Differences in Methylation Patterns in the Methylation Boundary Region of IDS Gene in Hunter Syndrome Patients: Implications for Cpg Hot Spot Mutations
    European Journal of Human Genetics (2006) 14, 838–845 & 2006 Nature Publishing Group All rights reserved 1018-4813/06 $30.00 www.nature.com/ejhg ARTICLE Differences in methylation patterns in the methylation boundary region of IDS gene in hunter syndrome patients: implications for CpG hot spot mutations Shunji Tomatsu*,1, Kazuko Sukegawa2, Georgeta G Trandafirescu1, Monica A Gutierrez1, Tatsuo Nishioka1, Seiji Yamaguchi3, Tadao Orii2, Roseline Froissart4, Irene Maire4, Amparo Chabas5, Alan Cooper6, Paola Di Natale7, Andreas Gal8, Akihiko Noguchi1 and William S Sly9 1Department of Pediatrics, Saint Louis University, Pediatric Research Institute, St Louis, MO, USA; 2Department of Pediatrics, Gifu University School of Medicine, Gifu, Japan; 3Department of Pediatrics, Shimane University, Shimane, Japan; 4Centre d’Etude des Maladies Me´taboliques, Hoˆpital Debrousse, Lyon France; 5Institut de Bioquimica Clinica, Barcelona, Spain; 6Willink Biochemical Genetics Unit, Royal Manchester Children’s Hospital, Great Britain, UK; 7Department of Biochemistry and Medical Biotechnologies, University of Naples, Federico II, Italy; 8Institut fur Humangenetik, Universitatsklinikum Hamburg-Eppendorf, Hamburg, Germany; 9Edward A. Doisy Department of Biochemistry and Molecular Biology, Saint Louis University School of Medicine, St Louis, MO, USA Hunter syndrome, an X-linked disorder, results from deficiency of iduronate-2-sulfatase (IDS). Around 40% of independent point mutations at IDS were found at CpG sites as transitional events. The 15 CpG sites in the coding sequences of exons 1 and 2, which are normally hypomethylated, account for very few of transitional mutations. By contrast, the CpG sites in the coding sequences of exon 3, though also normally hypomethylated, account for much higher fraction of transitional mutations.
    [Show full text]
  • Lecture #1: Introduction Syllabus Introduction to Biology
    Special Topics in Computational Biology Lecture #1: Introduction Bud Mishra Professor of Computer Science and Mathematics 1 ¦ 25 ¦ 2001 Syllabus • Introductory Material – What do we know? – Biological information – Biotechnology (e.g. arrays, PCR, hybridization; single molecules; mass spectrometry) – Some biology (terminology) • Population Genetics – Diseases – Linkage analysis – Kinship analysis • Comparative Genomics – Phylogeny – Gene rearrangements between species – Gene families within specie • Functional Genomics – Taking cells at different stages of development, what can we infer from gene expression levels data? Can we determine the sequence of gene activation? Tools that allow biologists to try to answer these questions.) – Genetic Networks – Clustering algorithms • Proteomics • Cancer Genomics – (What can be done here) Introduction to Biology • Genome: – Hereditary information of an organism is encoded in its DNA and enclosed in a cell (unless it is a virus). All the information contained in the DNA of a single organism is its genome. • DNA molecule can be thought of as a very long sequence of nucleotides or bases: = {A, T, C, G} Complementarity • DNA is a double-stranded polymer and should be thought of as a pair of sequences over . However, there is a relation of complementarity between the two sequences: – A , T, C , G – That is if there is an A (respectively, T, C, G) on one sequence at a particular position then the other sequence must have a T (respectively, A, G, C) at the same position. • We will measure the sequence length (or the DNA length) in terms of base pairs (bp): for instance, human (H. sapiens) DNA is 3.3 £ 109 bp measuring about 6 ft of DNA polymer completely stretched out! Genome Size The genomes vary widely in size: measuring from » 11 • Few thousand base pairs for viruses to 2 » 3 £ 10 bp for certain amphibian and flowering plants.
    [Show full text]
  • GEP Glossary
    GEP Glossary Topic Definition 3' Refers to the third carbon of the nucleic acid sugar moiety to which additional nucleotides may be added by polymerase, often used to refer to that end of a single-stranded DNA or RNA molecule where the 3' carbon is unattached to an adjacent nucleotide; cf. 5'. 454 sequencing A large-scale parallel pyrosequencing system capable of sequencing roughly 400-600 megabases of DNA per 10-hour run. The technology is known for its relatively unbiased sample preparation and moderately long, highly accurate sequence reads (~400 pairs in length). 5' Refers to the fifth carbon of the nucleic acid sugar moiety, to which the triphosphate is attached in a nucleotide triphosphate, often used to refer to that end of a single-stranded DNA or RNA molecule where the 5' carbon's phosphate group is unattached to an adjacent nucleotide; cf. 3'. ab-initio In computing, ab initio is a term used to define computations based solely on theory or using only fundamental constants. In computational biology, the term refers to algorithms that use only sequence information rather than including experimental observations to make predictions about gene structure. accession number A unique identification number given to every DNA, RNA, and protein sequence submitted to NCBI or equivalent databases. For example, the human leptin receptor's accession number is P48357 in the SwissProt database. alignment In bioinformatics, a sequence alignment is a way of arranging two or more sequences of DNA, RNA, or protein to identify regions of similarity; such similarity may be a consequence of functional, structural, or evolutionary relationships between the sequences.
    [Show full text]
  • Glossary of Terms Note: Words in Bold in a Definition Indicate Terms Also Defined in This Glossary
    Glossary of Terms Note: Words in bold in a definition indicate terms also defined in this Glossary Term Definition “3 prime”; Refers to carbon 3 of the nucleic acid sugar component (either ribose in RNA or deoxyribose in DNA) to which additional nucleotides may be added by 3' polymerase, often used to refer to that end of a single-stranded DNA or RNA molecule where the 3' carbon retains its hydroxyl group (-OH) and no further nucleotides are bonded. “5 prime”; Refers to carbon 5 of the nucleic acid sugar component (either ribose in RNA or deoxyribose in DNA), to which the triphosphate is attached in a nucleotide 5' triphosphate, often used to refer to that end of a single-stranded DNA or RNA molecule where the 5' carbon's phosphate group(s) is/are unattached to a preceding nucleotide. The inclusion or exclusion of certain exons in the splicing reactions that determine the sequences included in the final mRNA product. This mechanism is utilized to generate a series of closely related protein isoforms, which differ by the inclusion alternative splicing or exclusion of the particular protein regions encoded by those exons. Alternative splicing is directed by RNA-binding proteins that may block, or stimulate, utilization of a particular splice site. The basic building block of proteins, a small molecule with a -C-C- core, an amine group (-NH2) at one end and a carboxylic acid group (-COOH) at the other end. The amino acid general structure can be represented as NH2-CHR-COOH, where R can be any of 20 different functional groups of acidic, basic, or nonpolar character.
    [Show full text]
  • Antisense Rnas During Early Vertebrate Development Are Divided in Groups with Distinct Features
    Downloaded from genome.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press Research Antisense RNAs during early vertebrate development are divided in groups with distinct features Sanjana Pillay,1 Hazuki Takahashi,2 Piero Carninci,2,3 and Aditi Kanhere4,5 1Department of Cell, Developmental and Regenerative Biology, Mount Sinai School of Medicine, New York, New York 10029, USA; 2Laboratory for Transcriptome Technology, RIKEN Center for Integrative Medical Sciences, Yokohama, Kanagawa, 230-0045, Japan; 3Fondazione Human Technopole, 20157 Milan, Italy; 4Institute of Systems, Molecular and Integrative Biology, University of Liverpool, Liverpool, L69 3GE, United Kingdom Long noncoding RNAs or lncRNAs are a class of non-protein-coding RNAs that are >200 nt in length. Almost 50% of lncRNAs during zebrafish development are transcribed in an antisense direction to a protein-coding gene. However, the role of these natural antisense transcripts (NATs) during development remains enigmatic. To understand NATs in early vertebrate development, we took a computational biology approach and analyzed existing as well as novel data sets. Our analysis indicates that zebrafish NATs can be divided into two major classes based on their coexpression patterns with re- spect to the overlapping protein-coding genes. Group 1 NATs have characteristics similar to maternally deposited RNAs in that their levels decrease as development progresses. Group 1 NAT levels are negatively correlated with that of overlapping sense-strand protein-coding genes. Conversely, Group 2 NATs are coexpressed with overlapping protein-coding genes. In contrast to Group 1, which is enriched in genes involved in developmental pathways, Group 2 protein-coding genes are en- riched in housekeeping functions.
    [Show full text]
  • UN2005/UN2401 '20 -- Lecture # 13 -- RNA & Protein Synthesis 0. Energy Poll (#1 of Last Time) Revisited II . Central Dogma
    UN2005/UN2401 '20 -- Lecture # 13 -- RNA & Protein Synthesis (c) 2020 Mowshowitz Department of Biological Sciences Columbia University New York, NY. Last revised 10/22/20 Handouts: You will need 12 A – PCR 13 A -- code table & tRNA structure 13 B -- DNA synthesis vs RNA synthesis PDFs are linked to the Handouts page. Note that Dr. Mary Ann Price has made videos of all class demonstrations; see the videos link on the Course Menu. (We also have 2 older videos of protein synthesis; links are below.) 0. Energy Poll (#1 of last time) Revisited Qs: How many ATPs are used and how many ‘high energy bonds’ are broken to add one dCMP to a growing chain? Ans: It takes two ATP but >2 high energy bonds. Details: 1. Two high energy bonds (in ATP) are broken to convert dCMP to dCTP. This is not a net change, but involves the breaking of 2 high energy bonds (in the ATP) to form 2 (in the dCTP). 2. Then two P's in the dCTP are knocked off in two steps, breaking two high energy bonds. (First, the bond between the inner P and the other 2 is broken, and PPi is released. Then the bond between the two 2 P's in PPi is broken.) P = phosphate. 3. Overall: Four high energy bonds are broken, but two are made, for a net change of 2. So 4 high energy bonds are broken, but only 2 high energy bonds are used up (net), More Q to think about: 1. How come the same enzyme can catalyze a reaction in both directions? Say A B and B A? 2.
    [Show full text]