Developing a zebrafish model system for thrombocyte research
Master Degree Project in Systems Biology A2E, SY749A Two years Level ECTS Spring and Autumn 2017 (2018-01-19)
Author: Aida Kaffash Hoshiar [email protected] Molecular Biotechnology (systems biology)
Supervisor: Marcel den Hoed [email protected] Dept. of Immunology, Genetics and Pathology, Uppsala University
Co-supervisor: Ci Song [email protected] Dept. of Medical Sciences, Uppsala University
Examiner: Diana Tilevik [email protected] School of Bioscience, University of Skövde
Högskolan i Skövde Högskolevägen Box 408, 541 28 Skövde Sweden Abstract
Platelets are blood cells produced from megakaryocytes, and their function is to stop bleeding in injury time. Low platelet count cause disorders like thrombocytopenia and abnormal bleeding. Thanks to 70% similarity of zebrafish genes to human, developing a transgenic zebrafish model system with fluorescently labeled thrombocytes and red blood cells can help us study drugs effects on platelets. Genome-wide association studies have identified several loci linked to platelet count in humans. This study aimed to develop and validate a zebrafish model system to study thrombocyte related research using aspirin as a drug well characterized effects. Then, generate multiplex mutant zebrafish line for thrombocyte count related genes. By taking advantage of CRISPR-Cas9 genome- editing technology, a mutant zebrafish model was generated to study seven candidate genes related to platelet count in human. To examine the effect of aspirin, larvae at four days post fertilization were treated with two doses of aspirin (5 µg/ml and 45 µg/ml) for 24 h. At five day post fertilization treated and control groups were imaged for thrombocyte count and body size using a high- throughput vertebrate automated screening technology BioImager. A mixed effect model was used in statistical analysis. The mean thrombocyte count in the control group (n=152), as well as in the group treated with 5 µg/ml (n=150) and 45 µg/ml (n=154) aspirin was 14.65 ± 4.24, 15.54 ± 4.11, and 15.65 ± 4.77 respectively. The ranges of mean thrombocyte count in all groups were 4.95 to 42.4. Only higher dose of aspirin (45 µg/ml) showed statistically significant increased on thrombocyte count (P<0.05). However, the body size factors were increased in both aspirin treated groups compared with controls (P<0.05). This may suggest an unknown role of aspirin in development stage that needs further investigation. The transgenic zebrafish model for thrombocyte and red blood cell could be used as a model system in thrombocyte related studies as well as drug screening.
Popular scientific summary
Blood is made of different kind of blood cells that are all produced from bone marrow. One type of these important cells is called platelets (in mammalian) or thrombocytes (in fish). If an injury occurs and causes bleeding, platelets aggregate together in order to stop the bleeding. When there is lack of platelet in blood, they cannot make clots to ban the bleeding and one can die from bleeding. Thrombocytopenia is a bleeding genetic disorder in low level of platelets. The treatment addresses the cause of disease that may refer to bone marrow or different unknown genetics variants. Genome-wide association studies have identified genetic variants associated with platelet count. A good way to examine which of the genes near these variants are the causal genes is to knock out the genes in an animal model system to see the effect on platelet count. Transgenic zebrafish larva with fluorescently labeled thrombocytes and red blood cells are a good model system to examine the function of the genes on blood cells. In current study, seven genes related to platelet count in human were knocked out in transgenic zebrafish using CRISPR-Cas9 technology (cas9 protein cuts specific part of double stranded DNA and cause insertion or deletion mutation in DNA sequence). Then, one can study the effect of those genes on blood cells count using high throughput screening under novel microscopy techniques. Aspirin is a well-known antiplatelet drug that is also widely used for other purposes, like to control fever, as a painkiller, and after heart attack. Long-term low doses of aspirin inhibit the aggregation of platelets by blocking formation of thromboxane A2 in humans. Thromboxane A2 is a protein that motivates the activity of other platelets and enhances platelets aggregation. Although people have been using aspirin for more than a century, its side effects, especially on development, are still incompletely understood. In this experiment, transgenic zebrafish larvae at four day post fertilization (dpf) were treated with two doses of aspirin (5 µg/ml and 45 µg/ml) for 24 h to see its effect on thrombocyte count as well as on body size. The low dose of aspirin (5 µg/ml) was reported to prevent thrombosis in 5 dpf zebrafish larvae. The selected high dose of aspirin (45 µg/ml) is 10% of the lethal concentration for 3-5 dpf larvae. The treated and control groups were imaged in 5 dpf for thrombocyte count and body size, followed by a statistical analysis to study the effect of aspirin on both thrombocyte count and body size. It was observed that 45 µg/ml resulted in a higher thrombocyte count in zebrafish larvae. In addition, because the larvae were in developing stage while treated with aspirin, body size was higher in both groups treated with low and high doses of aspirin compared with untreated controls. This may indicate an unknown molecular mechanism of aspirin’s target during the development process. However, in adult humans low dose of aspirin intake is 1.5 mg/kg (75 mg for 50 kg adult human) while in this study low dose of aspirin was 10,000 mg/kg (5 µg/ml for 0.5 mg larvae) and high dose of aspirin was 90,000 mg/kg (45 µg/ml for 0.5 mg larvae). An animal model system to study platelet related research, could increase our understanding on different molecular mechanism of drugs and their side effect in various doses.
List of abbreviations
CAD Coronary Artery Disease CRISPR Clustered Regularly Interspaced Short Palindromic Repeats dpf days post-fertilization DsRed Discosoma Red fluorescent protein eGFP enhanced Green Fluorescent Protein FLA Fragment Length Analysis GWAS Genome-wide association studies hpf hour post-fertilization HSCs Hematopoietic Stem Cells KLF1 Kruppel-Like Factor 1 MAP1A Microtubule Associated Protein 1A NFE2 Nuclear Factor Erythroid 2 PLT Platelet Count RBCs Red Blood Cells sgRNA single guide Ribonucleic Acid VAST Vertebrate Automated Screening Technology
Table of Contents
1. Introduction ...... 1 1.1. Platelet function and development ...... 1 1.2. Zebrafish as a model to study blood cells ...... 2 1.3. Aspirin's antiplatelet effect ...... 2 1.4. Genome–wide association studies for PLT...... 3 1.5. CRISPR/cas9 technology ...... 4 1.6. Aims ...... 4
2. Material and methods ...... 4 2.1. Zebrafish handling, husbandry, and sorting transgenic zebrafish ...... 5 2.2. Aspirin treatment...... 5 2.3. High throughput imaging on thrombocyte count and RBCs by VAST BioImager ...... 5 2.4. Quantification of thrombocyte count ...... 6 2.5. Body size analysis...... 7 2.6. Statistical analysis ...... 7 2.7. Generation of transgenic zebrafish mutant lines with platelet related genes ...... 8 2.7.1. CRISPR-Cas9 target design ...... 8 2.7.2. Preparation of sgRNA oligos and FLA primers for ordering ...... 8 2.7.3. sgRNA preparation ...... 9 2.7.4. Microinjection...... 9
3. Results ...... 9 3.1. Script annotation results for thrombocyte count ...... 9 3.2. Thrombocyte count and body size ...... 10 3.3. The effect of aspirin on thrombocyte count ...... 11 3.4. The effect of aspirin on body size ...... 11 3.5. Select the target gene region and designed CRISPR-Cas9 targets ...... 12
4. Discussion and conclusion...... 12
5. Ethical aspects and impact on the society ...... 15
6. Future perspective ...... 15
7. Acknowledgments ...... 16
8. References ...... 17
9. Appendix I ...... 23
10. Appendix II ...... 26
1. Introduction 1.1. Platelet function and development
Platelets, or thrombocytes, are blood cells that are responsible to stop bleeding by releasing fibrinogen-like material after dissipating (Laki, 1972). Their function is to ban bleeding to prevent loss of blood in injury time (Laki, 1972). When injuries occur, platelets bind to materials beyond the endothelium, change their shape, turn on a series of surface receptors, release multiple signals to stimulate a change in platelet shape, ultimately aggregating, and making bridges to stop bleeding (Yip et al., 2005). In humans, these blood cells stay in the circulation for about ten days, although studies showed that in metabolic diseases like diabetes this life span is approximately seven days (Tindall et al., 1981). Platelet count (PLT) is widely used in clinical trials as part of the complete blood count examination. In a healthy man, mean platelet volume (MPV) ranges 10.4 fL (femtolitre) (Peng et al., 2018) and PLT ranges from 1.5 to 4.0 × 109 per liter (Ross et al., 1988). At times of stress or disease like thrombocytopenia or idiopathic thrombocytopenic purpura (ITP), this amount might be lower (Branehog et al., 1975). A low PLT count indicates abnormal bleeding. Hematopoietic stem cells (HSCs) are located in osteoblastic niches and give rise to megakaryocytes (Reems et al., 2010). Platelets are produced by progenitor stem cells from megakaryocytes in the bone marrow (Machlus et al., 2014). It is reported that approximately 2,000 to 11,000 platelets are released per megakaryocyte cell in the bone marrow (Kaufman et al., 1965). Many genes are involved in regulating the progress of platelet biogenesis, for example, GATA-1 is shown to have an important function in the case of megakaryocytes, which is a progenitor of blood platelets (Shivdasani et al., 1997). Cooperation of GATA-1 transcription factor with FOG-1 is reported as an important factor in different stages of megakaryopoeisis (Crispino, 2005). Mutations in GATA-1 protein cause anemia and thrombocytopenia (Nichols et al., 2000). However, the reactivity of this protein is not reported in mature platelets and red blood cells (RBCs) (Lee et al., 2017). Nuclear Factor Erythroid 2 (NFE2) is another transcription factor that has been reported as an important regulatory factor in expression of several genes related to thrombocyte generation (Tiwari et al., 2003). The development of platelets from Human Pluripotent Stem Cells (HPSCs) occurs in three main steps: first from Pluripotent Stem Cells (PSCs) to progenitor cells, then maturation, and finally release of platelets (Sim et al., 2016). In the final phase of platelet generation, megakaryocytes change their whole cytoplasm and a part of the cells break to produce platelet (Battinelli et al., 2007). Besides that, PSCs are important factors for genome-editing technologies since they have the ability for self-renewal and differentiation to megakaryocytes then platelets (Li et al., 2014). These stem cells can be used for testing drugs and modeling complex diseases (Wang Y. et al., 2014). In the human body, platelets are produced from differentiation of hematopoietic stem cells (HSCs) that gives rise to different blood cells (Figure 1) (Yin and Li, 2006).
Figure 1. Hematopoietic stem cells (HSCs) are the cells near the endosteal bone that move to the bone marrow area by blood, differentiate to different cells, and give rise to megakaryocytes. At the end megakaryocytes cell produce platelets. MPPs: Multipotent Progenitor stem cells, CMP: Common Myeloid Progenitor, MKEP: Megakaryocyte Erythroid Progenitor, MK: Megakaryocyte (Adapted from Thon and Italiano, 2010).
Page | 1
Different mechanisms are involved in platelet clearance; platelets release signals to induce apoptosis by aging, and they can be removed by immune cells when antibodies attach to them (Grozovsky et al., 2015). 1.2. Zebrafish as a model to study blood cells
The zebrafish (Danio rerio) has become a popular model organism in human disease like hematopoietic disorders, cardiovascular disorders, and kidney disorders. (Dooley and Zon, 2000). However, there are some advantages and disadvantages of using this model system. Its genome has been sequenced completely, which has turned zebrafish into a famous model for human disease, and roughly 70% of human genes have orthologs in zebrafish (Howe et al., 2013). This fish has 26,206 protein-coding regions in its genome and about 69% of these genes have at least one ortholog in human, although only 47% of human genes have one by one correlation with this animal (Collins et al., 2012). Zebrafish grow fast and are suitable for high-throughput screening (Weyand and Shavit, 2014). The advantage of using high throughput screening is to increases the sample size and thereby the statistical power (Li et al., 2017). A larger sample size increases the statistical power and the likelihood of finding statistically significant result (Dorey, 2011). The short fertilization cycle and transparency of larvae are important factors that increase the efficiency of using this animal for studies related to human disease (He et al., 2014). The similarities in molecular mechanisms and signaling pathways between zebrafish and humans make this animal a good model of studying cardiovascular diseases as well as other human diseases (Bournele and Beis, 2016). Zebrafish come with a huge range of naturally occurring genetic variation. A comparative study on the zebrafish reference genome has reported roughly 5.2 million single nucleotide variations (SNVs) and more than 1.6 million insertion and deletion variations (Patowary et al., 2013). It is shown that inbreeding in a small population reduced the variation (Whiteley et al., 2011). One disadvantage of using zebrafish in human platelet study is the difference in structure of thrombocytes in zebrafish and platelets in human. In zebrafish, thrombocytes have a nucleus, while human platelets have lost their nucleus in development (Khandekar et al., 2012). However, studies have shown similar morphological and functional activities between human platelets and zebrafish thrombocytes (Jagadeeswaran et al., 1999). Zebrafish carrying a fluorescent marker on the cd41 promoter have fluorescently labelled thrombocytes (cd41:eGFP) (Lin et al., 2005). In gata1:DsRed transgenic zebrafish, RBCs are fluorescently labeled using a gata-1 promoter expressing Discosoma red fluorescent protein (DsRed) (Long et al., 1997). Multicolor-labelled transgenic fish enable the performance of different experiments simultaneously. For example, a transgenic zebrafish with cd41:eGFP+/gata1:DsRed+ can be used as a model system to study a drug effect on both thrombocytes and RBCs. 1.3. Aspirin's antiplatelet effect
Aspirin is known to reduce the risk myocardial infarction by prohibiting blood clots (Dalen, 2006). Platelets attach to the endothelial part of blood vessels’ wall when the tissue is damaged (Ruggeri, 1997). Previous studies have shown that even low doses of aspirin increase the bleeding time in normal patients (Quick, 1966). It is widely known that aspirin has an antiplatelet impact, but its molecular mechanisms of action are still unclear (Miner and Hoffhines, 2007). Although this drug has some beneficial effects to prevent myocardial infarction, it has some side effects as well. Aspirin is toxic and causes liver degeneracy and decreased liver size in zebrafish (He et al., 2013). Studies showed that aspirin speed up heart rate in zebrafish meaning that this drug is considered a cardiotoxic drug (Zhu et al., 2014). Twenty mg/kg of aspirin treatment for 48-h induced thrombosis in a rat model but showed no effect on either PLT or RBC count (Ma et al., 2015). Patients suffering from coronary artery disease (CAD), showed a lower response to platelet count on 75 mg aspirin per day for seven days compared with healthy controls, but had a higher RBCs count and plasma levels (Karolczak et al., 2013). In another study on patients suffering from CAD, 162 mg aspirin did not
Page | 2 show any significant change on platelet count after 2 h (Nishiyama et al., 2003). Moreover, in a study on healthy humans with 250 mg aspirin intake daily for 7 days, it was reported an increased in PLT in the first day (Erhart et al., 1999). Understanding whether aspirin can affect circulating blood cell count in zebrafish will enhance our understanding of aspirin’s effect on blood cell counts in humans. However, there are effects of aspirin that are still unclear. For example, aspirin is banned in children under 16 years of age because it increases the risk of Reye's syndrome (Macdonald, 2002). 1.4. Genome–wide association studies for PLT
Genome-wide association studies (GWAS) have been conducted to increase our understanding of the genetic architecture of human traits. Thousands of genetic loci have been associated with human traits. Greedy Randomized Adaptive Search Procedure (GRASP) contains more than 6 million single-nucleotide variants (SNV) phenotype associations that have been identified by GWAS (Leslie et al., 2014). However, in most cases, the causal genes remain unclear. Nowadays, the big challenge is to find a way to identify the causal genes for complex diseases (Varshney et al., 2015). Previous GWAS identified some important genes related to PLTs, (Figure 2) (Eicher et al., 2016).
Figure 2. Among the genes associated with platelet, 56 single-nucleotide variants (SNVs) showed correlation to PLT (Adapted Eicher et al., 2016).
Platelet-associated variants implicated some genes that are anticipated to be relevant for PLT, for example: MAP1A, ZMIZ2, SMG6, ARFGAP3, IQGAP2, KARLN, NFE2, and PEAR1 (Eicher et al., 2016). ZMIZ2 showed a corporation in RBCs traits as well as increase of PLT (Eicher et al., 2016). ZMIZ2 protein is also called ZIMP7 and has a key regulatory role in the Wnt/β-catenin signaling pathway (Lee et al., 2013). This signaling pathway is involved in controlling cell proliferation in development of embryos as well as homeostasis in adult tissues (MacDonald et al., 2009). MAP1A is reported to increase PLT but decreases RBC counts (Chami et al., 2016). Microtubule associated protein 1A (MAP1A) and MAP1B are two proteins that have a role in the neuronal cytoskeleton regulatory mechanism. However, the light chains of these proteins are suggested to have a regulatory function for heavy chains as well as other independent biological functions that are still unclear (Wolff et al., 2005). MAP1A protein has also been associated with Casein Kinase 1 δ (CK1δ) protein (Wolff et al., 2005). Expression of IQGAP2 protein is reported in human platelets and its function is to activate platelets by regulating thrombin (Schmidt et al., 2003). In addition, IQGAP2 may have a physiological function in cytoskeletal actin synthesis, according to its domain shape (Djinovic Carugo et al., 1997). Smg6 is another human protein that has an ortholog in zebrafish and is a homolog of Est1 protein, which has been associated with telomerase and telomere regulation (Reichenbach et al., 2003). In SNVs studies, ARFGAP3 and PACSIN2 genes have been reported to have corporation with decreasing PLT (Eicher et al., 2016). For instance, a point mutation in rs1018489 single nucleotide polymorphism (SNP) in ARFGAP3 showed correlation with a lower PLT. However, this variant is an expression quantitative trait locus (eQTL) for PACSIN2 (Eicher et al., 2016). PACSIN2 protein via interaction of
Page | 3
FLNA regulates establishment of megakaryocytes during platelet generation by marking tubulation in plasma membrane (Begonja et al., 2015). The Kruppel-like factor 1 (KLF1) protein is a transcription factor that controls production of erythrocytes by regulating erythroid progenitors cells (Hariharan et al., 2017). NBEAL2 is shown to play a role in thrombocyte formation. Mutations in this gene cause Gray Platelet Syndrome (GPS) (Albers et al., 2011). In this rare disorder, platelets and their progenitor megakaryocytes are almost free from alpha-granules (White et al., 2006). An association for lipids traits is observed for SH2B3 and GCKR genes, which leads to association with PLT association between several lipid loci with PLT (Eicher et al., 2016). In general, a few genes have been identified in platelet function, hemostasis, and thrombosis (Khandekar et al., 2012). 1.5. CRISPR/cas9 technology
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) is a genome editing technology that can introduce mutations in the DNA sequence using a single guide ribonucleic acid (sgRNA) and Cas9 protein (Zhang et al., 2014). Cas9 protein (endonuclease enzyme) attaches to complementary sequence of sgRNA on one strand of double stranded DNA and cut both strands of DNA (Liang et al., 2017). The cell’s endogenous repair system detects the damaged part and tries to repair it by adding nucleic acids to both strands, resulting in insertions or deletions in the damaged region. CRISPR-Cas9 can be used to generate multiplex mutant lines, i.e. targeting multiple genes simultaneously. Zebrafish that transgenically express cd41:eGFP – tagging thrombocytes and gata1:DsRed – tagging RBCs can serve as an ideal background in which CRISPR-Cas9 mutants for prioritized genes will be generated. 1.6. Aims
Develop a zebrafish model system for genetic screens on thrombocyte and red blood cell count. To have a model system for human platelet and red blood cells related studies. Validate the model system by examining effects of aspirin on thrombocyte count by counting mean value of moving thrombocytes in caudal vessels with 20 sec video in 5 dpf transgenic zebrafish larvae, followed by screening thrombocyte count using high throughput imaging. To have an efficient and cheaper model system than mice or rat to screen drugs effects. Generate zebrafish mutants for candidate genes related with platelet count in humans using CRISPR-Cas9. In order to identify platelet count causal genes for future study on drug targets. To identify causal genes related to platelet count for probable study on drug targets.
2. Material and methods
Methods in this experiment were followed based on the following flow chart (Figure 3).
Figure 3. Pipeline of the methods described in a flow chart. The project was started with developing zebrafish transgenic line and validates the model system using aspirin. Then, high-throughput imaging was applied to thrombocyte count and body size. In the next step, thrombocyte count and body size were analyzed and a
Page | 4 statistical analysis was applied to the data to study association between thrombocyte count and aspirin as well as body size and aspirin. Finally, a multiplex mutant line was generated using CRISPR-Cas9 system. 2.1. Zebrafish handling, husbandry, and sorting transgenic zebrafish
Adult transgenic zebrafish for cd41:eGFP were crossed to transgenic fish for gata1:DsRed to generate a double positive (cd41:eGFP+/gata1:DsRed+) transgenic line for fluorescently labeled thrombocytes in green and RBCs in red. Fish were kept in an automatic light and temperature controlled zebrafish facility in Scilifelab Uppsala University with 14 h light and 10 h dark and in zebrafish system water with controlled pH, nitrite, and temperature. (Appendix I, Table 1). The adult double positive zebrafish were fed twice daily at 9:00 h and 15:30 h with dry food (ZEBRAFEED by SPAROS 400-600) and rotifers. The rotifers were fed twice per day with algae (PHYTOBLOOM GREEN FORMULA), 4 ml in the morning and 6 ml in the afternoon. These transgenic zebrafish were housed in 10 l tanks with the ratio of six to eight females and eight males in system water. Experiments in this study were mainly conducted using offspring’s of this double positive line at 5 dpf. To collect larvae, two to three female and three male zebrafish were set up in 1 l breading tanks for mating. Each adult female zebrafish was able to produce approximately 200 eggs per week with high fertilization rate. The eggs were collected next day and kept in 92x16 mm petri dish with 0.001% methylene blue (Sigma-Aldrich) solution. The 0.001% methylene blue solution was used to limit bacterial and fungus growth in zebrafish larvae culture and was made using 0.5 ml stock solution dissolved in 500 ml filtered water. After hours post fertilization (hpf), fertilized eggs were selected and up to 50 embryos were kept in a 92x16 mm petri dish with methylene blue solution in an incubator at 28.5 °C. At 5 dpf, 1 ml tricaine solution (Sigma-Aldrich, Cat. A-5040) was added to each petri dish to anesthetize larvae. Tricaine solution was made using a protocol from zfin (www.wiki.zfin.org) (Appendix I, Table 2). Then, anesthetized larvae were transferred to 96-well plate to sort for fluorescently labeled thrombocytes and RBCs (double positive) using an EVOS microscope (EVOSTM Auto 2, invitrogen). Finally, selected transgenic larvae (cd41:eGFP+/ gata1:DsRed+) were put back in a petri dish in methylene blue solution in incubator for aspirin treatment experiment at 4 dpf. 2.2. Aspirin treatment
Aspirin (acetylsalicylic acid) was purchased from Sigma-Aldrich (Cat. A6810-250G). The stock solution was prepared by dissolving 0.01 gr aspirin powder in 5 ml methylene blue solution. Two different aspirin concentrations were chosen to test in this experiment: 1) 5 μg/ml, an effective dose of aspirin that has reported to prevent thrombosis in 5 dpf zebrafish (Zhu et al., 2016) 2); and 45 μg/ml, a lethal concentration 10% (LC10) for larva between 3-5 dpf (He et al., 2013). Twenty double positive zebrafish larvae (cd41:eGFP+/gata1:DsRed+) at 4 dpf (96 hpf) were transferred to 55x15 mm petri dishes with 9 ml methylene blue solution. For 5 μg/ml and 45 μg/ml aspirin treatment groups 30 μl and 270 μl from aspirin stock solution were added to each petri dish, respectively. An untreated group was used as control. All groups were kept in incubator with 28.5°C for 24 h. Three different groups were blinded in the whole experiment with C1, C2, and C3, which were the groups treated with 5 μg/ml and 45 μg/ml aspirin, and the untreated group. 2.3. High throughput imaging on thrombocyte count and RBCs by VAST BioImager
Five dpf larvae were collected at 9:00 h and anesthetized for imaging. Larvae were anesthetized in a tricaine solution (i.e., 8 ml tricaine in 300 ml filtered water) before imaging. To limit batch effects due to selection bias, three different groups were blinded for the operator who was conducting the imaging with numbers from 1 to 3. Two larvae were anesthetized each time from each group for imaging. Time of day and tank number were recorded to learn whether these factors could affect our conclusion in the later statistical analyses. Imaging was conducted using VAST BioImager (Union
Page | 5
Biometrica Inc, Geel, Belgium) (Change et al., 2012; Pardo-Martin et al., 2013). The VAST BioImager was connected to a Leica DM6000B LED automated upright fluorescence microscope (MicroMedic AB, Stockholm, Sweden) and LAS X software (Leica Microsystems CMS GmbH, 1.1.12420.0). When the larva was automatically loaded into a borosilicate capillary in VAST, it was detected by a camera and 12 whole-body images were obtained in one full rotation. A Leica drop-in objective with 10X magnification (Leica OBJ HCX APO L 10X/0.50 W) was used to optimize a small window (X=1.27 mm, Y=200.87 μm) covering part of caudal artery (CA) and caudal vein (CV) vessels. The circulating thrombocytes and RBCs passed by the window were recorded in two ~20 s videos, separately. Exposure time (fluorescent camera’s shutter speed) and gain were set as 30.00 milliseconds (ms) and 1.4 respectively, resulting in 519 cycles in total and 26.5 frame rate per second (Appendix I, Table 3.1-4). Green and red fluorescent channels were applied for thrombocytes and RBCs respectively. Leica DFC365 FX CCD camera was detected and recorded fluorescent signal from each channel. 2.4. Quantification of thrombocyte count
A customized software, ThrombocyteCount v1.2, was applied to quantify the thrombocyte count from videos of moving thrombocytes in caudal vein and caudal artery in each fish. It was derived by IT support in Uppsala University from a script written in MATLAB (R2016b). The software took the raw video from LAS X software and transferred thrombocyte count to a result video as outcome as well as a text file to report the counted number of thrombocytes per frame. The software was designed to capture moving spots (moving thrombocytes) in each image, and objects smaller than five pixels were removed from the count to erase unwanted noise. For each time point, area of the objects, the total number of spots and the fluorescent intensity in all spots were exported as outcome (Figure 4).
Figure 4. One out of 519 frames of moving and not moving (marked with red circle) thrombocytes in a 20 sec video with green spots and its script’s outcome with white spots. Only moving spots larger than 5 pixels were counted as thrombocytes by the script.
Optimization for LAS X setting and thrombocyte count script were performed based on various exposure time (from 10 ms to 50 ms) and gain (1.5 and 1.4) in LAS X by imaging 5 dpf transgenic zebrafish larvae and analyzing by the ThrombocyteCount software. Then, both raw and result videos plus the number of counted spots from script were compared to each other using ImageJ 1.51o (Schneider et al., 2012). Annotation was done to choose the best setting with high sensitivity that was captured maximum number of moving thrombocytes in each frame with the following description and algorithms:
True positive (TP): Number of real thrombocytes in raw file that ThrombocyteCount software counted as thrombocytes. False Positive (FP): Number of false thrombocyte spots in raw file that ThrombocyteCount software counted as thrombocyte in result file.
Page | 6
False Negative (FN): Number of real thrombocytes in raw file that ThrombocyteCount software did not count as thrombocyte in result file. Sensitivity: False positive rate (FP rate):
2.5. Body size analysis
To analyze body size in treated zebrafish with two doses of aspirin vs. controls, the whole-body images from VAST BioImager (twelve body images in one full rotation in capillary) were preprocessed and analyzed using an in-house image-analysis pipeline using ImageJ 1.50d. A customized classifier was prepared using ilastik 1.1.5 (Sommer et al., 2011) that uses image pixel intensity to distinguish between fish, capillary, and background (Figure 5). Then the classifier was used to identify fish and measure body length, dorsal and lateral area in CellProfiler 2.1.2 (Jones et al., 2008). The whole-body volume for each fish was evaluated at the end by another customized pipeline in ImageJ 1.50d. Finally, annotation was done based on annotation criteria for anthropometric traits (Appendix I, Table 4).
Figure 5. Body size analysis procedure of first out of twelve images for anthropometric traits from VAST (from left to right). Firstly, raw images were preprocessed in imageJ. Then, a classifier was designed for all twelve images with different positions in one complete rotation to use in CellProfiler to get dorsal and lateral area size as well as length. Finally, the whole-body volume was measured in imageJ by combining twelve images from CellProfiler outcome (last image). 2.6. Statistical analysis
The mean value of thrombocyte count at the caudal vein (CV) and dorsal artery (DA) in 5 dpf zebrafish larvae was compared between control group and two aspirin treated groups. Then, the effect of aspirin on thrombocyte count was analyzed using linear regression and multi-variant mixed effect models using STATA (14.2). Three different regression models were used to study association between thrombocyte count and aspirin with the following formulas:
1. y = β1x1 2. y = β1x1 || batch 3. y = β1x1 + β2x2 + β3x3 + β4x4 || batch
In the first model, thrombocyte count was the dependent variable (y), while treatment with aspirin was the independent variable (x1). β1 was the effect of aspirin on thrombocyte count. A second model was preferred adjusting for batch (date). In addition, the fish imaged in the same day were treated as a cluster in the model, considering they shared more unknown/unmeasured factors. These factors, may affect the association between aspirin and thrombocyte count, such as handling the fish. In third model, three more covariates were added to a mixed effect model: fish length (x2), dorsal area (x3), and time of day (x4). β2, β3, and β4 were effects of length, dorsal area, and time of imaging on thrombocyte count respectively. The aim of any analysis technique is to draw out precise assessment from raw data and to answer the question whether there is a statistical association between reaction variable (y) and exposure variables (xi) (Alexopoulos, 2010). In all models, aspirin
Page | 7 treatment was treated as a categorical variable, so that, aspirin doses of 5 μg/ml and 45 μg/ml were compared with the control group separately. Association between body size factors and aspirin was with the following formulas:
Length: y1 = β1x1 + β5x2 || batch Dorsal area: y2 = β2x1 + β5x2 || batch Lateral area: y3 = β3x1 + β5x2 || batch Volume: y4 = β4x1 + β5x2 || batch
Body size factors like: length, dorsal area, lateral area, and the whole-body volume were dependent variables (y1, y2, y3, and y4 respectively). β1-5, were the effect of aspirin on length, dorsal area, lateral area, volume, and time of measurement respectively. X1 was treatment with aspirin as the independent variable and X2 was time measurement in imaging day (from 9:00 am to 5:00 pm). Imaging was done in eight different days and in all four equations day of imaging was adjusted as batch effect. P-values lower than 0.05 indicate a significant association. 2.7. Generation of transgenic zebrafish mutant lines with platelet related genes
2.7.1. CRISPR-Cas9 target design
Twenty genes were selected based on previous genome-wide exome array association study for platelet count (Eicher et al., 2016). Orthologs in zebrafish as well as percentage of similarity to human sequence for those genes were then annotated using Ensembl (www.ensembl.org) and genomicus (www.genomicus.biologie.ens.fr). The transcript ID with the most overlap from ensembl (in the case of many transcripts) was selected to use in CHOPCHOP (chopchop.cbu.uib.no) to select sgRNAs targets. If there was a gene with multiple transcripts but no overlap between these, independent targets would be selected for different transcripts. One sgRNA target for each gene was selected based on target design criteria (Appendix I, Table 5). One criteria for selecting targets was the target efficiency score. Target efficiency was calculated by GC-content in sgRNA (40 to 70%) and checking if the 20 bp target ending with a G (Wang T. et al., 2014). Forward and reverse primers also were chosen from suggested primers in CHOPCHOP to amplify the target region in PCR. The sequence of target region from Ensembl was recorded using ApE (ApE 2.0.49, 2016) as a reference sequence.
2.7.2. Preparation of sgRNA oligos and FLA primers for ordering
Target preparation was performed as described by Varshney et al., 2016. In order to prepare sgRNA for injection to zebrafish larvae two oligos were annealed (oligo A and oligo B). Oligo A was gene specific and contained the target sequence. Oligo B was a gRNA core with 80-bp, and the same for all the genes (5′-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTA TTTCTAGCTCTAAAAC-3′). In order to anneal oligo A and B, a complementary sequence to part of oligo B was added to the end of oligo A sequence (23-bp overlap to the sequence marked with red color). T7 or SP6 promoter sequence was added to the beginning of oligo A sequence for RNA polymerase to start in vitro transcription of the DNA oligo to RNA. M13 sequence was added to upstream of the forward FLA primer and Pigtail sequence was added to upstream of the reverse FLA primer (Appendix I, Table6). A fluorescent primer was used (M13-FAMTM) in PCR protocol in FLA preparation for fluorescent detection of the amplicons that was complementary to the M13 sequence. Pigtail sequence was added to ensure consistency in amplicon size (Brownstein et al., 1996) (Appendix II, Figure 1).
Page | 8
2.7.3. sgRNA preparation
First, oligo A and B were annealed using Phusion polymerase in PCR. To check if annealing was successful, DNAs were run in 2% agarose gel (Fisher Scientific BP1356-500). Then, based on promoter sequence that was added to the beginning of each sgRNA target sequence, T7 (Thermo Fisher Scientific #K0441) or SP6 (Invitrogen MEGAscriptTM SP6) kit were used for in vitro transcription to transcribe DNA to RNA. After minimum 3 h of keeping in 37 °C incubator, RNA purification was done using RNA Clean & ConcentratorTM-5 (The Epigenetics company #R1016) kit. Purified RNAs then measured with nanodrop, diluted to 250 ng/μl, and stored in -80 for test and real injection. To check the quality of RNAs, they were also subjected to 2% agarose gel electrophoresis.
2.7.4. Microinjection
Test injection was done to check targets efficiency and choose a highly efficient sgRNA target for each gene (minimum inducing mutants in 50% of injected fish). Two to three pairs of wild type zebrafish were set up in the day before injection in 1 l tanks with a divider between males and females to control the laying time. The fish were kept in the same condition that was explained in aspirin treatment. Selected sgRNAs for injection were heated to 30 °C for 12 mins to avoid self- complementary. They were then mixed with 250 pg per target (up to eight targets) plus 250 pg cas9 mRNA in a PCR tube (Varshney et al., 2015). Co-injections of targets and cas9 mRNA were performed at the one-cell stage. Un-injected embryos were used as controls. The larvae were sorted after 6 hpf, and fertilized eggs were kept in 92x16 mm petri dishes with methylene blue solution in an incubator at 28.5°C. Up to ten injected larvae and two controls were sacrificed at 4 dpf to check whether CRISPR-Cas9 induced mutant was successful or not. The larvae were anesthetized by 1 ml tricaine in each petri dish. Then, they were placed one by one to a PCR plate for DNA lysis. Lysis mix was prepared using proteinase K, recombinant PCR Grade (REF 03115828001) and lysis buffer at 1:100 ratio. Fifty μl of lysis mix was added to each well with fish to extract their DNA in 55 °C for 2 h and 98 °C for 10 mins using PCR. Gene specific primers were added to extracted DNA of each larvae followed by a matrix table (Appendix II, Figure 2). DNA fragments were prepared for fragment length analysis (FLA) using FLA protocol and amplified by fluorescent PCR program (Appendix I, Table 7.1-2). Products were subjected to 2% agarose gel electrophoresis to check the quality of the DNA fragments, and then they were submitted for FLA at the Uppsala Genome Center. At the end the FLA chromatograms result were analyzed by Peak Scanner v0.2 to see the mutation peaks and select desire targets based on recommended target activity criteria (Appendix I, Table 8). Finally, seven efficient targets were selected from the test injection. They were further used to generate the transgenic zebrafish line with multiple mutants for all seven selected genes. The microinjection was conducted in transgenic zebrafish (cd41:eGFP+/gata1:DsRed+) following the same procedure described above. At 5 dpf, the injected larvae were put in system to grow following the regular zebrafish handling protocol as described above.
3. Results 3.1. Script annotation results for thrombocyte count
The microscope was used to record several videos of circulating thrombocytes in the CV and DA region of transgenic zebrafish larvae. Acquired videos were, annotated by comparing randomly chosen frames from each raw video with their script’s result video and counted number of thrombocytes in a text file. Then, sensitivity and false positive rate were calculated to choose the best setting (Table 2). For exposure times of 10-35 ms, background noise was observed and counted as thrombocytes in the result file. With exposure times >40 ms this noise disappeared, however the sensitivity was decreased. Higher exposure times resulted in lower frame rates, resulting in some
Page | 9
moving thrombocytes being recorded as stripes instead of spots. In some cases, stripe shape of moving thrombocytes in exposure time >=40 ms was counted as more than one spot by the script, resulting in an overestimation of the thrombocyte count. Then, two suggested setting based on modified script were tested again and analyzed by a second version of the script (ThrombocyteCount v1.2). After annotation, an exposure time of 30 ms and a gain of 1.4 showed the highest sensitivity with fewer false positive. This setting was selected for the thrombocyte count experiment in zebrafish.
Table 2. Annotation result of different setting in fluorescent channel for first and second version of ThrombocyteCount script. ThrombocyteCount v1.1 ThrombocyteCount v1.2 Fish N Exposure time Gain* Noise** Sensitivity FP rate Exposure time Gain Noise Sensitivity FP rate (ms) (ms) 1 10 1.5 Yes ------2 15 1.5 Yes ------3 20 1.5 Yes ------4 25 1.5 Yes ------5 30 1.5 Yes ------6 35 1.5 Yes ------7 40 1.5 No 0.95 0.06 - - - - - 8 45 1.5 No 0.93 0.40 - - - - - 9 50 1.5 No 0.85 0.26 - - - - - 10 10 1.4 Yes - - 11 - - - - - 30 1.4 No 0.97 0.02 12 - - - - - 50 1.4 No 0.91 0.08
* Gain enhances the recorders sensitivity to light, and optimized gain was constant in the whole setting experiment. High gain decreases the quality of image/video (www.leica-microsystems.com). ** Noise here is recorded as background noise that counted as thrombocytes in script. 3.2. Thrombocyte count and body size
The mean values of thrombocyte count for each fish were obtained. The range of thrombocyte count among different groups was 4.95 to 42.4. In most fish, the thrombocyte count among 519 frames in ~20 sec for each fish was normal distributed (Supplementary I). Means and standard deviations (SD) for thrombocyte count, length, dorsal area, lateral area, and the whole-body volume were calculated (Table 3). In total, 152, 150, and 154 larvae were imaged in the control group, and groups treated with 5 µg/ml and 45 µg/ml aspirin. The mean value of thrombocyte count in the control group was 14.65±4.24, while in larvae treated with a lower and higher dose of aspirin counts were 15.45±4.11 and 15.65±4.77 respectively. The whole-body volume in the control group was 0.36 mm3, compared with 0.37 mm3 in both treated groups.
Table 3. Mean value and SD for thrombocyte count, length, dorsal and lateral area, and the whole- body volume in control and different doses of aspirin treatment groups. Variable Control Group_C3 Aspirin 5 µg/ml_C1 Aspirin 45 µg/ml_C2 Mean value SD Mean value SD Mean value SD Number of fish 152 - 150 - 154 - Thrombocyte count 14.65 4.24 15.45 4.11 15.65 4.77 Length (mm) 3.99 0.15 4.03 0.15 4.06 0.17 Dorsal area (mm2) 0.98 0.05 1 0.07 1.01 0.08 Lateral area (mm2) 1.30 0.08 1.31 0.1 1.32 0.11 Total Volume (mm3) 0.36 0.03 0.37 0.04 0.37 0.05
Page | 10
3.3. The effect of aspirin on thrombocyte count
Association between thrombocyte count and two aspirin treatment groups were analyzed using three regression models (Table 4). In first model, by comparing control group to 45 µg/ml aspirin treated group, thrombocyte count was 1.00 higher than in the treated group, with a boarder-line significant level (P=0.05). Treated with 5 µg/ml aspirin did not seem to affect thrombocyte count (p=0.12). Correction for batch (date), the significance levels of both aspirin treatment groups vs. controls were similar as in the first model. However, batch effect showed a statistically significant effect on thrombocyte count (p=0.0003). A model that additionally adjusted for length, dorsal area, and time of measurement showed similar results. Taken together, only a higher dose of aspirin showed a statistically significant effect on thrombocyte count.
Table 4. Three different regression models representing coefficient, range in 95% Confidence Interval (CI), and P value. Model 1* Model 2** Variable Coefficient 95% CI P-value Coefficient 95% CI P-value Aspirin 5 (µg/ml) 0.80 (-0.19, 1.79) 0.12 0.80 (-0.19, 1.79) 0.12 Aspirin 45 (µg/ml) 1.00 (0.02, 1.99) 0.05 0.98 (0.02, 1.94) 0.05 Batch effect - - - - - 0.0003
Model 3*** Variable Coefficient 95% CI P-value Aspirin 5 (µg/ml) 0.80 (-0.18, 1.78) 0.11 Aspirin 45 (µg/ml) 1.06 (0.08, 2.04) 0.03 Batch effect - - 0.01 Length (mm) -0.13 (-0.88, 0.63) 0.74 Dorsal area (mm2) -0.11 (-0.94, 0.72) 0.79 Time (h) -0.15 (-0.34, 0.04) 0.12
* Crude model. ** Using a mixed effect model to correct the batch effect. *** Second model (mixed effect model) and adjusted for length, dorsal area, and time of measurement. 3.4. The effect of aspirin on body size
The effect of aspirin on body size was investigated using a mixed effect model adjusted for batch (date) and time (Table 5). Aspirin in 5 µg/ml treated group resulted in 0.04 mm in longer larvae, with a 0.02 mm2 larger dorsal area, etc. when compared with controls. A statistically significant difference (p<0.05) was observed for all traits except lateral area (p=0.16). Larvae treated with 5 µg/ml and 45 µg/ml aspirin had a larger body size compared to controls. High dose of aspirin had increased 0.07 mm in length, 0.03 mm2 in dorsal area, 0.03 mm2 in lateral area, and 0.01 mm3 in total volume when comparing with untreated group.
Table 5. Mixed effect model of aspirin treatment for the whole-body size traits, adjusted for batch effect and measure time. Aspirin 5 µg/ml Aspirin 45 µg/ml Variable Coefficient 95% CI P-value Coefficient 95% CI P-value Length (mm) 0.04 (0.01, 0.07) 0.01 0.07 (0.04, 0.1) 4E-06 Dorsal area (mm2) 0.02 (0.01, 0.04) 6E-05 0.03 (0.02, 0.04) 2E-05 Lateral area (mm2) 0.01 (-0.005, 0.03) 0.16 0.03 (0.01, 0.04) 0.001 Total Volume (mm3) 0.009 (0.003, 0.02) 0.002 0.01 (0.006, 0.02) 2E-04
Page | 11
3.5. Select the target gene region and designed CRISPR-Cas9 targets
Twenty genes were selected from GWAS studies that have orthologues in zebrafish (four of these 20 genes have shown two orthologues in zebrafish) which have been reported to be associated with human platelet count (Eicher et al., 2016). Over 70 targets were designed for these genes, and about nine test injections were conducted for 24 orthologues. Two targets were designed and tested for about 50% of the genes, and for the rest of the genes four to six targets were designed and tested in order to find one that worked. In sgRNA target preparation, the quality of different targets were tested by gel electrophoresis in annealed DNA and purified RNA level (Appendix II, Figure 3). Based on FLA results from test injections seven efficient sgRNA targets (with moderate and high activity score) were selected to knock out seven genes in zebrafish (Table 6). Less and high similarity percentage of these seven selected genes to human sequence were belonged to nfe2 and myb with 29.40% and 59.13%.
Table 6. Seven selected genes related to platelet count in humans and their orthologues in zebrafish with similarity percentage and working sgRNA target sequence that co-injected with cas9 mRNA in first mutant line. Gene name Gene name Similarity (%) Transcript ID Target sequence for In Zebrafish In Human To human sequence In Zebrafish CRISPR-Cas9 (20bp) arfgap3 ARFGAP3 50.10% ENSDART00000156692.2 GGGTACACCTGTCCTTCATC sh2b3 SH2B3 37.04% ENSDART00000102236.4 GGGAGCGCTGGAATCCATGG myb MYB 59.13% ENSDART00000075730.6 GGGTCCAGCGTGTCTTGCCG nbeal2 NBEAL2 54.59% ENSDART00000158704.1 gGTCCCCCTTCTCCCCAAGG* klf1 KLF1 31.23% ENSDART00000011724.6 GGGCACCATGCTCTGTGTGG nfe2 NFE2 29.40% ENSDART00000014840.5 GGAGCCCATGGTATCTCAAG gckr GCKR 41.99% ENSDART00000148916.1 gGCATGTGTATTATCTGGGA*
Gene name Exon GC% Target Self- Off-targets CRISPRscan Primer In Zebrafish Efficiency complementarity* score Product size arfgap3 2 57% 0.40 0 0 40 218 sh2b3 1 70% 0.68 1 0 83 284 myb 2 70% 0.63 0 0 47 275 nbeal2 4 65% 0.62 1 0 64 263 klf1 2 65% 0.66 0 0 67 278 nfe2 4 61% 0.60 1 0 64 210 gckr 1 48% 0.58 0 0 46 258
* A point mutation in the beginning of two targets were done to change the first nucleotide to G in order to be able to use T7 promoter. ** One self-complementary is acceptable.
4. Discussion and conclusion
In this study, a zebrafish model system for platelet related research was developed using a high throughput screening approach. This experiment on transgenic zebrafish larvae with low and high doses of aspirin (5 µg/ml and 45 µg/ml) showed that larvae treated with a high concentration of aspirin had a higher thrombocyte count. A low concentration of aspirin did not show an effect on thrombocyte count. However, to observe an accurate result of low dose of aspirin on thrombocyte count a higher sample size is recommended. The doses used in this research were much higher than previously studies in humans. For example, a low dose of aspirin in humans was 1.5 mg/kg (75 mg aspirin for 50 kg human weight) while a low dose of aspirin in zebrafish that prevented thrombosis
Page | 12
(Zhu et al., 2016) was 10,000 mg/kg. Body mass in 5 dpf zebrafish was on average around 0.5 mg (Barrionuevo and Burggren, 1999). A higher dose of aspirin (45 µg/ml) as chosen in this experiment was LC10 for cardiac toxicity for 48 h aspirin treatment from 3-5 dpf (He et al., 2013). However, in this experiment, the aspirin treatment was done for 24 h and from 4-5 dpf. Aspirin is the most famous antiplatelet drug that was discovered by John Vane. He discovered that aspirin blocks generation of prostaglandins and thromboxanes (Vane, 1971). There are some studies have shown an effect of different dose of aspirin on platelet count in human and rat model systems. For example, it is reported that patients suffering from CAD showed lower response on platelet count for 75 mg aspirin per day for 7 days compared with healthy controls, but had a higher RBC count and plasma level (Karolczak et al., 2013). In addition, 162 mg aspirin intake did not show any significant effect on platelet count after 2 h for patient suffering from CAD (Nishiyama et al., 2003). However, a higher dose of aspirin, 250 mg intake on healthy human for 7 days showed an increase in platelet count from the first day and after 4 h (Erhart et al., 1999). In an in vitro study on effect of aspirin on the platelet count, even a dose of 250 mg did not show any destruction of platelets; however, the same study in vivo for the same aspirin concentration for 7 days showed an increase on platelet count in first day (Erhart et al., 1999). Studies on a rat-tail thrombosis induced model showed that 20 mg of aspirin treatment for 24 h and 48 h did not show any significant effect on platelet count (Ma et al., 2015). Aspirin effect on platelet count from previous studies have shown that low dose of aspirin did not have any effects on platelet count, however a high dose of aspirin increased platelet count. Moreover, its effect on healthy individuals was more than its impact on patients suffering from CAD. Aspirin treatment for over than 24 years in human increases the risk of gastrointestinal bleeding while it was suggested to use the minimum effective dose of aspirin either in long-term or short- term treatment (Huang et al., 2011). Increasing the number of platelet by using high dose of aspirin is a sign of damaging the body, because aspirin has mainly effect on platelet reactivity by inhibiting cyclooxygenase-1 (COX-1) and COX-2. The minimum dose and duration of aspirin treatment as well as risks and benefits ratio of this drug is still unclear. The range of thrombocyte count among all treated and non-treated groups was 4.95 to 42.4. One reason for this large range can be genetic heterogeneity in zebrafish (Patowary et al., 2013). Inbreeding may decrease the variation (Whiteley et al., 2011). A reason for less thrombocyte count would be internal bleeding in that specific larva. When bleeding occurs thrombocytes aggregate in the injured area and by clotting blood, stop the bleeding (Laki, 1972). To avoid this issue in the future, moving fluorescently labeled RBCs in the whole-body should be checked for any probable bleeding area in larva. I also have examined aspirin’s effect on body size. Length, dorsal area, lateral area, and whole- body volume were higher in larvae treated with either dose of aspirin. This result indicates a new discovery of aspirin intake on body size during growth in zebrafish. However, it was reported that 330 mg aspirin intake per day for obese human for eight months caused weight loss (Daly et al., 1993). This indicates conflict results of aspirin in adult human and zebrafish larvae. The effect of aspirin in development is still unclear and due to high risk of disorders and side effects, it was not examined in children. Aspirin intake for children under twelve was banned in UK since 1986, and not recommended for children under 16 due to high risk of Reye's syndrome (Macdonald, 2002). Reye’s syndrome is a metabolic encephalopathy illness that also causes liver dysfunction in children (Trauner, 1984). However, Reye’s syndrome was reported to be a dose-dependent effect of aspirin, and it was associated with more than 40 mg/kg aspirin dose per day (Young et al., 1984). In some countries, aspirin is still used as an antithrombotic therapy for neonates and children. For example, it was suggested to use one to 5 mg/kg aspirin per day as an antiplatelet therapy for children in Germany (Monagle et al., 2012). Previous studies have reported side effects of high dose of aspirin on zebrafish larvae. For instance, 33.87 µg/ml aspirin treatment on 72 hpf to 120 hpf zebrafish larvae was hepatotoxicity and decreased liver size (He et al., 2013). In a study on aspirin’s cardiovascular toxicity, it was shown that 45.58 µg/ml aspirin treatment in zebrafish from 48 hpf to 72 hpf cause 10% death and speed up heart rate after 4 h (Zhu et al., 2014).
Page | 13
SgRNA targets were selected based on FLA result and target activity. FLA is an efficient and quick way of identifying single base pair mutations (Hamilton et al., 2008). However, this method cannot detect whether the mutation in different bases affects the amino acid or not (Tanahashi et al., 2000). An efficient sgRNA target may cause different mutations (insertion and deletion) in different fishes. In this experiment, based on FLA result for sgRNA of nbeal2, this target was selected to use for CRISPR-Cas9 knock out. The target has marked as a high active target due to several mutations. This sgRNA was tested in five fishes and in each fish, there were several different peaks observed for insertion and deletions in FLA result. However, after knock out the gene in zebrafish genotyping should be done on offspring that carry the mutation to study the amino acid change. Previously study in nbeal2 in zebrafish showed that silencing this gene repeal process of forming thrombocytes (Albers et al., 2011). In this study the role of this gene also can be examine in platelet count by knocking out the gene in zebrafish. Other six sgRNAs also were selected based on FLA result and their target activity has marked as moderate and high. The highest similarity percentage of the selected genes among those knocked out genes was myb with 59.13% similarity to human gene. This gene is a transcription factor that has a regulatory function in hematopoiesis in human (Soza-Ried et al., 2010). Mutation in this gene or reduction of the gene’s product in mouse cause thrombocytosis that body produces too many platelets (Metcalf et al., 2005). However, this disorder was not reported in zebrafish mutant for this gene (Soza-Ried et al., 2010). This study will knocked out the gene in a proper way to observe the effect on thrombocyte count. In script annotation for ThrombocyteCount software, sensitivity was calculated by dividing TP (the number of real moving thrombocytes that were counted by script) to TP plus FN (the number of real moving thrombocytes that were not counted by script). In second version of the software (after modifying for background noise), still exposure time <=10 had recorded noise. A higher exposure time makes images brighter, however by increasing the exposure time, frame rate decreases (www.leica-microsystems.com). To increase the quality of images, gain should be kept in low range (~1.4). Exposure time 30 ms and 1.4 gain had shown the highest sensitivity and lowest FP rate, which means that the software had recorded more number of true moving spots as thrombocytes. To conclude, the exposure time should be in a range that exposes enough light that camera could capture as many spots as possible with an appropriate frame rate to avoid spots becoming strips. Even though the study has reached its aims, there were some limitations. First, all images for thrombocyte count and body size could not be done in one day. Due to time limitation for drug treatment, the maximum numbers of conducted images per day were 60 images and batch adjustment showed a statistically significant difference between different dates of imaging on thrombocyte count. However, after adjustment for date as batch effect it did not influence the effect estimate of aspirin. Second, zebrafish larvae for aspirin treatment were in development stage. Therefore, aspirin’s effect on body size in zebrafish larvae could not be comparable with adult humans. Eventually, thrombocytes in zebrafish were reported to have nucleus (Khandekar et al., 2012); that was not 100% comparable in human, because platelets in human do not have a nucleus. This fact did not have influence on the aspirin treatment result, however there are still unknown differences between human platelets and thrombocytes count due to morphological difference. In conclusion, a high-throughput image based system and customized software for quantification of thrombocyte count in zebrafish larvae have been developed, but quantification for RBC count is still in progress. I show that aspirin has an effect on thrombocyte count in zebrafish that is comparable to the drug’s effect in humans. However, the two doses that have been used in this experiment were too higher compare to human intake per kilogram. It has been discovered that aspirin treatment with low (5 μg/ml) and high (45 μg/ml) dose could increase body size after 24 h treatment in 5 dpf zebrafish larvae. Finally, a mutant line of genes related to PLT in human was knocked out in zebrafish to study if they have a function on thrombocyte count in zebrafish or not.
Page | 14
5. Ethical aspects and impact on the society
Aspirin is probably the most widely used anti-platelet drug. Its function is to prevent blood cells from clotting, but high doses of aspirin in the long-term increase the risk of bleeding. However, based on its molecular mechanism, it may have other unknown effects and side effects that need to be investigated. In addition, finding causal genes related to human platelet count will lead to find new drug targets and design new drugs that are more efficient. The aim of using an animal model system is to understand diseases linked to human without making any risks for human beings. Zebrafish have become a popular model system to study human diseases due to their genetic similarity to humans. However, there is still a lot to discover about this animal. Therefore, ethical aspects and handling of the model organism need to be taken under consideration. The main ethical concerns for zebrafish are about how to deal with anesthesia, euthanasia, housing, husbandry, breeding, and production (Lidster et al., 2017). Based on the EU Directive 2010/63/EU, the animals in early stage of life (5 dpf for zebrafish) are not defined for animal protection in science research (Strahle et al., 2012). In this research, to examine the effect of aspirin on thrombocyte count in zebrafish, 5 dpf larvae were used for thrombocyte count screening. In addition, all experimental procedures were performed on anaesthetized larvae to prevent unnecessary stress and pain. In order to generate multiplex mutant zebrafish and to examine thrombocyte count, microinjections were done in one- cell stage embryos. In this study, adult zebrafish were only used for breeding. Adult zebrafish were kept in an automatic light and temperature controlled zebrafish facility and were fed twice daily. The Uppsala ethical committee at the Uppsala University has approved this experiment for the genetic screen in zebrafish larvae (ethical approval no. C142/13 and C14/16).
6. Future perspective
Developing an efficient model organism to study blood cells enables further discoveries. Fluorescently labeled thrombocytes and RBCs in transgenic zebrafish larvae make it easy to explore blood cells under the microscope. The seven genes related to platelet count that were knocked out – selected based on GWAS (Eicher et al., 2016) – will be investigated for thrombocyte and RBC count in the future. Moreover, it is reported that a mutation in WAS causes low platelet count in humans (Medina et al., 2017). By finding this gene’s ortholog in zebrafish and by taking advantage of the CRISPR-Cas9 technology to knock out the gene, the causality of this gene for platelet count could be confirmed or refuted using a zebrafish model system. The developed transgenic zebrafish could be used for more studies on other antiplatelet drugs like tectorigenin that is reported to be a stronger antiplatelet drug than aspirin (Applova et al., 2017). In addition, RBCs count could be measured along with thrombocyte count to study the effect of drugs on both PLT and RBC count. For example, in a human study it is reported that 75 mg of aspirin did not have an effect on PLT count in patients suffering from CAD compare to healthy ones, however RBC count increased in both groups (Karolczak et al., 2013). In the future, zebrafish larvae with induced thrombosis will be generated to study the effect of aspirin on thrombocyte reactivity. Also, aspirin irreversibly inhibit human COX-1 (Toth et al., 2013); by finding its ortholog in zebrafish and knocking out this gene using CRISPR-Cas9 system aspirin’s target can be investigated.
Page | 15
7. Acknowledgments
I would like to thank Dr. Marcel den Hoed for accepting me to his group, his continuous support, and the best leadership. I express my warm thanks to Dr. Ci Song for welcoming me to her research project and giving me the opportunity to perform this project by her supportive guidance. I am also grateful to Dr. Anastasia Emmanouilidou for her advice and expertise that greatly assisted the research. I would also like to thank Dr. Amin Allalou for his help on thrombocyte image-analysis script. I would like to thank Tiffany Klingström and all hard working group members and visiting students for their daily support. Last but not the least; I would like to thank my parents for being there for me without a doubt and warming my heart.
Page | 16
8. References
Albers C. A., Cvejic A., Favier R., Bouwmans E. E., Alessi M. C., Bertone P., et al. (2011) Exome sequencing identifies NBEAL2 as the causative gene for gray platelet syndrome. Nat Genet, 43, (p. 735-7).
Alexopoulos, E. C. (2010) Introduction to multivariate regression analysis. Hippokratia, 14, (p. 23-8). applova, L., Karlickova J, Riha M, Filipsky T, Macakova K., Spilkova J., Mladenka P. (2017) The isoflavonoid tectorigenin has better antiplatelet potential than acetylsalicylic acid. Phytomedicine, 35, (p. 11-17).
Barrionuevo W. R., Burggren W. W. (1999) O2 consumption and heart rate in developing zebrafish (Danio rerio): influence of temperature and ambient O2. Am J Physiol, 276, (p. R505-13).
Battinelli E. M., Hartwig J. H., Italiano J. E. Jr. (2007) Delivering new insight into the biology of megakaryopoiesis and thrombopoiesis. Curr Opin Hematol, 14, (p. 419-26).
Begonja A. J., Pluthero F. G., Suphamungmee W., Giannini S., Christensen H., Leung R. (2015) FlnA binding to PACSIN2 F-BAR domain regulates membrane tubulation in megakaryocytes and platelets. Blood, 126, (p. 80-8).
Bournele D., Beis D. (2016) Zebrafish models of cardiovascular disease. Heart Fail Rev, 21, (p. 803- 813).
Branehog I., Ridell B., Swolin B., Weinfeld A. (1975). Megakaryocyte quantifications in relation to thrombokinetics in primary thrombocythaemia and allied diseases. Scand J Haematol, 15, (p. 321- 32).
Brownstein M. J., Carpten J. D., Smith J. R. (1996) Modulation of non-templated nucleotide addition by Taq DNA polymerase: primer modifications that facilitate genotyping. Biotechniques, 20, (p. 1004- 6, 1008-10).
Chami N., Chen M.H., Slater A.J., Eicher J.D., Evangelou E., Tajuddin S.M., et al. (2016) Exome Genotyping Identifies Pleiotropic Variants Associated with Red Blood Cell Traits. Am J Hum Genet, 99, (p. 8-21).
Chang T. Y., Pardo-Martin C., Allalou A., Wählby C., Yanik M. F. (2012) Fully automated cellular- resolution vertebrate screening platform with parallel animal processing. Lab Chip, 12, (p. 711-6).
Collins J. E., White S., Searle S. M., Stemple D. L. (2012) Incorporating RNA-seq data into the zebrafish Ensembl genebuild. Genome Res, 22, (p. 2067-78).
Crispino J. D. (2005) GATA1 in normal and malignant hematopoiesis. Semin Cell Dev Biol, 16, (p. 137- 47).
Dalen J. E. (2006) Aspirin to prevent heart attack and stroke: what's the right dose? Am J Med, 119, (p. 198-202).
Daly P. A., Krieger D. R., Dulloo A. G., Young J. B., Landsberg L. (1993) Ephedrine, caffeine and aspirin: safety and efficacy for treatment of human obesity. Int J Obes Relat Metab Disord, 17 Suppl 1, (p. S73-8).
Djinovic Carugo K., Banuelos S., Saraste M. (1997) Crystal structure of a calponin homology domain. Nat Struct Biol, 4, (p. 175-9).
Page | 17
Dooley K., Zon L. I., (2000) Zebrafish: a model system for the study of human disease. Curr Opin Genet Dev, 10, (p. 252-6).
Dorey F. J. (2011) Statistics in brief: Statistical power: what is it and when should it be used? Clin Orthop Relat Res, 469, (p. 619-20).
Eicher J. D., Chami N., Kacprowski T., Nomura A., Chen MH., Yanek L. R., et al. (2016) Platelet-Related Variants Identified by Exomechip Meta-analysis in 157,293 Individuals. Am J Hum Genet, 99, (p. 40- 55).
Erhart S., Beer J. H., Reinhart W. H. (1999) Influence of aspirin on platelet count and volume in humans. Acta Haematol, 101, (p. 140-4).
Grozovsky R., Begonja A. J., Liu K., Visner G., Hartwig J. H., Falet H. and Hoffmeister K. M. (2015) The Ashwell-Morell receptor regulates hepatic thrombopoietin production via JAK2-STAT3 signaling. Nat Med, 21, (p. 47-54).
Hamilton P. B., Adams E. R., Malele I. I., Gibson W. C. (2008) A novel, high-throughput technique for species identification reveals a new species of tsetse-transmitted trypanosome related to the Trypanosoma brucei subgenus, Trypanozoon. Infect Genet Evol, 8, (p. 26-33).
Hariharan P., Colaco S., Colah R., Ghosh K., Nadkarni A. (2017) Does the Novel KLF1 Gene Mutation Lead to a Delay in Fetal Hemoglobin Switch? Ann Hum Genet, 81, (p. 125-128).
He J.H., Gao J. M., Huang C. J., Li C. Q. (2014) Zebrafish models for assessing developmental and reproductive toxicity. Neurotoxicol Teratol, 42, (p. 35-42).
He J. H., Guo S. Y., Zhu F, Zhu J. J., Chen Y. X., Huang C. J., Gao J. M., Dong Q. X., Xuan Y. X., Li C. Q. (2013) A zebrafish phenotypic assay for assessing drug-induced hepatotoxicity. J Pharmacol Toxicol Methods, 67, (p. 25-32).
Howe K., Clark M. D., Torroja C. F., Torrance J., Berthelot C., Muffato M., et al. (2013) The zebrafish reference genome sequence and its relationship to the human genome. Nature, 496, (p. 498-503).
Huang E. S., Strate L. L., Ho W. W., Lee S. S., Chan A. T. (2011) Long-term use of aspirin and the risk of gastrointestinal bleeding. Am J Med, 124, (p. 426-33).
Jagadeeswaran P., Sheehan J. P., Craig F. E. and Troyer D. (1999) Identification and characterization of zebrafish thrombocytes. Br J Haematol, 107, (p. 731-8).
Jones T. R., Kang I. H., Wheeler D. B., Lindquist R. A., Papallo A., Sabatini D. M., (2008) CellProfiler Analyst: data exploration and analysis software for complex image-based screens. BMC Bioinformatics, 9, (p. 482).
Karolczak K., Pietruszynski R., Drzewoski J., Kasznicki J., Watala C. (2013) Aspirin dose increase from 75 to 150 mg suppresses red blood cell contribution to suboptimal platelet response to aspirin in patients with CAD. Cardiovasc Drugs Ther, 27, (p. 549-58).
Kaufman R. M., Airo R., Pollack S., Crosby W.H. (1965) Circulating megakaryocytes and platelet release in the lung. Blood, 26, (p. 720-31).
Khandekar G., Kim S. and Jagadeeswaran P. (2012) Zebrafish thrombocytes: functions and origins. Adv Hematol, 2012, 857058.
Laki K. (1972) our ancient heritage in blood clotting and some of its consequences. Ann N Y Acad Sci, 202, (p. 297-307).
Page | 18
Lee S. H., Zhu C., Peng Y., Johnson D. T., Lehmann L., Sun Z. (2013) Identification of a novel role of ZMIZ2 protein in regulating the activity of the Wnt/beta-catenin signaling pathway. J Biol Chem, 288, (p. 35913-24).
Lee W. Y., Weinberg O. K., Pinkus G. S. (2017) GATA1 Is a Sensitive and Specific Nuclear Marker for Erythroid and Megakaryocytic Lineages. Am J Clin Pathol, 147, (p. 420-426).
Leslie R., O'Donnell C. J. and Johnson A. D. (2014) GRASP: analysis of genotype-phenotype results from 1390 genome-wide association studies and corresponding open access database. Bioinformatics, 30, (p. 185-94).
Lidster K., Readman G. D., Prescott M. J., Owen S. F. (2017) International survey on the use and welfare of zebrafish Danio rerio in research. J Fish Biol, 90, (p. 1891-1905).
Lin H. F., Traver D., Zhu H., Dooley K., Paw B. H., Zon L. I., and Handin R. I. (2005) Analysis of thrombocyte development in CD41-GFP transgenic zebrafish. Blood, 106, (p. 3803-10).
Li CI, Samuels DC, Zhao YY, Shyr Y, Guo Y (2017) Power and sample size calculations for high- throughput sequencing-based experiments. Brief Bioinform.
Li M., Suzuki K., Kim N. Y., Liu G. H. and Izpisua Belmonte J. C. (2014) a cut above the rest: targeted genome editing technologies in human pluripotent stem cells. J Biol Chem, 289, (P. 4594-9).
Long Q., Meng A., Wang H., Jessen J. R., Farrell M. J., Lin S. (1997) GATA-1 expression pattern can be recapitulated in living transgenic zebrafish using GFP reporter gene. Development, 124, (p. 4105-11).
Ma N., Liu X. W., Yang Y. J., Li J. Y., Mohamed I., Liu G. R. (2015) Preventive Effect of Aspirin Eugenol Ester on Thrombosis in kappa-Carrageenan-Induced Rat Tail Thrombosis Model. PLoS One, 10, (p. e0133125).
MacDonald B. T., Tamai K., He X. (2009) Wnt/beta-catenin signaling: components, mechanisms, and diseases. Dev Cell, 17, (p. 9-26).
Macdonald S. (2002) Aspirin use to be banned in under 16 year olds. BMJ, 325, (p. 988).
Machlus K. R., Thon J. N., and Italiano J. E. Jr. (2014) interpreting the developmental dance of the megakaryocyte: a review of the cellular and molecular processes mediating platelet formation. Br J Haematol, 165, (p. 227-36).
Medina S. S., Siqueira L. H., Colella M. P., Yamaguti-Hayakawa G. G., Duarte B. K. L., Dos Santos Vilela M. M. (2017) Intermittent low platelet counts hampering diagnosis of X-linked thrombocytopenia in children: report of two unrelated cases and a novel mutation in the gene coding for the Wiskott- Aldrich syndrome protein. BMC Pediatr, 17, (p. 151).
Metcalf D., Carpinelli M. R., Hyland C., Mifsud S., Dirago L., Nicola N. A. (2005) Anomalous megakaryocytopoiesis in mice with mutations in the c-Myb gene. Blood, 105, (p. 3480-7).
Miner J. and Hoffhines A. (2007). The discovery of aspirin's antithrombotic effects. Tex Heart Inst J, 34, (p. 179-86).
Monagle P., Chan A. K. C., Goldenberg N. A., Ichord R. N., Journeycake J. M., Nowak-Göttl U. (2012) Antithrombotic therapy in neonates and children: Antithrombotic Therapy and Prevention of Thrombosis, 9th ed: American College of Chest Physicians Evidence-Based Clinical Practice Guidelines. Chest, 141, (p. e737S-e801S).
Page | 19
Nichols K. E., Crispino J. D., Poncz M., White J. G., Orkin S. H., Maris J. M., and Weiss, M. J. (2000). Familial dyserythropoietic anaemia and thrombocytopenia due to an inherited mutation in GATA1. Nat Genet, 24, (p. 266-70).
Nishiyama A., Niikawa O., Mohri H., Tsushima M. (2003) Timing of anti-platelet effect after oral aspirin administration in patients with sympathetic excitement. Circ J, 67, (p. 697-700).
Pardo-Martin C., Allalou A., Medina J., Eimon P. M., Wählby C., Fatih Yanik M. (2013) High- throughput hyperdimensional vertebrate phenotyping. Nat Commun, 4, (p. 1467).
Patowary A, Purkanti R., Singh M., Chauhan R., Singh A.R., Swarnkar M. (2013) A sequence-based variation map of zebrafish. Zebrafish, 10, (p. 15-20).
Peng F., Zheng W., Li F., Wang J., Liu Z., Chen X (2018) Elevated mean platelet volume is associated with poor outcome after mechanical thrombectomy. J Neurointerv Surg, 10, (p. 25-28).
Quick A. J. (1966) Salicylates and bleeding: the aspirin tolerance test. Am J Med Sci, 252, (p. 265-9).
Reems J. A., Pineault N., and Sun S. (2010) In vitro megakaryocyte production and platelet biogenesis: state of the art. Transfus Med Rev, 24, (p. 33-43).
Reichenbach P., Hoss M., Azzalin C. M., Nabholz M., Bucher P., Lingner J. (2003) A human homolog of yeast Est1 associates with telomerase and uncaps chromosome ends when overexpressed. Curr Biol, 13, (p. 568-74).
Ross D. W., Ayscue L. H., Watson J. and Bentley S. A. (1988) Stability of hematologic parameters in healthy subjects. Intraindividual versus interindividual variation. Am J Clin Pathol, 90, (p. 262-7).
Ruggeri Z.M. (1997) Mechanisms initiating platelet thrombus formation. Thromb Haemost, 78, (p. 611-6).
Schmidt V. A., Scudder L., Devoe C.E., Bernards A., Cupit L.D., Bahou W.F. (2003) IQGAP2 functions as a GTP-dependent effector protein in thrombin-induced platelet cytoskeletal reorganization. Blood, 101, (p. 3021-8).
Schneider C. A., Rasband W. S., Eliceiri K. W. (2012) NIH Image to ImageJ: 25 years of image analysis. Nat Methods, 9, (p. 671-5).
Schoemaker R. G., Saxena P. R., Kalkman E. A. (1998) Low-dose aspirin improves in vivo hemodynamics in conscious, chronically infarcted rats. Cardiovasc Res, 37, (p. 108-14).
Shivdasani R. A., Fujiwara Y., McDevitt M. A. and Orkin S. H. (1997) a lineage-selective knockout establishes the critical role of transcription factor GATA-1 in megakaryocyte growth and platelet development. EMBO J, 16, (p. 3965-73).
Sim X., Poncz M., Gadue P. and French D. L. (2016) Understanding platelet generation from megakaryocytes: implications for in vitro-derived platelets. Blood, 127, (p. 1227-33).
Sommer, C., Strähle, C., Köthe, U. & Hamprecht, F.A. (2011) Ilastik: Interactive Learning and Segmentation Toolkit. Eighth IEEE International Symposium on Biomedical Imaging (ISBI). Proceedings, (p. 230-233).
Soza-Ried C., Hess I., Netuschil N., Schorpp M., Boehm T. (2010) Essential role of c-myb in definitive hematopoiesis is evolutionarily conserved. Proc Natl Acad Sci U S A, 107, (p. 17304-8).
Page | 20
Strahle U., Scholz S., Geisler R., Greiner P., Hollert H., Rastegar S., et al. (2012) Zebrafish embryos as an alternative to animal experiments--a commentary on the definition of the onset of protected life stages in animal welfare regulations. Reprod Toxicol, 33, (p. 128-32).
Tanahashi T., Kita M., Kodama T., Sawai N., Yamaoka Y., Mitsufuji S. (2000) Comparison of PCR- restriction fragment length polymorphism analysis and PCR-direct sequencing methods for differentiating Helicobacter pylori ureB gene variants. J Clin Microbiol, 38, (p. 165-9).
Thon J. N., and Italiano J. E. (2010) Platelet formation. Semin Hematol, 47, (p. 220-6).
Tindall H., Paton R. C., Zuzel M. and McNicol G. P. (1981) Platelet life-span in diabetics with and without retinopathy. Thromb Res, 21, (p. 641-8).
Tiwari S., Italiano J.E. Jr., Barral D.C., Mules E. H., Novak E. K., Swank R. T. , et al. (2003) A role for Rab27b in NF-E2-dependent pathways of platelet formation. Blood, 102, (p. 3970-9).
Toth L., Muszbek L., Komaromi I. (2013) Mechanism of the irreversible inhibition of human cyclooxygenase-1 by aspirin as predicted by QM/MM calculations. J Mol Graph Model, 40, (p. 99- 109).
Trauner D. A. (1984) Reye's syndrome. West J Med, 141, (p. 206-9).
Vane J. R. (1971) Inhibition of prostaglandin synthesis as a mechanism of action for aspirin-like drugs. Nat New Biol, 231, (p. 232-5).
Varshney G. K., Carrington B., Pei W., Bishop K., Chen Z., Fan C., (2016) A high-throughput functional genomics workflow based on CRISPR/Cas9-mediated targeted mutagenesis in zebrafish. Nat Protoc, 11, (p. 2357-2375).
Varshney G. K., Pei W., LaFave M. C., Idol J., Xu L., Gallardo V., el al. (2015) High-throughput gene targeting and phenotyping in zebrafish using CRISPR/Cas9. Genome Res, 25, (p. 1030-42).
Wang T., Wei J. J., Sabatini D. M., Lander E. S. (2014) Genetic screens in human cells using the CRISPR-Cas9 system. Science, 343, (p. 80-4).
Wang Y., Liang P., Lan F., Wu H., Lisowski L., Gu M. (2014) Genome editing of isogenic human induced pluripotent stem cells recapitulates long QT phenotype for drug testing. J Am Coll Cardiol, 64, (p. 451-9).
Weyand A. C. and Shavit J. A. (2014) Zebrafish as a model system for the study of hemostasis and thrombosis. Curr Opin Hematol, 21, (p. 418-22).
White J. G., Kumar A., Hogan M. J. (2006) Gray Platelet Syndrome in a Somalian family. Platelets, 17, (p. 519-27).
Whiteley A. R., Bhat A., Martins E. P., Mayden R. L., Arunachalam M., Uusi-Heikkilä S. (2011) Population genomics of wild and laboratory zebrafish (Danio rerio). Mol Ecol, 20, (p. 4259-76).
Wolff S., Xiao Z., Wittau M., Sussner N., Stoter M., Knippschild U. (2005) Interaction of casein kinase 1 delta (CK1 delta) with the light chain LC2 of microtubule associated protein 1A (MAP1A). Biochim Biophys Acta, 1745, (p. 196-206).
Yin T. and Li L. (2006) The stem cell niches in bone. J Clin Invest, 116, (p. 1195-201).
Yip J., Shen Y., Berndt M. C. and Andrews R. K. (2005) Primary platelet adhesion receptors. IUBMB Life, 57, (p. 103-8).
Page | 21
Young R. S., Torretti D., Williams R. H., Hendriksen D., Woods M. (1984) Reye's syndrome associated with long-term aspirin therapy. JAMA, 251, (p. 754-6).
Zhang F., Wen Y., Guo X. (2014) CRISPR/Cas9 for genome editing: progress, implications and challenges. Hum Mol Genet, 23, (p. R40-6).
Zhu J. J., Xu Y. Q., He J. H., Yu H.P., Huang C.J., Gao J.M. (2014) Human cardiotoxic drugs delivered by soaking and microinjection induce cardiovascular toxicity in zebrafish. J Appl Toxicol, 34, (p. 139-48).
Zhu X. Y., Liu H. C., Guo S. Y., Xia B., Song R. S., Lao Q. C., Xuan Y. X., Li C. Q. (2016) A Zebrafish Thrombosis Model for Assessing Antithrombotic Drugs. Zebrafish, 13, (p. 335-44).
ChopChop (2017) CHOPCHOP. Available at: http://chopchop.cbu.uib.no/ [collected 2017.11.22]
Ensembl (2017) search. Available at: https://www.ensembl.org/index.html [collected 2017.11.22]
Genomicus (2017) search. Available at: http://www.genomicus.biologie.ens.fr/genomicus-90.01/cgi-bin/search.pl [collected 2017.11.22]
ZFIN Community Wiki (2017) ZFIN Protocol Wiki. Available at: https://wiki.zfin.org/display/prot/TRICAINE [collected 2017.11.22]
Page | 22
9. Appendix I
Table 1. Recommended system water quality parameters for zebrafish Parameters Desired Level Low Limit High Limit PH 7 – 7.5 6.5 8.0 Temperature 28 24 30 Conductivity 600 – 800 μs 400 μs 1000 μs Ammonia 0 0 2 ppm Nitrite 0 0 1 ppm Nitrate < 50 ppm 0 200 ppm
Table 2. Tricaine stock solution for 700 mL (in a 1 L glass bottle) Material Amount Tricaine powder 2.8 gr 1 M Tris (pH 9)* 685.3 mL DD water ~14.7 ml
* Adjust pH to ~7 at the end.
Table 3.1. LAS X software setting for thrombocyte and RBC count Dimension Logical Size Physical Length Physical Origin Voxel Size X 688 pixels 1.27 mm 0.00 mm 0.002 Y 110 pixels 200.87 μm 0.00 μm 1.843 T 519 repeats 19.995 s 0 s 0 s
Table 3.2. Fluorescent channel setting Channel Name LUT Name Exposure Time Gain Resolution XY Resolution Z PLT Green 30.000 ms 1.4 1.525 μm 11.364 μm RBC Red 30.000 ms 1.4 1.525 μm 11.364 μm
Table 3.3. Leica camera setting Camera Camera DFC365FX-710560914 Binning 2 x 2 Resolution 8 bits Gamma 1 Pixel Clocking Rate 40.00 MHz Dual light mode NR mode Black-Value 0 White-Value 255 Online Shading Correction OFF Live Binning OFF Cooler ON Hotspot Correction Threshold 50% Hotspot Correction Exposure Start 0.999 ms Brightness Correction OFF
Page | 23
Table 3.4. Leica microscope setting Microscope System Name AF 6000LX Microscope Family Type Compound Valentine Objective Universal 10x/0.22 DRY Order number (obj) 1000 Numerical aperture (obj) 0.22 Refraction index 1 Magnification-Changer X Z Movement Z then Lambda
Table 4. Anthropometric traits for annotation Value Description 1 Preprocessing cut off part of fish 2 External muck included in bubble 3 bubble included in calculation 4 part of fish not imaged 5 bent body 6 dead fish 7 bad segmentation 8 poor tomography 9 re-analyzed
Table 5. CRISPR-Cas9 target design criteria CRISPR-Cas9 target criteria Exon Longest exon, close to the beginning of the gene, common between different transcripts, and with lower variants Target position Preferably in the beginning or middle of the exon Variants Avoid variants in sgRNA target and its primers Target starting nucleotide GN/NG for T7 and SP6 promoter respectively GC content >50% Efficiency >0.50 Self-complementary Preferably no self-complementary, but in exception cases one is acceptable Off-targets 0 Primer off-targets 0 Primer product size ~250 CRISPRscan score >50
Table 6. sgRNA oligos and FLA primers preparation for ordering Extra sequences adding in oligos and FLA primers T7 promoter* TAATACGACTCACTATA Sp6 promoter* ATTTAGGTGACACTATA Overlap with oligo B sequence GTTTTAGAGCTAGAAATAGCAAG M13 F sequence TGTAAAACGACGGCCAGT Pigtail GTGTCTT
* T7 or SP6 promoter sequence was added if sgRNA target started with GG or GA respectively.
Page | 24
Table 7.1. FLA protocol FLA reagents volume DNA 2 water 5.8 10X buffer MgCl2 1 50 mM MgCl2 0.3 10 mM dNTPs 0.2 10 μm M13 0.2 Platinum 0.1 10 μm primer F 0.2 10 μm primer R 0.2
Table 7.2 FLA PCR program Temperature Duration 1. 94 °C 2:00 min 2. 94 °C 0:30 min 3. 60 °C 0:30 min 4. 72 °C 0:30 min 5. GOTO step 2, 35X 6. 72 °C 5:00 min 7. 12 °C ∞
Table 8. Recommended target activity for real microinjection Target activity Description No All injected larvae have a peak corresponding to wild type peak, and have no additional peaks of different sizes. Low All injected larvae have a peak corresponding to wild type peak, and less than 50% injected larvae have additional peaks of different sizes. Moderate All injected larvae have a peak corresponding to wild type peak, and more than 50% injected larvae have additional peaks of different sizes. High At least 50% injected larvae have a peak corresponding to wild type peak, and most/all injected larvae have additional peaks of different sizes. Very high Less than 50% injected larvae have a peak corresponding to wild type peak, and all injected larvae have additional peaks of different sizes. Too high None of injected larvae have a peak corresponding to wild type peak, and all injected larvae have additional peaks of different sizes.
NOTE: In the order “best to okay”: high, moderate, very high, and low.
Page | 25
10. Appendix II
Figure 1. A) Oligo A consists of a T7/SP6 promoter, 20 nucleotide target sequence and 23 nucleotide overlap has sequence to oligo B. By annealing of oligo A and B, sgRNA template is ready for In vitro transcription (Adapted Varshney et al., 2015). B) Overview of FLA procedure. Gene specific primers amplify CRISPR target site and to observe that, fluorescent PCR strategy was used by adding a fluorescent primer that attach to the end of forward primer [adapted from (Varshney et al., 2016)].
Figure 2. FLA matrix was designed in 96 well PCR plate by adding gene specific primers (up to 8 genes) in each row and fish DNA (10 injected and 2 controls extracted fish DNA) in column.
Page | 26
Figure 3. 2% gel electrophoresis result for annealed DNA and purified RNA for the first multiplex sgRNA targets. All DNAs and transcribed RNAs were 117-bp long. Ladder is O'Generuler 50-bp DNA ladder (thermo fisher #SM1133).
Page | 27