2-Methoxyestradiol Induces Mammary Gland Differentiation Through

2-Methoxyestradiol Induces Mammary Gland Differentiation through Amphiregulin-Epithelial Growth Factor Receptor-Mediated Signaling: Molecular Distinctions from the Mammary Gland of Pregnant Mice

Jung-Im Huh, Ting Hu Qiu, Gadisetti V. R. Chandramouli, Rhonda Charles, Malgorzata Wiench, Downloaded from https://academic.oup.com/endo/article/148/3/1266/2502028 by guest on 23 September 2021 Gordon L. Hager, Raul Catena, Alfonso Calvo, Theresa M. LaVallee, Pierre-Yves Desprez, and Jeffrey E. Green Laboratories of Cell Regulation and Carcinogenesis (J.-I.H., T.H.Q., R.C., J.E.G.), Biosystems and Cancer (G.V.R.C.), and Receptor Biology and Gene Expression (M.W., G.L.H.), National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892; Division of Oncology (R.C., A.C.), Center for Applied Medical Research (CIMA), and Department of Histology and Pathology, University of Navarra, Pamplona, 31080 Spain; EntreMed, Inc. (T.M.L.), Rockville, Maryland 20850; and California Pacific Medical Center (P.-Y.D.), Cancer Research Institute, San Francisco, California 94143

Levels of 2-methoxyestradiol (2ME2), an endogenous metab- mammary glands from late-stage pregnancy, including ele- olite of estradiol, are highly elevated during late stages of vated expression of many milk protein differentiation mark- pregnancy when mammary glands have differentiated with ers. However, several genes are differentially regulated be-

the formation of alveolar structures producing milk proteins. tween 2ME2-treated mammary glands and differentiated Based upon our previous demonstration that 2ME2 induces mammary glands through pregnancy. Significantly, amphi- mammary ductal dilation associated with expression of mam- regulin, ATF3, serpine2, and SOX6 were up-regulated in 2ME2- mary differentiation markers when administered to trans- treated mammary glands but not in mammary glands from genic mice that spontaneously develop mammary cancer, we pregnant mice. Using the SCp2 differentiation cell line sys-

studied the effects of 2ME2 on normal mammary gland devel- tem, we demonstrate that 2ME2 induces differentiation opment. The results of this study demonstrate that 2ME2 can through the down-regulation of Id-1 and up-regulation of am- induce a partial differentiation of normal mammary glands in phiregulin. Administration of amphiregulin to SCp2 cells in-

virgin mice, as evidenced by the appearance of limited num- duced differentiation, whereas inhibition of 2ME2-induced ex- bers of alveolar cells and significantly increased expression of pression of amphiregulin by small interfering RNA blocked the differentiation markers ␤-casein and whey acidic protein. differentiation. Estrogen receptor-negative SCp2 cells differ-

2ME2-induced differentiation is associated with inhibition of entiate in response to 2ME2, but not estradiol, suggesting that expression of inhibitor of differentiation 1 (Id-1) in normal 2ME2 operates through an estrogen receptor-independent ؅ mammary epithelial cells through elements in the 5 -flanking mechanism. These data demonstrate that 2ME2 can induce a region of the Id-1 gene. Microarray analysis revealed that partial differentiation of the mammary gland through mech-

2ME2-induced differentiation of the mammary gland shares anisms that differ from those normally used during some significant similarities in gene expression with that of pregnancy. (Endocrinology 148: 1266–1277, 2007)

IFFERENTIATION OF THE mammary gland is a com- rendering it less susceptible to transformation (1). However, D plex process that involves the coordinated response to the risk of breast cancer is actually increased during and several hormone signals during pregnancy, lactation, and immediately after pregnancy, which may be influenced by subsequent involution (1). Pregnancy has paradoxical effects the extensive remodeling of the mammary gland during this on breast cancer risk, suggesting that the state of mammary period (3). gland differentiation and history of parity can influence the Relatively modest increases in maternal serum estradiol development of cancer (2, 3). It has been proposed that preg- ϳ ϳ (E2)( 100 nm) and estrone ( 75 nm) occur during pregnancy nancy early in life provides a protective effect against the compared with estriol, which may reach approximately 900 delayed development of breast cancer by permanently al- nm, produced primarily through the fetal-placental unit (4). tering the state of differentiation of the mammary gland and However, levels of 2-methoxyestradiol (2ME2), an endoge- ␤ nous metabolite of 17 -E2 with low affinity to estrogen re- First Published Online December 7, 2006 ceptors (ER) ␣ and ␤, dramatically increase during preg- Abbreviations: E2, Estradiol; ECM, extracellular matrix; EGFR, epithelial growth factor receptor; ER, estrogen receptor; ERE, estrogen nancy. 2ME2 is formed by the sequential hydroxylation of ␤ response element; FBS, fetal bovine serum; Id, inhibitor of differentia- 17 -E2 by cytochrome P450 enzymes followed by O-meth- tion; L2,d2oflactation; 2ME2, 2-methoxyestradiol; P16, d 16 of preg- ylation by catechol-O-methyltransferase. Significant levels of nancy; si RNA, small interfering RNA; TSP-1, thrombospondin-1; W30, d 30 post lactation; WAP, whey acidic protein. 2ME2 can be measured in both the blood and urine of hu- mans, with highly elevated levels during pregnancy. Serum Endocrinology is published monthly by The Endocrine Society (http:// www.endo-society.org), the foremost professional society serving the levels of 2-methoxyestrogens between the 11th and 16th endocrine community. weeks of pregnancy range between 2 and 15 nm; between the

1266 Huh et al. • 2ME2-Induced Mammary Gland Differentiation Endocrinology, March 2007, 148(3):1266–1277 1267

37th and 40th weeks of pregnancy, the serum level of 2ME2 Whole-mount analysis and immunohistochemistry reaches 18–96.21 nm; and during labor, levels are 12.15–90 For whole-mount analysis, four mammary glands from 12-wk-old nm (5). Although the levels of 2ME2 during pregnancy are normal FVB mice were removed and mounted on slides, fixed overnight quite high, the normal physiological roles for 2ME2 have not in 10% formalin, placed overnight in acetone to remove fat, dehydrated, been extensively explored. stained with hematoxylin, rehydrated, cleared with xylene, and cover- During the course of our previous study to determine the slipped (Daigger, Wheeling, IL) with VectaMount (Vector Laboratories, Burlingame, CA) for morphological analysis. effects of 2ME2 on mammary tumor development, it was For immunohistochemical analysis, sections were heated in a micro- observed that 2ME2 induced limited differentiation of the wave oven in 0.1 m sodium citrate for antigen retrieval, hybridized with mammary glands resulting in ductal dilatation and produc- casein antisheep antibody (1:250, kindly provided by Dr. Barbara K. tion of milk proteins (6), although no direct role for 2ME on Vonderhaar, National Cancer Institute, National Institutes of Health), 2 and processed using the avidin-biotin complex method (Vectastain ABC normal mammary differentiation has been previously re- Elite kit; Vector Laboratories). Secondary sheep polyclonal antibody ported. This intriguing observation suggested that 2ME

2 (1:12,000) to casein was purchased from Jackson ImmunoResearch Lab- Downloaded from https://academic.oup.com/endo/article/148/3/1266/2502028 by guest on 23 September 2021 could exert some differentiating effects upon the mammary oratories, Inc. (West Grove, PA). gland, through a non-prolactin-dependent manner and without signaling directly through the ER. Promoter assays In this study, we have confirmed that 2ME2 can cause Id-1 promoter luciferase constructs (Id-1 Luc 2.2 kb, 5Ј-del 1, 5Ј-del 2, differentiation of mammary epithelial cells in vitro as well as 5Ј-del 3, and 5Ј-del 6) (8) and pRL-CMV were cotransfected into SCp2 normal mammary glands in vivo with milk protein expres- cells over 4 h using Lipofectamine 2000 (Invitrogen) with 2% FBS fol- sion but that the mechanisms for the induction of mammary lowing the manufacturer’s protocol. 2ME2 was added for 24 h at which differentiation is different from that which occurs during time cells were lysed and promoter activity was measured using the dual-luciferase reporter assay system kit (Promega, Madison, WI) and normal pregnancy. We demonstrate that 2ME2-induced dif- Wallac Victor 2 1420 multilabel counter (Perkin Elmer, Shelton, CT). ferentiation involves the transcriptional down-regulation of Transfection efficiency was normalized using the pRL-CMV vector as an the inhibitor of differentiation-1 (Id-1) and Id-3 and induc- internal control (Promega). For the estrogen response element (ERE) ϫ 4 tion of amphiregulin signaling through the epithelial growth reporter assay, SCp2 cells were plated either on 24-well plates (5 10 cells per well) or 96-well plates (0.75 ϫ 104 cells per well) and transfected factor receptor (EGFR). Additionally, 2ME2 induces some 2 d later. Two hours before transfection, the medium was changed to changes in the expression of extracellular matrix (ECM) and contain 5% charcoal-stripped serum. Cells were cotransfected with the immune-related genes similarly altered during pregnancy. green fluorescent protein-ER expression plasmid pCL-nGL1-HEGO and These results provide new insights into 2ME -induced mam- pERE-Luc plasmid (27) with pRL-CMV as an internal control. Two days 2 ␮ Ϫ2 ␮ mary differentiation independent of prolactin or ER after transfection, cells were treated with 10 m 2ME2,10 ME2 (Equitech-Bio, Inc., Kerrville, TX) or 0.1 ␮m tamoxifen (Tocris Bioscience, signaling. Ellisville, MO) for 8 h and subjected to the dual-luciferase assay with the Dual-Glo Luciferase assay system (Promega) by means of a POLARstar OPTIMA (BMG Labtech, Durham, NC). All experiments were con- Materials and Methods ducted in triplicate. Cell culture and reagents SCp2 cells (7) were generously provided by Dr. Mina Bissell (Law- Small interfering RNA (siRNA) transfection rence Berkeley National Laboratory, Livermore, CA). SCp2 cells were SCp2 or M6 cells (0.5 ϫ 105) were plated in six plates with DMEM/F12 maintained in DMEM/nutrient mixture F-12 (Invitrogen, Carlsbad, CA) ␮ containing 2% FBS or DMEM containing 5% FBS without antibiotics the supplemented with 2% fetal bovine serum (FBS) (Invitrogen), 5 g/ml day before transfection. siRNA was transfected using Lipofectamine insulin (Invitrogen), and 50 ␮g/ml gentamycin (Sigma Chemical Co., St. ␮ 2000 (Invitrogen) following the manufacturer’s protocol. Ten micromo- Louis, MO). SCp2 cells were incubated with 0, 5, 10, and 50 m 2ME2 lar 2ME2 was added for the indicated time periods. Protein was extracted for indicated time points, and RNA was extracted for RT-PCR. Amphi- from M6 cells for Western blotting, and RNA was extracted from SCp2 regulin (R&D Systems, Inc., Minneapolis, MN) was added to SCp2 cells cells for RT-PCR. All experiments were repeated at least twice. Two at a concentration of 6 ng/ml. Tarceva, obtained from OSI Pharmaceu- ␮ different sequences of siRNA for Id-1 were designed, but only one of ticals (Melville, NY), was used at a 10 m concentration (100 mm stock them could knock down Id-1 expression, and we used this sequence for in dimethylsulfoxide). A stock solution of 100 mm 2ME2 (kindly pro- our experiment. The target sequence of siRNA for Id-1 used in this study vided by EntreMed, Inc., Rockville, MD) in dimethylsulfoxide was used is GGCTACGTCCAGGAGCGCACC. To knock down amphiregulin ex- and diluted as indicated. pression, three different siRNA entities for AREG were transfected into SCp2 cells at the same time (each at a concentration of 30 nm) following ␮ Animals and experimental schedule the same method as described for Id-1 siRNA transfection. 2ME2 (10 m) was added 15 h after transfection, and RNA was extracted 12 h after treatment with 2ME . Target sequences of siRNA for AREG were CCA- To determine the effects of 2ME2 on normal mammary glands, four 2 groups of wild-type FVB mice were studied using the same experimental CAAATATCCGGCTATA (no. 1), ACAAGGACCTATCCAAGAT (no. schedule for 6 wk. Seven mice per group received 25, 75, or 150 mg/kg 2), and AGAGAGGTTTCCACCATAA (no. 3). siRNA for the green fluorescent protein duplex was used as a control for the siRNA experi- of 2ME2 daily by gavage formulated in 1% hydroxypropylcellulose beginning at 6 wk of age for 6 wk. Control mice received 0.2 ml of 1% ments. All the target sequences for siRNA for Id-1 and AREG were hydroxypropylcellulose by gavage daily, following the same schedule designed using the Dharmacon siRNA design center (http://www. as the experimental group. All of the mice were killed at diestrus to dharmacon.com/sidesign) and synthesized by Dharmacon, Inc (Lafay- exclude variations due to the estrous cycle. The stage of estrus was ette, CO). determined by measuring the electrical impedance using an MK-10 rat estrous cycle monitor (Fine Science Tools, Inc., Foster City, CA). Mam- Western blotting mary tissues were immediately collected in liquid nitrogen for RT-PCR or fixed in 4% paraformaldehyde for histological analyses. All mice were Protein was extracted from M6 cells using RIPA lysis buffer [1% treated in accordance with the Guide for the Care and Use of Laboratory Triton X-100, 50 mm Tris-HCl (pH 7.5), 150 mm NaCl, 10 mm Na3VO4] Animals (National Institutes of Health publication no. 86-23, 1985) under with protease inhibitor cocktail tablets (Roche, Penzberg, Germany) for an approval animal protocol. protein analysis. Thirty micrograms of protein were resolved on 16% 1268 Endocrinology, March 2007, 148(3):1266–1277 Huh et al. • 2ME2-Induced Mammary Gland Differentiation

Tris-glycine gradient gels (Invitrogen), transferred to polyvinylidene VectaMount containing 4Ј,6-diamidino-2-phenylindole (Vector) and vi- difluoride membranes (Invitrogen), blocked with 5% nonfat milk, and sualized using a Leica DMIRBE confocal microscope. incubated with the Id-1 primary antibody (Santa Cruz Biotechnology, Santa Cruz, CA), followed by horseradish-peroxidase-conjugated anti- Oligonucleotide microarray hybridization and data analysis rabbit secondary antibody (Santa Cruz Biotechnology). Signal was visualized using an ECL detection kit (Amersham Biosciences, Piscataway, Four normal controls and four mammary gland samples from indi- NJ). ␣-Tubulin (Sigma-Aldrich Inc., St. Louis, MO) was used as an vidual mice treated with 75 and 150 mg/kg 2ME2 were collected for internal control. Affymetrix (Santa Clara, CA) microarray analyses. Additionally, three mammary gland samples were collected from FVB/N mice at each of RNA extraction and semiquantitative RT-PCR and real- following time points: 12-wk-old virgin (12W), d 16 of pregnancy (P16), time RT-PCR d 2 of lactation (L2), and five samples each of d 30 post lactation (W30) and age-matched control animals for W30. SCp2 cells treated with 10 ␮m Total RNA was isolated from frozen tissues and cells using Trizol 2ME2 and the corresponding untreated controls were collected at 6, 24, reagent (Invitrogen) following the manufacturer’s instructions, and RT- and 48 h after treatment. Total RNA was extracted from frozen tissues PCR was performed as follows: RT reactions were performed using the or cells using TRIzol reagent (Life Technologies, Inc., Rockville, MD) Downloaded from https://academic.oup.com/endo/article/148/3/1266/2502028 by guest on 23 September 2021 Superscript first-strand synthesis system for RT-PCR (Invitrogen) fol- according to the manufacturer’s protocol. Ten micrograms of total RNA ␮ lowing the manufacturer’s protocol. The PCR mixture included 1 lof were reverse transcribed using a T7 (dT)24 primer to synthesize the the cDNA generated from the RT reaction, 1 ␮lof10ϫ PCR buffer, 1.5 cDNA, followed by the incorporation of biotinylated ribonucleotides by ␮ ␮ ␮ lof50mm MgCl2,1 lof10mm dNTP, 0.4 lofTaq polymerase (5 in vitro transcription using T7 RNA polymerase. The biotinylated RNA U/␮l), 0.5 ␮lof20␮m sense primer, and 0.5 ␮lof20␮m antisense primer was fragmented and hybridized to an oligonucleotide microarray mu- in a total volume of 50 ␮l. PCR conditions were as follows: 94 C for 5 rine genome 430 2.0 chip containing 45,100 features (for normal controls min, 94 C for 30 sec, annealing temperature as indicated in Table 1 for and 2ME2-treated samples) and a murine genome U74Av2 chip con- 30 sec, 72 C for 1 min, 72 C for 7 min, and4Catthecompletion of the taining 12,500 features (for the pregnancy samples) (Affymetrix) ac- reactions. Primer sequences with annealing temperature and cycles of cording to the manufacturer’s protocol. Gene expression analysis was PCR are listed in Table 1. Quantitative real-time PCR for amphiregulin performed using the GeneChip Operating Software (GCOS) version 1.1 in 2ME2-treated glands and mammary glands during pregnancy was software (Affymetrix). Signal intensities of each chip were normalized done using the Brilliant SYBR Green QPCR kit (Stratagene, La Jolla, CA) to an average target value for 500 excluding the lowest 2% and highest and an iCycler IQ real-time detection system (Bio-Rad Laboratories, 2% signals and transformed to a logarithmic scale for statistical Hercules, CA). The result was normalized by GAPDH expression. The calculations. same primer sets and cDNA for amphiregulin and GAPDH used for Significant differences in gene expression between classes were identi- RT-PCR were used for real-time PCR. fied by ANOVA calculation. Two-class comparisons were made of 2ME2- treated vs. respective controls at each of the doses and time points, and Immunofluorescence microscopy pregnancy and post-pregnancy days vs. corresponding controls. Genes altered by 2-fold at P Ͻ 0.05 and having one of the geometric average Cells were plated on glass coverslips (Corning, NY) in the bottom of signal values above 100 with at least one “Present” call were selected for six-well tissue culture plates. After overnight incubation, cells were further examination. Hierarchical clustering of both genes and samples washed twice with PBS, and serum-free medium was added. SCp2 cells was performed using the Eisen Cluster program (9) with 1 Ϫ ␳ as the ␮ were treated with 10 m 2ME2 for 48 h. F-actin staining with Alexa Fluor distance metric where ␳ is the Pearson correlation coefficient and the 488 phalloidin (Molecular Probes, Inc., Eugene, OR) was performed complete linkage option of the software for agglomerative clustering. following the protocol of the manufacturer. Stained cells were washed Matching of probes present on the 45 K mouse 430 2.0 chip with the probes twice with PBS, air dried, and mounted on the glass slides with a present on the 12.5 K murine genome array U74Av2 was done using the good match file provided by Affymetrix (http://www.affymetrix.com). Multiple matches were unified by best overlap of GenBank TABLE 1. Primers sequences for semiquantitative RT-PCR sequences.

Cycles (annealing Size Genes Primer sequences (5Ј–3Ј) Results temperature, C) (bp) Casein GCTGGACAATAGCGTGTTCTTCC 35 (55) 450 2ME2 induces morphological changes associated with GGGAAGGTGTAATCCTTACTGGG expression of milk proteins in mammary glands WAP TAGCAGCAGATTGAAAGCATTATG 35 (55) 500 GACACCGGTACCATGCGTTG In our previous study demonstrating that 2ME2 sup- Id-1 GTACAACCTTTCTCCAACTT 30 (58) 553 pressed mammary tumor formation in C3(1)/Tag transgenic ATCTGGTCCCTCAGTGCGCC mice (6), we observed that 2ME2 caused significant dilation Id-2 GGAATTGCCCAATGTAAGCA 25 (58) 114 of mammary gland ducts with accumulation of secretory AGGCCATTTCTGACCAAAGA materials including casein. This suggested that 2ME might Id-3 GGTGCGCGGCTGCTACGAG 25 (55) 530 2 CAGGCCACCCAAGTTCAGTCC induce partial differentiation of the mammary glands. To TSP-1 CTCCTGTGATGAGCTGTCCA 30 (55) 190 further investigate the role of 2ME2 on mammary differen- TGTGATAGCATAGGGGAGGC tiation, 6-wk-old wild-type virgin female FVB/N mice were AREG GACTCACAGCGAGGATGACA 25 (55) 249 administered 25, 75, or 150 mg 2ME /kg body weight per GGCTTGGCAATGATTCAACT 2 FOXf2 ATCATCCTCTGCCTCCTGTG 35 (55) 245 day by gavage for 6 wk in this study. Whole-mount analysis GCGCCTGTAGGAACTGGTAG of the mammary glands revealed morphological changes in MMP-12 GCTGTCACAACAGTGGGAGA 35 (55) 236 ductal terminal lobular units with small numbers of alveolar- ATGCTCCTGGGATAGTGTGG type cells and dilated ductal termini (Fig. 1A, right) compared PAX4 GCTCTCCGTTTTCAGTTTGC 35 (55) 184 with the untreated virgin controls (Fig. 1A, left). No signif- AGGGTCGCATCCCTCTTATT ATF3 CAGAGCCTGGTGTTGTGCTA 30 (55) 224 icant difference in the number of terminal lobular units was AGGTGTCGTCCATCCTCTGTT observed between the 2ME2-treated and control animals as GAPDH ATCACCATCTTCCAGGAGCGAGAC 35 (55) 475 determined by computer-assisted quantification (data not ATGCCAGTGAGCTTCCCGTTCAGC shown). The dilated ductal terminal lobular units in the

Sense primer is listed first, with antisense primer below it. 2ME2-treated mammary glands exhibited increased cellular- Huh et al. • 2ME2-Induced Mammary Gland Differentiation Endocrinology, March 2007, 148(3):1266–1277 1269 Downloaded from https://academic.oup.com/endo/article/148/3/1266/2502028 by guest on 23 September 2021

FIG. 2. A, Morphological changes and F-actin staining (green)of

SCp2 cells by 2ME2. Actin cytoskeleton images were visualized using confocal microscopy in normal mammary epithelial cells. Nuclei are visualized by 4Ј,6-diamidino-2-phenylindole staining (blue). SCp2 ␮ cells were treated with 10 M 2ME2 for 48 h. B, SCp2 cells were starved for 3 d before treatment and then maintained in 2% FBS FIG. 1. Wild-type FVB mice were treated with 2ME2 from6wkofage ␮ medium treated with 2ME2 in 0, 5, 10, or 50 M concentration for 24 for 6 wk. A, Mammary whole-mount analysis demonstrates that mor- and 48 h. To detect mRNA expression, RT-PCR for ␤-casein, Id-1, Id-2, phological changes were induced by 2ME in mammary glands. In the 2 Id-3, and TSP-1 was performed in SCp2 cells. GAPDH was used as an 150-mg/kg 2ME -treated mice, alveolar side branching and budding 2 internal control. C, siRNA for Id-1 (50 and 100 nM) was transfected was observed compared with the control groups (magnification, ϫ with Lipofectamine 2000 for 24 h following the manufacturer’s in- 100). B, Red boxes in A were enlarged. C, Immunohistochemical struction in M6 cells for Western blotting to detect Id-1 protein ex- analysis of casein shows that casein expression was dramatically pression. D, Knocking down of Id-1 alone by siRNA could not produce secreted inside of lumen of mammary glands by 2ME . D, RT-PCR 2 ␤-casein. However, 2ME had a synergic effect when it was used with was performed to show the expression of milk proteins. ␤-Casein was 2 siRNA for Id-1. The cells were treated with siId-1 or 2ME2 for 6 and expressed in a dose-dependent manner, whereas WAP expression was 48 h. highly detected in the highest dose (150 mg/kg⅐d).

ity (Fig. 1B, right) compared with mammary glands from induced significant intracellular cytoskeleton reorganization control mice (Fig. 1B, left). The morphological changes were with larger nuclei associated with the differentiation of the associated with increased expression of milk protein ␤-casein SCp2 cells (Fig. 2A, lower panel). as determined by immunohistochemical analysis (Fig. 1C). A milder differentiating effect was observed at 75 mg/kg⅐d but 2ME2 induces differentiation associated with down- not at 25 mg/kg⅐d, demonstrating a dose response. Increased regulation of Id-1 expression of whey acidic protein (WAP), which is usually ␤ 2ME2 induced -casein expression in SCp2 cells as well as detected at a late stage of pregnancy, was demonstrated by in mammary epithelium in vivo. Because Id-1 has been shown RT-PCR at the higher dose of 2ME2, whereas increased levels ␤ to inhibit mammary epithelial differentiation and Id-2 ex- of -casein, which is usually detected at early stages of preg- pression is associated with mammary gland differentiation nancy, was observed at both the 75- and 150-mg/kg doses of ␤ and -casein expression (12), we explored whether 2ME2 also 2ME2 (Fig. 1D). regulates mammary differentiation, at least in part, through Id proteins. 2ME reduced Id-1 and Id-3 expression in asso- 2ME induces morphological and cytoskeletal changes 2 2 ciation with induced expression of ␤-casein in a dose-de- during differentiation in vitro pendent manner in SCp2 cells, consistent with previous re-

To investigate potential mechanisms of mammary differ- ports (13). 2ME2 had no effect on Id-2 expression (Fig. 2B). entiation induced by 2ME2, we employed the SCp2 mam- Because thrombospondin-1 (TSP-1) is a downstream target mary epithelial cell in vitro system (7). Striking morpholog- and negatively inhibited by Id-1 (14), we evaluated TSP-1 ical changes are observed during mammary differentiation in expression. Consistent with the down-regulation of Id-1,

vivo, and changes in cellular architecture may influence cel- TSP-1 expression was increased in response to 2ME2 treat- lular growth, differentiation, and gene expression (10, 11). ment. These results suggest that the induction of mammary Changes in cellular architecture lead to altered intracellular epithelial cell differentiation is strongly associated with the signaling including those induced by the ECM. As shown in down-regulation of Id-1 expression (Fig. 2B).

Fig. 2A, addition of 2ME2 resulted in the growth arrest of To examine whether inhibition of Id-1 expression alone SCp2 cells, which became larger and more rounded than might directly lead to mammary differentiation, we used untreated SCp2 cells whose morphology remained flattened Id-1 siRNA to inhibit expression. The efficacy of the siRNA

(Fig. 2A, upper panel). Staining for F-actin revealed that 2ME2 in reducing Id-1 protein levels was demonstrated by Western 1270 Endocrinology, March 2007, 148(3):1266–1277 Huh et al. • 2ME2-Induced Mammary Gland Differentiation

blot analysis. Id-1 protein levels in M6 tumor cells, which gesting that a suppressor element may be contained within express high basal protein levels of Id-1, significantly de- this portion of the 5Ј-flanking region of the Id-1 gene. creased using Id-1 siRNA (Fig. 2C). SCp2 cells (whose basal level of Id-1 protein was below the sensitivity threshold for Comparison of gene expression profiles between 2ME2- our Western blot) transfected with Id-1 siRNA (Fig. 2D) did treated mammary glands and mammary glands not differentiate because ␤-casein expression did not in- differentiated during pregnancy crease, even though Id-1 expression decreased (Fig. 2D). To understand potential molecular mechanisms by which However, reducing the level of Id-1 expression in combina- 2ME2 induces differentiation, microarray expression profiling tion with administration of 2ME2 augmented the level of ␤ was performed to identify changes in gene expression induced -casein expression compared with 2ME2 treatment alone by 2ME2 both in vitro and in vivo. Global gene expression (Fig. 2D). This suggests that Id-1 may play a cooperative role profiling was performed using mammary glands at P16, L2, in mammary differentiation with other factors induced by and W30 and compared with gene expression changes in- Downloaded from https://academic.oup.com/endo/article/148/3/1266/2502028 by guest on 23 September 2021 2ME2, because reduction of Id-1 alone is not sufficient to duced by 2ME2 treatment of mammary glands in vivo and induce differentiation of SCp2 cells. mammary epithelial SCp2 cells in vitro. Gene expression data are available at http://caarraydb.nci.nih.gov/caarray/. 2ME represses Id-1 transcriptional activity 2 Compared with the control virgin mammary gland, we To investigate 5Ј genomic regions of the Id-1 gene poten- found 100 up-regulated and 141 down-regulated genes in ⅐ tially regulating transcription in response to 2ME2, Id-1 pro- mice treated with 75 mg 2ME2/kg d, whereas 60 up-regu- moter luciferase assays were performed using five different lated and 202 down-regulated genes were observed in the Ϫ ⅐ mutant reporter constructs (8): Id-1 Luc 2.2 kb ( 2212 to 0 150-mg 2ME2/kg d group. A comparison between 2ME2 bp), 5Ј del-1(Ϫ1572 to 0 bp), 5Ј del-2 (Ϫ1361 to 0 bp), 5Ј del-3 treatment and P16 groups demonstrated 27 genes with sim- (Ϫ1200 to 0 bp), and 5Ј del-6 (Ϫ272 to 0 bp) (Fig. 3A). Binding ilar expression patterns including the up-regulation of many sites for transcription factors YY1, EGR-1, CREB/ATF, AP2, milk proteins (2-fold change at P Ͻ 0.05) (Table 2). Several Ϫ Ϫ Ͻ and E-box are contained between 1156 and 946 bp, genes significantly altered by 2ME2 treatment in vivo (P whereas sites for C/EBP␣, NF1, SP1, CP1, and Zeste are 0.05 and 2-fold) were similarly regulated in mammary glands Ϫ Ϫ ␣ ␤ ␥ located between 272 and 145 bp. 2ME2 had a significant during pregnancy (Fig. 4A) including the caseins , , and , dose-dependent effect on Id-1 transcriptional levels in all of WAP, lactalbumin ␣, and lactotransferrin.

the constructs used, including the longest promoter available Subclusters of genes significantly altered by 2ME2 in vitro (2.2 kb). An element downstream from Ϫ2.2 kb appears to (2-fold, P Ͻ 0.05) are shown in Fig. 4, C and D. Most milk

suppress general transcriptional activity (Fig. 3B). 2ME2 also proteins were up-regulated in both 2ME2-treated and preg- decreased 75% of the promoter activity in the 5Ј del-3 con- nant glands, whereas Per1, Per2, and oxysterol binding pro- ␮ struct at the 50 m concentration. This region has been shown tein-like 9 were similarly down-regulated in 2ME2-treated to be crucial for constitutive Id-1 expression in metastatic glands and glands from pregnant mice (Fig. 4A). Clusters of

cells as well as serum responsiveness in nonaggressive breast genes that are differentially expressed between 2ME2 treat- cancer cells (8). Interestingly, the basal promoter activity ment in vivo and pregnant mammary glands were selected in increased with loss of the Ϫ2212 to Ϫ1572 sequences, sug- Fig. 4, C and D. Serpine2, AREG, Sox6, and ATF3 were

FIG. 3. A, Id-1 promoter constructs; B, Id-1 promoter luciferase vectors (Id-1 Luc 2.2 kb, 5Јdel-1, 5Јdel-2, 5Јdel-3, and 5Јdel-6) were transfected into SCp2 cells to investigate transcriptional regulation. Four hours after Id-1 promoter ␮ luciferase vectors, 2ME2 was added with 0, 10, 50, or 100 M concentration in 2% FBS. Id-1 promoter activity was down-

regulated by 2ME2 in a dose-dependent manner. The result was normalized with pCMV luciferase activity. The experiments were done in triplicate. Huh et al. • 2ME2-Induced Mammary Gland Differentiation Endocrinology, March 2007, 148(3):1266–1277 1271

⅐ TABLE 2. Comparison of gene expression profiles of mammary glands from pregnancy (16 d) and 2ME2 (150 mg/kg d) treatment

Probeset Id UniGene ID Gene Description P16 /12W 2ME2/control 1448386_a_at Mm.268094 Wap Whey acidic protein 1584.07 33.1 1418363_at Mm.5074 Lalba Lactalbumin, ␣ 377.93 15.47 1420633_a_at Mm.4908 Csng Casein ␥ 225.98 34.58 1449254_at Mm.288474 Spp1 Secreted phosphoprotein 1 44.6 3.38 1420369_a_at Mm.268737 Csnb Casein ␤ 43.36 12.92 1416854_at Mm.284891 Slc34a2 Solute carrier family 34 (sodium phosphate), member 2 32.23 1.52 1420627_a_at Mm.295878 Csna Casein ␣ 25.77 6.46 1419473_a_at Mm.2619 Cck Cholecystokinin 24.92 2.01 1449326_x_at Mm.200941 Saa2 Serum amyloid A 2 11.65 2.15 1450009_at Mm.282359 Ltf Lactotransferrin 4.99 2.44 1418220_at Mm.243661 Foxf2 Forkhead box F2 4.11 2.87 1445149_at Mm.227506 D7Ertd458e Poliovirus receptor 3.71 1.27 Downloaded from https://academic.oup.com/endo/article/148/3/1266/2502028 by guest on 23 September 2021 1451598_at Mm.8026 Pax4 Paired box gene 4 3.23 3.8 1419349_a_at Mm.226708 Cyp2d9 Cytochrome P450, family 2, subfamily d, polypeptide 9 2.94 5.44 1450834_at Mm.63450 Fut4 Fucosyltransferase 4 2.73 3.82 1426337_a_at Mm.14774 Tead4 TEA domain family member 4 2.38 4.32 1421036_at Mm.2380 Npas2 Neuronal PAS domain protein 2 2.34 2.23 1449524_at Mm.328086 Eda Ectodysplasin-A 2.25 1.87 1420335_at Mm.2524 Dmc1 h Disrupted meiotic cDNA 1 homolog 1.93 2.23 1427669_a_at Mm.8321 Cit Citron 1.42 2.8 1419487_at Mm.373556 Mybph Myosin binding protein H 0.46 0.49 1422135_at Mm.42054 Zfp146 Zinc finger protein 146 0.44 0.48 1427385_s_at Mm.253564 Actn1 Actinin, ␣ 1 0.39 0.65 1419064_a_at Mm.306021 Ugt8 UDP-glucuronosyltransferase 8 0.28 0.3 1452523_a_at Mm.30095 4930527D15Rik RIKEN cDNA 4930527D15 gene 0.27 0.3 1415994_at Mm.21758 Cyp2e1 Cytochrome P450, family 2, subfamily e, polypeptide 1 0.22 0.64 1420018_s_at Mm.22270 Tspan8 Tetraspanin 8 0.06 0.53

up-regulated by 2ME2 treatment but were down-regulated in Quantitative analysis of amphiregulin was performed us- pregnant glands (Fig. 4C). Catenin ␦2, endothelin 2, Mesp1, ing quantitative real-time PCR. A representative result is and Gjbp4 were down-regulated by 2ME2 but up-regulated demonstrated in Fig. 6B. Mammary glands from 2ME2- in glands during pregnancy (Fig. 4D). treated mice demonstrated increased expression of amphi- To identify whether any changes in gene expression in- regulin in a dose-dependent manner, which was not detect- duced by 2ME2 are also seen in fully involuted mammary able in mammary glands from pregnant mice (Fig. 6B). glands, we compared 2ME2-treated samples with mammary Results were normalized using GAPDH expression as an glands from animals 30 d after the cessation of lactation internal control. (W30). Genes whose expression was similarly altered between W30 and 2ME2 treatment are depicted in the cluster 2ME2 but not E2 induces differentiation in Fig. 5. Immune mediators (IgM, Igk-V8, Igh-1a, Igj, Ighg, To determine whether mammary differentiation induced Igh-4, and Igk-C) and milk proteins were up-regulated in ␤ by 2ME2 can be similarly induced by E2, induction of -casein both 2ME2-treated glands and mammary glands during by SCp2 cells was assessed upon stimulation by 2ME or E . pregnancy. Several genes that modify the ECM were iden- 2 2 Exposure to 2ME2, but not E2, resulted in a small but de- tified in 2ME2-treated mammary glands. Spondin 1, elastin, tectable level of ␤-casein production in SCp2 cells (Fig. 7A). cathepsin R, and fibulin1 were up-regulated in 2ME2-treated To further confirm the specific effects of 2ME2, SCp2 cells Ϫ Ϫ mammary gland, whereas MMP-9 and MMP-12 were up- were exposed to a wide range of concentrations (0, 10 1,10 2, regulated in both 2ME2-treated glands and mammary glands ␮ 1, and 10 m)of2ME2 and E2. AREG and Id-1 expression during pregnancy. were determined by RT-PCR after 24 h or 48 h treatment, respectively (Fig. 7B). AREG expression was up-regulated by Validation of microarray analysis by RT-PCR 2ME2, but E2 did not alter AREG expression. Conversely, Id-1 RT-PCR was performed to confirm the microarray results expression was down-regulated by 2ME2 but was up-regu- from mammary tissue samples from mice treated with 0, 25, lated by E2, suggesting 2ME2 and E2 operate through differ- ⅐ 75, or 150 mg 2ME2/kg d, and representative results are ent mechanisms to alter gene transcription and differentiate shown in Fig. 6A. mammary glands. ␮ Ϫ2 ␮ Amphiregulin and ATF3 were up-regulated in 2ME2- Additionally, the effects of 2ME2 (10 m) and E2 (10 M) treated samples but were down-regulated in pregnant mam- on ER signaling in SCp2 cells, which are ER negative (data mary glands. The expression of PAX4 and FOXf2 were in- not shown), was assessed using a reporter system with an creased in both 2ME2-treated and P16 mammary glands. ERE fused to luciferase (pERE-Luc plasmid). This plasmid MMP-12 was similarly up-regulated in both 2ME2-treated was cotransfected with the ER expression plasmid (pCL- Ϫ2 ␮ and W30 mammary glands. Id-1 expression was down-reg- nGL1-HEGO) in SCp2 cells (Fig. 7C). E2 at 10 M activated ulated by 2ME2 (Fig. 6A), with the maximal effect observed ERE-dependent transcription in SCp2 cells, but even at con- ⅐ ␮ ␮ at 75 mg/kg d. centrations of 10 m 2ME2 or 0.1 m tamoxifen, no effect on 1272 Endocrinology, March 2007, 148(3):1266–1277 Huh et al. • 2ME2-Induced Mammary Gland Differentiation Downloaded from https://academic.oup.com/endo/article/148/3/1266/2502028 by guest on 23 September 2021

FIG. 4. For microarray studies, mammary glands of wild-type FVB mice from

6 wk of age were treated with 2ME2 for 6wkforin vivo. For in vitro samples, ␮ SCp2 cells treated with 10 M 2ME2 for 6, 24, or 48 h were used. Pregnancy mammary tissue samples were collected at P16, L2, and W30. Shown is hierarchical clustering of 243 genes altered on

2ME2 treatment in vitro by at least 2-fold at P Ͻ 0.05 and comparison with

the expressions in pregnancy and 2ME2 treatment in vivo. A and B, Genes reg-

ulated in the same direction in 2ME2- treated and pregnancy mammary glands. C and D, Differentially ex-

pressed genes between 2ME2 treatment and pregnancy were clustered.

the transcriptional activity through the ERE was observed, siRNA followed 15 h later with the supplementation of 2ME2 consistent with previous reports that suggest that 2ME2 may for 12 h. Inhibition of AREG was associated with a complete operate through non-ER-ERE mechanisms (Fig. 7C). lack of ␤-casein expression, suggesting that AREG is in-

volved in 2ME2-induced mammary differentiation (Fig. 8A). Amphiregulin is involved in 2ME2-induced mammary Additionally, knockdown of AREG expression was associ- differentiation ated with the up-regulation of Id-1 and the down-regulation

Because AREG was significantly induced by 2ME2 both in of ATF3, whose expression was shown by microarray anal- vitro and in vivo, we investigated whether AREG plays a role ysis to be up-regulated by 2ME2 treatment.

in 2ME2-induced differentiation. AREG levels were altered in EGFR is thought to be the exclusive receptor for amphi- SCp2 cells either through the knockdown of expression by regulin signaling. Tarceva, an inhibitor of EGFR phosphor- siRNA or through the exogenous administration of amphi- ylation and signaling, blocked 2ME2-induced differentiation regulin to SCp2 cells. SCp2 cells were transfected with AREG (Fig. 8, B and D) and down-regulated AREG expression in Huh et al. • 2ME2-Induced Mammary Gland Differentiation Endocrinology, March 2007, 148(3):1266–1277 1273 Downloaded from https://academic.oup.com/endo/article/148/3/1266/2502028 by guest on 23 September 2021

FIG. 5. Hierachical clustering of gene expression profiles compared between mammary glands from 2ME2 treatment and post lactation (W30) altered by 2-fold changes at P Ͻ 0.05. 1274 Endocrinology, March 2007, 148(3):1266–1277 Huh et al. • 2ME2-Induced Mammary Gland Differentiation Downloaded from https://academic.oup.com/endo/article/148/3/1266/2502028 by guest on 23 September 2021

FIG. 6. A, Validation of microarray data by RT-PCR. AREG, MMP- 12, Foxf2, Pax4, and ATF3 were up-regulated and Id-1 was down- regulated in mammary glands from normal virgin mice by 0, 25, 75, ⅐ and 150 mg/kg dof2ME2 treatment for 6 wk beginning at 6 wk of age. B, Relative mRNA expression of AREG in 2ME2-treated glands and mammary glands during pregnancy was quantified by real-time RT- PCR. The result was normalized by GAPDH. N, 12-wk-old virgin; W, ␤ Ͻ ⅐ FIG. 7. A, Casein expression by RT-PCR. -Casein was expressed d 30 post lactation. *, P 0.05 for control vs. 75 or 150 mg/kg d. Bar, ␮ Ϫ2 mildly by 2ME2 (10 M) for 24 h in 2% FBS medium but not by E2 (10 SD. ␮ Ϫ2 M) in SCp2 cells. B, Various concentrations of 2ME2 and E2 (0, 10 , Ϫ 10 1, 1, and 10 ␮M) were treated in SCp2 cells. Amphiregulin and Id-1 SCp2 cells. Changes in cell morphology induced by 2ME2 expression were compared by RT-PCR for 24 or 48 h treatment, differentiation were also inhibited by Tarceva (Fig. 8C). ATF3 respectively. Amphiregulin expression was up-regulated, whereas was significantly up-regulated by exogenous amphiregulin Id-1 expression was down-regulated by 2ME2.E2 treatment did not or 2ME treatment for 24 h, and Id-1 expression was down- change AREG expression but up-regulated Id-1 expression. GAPDH 2 was used as an internal control. C, ER promoter assay after treatment regulated under the same conditions, suggesting these genes ␮ with 2ME2,E2, tamoxifen (Tam, 0.1 M) in SCp2 cells. E2 increased are involved in 2ME2-induced differentiation (Fig. 8D). ER promoter activity; however, no effect was observed with 2ME2 or Ͻ tamoxifen. *, P 0.05, 2ME2 vs. E2. Discussion Differentiation of the mammary gland is a complex pro- levels in the range of 9–60 nm can be achieved (data not cess that requires coordinated hormone signaling and stro- shown). At these plasma levels in mice, which are consid- mal-epithelial interactions (15) leading to tremendous ex- erably lower than those needed in vitro, we see effects on pansion of alveolar cell numbers with the ability to secrete tubulin and an antitumor response (16). In vitro effects of ␣ significant quantities of milk. Aside from the critical role of 2ME2 on tubulin and HIF-1 were demonstrable at 10–100 mammary differentiation for lactation, it has been proposed ␮m concentrations, whereas in vivo activity was seen at 30– ⅐ that pregnancy and mammary differentiation may strongly 150 mg 2ME2/kg d (16). This could occur for several reasons: influence risk factors related to the development of mam- 1) plasma drug levels do not reflect tumor drug levels or 2) mary cancer. Early pregnancy is associated with a reduced in vitro experiments are done with constant exposure to drug, risk of breast cancer years later, whereas the periparous whereas once-daily administration of 2ME2 to mice does not period is associated with an increased risk of aggressive result in significant drug levels for the 24-h period. Indeed, breast cancer development (3). in vitro experiments looking at transient exposure to drug

Given the fact that endogenous levels of 2ME2 are ex- demonstrated that cells had to be exposed to drug for greater tremely high during later stages of pregnancy and that our than6hina24-h period to approach the activity of constant previous study suggested that 2ME2 may have a differenti- drug exposure. Furthermore, in vivo experiments have ating effect on the mammary gland, we further evaluated the shown that fractionated dosing of 2ME2 results in better differentiating effects and mechanisms by which 2ME2 in- activity, such that 2 mg/d given as 0.5 mg four times a day fluences mammary epithelial cell differentiation. gives better antitumor activity than 2 mg given once a day. An extensive analysis evaluating the pharmacokinetic and In a previously published study from our lab, we demon- pharmacodynamic relationship of 2ME2 has been done. Mice strated that 2ME2 has antiangiogenic activity when admin- ⅐ orally administered 150 mg/kg 2ME2 achieve a plasma max- istered to mice at 150 mg/kg d (6). imal concentration of 1967 nm and area under the curve of The results of the present study demonstrate that 2ME2 3971 nm-h (data not shown). In the mice at 150 mg/kg, drug alters the state of mammary epithelial differentiation both Huh et al. • 2ME2-Induced Mammary Gland Differentiation Endocrinology, March 2007, 148(3):1266–1277 1275

reports and suggest that Id-3 expression may also be important for regulating mammary gland differentiation.

Additionally, we have demonstrated that 2ME2 is able to inhibit Id-1 expression, at least in part, through repression of transcription in normal mammary epithelial cells. We dem-

onstrated that 2ME2 inhibits Id-1 transcriptional activity in several breast cancer cell lines and proposed that this may, in part, account for the antitumorigenic activity of 2ME2

observed in our previous study (6). A major effect of 2ME2 transcriptional repression in normal mammary epithelial cells appears to be through a cis-acting region within approximately 270 bp upstream of the transcriptional start site Downloaded from https://academic.oup.com/endo/article/148/3/1266/2502028 by guest on 23 September 2021 and another region extending up to Ϫ1200 bp. In the breast

cancer cell lines studied, 2ME2 has less of an inhibitory effect on Id-1 promoter activity in the 5Ј del-6 construct, containing the Ϫ270 to 0 bp region, compared with the other promoter FIG. 8. A, SCp2 cells were transfected with siRNA for AREG (100 sequences contained in the 5Ј del-1 and 5Ј del-3 constructs (6). ␮ nM). 2ME2 (10 M) was added 15 h after transfection for 12 h. RT-PCR Although several transcriptional binding sites are contained was performed to detect AREG, ATF3, Id-1, and ␤-casein. GAPDH was used as an internal control for in vivo and in vitro samples. siRNA in these regions, more studies will be required to determine for AREG induced Id-1 expression resulting in blocking ␤-casein ex- exactly through which cis-acting elements 2ME2 results in pression, whereas it had a minor effect on ATF3 expression induced transcriptional repression. by 2ME . B, Tarceva (10 ␮M) inhibited expression of ␤-casein induced 2 A major difference between 2ME2-induced differentiation by 2ME ; however, Tarceva alone showed no effects on Id-1 expres- 2 and pregnancy was noted in the expression of AREG. Mice sion. C, Tarceva blocked morphological changes caused by 2ME in 2 lacking functional AREG exhibit severely stunted ductal out- SCp2 cells. Cells were treated with Tarceva for 1 h, and then 2ME2 was added for 24 h before cells were photographed. D, Overexpression growth during puberty, consistent with an important role for of AREG induced expression of ␤-casein. SCp2 cells were treated with AREG during normal development of mammary ducts and ␮ ␮ 2ME2 (10 M), AREG (6 ng/ml), or Tarceva (10 M) for 24 h in the terminal end buds (19). AREG has been shown to influence culture condition mentioned in Materials and Methods. Both 2ME2- induced AREG and exogenous AREG treatment induced ␤-casein early stages of mammary differentiation, but its expression expression. Tarceva blocked AREG expression, which is induced by during pregnancy is dramatically down-regulated. This is in

2ME2 or exogenous AREG treatment. ATF3 expression was up-reg- contrast to both our in vitro and in vivo demonstration that ulated by up-regulation of AREG, whereas Id-1 expression was in- 2ME2 induces the overexpression of AREG, which is known versed. to signal through EGFR.

To more fully assess the role of AREG in 2ME2-induced in vitro and in vivo. However, although 2ME2 can stimulate differentiation of mammary epithelial cells, we used the pre- the expression of mammary differentiation markers such as viously well-characterized SCp2 cell system that was derived ␤-casein and WAP, it appears to do so through mechanisms from normal mammary epithelial cells of a pregnant mouse. that are distinct from pregnancy-induced differentiation. SCp2 cells have been shown to differentiate into casein- This is exemplified by the significant differences in gene producing cells upon stimulation with prolactin and laminin.

expression observed in 2ME2-induced differentiation in nor- In the present study, we demonstrate that SCp2 cells can ␤ mal FVB/N mice compared with gene expression changes undergo differentiation by 2ME2 alone, as evidenced by -ca- that occur during pregnancy. Mice treated with 2ME2 did not sein expression independent of prolactin. This differentiation develop an extensive lobuloalveolar system as seen in preg- effect is blocked by inhibition of AREG expression using nancy, and prolactin serum levels were not changed in the siRNA, whereas the addition of amphiregulin to the media

2ME2-treated mice compared with the control mice (data not results in the expression of the differentiation markers. Con- shown). sistent with these findings is the observation that Tarceva, an Previous studies using SCp2 cells have also demonstrated inhibitor of EGFR signaling, also blocks differentiation in-

that there is an inverse association between the expression of duced by both 2ME2 and amphiregulin. Id-1 and cellular differentiation (13). Inhibitor of differenti- ATF3 (a gene involved in stress response, wound healing, ation (Id) proteins are key regulators of myogenesis, neuro- cell cycle, sexual differentiation, and estrogen signaling) (20) genesis, angiogenesis, and differentiation of many cell lin- is a component of the ATF/SMAD3 complex that mediates ␤ eages (17, 18). We have previously demonstrated that 2ME2 the repression of Id-1 by TGF- (21). Based on these obser- inhibits Id-1 expression in endothelial cells and breast cancer vations, we hypothesized that 2ME2 might suppress Id-1 cells, which is related to antiangiogenic and antitumorigenic expression through a mechanism involving ATF3, leading to effects (6). In this study, we observed that expression of Id-1 mammary epithelial differentiation, and therefore, we also and Id-3, but not Id-2, are down-regulated in normal mam- measured levels of ATF3. The expression level of ATF3 was ⅐ mary epithelial cells by 2ME2. Id-3 is often coexpressed tem- the highest in mice that received 75 mg 2ME2/kg d, not 150 porally and spatially with Id-1 during murine neurogenesis mg/kg⅐d. Such a U-shaped dose-response curve has been and angiogenesis (18), whereas little is known about the role observed in other systems. A biphasic dose-response has of Id-3 in association with mammary differentiation. The been observed for endostatin, an endogenous antiangiogenic results of this study are in agreement with these previous factor (22). Our results similarly suggest that there may be an 1276 Endocrinology, March 2007, 148(3):1266–1277 Huh et al. • 2ME2-Induced Mammary Gland Differentiation

optimal concentration of 2ME2 to alter Id-1 and ATF because our previous studies have demonstrated that it may expression. increase cystic tumor formation in a prevention setting.

Our current study suggests that 2ME2 does not require ER to induce its effects and does not stimulate transcription Acknowledgments through an ERE. 17␤-E does not induce ␤-casein in SCp2 2 We are grateful to Lisa Riffle for animal care, Dr. Barbara Vonderhaar cells, further suggesting that 2ME2 uses a non-ER signaling for generously providing casein antibody, Dr. Mina Bissell for kindly pathway to differentiate mammary epithelial cells. However, providing SCp2 cells, and Dr. Christina Bennett for her critical review additional studies are required to more definitively exclude of this manuscript. We also appreciate assistance with confocal imaging the role of ER in mediating 2ME effects. Interestingly, 2ME from Drs. James McNally and Tatiana Karpova in the Fluorescence 2 2 Imaging Facility, Laboratory of Receptor Biology and Gene Expression, could increase casein expression in SCp2 cells without stim- National Cancer Institute, National Institutes of Health. ulation by lactogenic hormones or ECM components, whereas E did not have this effect. Signaling through EREs

2 Received July 19, 2006. Accepted November 29, 2006. Downloaded from https://academic.oup.com/endo/article/148/3/1266/2502028 by guest on 23 September 2021 by E2, however, was demonstrated in SCp2 cells using an Address all correspondence and requests for reprints to: Jeffrey E. ERE-luciferase reporter system cotransfected with ER ex- Green, Laboratory of Cell Regulation and Carcinogenesis, National Can- cer Institute, National Institutes of Health, Building 41, Room C629, 41 pression plasmid, but much higher concentrations of 2ME2 Medlars Drive, Bethesda, Maryland 20892. E-mail: [email protected]. did not induce transactivation of the ERE reporter. The expression level of casein induced by 2ME2 was quite low, References however, compared with prolactin stimulation, indicating 1. Russo J, Hu YF, Silva ID, Russo IH 2001 Cancer risk related to mammary that prolactin is a much stronger inducer of differentiation gland structure and development. Microsc Res Tech 52:204–223 than 2ME2. Additionally, a previous study reported that 2. Polyak K 2006 Pregnancy and breast cancer: The other side of the coin. Cancer estradiol induced AREG expression in ER-positive human Cell 9:151–153 3. Schedin P 2006 Pregnancy-associated breast cancer and metastasis. Nat Rev breast cancer cells (9). However, in ER-negative SCp2 cells, Cancer 6:281–291 AREG expression was induced by 2ME2 but not by E2. This 4. Mesiano S, Jaffe RB 1999 The endocrinology of human pregnancy and fetal- result further suggests that 2ME and E might use different placental neuroendocrine development. 5th ed. Philadelphia: Elsevier Saun- 2 2 ders mechanisms to induce differentiation in mammary epithelial 5. Berg D, Sonsalla R, Kuss E 1983 Concentrations of 2-methoxyoestrogens in cells based on their ER status. human serum measured by a heterologous immunoassay with an 125I-labelled ligand. Acta Endocrinol (Copenh) 103:282–288 Changes in the expression of genes influencing the mi- 6. Huh JI, Calvo A, Charles R, Green JE 2006 Distinct tumor stage-specific croenvironment and immune response during involution inhibitory effects of 2-methoxyestradiol in a breast cancer mouse model as- have been proposed as factors that may promote tumori- sociated with Id-1 expression. Cancer Res 66:3495–3503 7. Roskelley CD, Desprez PY, Bissell MJ 1994 Extracellular matrix-dependent genesis in the periparous period (3). Degradation of the ECM tissue-specific gene expression in mammary epithelial cells requires both phys- is an important element of tissue remodeling during mam- ical and biochemical signal transduction. Proc Natl Acad Sci USA 91:12378– 12382 mary gland involution and also for tumor invasion and pro- 8. Singh J, Murata K, Itahana Y, Desprez PY 2002 Constitutive expression of the gression. Several ECM proteins such as spondin1, MMP-9, Id-1 promoter in human metastatic breast cancer cells is linked with the loss elastin, and cathepsin R were found to be up-regulated by of NF-1/Rb/HDAC-1 transcription repressor complex. Oncogene 21:1812– 1822 2ME2 in this study and may lead to partial remodeling of the 9. Martinez-Lacaci I, Saceda M, Plowman GD, Johnson GR, Normanno N, ECM. In this regard, it is possible that the increased cystic Salomon DS, Dickson RB 1995 Estrogen and phorbol esters regulate amphi- tumor formation we previously observed when 2ME was regulin expression by two separate mechanisms in human breast cancer cell 2 lines. Endocrinology 136:3983–3992 administered in a cancer prevention setting (6) could also be 10. Boudreau N, Bissell MJ 1998 Extracellular matrix signaling: integration of due in part to changes induced in the mammary microen- form and function in normal and malignant cells. Curr Opin Cell Biol 10:640– 646 vironment in addition to the inhibitory effect of 2ME2 on 11. Kheradmand F, Werner E, Tremble P, Symons M, Werb Z 1998 Role of Rac1 endothelial cell growth. Some of these extracellular compo- and oxygen radicals in collagenase-1 expression induced by cell shape change. nents, such as MMP-9 and elastin, are potentially involved Science 280:898–902 12. Parrinello S, Lin CQ, Murata K, Itahana Y, Singh J, Krtolica A, Campisi J, in promoting cancer progression (23). Previous microarray Desprez PY 2001 Id-1, ITF-2, and Id-2 comprise a network of helix-loop-helix studies identified alterations in the expression of numerous proteins that regulate mammary epithelial cell proliferation, differentiation, immune-related genes during mammary involution (24, 25). and apoptosis. J Biol Chem 276:39213–39219 13. Desprez PY, Hara E, Bissell MJ, Campisi J 1995 Suppression of mammary Immune mediators, primarily Ig, were also identified in epithelial cell differentiation by the helix-loop-helix protein Id-1. Mol Cell Biol 2ME2-treated mammary glands in our present study. 15:3398–3404 14. Volpert OV, Pili R, Sikder HA, Nelius T, Zaichuk T, Morris C, Shiflett CB, Multiple signaling pathways have also been known to be Devlin MK, Conant K, Alani RM 2002 Id1 regulates angiogenesis through involved in mammary budding, branching, and differenti- transcriptional repression of thrombospondin-1. Cancer Cell 2:473–483 ation, such as stimulation by progesterone, Wnt, prolactin, 15. Wiseman BS, Werb Z 2002 Stromal effects on mammary gland development and breast cancer. Science 296:1046–1049 EGF family members, and Stat5a signaling (26). However, 16. Mabjeesh NJ, Escuin D, LaVallee TM, Pribluda VS, Swartz GM, Johnson the results of this study demonstrate that 2ME2 can induce MS, Willard MT, Zhong H, Simons JW, Giannakakou P 2003 2ME2 inhibits a partial differentiation of the mammary gland involving the tumor growth and angiogenesis by disrupting microtubules and dysregulating HIF. Cancer Cell 3:363–375 amphiregulin-EGFR pathway. Additionally, 2ME2 led to 17. Benezra R, Davis RL, Lockshon D, Turner DL, Weintraub H 1990 The protein changes in expression of immune- and ECM-related genes. Id: a negative regulator of helix-loop-helix DNA binding proteins. Cell 61: 49–59 Although differentiation therapy has been proposed as a 18. Lyden D, Young AZ, Zagzag D, Yan W, Gerald W, O’Reilly R, Bader BL, potential method to reduce breast cancer risk beyond anti- Hynes RO, Zhuang Y, Manova K, Benezra R 1999 Id1 and Id3 are required for neurogenesis, angiogenesis and vascularization of tumour xenografts. Na- angiogenic activity of 2ME2 in cancer therapy, caution would ture 401:670–677 be warranted in using 2ME2 for this purpose because it does 19. Luetteke NC, Qiu TH, Fenton SE, Troyer KL, Riedel RF, Chang A, Lee DC not induce identical changes as observed in pregnancy and 1999 Targeted inactivation of the EGF and amphiregulin genes reveals distinct Huh et al. • 2ME2-Induced Mammary Gland Differentiation Endocrinology, March 2007, 148(3):1266–1277 1277

roles for EGF receptor ligands in mouse mammary gland development. De- 24. Stein T, Morris JS, Davies CR, Weber-Hall SJ, Duffy MA, Heath VJ, Bell velopment 126:2739–2750 AK, Ferrier RK, Sandilands GP, Gusterson BA 2004 Involution of the 20. Liu B, Agras K, Willingham E, Vilela ML, Baskin LS 2006 Activating tran- mouse mammary gland is associated with an immune cascade and an scription factor 3 is estrogen-responsive in utero and upregulated during acute-phase response, involving LBP, CD14 and STAT3. Breast Cancer Res sexual differentiation. Horm Res 65:217–222 6:R75–R91 21. Kang Y, Chen CR, Massague J 2003 A self-enabling TGF␤ response coupled 25. Clarkson RW, Wayland MT, Lee J, Freeman T, Watson CJ 2004 Gene ex- to stress signaling: Smad engages stress response factor ATF3 for Id1 repres- pression profiling of mammary gland development reveals putative roles for sion in epithelial cells. Mol Cell 11:915–926 death receptors and immune mediators in postlactational regression. Breast 22. Tjin Tham Sjin RM, Naspinski J, Birsner AE, Li C, Chan R, Lo KM, Gillies Cancer Res 6:R92–R109 S, Zurakowski D, Folkman J, Samulski J, Javaherian K 2006 Endostatin 26. Brennan KR, Brown AM 2004 Wnt proteins in mammary development and therapy reveals a U-shaped curve for antitumor activity. Cancer Gene Ther cancer. J Mammary Gland Biol Neoplasia 9:119–131 13:619–627 27. Htun H, Holth LT, Walker D, Davie JR, Hager GL 1999 Direct visualization 23. Kadar A, Tokes AM, Kulka J, Robert L 2002 Extracellular matrix components of the human estrogen receptor ␣ reveals a role for ligand in the nuclear in breast carcinomas. Semin Cancer Biol 12:243–257 distribution of the receptor. Mol Biol Cell 10:471–486

Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the Downloaded from https://academic.oup.com/endo/article/148/3/1266/2502028 by guest on 23 September 2021 endocrine community.