1 O-Glcnac Transferase Regulates Glioblastoma Acetate Metabolism

bioRxiv preprint doi: https://doi.org/10.1101/2021.05.10.443157; this version posted May 11, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 O-GlcNAc transferase regulates glioblastoma acetate metabolism via regulation of 2 CDK5-dependent ACSS2 phosphorylation 3 4 Running Title: OGT regulates acetate metabolism via CDK5/ACSS2 5 6 7 Lorela Ciraku1,7, Zachary A. Bacigalupa1,7, Jing Ju1, Rebecca A. Moeller1, Rusia H. Lee1, Michael 8 D. Smith1, Christina M. Ferrer1, Sophie Trefely4, Mary T. Doan4, Wiktoria A. Gocal1, Luca 9 D’Agostino2, Wenyin Shi5, Joshua G. Jackson3, Christos D. Katsetos2, Nathaniel W. Snyder4, and 10 Mauricio J. Reginato1,6* 11 12 1Department of Biochemistry and Molecular Biology, 2Department of Pathology and Laboratory 13 Medicine, 3Department of Pharmacology and Physiology, Drexel University College of Medicine, 14 Philadelphia, PA 19102, USA 15 4Center for Metabolic Disease Research, Department of Microbiology and Immunology, 16 Temple University Lewis Katz School of Medicine, Philadelphia, PA 19140, USA 17 5Department of Radiation Oncology, 6Translational Cellular Oncology Program, Sidney 18 Kimmel Cancer Center, Thomas Jefferson University, Philadelphia, PA 19107, USA 19 7These authors contributed equally 20 21 22 23 24 25 26 27 28 Key words: O-GlcNAc, OGT, hexosamine, cancer, metabolism, glioblastoma, acetate, acetyl-CoA, 29 ACSS2, CDK5 30 31 32 33 34 *Corresponding author: 35 Mauricio J. Reginato, Ph.D. 36 Drexel University College of Medicine 37 Department of Biochemistry and Molecular Biology 38 245 N. 15th Street. 39 Philadelphia, Pennsylvania 40 Phone: (215) 762-3554 41 FAX: (215) 762-4452 42 e-mail: [email protected] 43

45 1

1 Abstract

2 Glioblastomas (GBMs) preferentially generate acetyl-CoA from acetate as a fuel source to promote

3 tumor growth. O-GlcNAcylation has been shown to be elevated by increasing O-GlcNAc transferase

4 (OGT) in many cancers and reduced O-GlcNAcylation can block cancer growth. Here, we identify a

5 novel mechanism whereby OGT regulates acetate-dependent acetyl-CoA production by regulating

6 phosphorylation of acetyl-CoA synthetase 2 (ACSS2) by cyclin-dependent kinase 5 (CDK5). OGT is

7 required and sufficient for GBM cell growth and regulates acetate conversion to acetyl-CoA. Elevating

8 O-GlcNAcylation in GBM cells increases phosphorylation of ACSS2 on Ser-267 in a CDK5-dependent

9 manner. Importantly, we show that ACSS2 Ser-267 phosphorylation regulates its stability by reducing

10 polyubiquitination and degradation. ACSS2 Ser-267 is critical for OGT-mediated GBM growth as

11 overexpression of ACSS2 Ser-267 phospho-mimetic rescues growth in vitro and in vivo. Importantly, we

12 show that pharmacologically targeting OGT and CDK5 reduces GBM growth ex vivo. Thus, the

13 OGT/CDK5/ACSS2 pathway may be a way to target altered metabolic dependencies in brain tumors.

1 Introduction

2 Glioblastoma (GBM) is the most common type of primary malignant brain tumor (Dunn et al.,

3 2012). Glioblastomas, along with brain metastasis, oxidize acetate via the metabolic enzyme acetyl-CoA

4 synthetase short chain family member 2 (ACSS2), which catalyzes the ATP-dependent conversion of

5 acetate and coenzyme A (CoA) into acetyl-CoA (Schug et al., 2016). ACSS2 is required for the majority

6 of acetate conversion to acetyl-CoA (Comerford et al., 2014) which can be utilized for de novo

7 biosynthesis of fatty acids and to provide carbon for the TCA cycle which is essential for tumor growth

8 and survival (Lewis et al., 2015; Mashimo et al., 2014) (Comerford et al., 2014). Reducing ACSS2 levels

9 can block cancer cell growth both in vitro and in vivo (Comerford et al., 2014; Mashimo et al., 2014;

10 Yoshii et al., 2009). While ACSS2 is emerging as a novel therapeutic target for brain cancer, little is

11 known regarding its regulation.

12 The hexosamine biosynthetic pathway utilizes major metabolites to generate (Marshall et al.,

13 1991) UDP-N-acetylglucosamine (UDP-GlcNAc) which serves as a substrate for both N- and O-

14 Glycosylation that regulate cellular behaviors in response to nutrient availability (Zachara and Hart,

15 2004). UDP-GlcNAc is also a substrate for O-linked b-N-acetylglucosamine (O-GlcNAc) transferase

16 (OGT) which catalyzes the addition of O-GlcNAc moieties onto serine and threonine residues of nuclear

17 and cytoplasmic proteins. Removal of O-GlcNAcylation is catalyzed by the glycoside hydrolase O-

18 GlcNAcase (OGA) (Gao et al., 2001). This modification alters protein functions, can regulate protein-

19 protein interactions and phosphorylation states (Zachara and Hart, 2006) (Bond and Hanover, 2015).

20 OGT and O-GlcNAcylation are elevated in most cancers (Ferrer et al., 2016), and targeting this

21 modification inhibits tumor cell growth in vitro and in vivo (Caldwell et al., 2010) (Lynch et al., 2012).

22 Recently, metabolomic profiling of breast cancer cells depleted of OGT revealed significant changes in

23 lipid metabolites (Sodi et al., 2018). Thus, we hypothesized that OGT may regulate lipid-dependent

24 cancers including glioblastomas.

1 Cyclin-dependent kinase 5 (CDK5) is an atypical member of the cyclin-dependent kinase family

2 predominantly expressed in the brain and activated by non-cyclin activators such as p35, or its truncated

3 product p25 (Pozo and Bibb, 2016). While CDK5 is not known to be mutated in cancers (Pozo and Bibb,

4 2016), deregulation of CDK5 stimulates hyperactivation of downstream proteins such as RB, STAT3,

5 FAK, vimentin (Antoniou et al., 2011; Fu et al., 2004; Futatsugi et al., 2012; Lindqvist et al., 2015; Pozo

6 and Bibb, 2016; Sharma et al., 2020) and regulates tumorigenesis through cell proliferation and

7 metastatic invasion (Lenjisa et al., 2017; Pozo and Bibb, 2016). While CDK5 levels have been found to

8 be elevated in glioblastoma tissue (Catania et al., 2001; Liu et al., 2008; Yushan et al., 2015), its

9 functional roles in this cancer are not known.

10 Here, we present evidence that OGT and O-GlcNAcylation levels are elevated in glioblastoma

11 tissues and cells and that OGT is required for GBM cell growth in vitro and in vivo. OGT regulates

12 acetate metabolism via regulation of ACSS2 protein levels. Mechanistically, we show that increased

13 OGT activity results in CDK5-mediated ACSS2 phosphorylation on Ser-267, stabilizing ACSS2 protein

14 levels, and reducing polyubiquitination and degradation. OGT regulation of ACSS2 requires CDK5 and

15 its effect on GBM growth requires Ser-267 phosphorylation of ACSS2. Importantly, ACSS2 Ser-267

16 phosphorylation is elevated in human glioblastoma and pharmacologically targeting OGT or CDK5

17 reduces GBM tumors ex vivo suggesting that this pathway is required for GBM growth and may serve as

18 potential therapeutic targets for treating brain cancer.

20 Results

21 OGT and O-GlcNAc levels are elevated in glioblastoma and are required for tumor

22 growth in vitro and in vivo.

23 OGT and O-GlcNAcylation have been shown to be elevated in multiple cancers (Ferrer et al., 2016).

24 However, the expression and possible role of OGT in glioblastomas has not been investigated. We first

25 examined levels of OGT from normal glial tissue through progressing stages of glioma including

1 glioblastoma (Grade IV). Using immunohistochemistry (IHC) analysis, we observed an increase in

2 OGT-positive staining that correlates with disease progression (Fig. 1a). Notably, normal glial tissue

3 exhibits minimal OGT-positive staining compared to Grade IV glioma (Fig. 1a). Moreover, analysis of

4 69 Grade IV glioblastoma patient tissue samples for global O-GlcNAcylation via IHC showed 82% of

5 these samples expressed medium to high O-GlcNAc (Fig. 1b). We also found that primary GBM cells

6 contain elevated OGT and O-GlcNAcylation compared to normal human astrocytes (Fig. 1c). Similar

7 elevation of OGT and O-GlcNAcylation was detected in established GBM U87-MG and T98G cell lines

8 (Fig. 1d). Together, these results show that human glioblastomas contain elevated levels of OGT and O-

9 GlcNAcylation.

10 To examine whether OGT is required for glioblastoma growth, we targeted OGT with shRNA in

11 glioblastoma cell lines. We observed that suppression of OGT was sufficient to impede cell growth in

12 both U87-MG (Fig. 2a, 2b) and T98G (Fig. 2c, 2d) cells, as indicated by crystal violet staining. We also

13 tested whether altering OGT expression could impact anchorage-independent growth. Reducing OGT

14 expression with stable expression of RNAi (Fig. 2a, 2c), we observed a significant reduction in the

15 anchorage-independent growth in both U87-MG and T98G (Fig. 2e, Extended Data Fig. 1a) compared to

16 controls. Additionally, we found that reducing OGT levels in two different primary GBM cell lines

17 SN310 and SN186 (Fig. 2f) significantly blocked neurosphere formation (Fig. 2g, 2h). To ensure OGT

18 contribution to GBM growth required its catalytic function, we also examined effects of treating GBM

19 cells with a pharmacological inhibitor of O-GlcNAcylation Ac-5S-GlcNAc (Ferrer et al., 2014; Gloster

20 et al., 2011; Sodi et al., 2015). Treating U87-MG cells with Ac-5S-GlcNAc reduced total O-

21 GlcNAcylation and also reduced cell growth (Extended Data Fig. 1b). To test whether reducing OGT

22 expression could block GBM cell growth in vivo, we utilized an intracranial orthotopic xenograft model.

23 Reduction of OGT expression in U87-MG cells expressing luciferase (Extended Data Fig. 1c) resulted in

24 a significant decrease in tumor growth in vivo as measured by bioluminescence (Fig. 2i). Representative

25 images of H&E sections show a striking reduction in tumor growth at Day 21 in mice injected with OGT

26 depleted cells (Fig. 2i). Importantly, mice that were grafted with glioblastoma cells where OGT

1 expression was reduced also had significantly extended survival (Fig. 2j), displaying a median survival

2 of 42 days, compared to 20 days for the control group. Altogether, these data indicate that OGT and O-

3 GlcNAc levels are elevated in human glioblastoma and OGT is required for glioblastoma cell growth in

4 vitro and in vivo.

6 OGT regulates lipid accumulation, acetyl-CoA, and acetate metabolism.

7 Several groups have characterized the importance of lipid metabolism (Lewis et al., 2015), and

8 more specifically, acetate metabolism for supporting glioblastoma growth (Comerford et al., 2014;

9 Mashimo et al., 2014). Thus, we investigated the effect of altering OGT on lipid accumulation, and

10 acetate dependent acetyl-CoA metabolism in glioblastoma cells. Consistent with OGT being critical for

11 GBM cell growth, overexpression of OGT in U87-MG cells increased total O-GlcNAcylation (Fig. 3a)

12 and anchorage-independent growth (Fig. 3b and Extended Data Fig. 1d). OGT overexpressing GBM

13 cells also contained increased intracellular lipid droplet accumulation as measured by nile red staining

14 (Fig. 3c), increased free fatty acids (Fig. 3d) and cellular acetyl-CoA levels (Fig. 3e). Conversely, stable

15 knockdown of OGT in U87-MG (Extended Data Fig. 2a) cells contained reduced nile red staining

16 (Extended Data Fig. 2b), free fatty acids (Extended Data Fig. 2c) and acetyl-CoA (Extended Data Fig.

17 2d) levels compared to control cells. Similar results were seen in T98G cells containing stable

18 knockdown of OGT (Extended Data Fig. 2e-h) while treating T98G cells with OGA inhibitor increased

19 acetyl-CoA levels (Extended Data Fig. 2i).

20 Since glioblastoma cells are highly dependent on acetate metabolism to generate acetyl-CoA and

21 regulate growth (Mashimo et al., 2014), we hypothesized that OGT may regulate acetate utilization. To

22 test this, we exposed U87-MG control cells and cells overexpressing OGT with stable isotope labeled

13 23 sodium acetate (1,2- C2-acetate) to track the incorporation of acetate into acetyl-CoA. Cells

24 overexpressing OGT displayed significantly increased acetate uptake as labeled acetate was depleted

25 from the media (Fig. 3f). Moreover, within the context of the increased pool of acetyl-CoA, we detect a

1 2% reduction in molar enrichment of unlabeled acetyl-CoA M+0 (Fig. 3g) and a corresponding increase

2 in molar enrichment of acetyl-CoA M2 (Fig. 3h) in OGT overexpressing cells compared to control cells

3 indicating an increased utilization of acetate in generating acetyl-CoA. These data implicate a role for

4 OGT in regulating the metabolism of acetate into acetyl-CoA and contributing to GBM lipid

5 accumulation and growth.

7 O-GlcNAcylation regulates ACSS2 S267 phosphorylation in a CDK5-dependent manner.

8 ACSS2 is a critical regulator of acetate conversion to acetyl-CoA and for growth of glioblastoma cells

9 (Comerford et al., 2014; Schug et al., 2015). Therefore, we examined ACSS2 expression in the context

10 of altered O-GlcNAcylation. Consistent with previous findings, we found ACSS2 levels to be elevated in

11 both primary GBM (Fig. 1c) and established GBM cell lines (Fig. 1d) compared to normal astrocytes.

12 U87-MG cells stably expressing OGT shRNA contained lower levels of ACSS2 protein (Extended Data

13 Fig. 2a). RNA levels of ACSS2 were not reduced in OGT depleted U87-MG cells as measured by

14 quantitative RT-PCR (qRT-PCR) (Extended Data Fig. 3a). Similar decreases in ACSS2 protein levels

15 were seen in OGT depleted primary GBM cells SN310 and SN186 (Fig. 4a) and T98G (Extended Data

16 Fig. 2e) cells. Conversely, we observe stabilization of ACSS2 protein when U87-MG cells (Fig. 3a and

17 Extended Data Fig. 3b) or primary GBM SN310 cells (Extended Data Fig. 3c) were stably

18 overexpressing OGT or U87-MG cells were treated with an OGA inhibitor NButGT (Extended Data Fig.

19 3d). ACSS2 protein does not appear to be directly modified by O-GlcNAc, as immunoprecipitated

20 ACSS2 from normal human astrocytes and GBM cells U87-MG, T98G and SN310 contained no

21 detectable O-GlcNAcylation by western blot analysis (data not shown). Thus, O-GlcNAcylation likely

22 regulates ACSS2 protein stability via an indirect mechanism.

23 O-GlcNAcylation can alter the phosphorylation state of proteins (Bond and Hanover, 2015). To

24 analyze potential changes in ACSS2 phosphorylation regulated by O-GlcNAcylation, we analyzed

25 changes in exogenous immunoprecipitated ACSS2 phosphorylation via mass-spectrometry in GBM cells

26 treated with control or OGA inhibitor (Extended Data Fig. 3e). Proteomic analysis identified only Ser- 7

1 267 of ACSS2 as being phosphorylated in NButGT-treated conditions (data not shown). Predictive

2 analyses for phosphorylation sites (ScanSite; (Obenauer et al., 2003)) for ACSS2 revealed Ser-267 as a

3 putative CDK5 phosphorylation site (Extended Data Fig. 3f). Alignment analysis revealed the consensus

4 CDK5 motif containing Ser-267 (SQSPPIKR) as being evolutionarily conserved in mammals (Extended

5 Data Fig. 3g). Consistent with our data, PhosphoSitePlus (Hornbeck et al., 2015) lists 13 studies that

6 have identified human ACSS2 Ser-267 as being phosphorylated in different cancers including breast,

7 lung, cervical, ovarian, and skin cancers. However, the functional role of this phosphorylation is not

8 known. Therefore, these data suggest that elevated O-GlcNAcylation increases ACSS2 phosphorylation

9 on Ser-267, a putative CDK5 site.

10 To establish ACSS2 as a putative substrate for CDK5 phosphorylation, we performed an in vitro

11 kinase assay. We observed a protein concentration-dependent increase in ACSS2 phosphorylation by

12 CDK5 (Extended Data Fig. 3h), confirming ACSS2 as a bona-fide substrate of CDK5. Importantly,

13 ACSS2 Ser-267 to alanine (S267A) mutant contained reduced phosphorylation by CDK5 in vitro

14 (Extended Data Fig. 3i). To test whether Ser-267 was also phosphorylated in GBM cells, we knocked

15 down endogenous ACSS2 with stable expression of shRNA against ACSS2 targeting the 3’ UTR and

16 overexpressed wildtype ACSS2 or ACSS2 S267A mutant. Mutation of ACSS2 S267 into alanine

17 abrogated ACSS2 phosphorylation, which was detected using an antibody specifically recognizing

18 ACSS2 pS267 (Fig. 4b). To further confirm the specificity of the phospho-ACSS2-S267 antibody, we

19 immunoprecipitated wild-type ACSS2 and ACSS2-S267A mutant from U87-MG cells and found that

20 the ACSS2 p267 antibody only detected wild-type ACSS2 protein (Extended Data Fig. 3j).

21 Phosphorylation of ACSS2 on Ser-267 in glioblastoma cells is dependent on CDK5 activity as stable

22 expression of CDK5 shRNA reduces phosphorylation of ACSS2 on Ser-267 (Fig. 4c) as well as

23 phosphorylation of RB on Ser-780 (Fig. 4c), a CDK5 specific phosphorylation site (Lin et al., 2007;

24 Piedrahita et al., 2010). Similar results were seen in cells treated with the pan-CDK inhibitor dinaciclib

25 that targets CDK5 (Fig. 4d) (Parry et al., 2010b). Conversely, overexpression of HA-CDK5 in U87-MG

26 cells increased ACSS2 Ser-267 phosphorylation (Fig. 4e). In addition, we found that CDK5 and ACSS2

1 interact in vitro (Extended Data Fig. 3k). However, in GBM cells this interaction was only detected in

2 conditions of elevated O-GlcNAcylation as immunoprecipitation of CDK5 showed an interaction with

3 ACSS2 only in cells treated with OGA inhibitor (Extended Data Fig. 3l). CDK5 was also found to

4 interact with phosphorylated ACSS2-S267, determined by immunoprecipitating with antibody

5 specifically recognizing ACSS2 pS267, and this interaction was increased under conditions of elevated

6 O-GlcNAcylation (Extended Data Fig. 4a). Consistent with the mass spectrometry results, we detected

7 an increase of ACSS2 Ser-267 phosphorylation in cells treated with an OGA inhibitor (Fig. 4e and 4f).

8 Conversely, inhibition of O-GlcNAcylation by treating cells with OGT inhibitor (Ac-5S-GlcNAc)

9 reduced ACSS2 Ser-267 phosphorylation (Extended Data Fig. 4b). We also tested whether OGT-

10 mediated phosphorylation of ACSS2 occurred in normal brain cells or tissue. Increased O-

11 GlcNAcylation in normal human astrocytes treated with an OGA inhibitor did not alter ACSS2 Ser-267

12 phosphorylation compared to GBM cells (Extended Data Fig. 4c). Using an ex vivo brain slice model

13 (Jackson et al., 2014), treating tumor-free brain tissue with an OGA inhibitor elevated O-GlcNAcylation

14 but had no effect on ACSS2 Ser-267 phosphorylation (Extended Data Fig. 4d) suggesting that OGT-

15 dependent regulation of ACSS2 Ser-267 phosphorylation may be cancer cell-specific. Increased O-

16 GlcNAcylation also increased CDK5 activity as measured by phosphorylation of RB on Ser-780 (Fig.

17 4f). Importantly, O-GlcNAc regulation of ACSS2 Ser-267 phosphorylation was reduced in cells stably

18 expressing CDK5 shRNA (Fig. 4f). Consistent with these results, cells overexpressing OGT contain

19 increased CDK5 levels and activity (Fig. 3a) and GBM cells stably expressing OGT RNAi contain

20 reduced levels of CDK5 and activity and ACSS2 ser-267 phosphorylation (Fig. 4a, Extended Data Fig.

21 2a, 2e). These results indicate that O-GlcNAc regulates ACSS2 phosphorylation on Ser-267 in a CDK5-

22 dependent manner.

24 ACSS2 S267 phosphorylation blocks degradation of ACSS2 and is required for GBM

25 growth.

1 Since we observed stabilization of ACSS2 protein when GBM cells were overexpressing OGT (Fig. 3a,

2 Extended Data Fig. 3b, 3c) or following OGA inhibition (Extended Data Fig. 3d), we hypothesized that

3 OGT and CDK5 regulate ACSS2 stability via phosphorylation of Ser-267. To test whether OGT

4 regulates ACSS2 degradation, U87-MG cells stably expressing control shRNA or OGT shRNA were

5 treated with the proteasome inhibitor lactacystin. OGT shRNA-mediated inhibition of ACSS2 protein

6 levels could be reversed by treatment with lactacystin (Fig. 5a) suggesting ACSS2 is being regulated at

7 the proteasomal level. To test whether ACSS2 Ser-267 phosphorylation alters polyubiquitination of

8 ACSS2, U87-MG cells stably expressing wild-type ACSS2 and S267 phosphosite mutants were

9 transfected with ubiquitin (WT-Ub) or ubiquitin-K48R (K48R-Ub) mutant. Following

10 immunoprecipitation ofACSS2, we show that wild-type ACSS2 is polyubiquitinated and that ACSS2-

11 S267A mutant contains significantly increased polyubiquitination compared to wild-type ACSS2 and

12 ACSS2-S267D phospho-mimetic mutant in cells transfected with WT-Ub (Fig. 5b, Extended Data Fig.

13 4e). Since mutation of lysine 48 to arginine renders ubiquitin (Ub) unable to form poly-Ub chains via

14 lysine 48 linkages with other Ub molecules (Chau et al., 1989), we tested effect of K48R-Ub on

15 polyubiquitination of ACSS2-S267A. K48 polyubiquitination of ACSS2-S267A was significantly

16 reduced in cells transfected with ubiquitin K48R mutant (K48R-Ub) compared to WT-Ub (Fig. 5b,

17 Extended Data Fig. 4e). This data suggests that Ser-267 phosphorylation alters polyubiquitination of

18 ACSS2. Consistent with the idea that ACSS2 phosphorylation of Ser-267 stabilizes and blocks

19 degradation of ACSS2, we show that the protein half-life of ACSS2 S267A mutant is significantly

20 reduced compared to wildtype ACSS2 or ACSS2 S267D phospho-mimetic mutant (Fig. 5c) in cells

21 treated with cyclohexamide. To test whether phosphorylation of ACSS2 Ser-267 plays a role in

22 tumorigenesis in GBM cells, we stably reduced endogenous ACSS2 expression utilizing a shRNA

23 targeting the 3’UTR (Fig. 5d) and then stably re-expressed either wildtype ACSS2, ACSS2 S267A or

24 ACSS2 S267D phospho-mimetic mutant (Fig. 5d). U87-MG cells overexpressing wildtype ACSS2 or

25 phosphomimetic S267D mutant, but not ACSS2 S267A mutant, were able to rescue anchorage

26 independent growth (Fig. 5e). Consistent with results seen in vitro, U87-MG cells expressing wild-type

1 ACSS2, but not cells containing ACSS2 S267A mutant, were able to form tumors in vivo (Fig. 5f,

2 Extended Data Fig. 4f). These results indicate that phosphorylation of ACSS2 on S267 is critical for its

3 protein stability, polyubiquitination and for GBM cell growth in vitro and in vivo.

5 CDK5 regulates acetate metabolism and GBM growth via ACSS2-S267 phosphorylation.

6 CDK5 has been implicated in the development and progression of multiple cancers (Pozo and Bibb,

7 2016). However, its role in glioblastoma has not been demonstrated. CDK5 levels have been shown to be

8 elevated in GBM tissue (Liu et al., 2008). A high level of CDK5 expression predicted poor prognosis in

9 GBM patients (Extended Data Fig. 5a). Consistent with this data, we detect an increase in CDK5 levels

10 in primary (Fig. 1c) and established GBM cell lines (Fig. 1d) compared to normal human astrocytes.

11 Since CDK5 phosphorylates ACSS2 S267 in vitro and in cells, we tested the role of CDK5 on acetate

12 metabolism and GBM cell growth. To test whether CDK5 regulates acetate metabolism and GBM cell

13 growth we reduced CDK5 levels via shRNA which blocked CDK5 activity as measured by RB

14 phosphorylation on Ser-780 and reduced ACSS2 phosphorylation on Ser-267 (Fig. 6a). We observed that

15 suppression of CDK5 was sufficient to impede the growth of U87-MG cells as indicated by crystal violet

16 staining (Fig. 6b) and anchorage-independent growth (Extended Data Fig. 5b). Reducing CDK5 levels in

17 T98G cells also blocked growth (Extended Data Fig. 5c) and anchorage-independent growth (Extended

18 Data Fig. 5d) and knockdown in primary GBM cells significantly blocked neurosphere formation (Fig.

19 6c, Extended Data Fig. 5e). Consistent with the idea that CDK5 regulates ACSS2, we also found that

20 depleting CDK5 levels in GBM cells reduced acetyl-CoA levels (Fig. 6d) and nile red staining

21 (Extended Data Fig. 5f). Importantly, we show that reduction in CDK5 expression in U87-MG cells

13 22 resulted in a significant decrease of 1,2- C2-acetate incorporation into acetyl-CoA (Fig. 6e). Moreover,

23 we show that reduction of CDK5 expression in U87-MG cells resulted in a significant decrease in tumor

24 growth in vivo as measured by bioluminescence and histology (Fig. 6f). To test whether OGT and O-

25 GlcNAc-mediated growth in GBM cells was dependent on CDK5 expression we tested the effect of

26 reducing CDK5 in OGT overexpressing cells. The increase in anchorage-independent growth observed 11

1 in U87-MG cells stably overexpressing OGT was reduced as a result of CDK5 knockdown cells

2 (Extended Data Fig. 6a, 6b). Consistent with OGT regulating ACSS2, the observed OGT-mediated

3 increase in ACSS2-S267 phosphorylation (Extended Data Fig. 6c) and acetyl-CoA (Extended Data Fig.

4 6d) was reduced in CDK5 knockdown cells. We detected similar decrease of ACSS2-S267

5 phosphorylation (Extended Data Fig. 6e) and acetyl-CoA (Extended Data Fig. 6f) in U87-MG cells

6 treated with OGA inhibitor containing CDK5 knockdown. To test whether ACSS2 phosphorylation was

7 required for CDK5 depletion-mediated effects, we overexpressed wildtype HA-ACSS2, HA-ACSS2

8 S267A and HA-ACSS2 S267D mutant in the context of CDK5 knockdown (Fig. 6g). Cells stably

9 overexpressing exogenous wildtype ACSS2 and ACSS2 S267D mutant, but not ACSS2 S267A mutant,

10 partly restored growth (Fig. 6h) and nile red staining (Extended Data Fig. 6g) in CDK5 knockdown cells.

11 Thus, these data suggest that CDK5 can regulate acetate metabolism and GBM growth in vitro and in

12 vivo and that OGT-mediated cell growth and acetyl-CoA regulation is partly dependent on CDK5. In

13 addition, we show that CDK5-mediated growth in glioblastoma cells is partly dependent on

14 phosphorylation of ACSS2 Ser267.

16 OGT regulates acetate metabolism and GBM growth via ACSS2 S267 in vitro and in vivo.

17 We have shown that GBM cell growth in vitro (Fig. 5e) and in vivo (Fig. 5f) requires ACSS2 Ser-267

18 phosphorylation and that CDK5-mediated regulation of cell growth also requires ACSS2 Ser-267

19 phosphorylation (Fig. 6h). To test whether OGT regulation of GBM lipid accumulation and growth also

20 requires ACSS2 Ser-267 phosphorylation, we tested whether overexpression of wildtype ACSS2 or

21 ACSS2 phospho-mimetic mutant would rescue the growth defects observed in OGT knockdown cells.

22 Stable OGT knockdown reduced anchorage-independent growth in vitro could be rescued by

23 overexpressing wildtype ACSS2 and ACSS2 S267D mutant, but not ACSS2 S267A mutant (Fig. 7a-7c).

24 In addition, we found that overexpressing wildtype ACSS2 and ACSS2 S267D mutant, but not ACSS2

25 S267A mutant, could partly rescue nile red staining (Extended Data Fig. 7a). Consistent with the idea

1 that OGT regulates acetyl-CoA via ACSS2, the OGT RNAi-mediated decrease in acetyl-CoA was

2 reversed by overexpressing the ACSS2-267D mutant (Extended Data Fig. 7b, 7c). Similar to results in

3 vitro, U87-MG cells expressing the phospho-mimetic mutant ACSS2 S267D, but not cells containing an

4 ASCC2 S267A mutant, were able to partly rescue the growth effects of OGT depletion in vivo (Fig. 7d,

5 7e and Extended Data Fig. 7d). Thus, OGT regulation of GBM cell growth in vivo is partly dependent

6 on ACSS2 Ser-267 phosphorylation.

8 Pharmacologically targeting OGT and CDKs in GBM ex vivo.

9 To test whether targeting OGT or CDK5 in a preformed GBM tumor can block cancer growth, we

10 treated ex vivo brain slices containing GBM tumors with an OGT inhibitor or pan-CDK inhibitor.

11 Twelve days following intracranial injections of U87-MG-luc cells, intact brains were excised and

12 sectioned, then slices containing tumors were cultured and treated with vehicle or Ac-5S-GlcNAc.

13 Tumors in brain slices treated with control continued growing ex vivo, while tumors exposed to OGT

14 inhibitor treatment significantly decreased in size (Fig. 8a, 8b) and exhibited reduced detection of the

15 proliferation marker Ki-67, ACSS2 Ser-267 staining, and increased caspase-3 staining (Fig. 8a).

16 Importantly, treating control brain slices with the OGT inhibitor reduced total O-GlcNAc levels

17 (Extended Data Fig. 7e) but did not alter brain tissue viability compared to control (Extended Data Fig.

18 7d). Treatment of GBM primary cells SN310 with pan-CDK inhibitor dinaciclib, which targets CDK1,

19 CDK2, CDK5 and CDK9 (Parry et al., 2010a), blocked ACSS2 S267 phosphorylation (Extended Data

20 Fig. 8a) and reduced neurosphere formation (Extended Data Fig. 8b). Treatment of U87-MG with

21 dinaciclib also reduced ACSS2 S267 phosphorylation (Extended Data Fig. 8c) and also significantly

22 decreased size of preformed tumors ex vivo (Fig. 8c, 8d) without causing loss of viability in brain slices

23 (Extended Data Fig. 8d). These results demonstrate that targeting OGT and CDKs is efficacious in

24 reducing preformed GBM tumor growth ex vivo and that this reduction is associated with reduced

25 ACSS2 Ser-267 phosphorylation.

1 Lastly, we performed IHC analysis on glioblastoma (Grade IV) patient samples and found that

2 phosphorylation levels of ACSS2 S267 was highly elevated in 24% percent of glioblastoma samples

3 (Fig. 8e). These results support the idea that ACSS2 S267 phosphorylation is highly elevated in

4 glioblastoma patients.

6 Discussion

7 Our studies reveal a novel role of O-GlcNAc in regulation of acetate conversion to acetyl-CoA

8 in glioblastoma cells via regulation of ACSS2. The brain has a unique ability to rewire its metabolism in

9 response to changing metabolite availability (Magistretti and Allaman, 2015). Similarly, brain tumors

10 must also be able to adapt in their ability to generate energy from non-glucose sources including acetate

11 (Schild et al., 2018). In the present study, we demonstrated that elevated OGT and O-GlcNAcylation

12 helps glioblastomas rewire metabolism to utilize acetate that provides a survival and growth advantage

13 in this unique environment. Specifically, we propose a previously unknown pathway by which OGT

14 regulates phosphorylation of ACSS2 on serine 267 in a CDK5-dependent manner and that this

15 phosphorylation stabilizes ACSS2 protein levels, reduces its polyubiquitination, and regulates acetate

16 conversion into acetyl-CoA and contributes to GBM lipid storage and growth (Fig. 8f). To our

17 knowledge, this is the first report to link CDK5 directly to regulation of cancer cell metabolism.

18 Interestingly, CDK5 has previously been shown to be regulated by glucose (Lowman et al., 2010; Ubeda

19 et al., 2004). In pancreatic beta-cells, increased concentrations of glucose result in increased CDK5

20 activity that regulates insulin gene expression (Ubeda et al., 2004). However, the mechanism by which

21 glucose regulates activation of CDK5 is not known. We speculate that increased glucose may lead to

22 elevated O-GlcNAcylation and activation of CDK5 activity. Intriguingly, three residues on CDK5 have

23 been shown to be dynamically O-GlcNAc modified, directly regulating its ability to activate p53-

24 mediated apoptosis in neurons during intracerebral hemorrhage (Ning et al., 2017). It will be of interest

25 to determine whether CDK5 is directly O-GlcNAcylated in glioblastomas or whether O-GlcNAc

1 regulates CDK5 via an indirect mechanism. Despite OGT inhibitors not being well developed to

2 determine tumor efficacy or possible toxicities, pan-CDK inhibitors such as dinaciclib have shown

3 promise as a primary therapy for multiple myeloma (Kumar et al., 2015) and in preclinical models of

4 pancreatic (Feldmann et al., 2011) and ovarian cancers (Chen et al., 2015). Therefore, in light of our ex

5 vivo results which suggest inhibition of glioblastoma growth by dinaciclib, it would be of clinical interest

6 to analyze the efficacy of these compounds, as well as more CDK5-specific inhibitors, for targeting

7 glioblastoma metabolism and growth.

8 Acetate conversion to acetyl-CoA in cancer can contribute to three major metabolic pathways:

9 de novo fatty acid and isoprenoid synthesis, the TCA cycle and histone acetylation (Schug et al., 2016).

10 For example, nuclear ACSS2 has been described as having the ability to recapture acetate produced as

11 the result of histone deacetylation and can utilize this acetate to maintain histone acetylation (Bulusu et

12 al., 2017). In addition, acetyl-CoA locally produced by ACSS2 using acetate generated from nuclear

13 protein deacetylation can be used for acetylation of promoters critical for regulating gene expression of

14 genes involved in cancer cell survival (Li et al., 2017). It would be intriguing to explore the possibility

15 that OGT-CDK5-mediated Ser267 phosphorylation may also regulate the localization of ACSS2,

16 influencing gene expression processes through ACSS2-dependent histone acetylation (Bulusu et al.,

17 2017; Li et al., 2017). Our data does suggest that the OGT-CDK5-ACSS2 pathway may contribute to

18 lipid biosynthesis as OGT and CDK5 knockdown inhibition of intracellular lipid storage can be reversed

19 by overexpressing ACSS2 phospho-mimetic mutant. Recent studies have shown that cancers in the brain

20 must adapt to lack of lipid availability in the brain environment (Jin et al., 2020) and thus are highly

21 dependent on fatty acid synthesis for growth and survival (Ferraro et al., 2021). Our study provides one

22 potential pathway for a mechanism by which GBM cells can generate acetyl-CoA, a major metabolite

23 feeding lipid synthesis, via phosphorylation of ACSS2 by CDK5 and activation of nutrient sensor OGT.

24 Future experiments investigating how OGT-CDK5-ACSS2 contributes to acetate metabolism-dependent

25 regulation of fatty acid biosynthesis, the TCA cycle and histone acetylation will be further explored.

26 15

1 Methods 2 Cell Culture. U87-MG and T98G cell lines were obtained from ATCC (Manassas, VA, USA) and 3 cultured according to ATCC protocol supplemented with 10% fetal bovine serum (FBS), 5% 10,000 4 Units/mL Penicillin-10,000 μg/mL Streptomycin, and 5% 200 mM L-Glutamine. Primary GBM WHO 5 grade IV cell lines SN186 (76 yr old male), SN275 (58 yr old male) and SN310 (78 yr old female) were 6 provided as a kind gift by P. Hothi (Swedish Neuroscience Institute, Seattle, WA) and have been 7 previously described (Hothi et al., 2012). Primary GBM cell lines were cultured in Neurobasal-A 8 Medium (Gibco; Gaithersburg, MD) supplemented with 1x B27 Supplement (Gibco), 1 mM sodium 9 pyruvate, 0.5 mM L-glutamine, 1x Antibiotic-Antimycotic (Gibco), 0.02 mg/mL insulin solution, 20 10 ng/mL EGF, and 20 ng/mL FGF-2. For crystal violet staining, 5 x 104 cells were plated and subjected to 11 the treatments as described in the individual figures and then stained with 0.5% crystal violet prepared in 12 a 1:1 methanol-water solution followed by PBS washes. 13 14 Animal models of cancer. Nu/Nu athymic 6-8 week old mice from Charles River Laboratories 15 (Wilmington, MA, USA) were immobilized using the Just for Mice TM Stereotaxic Frame (Harvard 16 Apparatus, Holliston, MA, USA) and injected intracranially with 5 μl of a 20,000 U87-MG-Luciferase 17 cells/μl solution. Tumor growth was monitored via bioluminescence imaging on the IVIS 200 system 18 (Perkin Elmer) and results analyzed using Living Image software (Caliper Life Sciences, Waltham, MA, 19 USA). For survival studies, mice were injected and health monitored until in moribund state. All animal 20 protocols were approved by the Institutional Animal Care and Use Committee. 21 22 Human samples. GBM tumor tissue samples were obtained from 36 patients diagnosed with craniotomy 23 resection of the tumor. All patients received standard 6-week radiation treatment with concurrent 24 temozolomide. Specimens from multiple resections were included in TMA including 26 samples from 25 36 patients that were isolated in the first resection, 30 samples from same 36 patients from second 26 resections, and 13 samples from the 36 patients were isolated from third resections thus total of 69 27 samples were analyzed. Histology was evaluated according to the World Health Organization (WHO) 28 classification for CNS tumors. For survival analysis Kaplan–Meier curves were generated using the 29 online database UALCAN (http://ualcan.path.uab.edu/analysis.html) (Chandrashekar et al., 2017)to 30 determine the relevance of CDK5 mRNA expression in patients with GBM. 31 32 Reagents. Anti-actin (Santa Cruz Biotechnology; Dallas, TX, USA), anti-OGT, anti-ACSS2, anti-Cdk5, 33 anti-K48 polyubiquitin, anti-HA-tag, anti-p35/p25, anti-Rb, anti-phospho Rb-S780, anti-cleaved- 34 caspase-3, IgG-conjugated sepharose beads (Cell Signaling Technology; Danvers, MA, USA), anti-O- 35 GlcNAc (Sigma Aldrich; St. Louis, MO, USA) and anti-thiophosphate ester (Abcam; Cambridge, U.K.). 36 Protein G sepharose 4B beads (Invitrogen; Carlsbad, CA, USA). Plasmids used were pReceiver N-Flag 37 OGT, pReceiver HA-ACSS2, HA-ACSS2-S267A, HA-ACSS2-S267D (Genecopoeia; Rockville, MD, 38 USA). Cdk5-HA was a gift from Sander van den Heuvel (Addgene plasmid # 1872). HA-Ub and HA- 39 Ub-K48R was a gift from Edward Hartsough (Drexel University). Ac-5S-GlcNAc and NButGT were a 40 kind gift from David J. Vocadlo and previously described (Gloster et al., 2011). Cycloheximide (Sigma 41 Aldrich, St. Louis, MO, USA), Dinaciclib (Selleckchem, Houston, TX, USA), lactacystin (Calbiochem, 42 San Diego, CA, USA), D-luciferin potassium salt (Perkin Elmer, Waltham, MA, USA), and crystal 43 violet (Sigma Aldrich, St. Louis, MO, USA). pReceiver.HA-ACSS2-WT, S267A, and S267D plasmid 44 were provided by Genewiz (South Plainfield, NJ, USA) and confirmed via Sanger sequencing. 45 Rabbit polyclonal antibody recognizing phosphorylated ACSS2 S267 was created by YenZym 46 Antibodies (South San Francisco, CA, USA). A peptide containing ACSS2 pS267 was injected into 47 rabbits and serum was collected and purified using affinity column conjugated with nonphosphorylated 48 ACSS2 S267 peptide to exclude antibodies recognizing ACSS2 nonphosphorylated form, followed by an 49 affinity column conjugated with phosphorylated ACSS2 S267 peptide to purify the ACSS2 S267 50 phospho-specific antibody. This antibody was the eluted and used at concentration of 0.22 µg/ml.

1 2 RNA interference. Stable cell lines for shRNA knockdowns were generated as previously described 3 (Caldwell et al., 2010). Briefly, HEK-293T cells were grown to ~75% confluency and transfected. Prior 4 to transfection, 20 μg of shRNA or overexpression plasmid DNA, 10 μg VSVG, 5 μg RSV, and 5 μg 5 RRE were gently mixed and incubated in 1.5 mL of Optimem for 5 minutes. Concurrently, 105 μl of PEI 6 was added dropwise to 1.5 mL of Optimem and incubated for 5 minutes. Following the 5 minute 7 incubation, the PEI solution was added dropwise to the DNA solution and incubated for at least 30 8 minutes. The PEI-DNA solution was then added dropwise to the HEK-293T cells already plated with 5 9 mL of Optimem and the cells were incubated overnight in the transfection media. Approximately 16-18 10 hours later, the transfection media was replaced with normal growth media. Viral supernatants were 11 collected at 24 and 48 hours following the media change. These supernatants were passed through a 0.45 12 μm filter and portioned into 1 mL aliquots to be stored at -80°C if not for immediate us. 13 Control shRNA was acquired from Addgene (plasmid 1864), from D. Sabatini (Massachusetts Institute 14 of Technology). Control-scrambled shRNA sequence used was: 15 CCTAAGGTTAAGTCGCCCTCGCTCTAGCGAGGGCGACTTAACCTT. All other shRNA 16 constructs were acquired from Sigma and shRNA sequence used: for OGT-1, 17 GCCCTAAGTTTGAGTCCAAATCTCGAGATTTGGACTCAAACTTAGGGC, and for OGT-2, 18 GCTGAGCAGTATTCCGAGAAACTCGAGTTTCTCGGAATACTGCTCAGC. Cdk5 shRNA 19 sequence used: for Cdk5-1, 20 CCGGGTGAACGTCGTGCCCAAACTCCTCGAGGAGTTTGGGCACGACGTTCACTTTTTTG, and 21 for Cdk5-2, 22 CCGGCAGAACCTTCTGAAGTGTAACCTCGAGGTTACACTTCAGAAGGTTCTGTTTTTTG. 23 ACSS2 shRNA sequence used: 24 CCGGGCTTCTGTTCTGGGTCTGAATCTCGAGATTCAGACCCAGAACAGAAGCTTTTTG. 25 26 mRNA expression. RNA was isolated from cells using RNEasy products and protocols (Qiagen, 27 Valencia, CA, USA). Taqman gene expression assay primer probes for OGT (Hs00269228_m1), ACSS2 28 (Hs00218766_m1), and GAPDH (Hs02758991_g1) were purchased from Applied Biosystems (Foster 29 City, CA, USA). qRT-PCR was performed as previously described (Sodi et al., 2015) using Brilliant II 30 qRT-PCR Master Mix 2 Kit (Stratagene, San Diego, CA, USA) using Applied Biosystems 7500 31 machine.. Briefly, isolated RNA concentrations were determined by measuring on a NanoDrop and all 32 samples were diluted to match the sample with the lowest concentration. A mastermix was then 33 generated for the individual primers using 8.8 μl dH₂O, 12.5 μl Brilliant PCR master mix, 0.4 μl diluted 34 dye (0.5 μl dye into 250 μl dH₂O), 0.1 μl reverse transcriptase, and 1.25 μl primer per sample. A total 35 reaction volume of 25 μl was used by gently mixing 2 μl of sample RNA and 23 μl of the mastermix into 36 the reaction tubes, being careful to avoid bubbles. The samples were then loaded into the Applied 37 Biosystems 7500 machine and the experimental setup was as follows: acquire experiment as 38 “Quantitation ΔΔCT”, targets and samples were assigned, the initial holding stage adjusted to 50°C for 39 30 minutes, followed by a secondary holding stage at 95°C for 10 minutes, then 40 cycles consisting of 40 95°C for 15 seconds and cooling to 60°C for 1 minute were completed. Data were exported from the 41 Applied Biosystems software and expression levels were analyzed using Data Assist v2.0 (Life 42 Technologies, Grand Island, NY, USA). 43 44 Immunoblotting. Immunoblotting protocols have been previously described (Lynch et al., 2012). 45 Briefly, cell lysates from 1-5 x 106 cells were prepared in radioimmune precipitation assay buffer (150 46 mM NaCl, 1% NP40, 0.5% DOC, 50 mM Tris HCL at pH 8, 0.1% SDS, 10% glycerol, 5 mM EDTA, 20 47 mM NaF, and 1 mM Na3VO4) supplemented with 1 μg/ml each of pepstatin, leupeptin, aprotinin, and 48 200 μg/ml PMSF. Lysates were cleared by centrifugation at 16,000 x g for 15 minutes at 4 °C and 49 analyzed by SDS-PAGE and autoradiography with chemiluminescence. Proteins were analyzed by 50 immunoblotting using primary antibodies indicated above. 51 17

1 Immunohistochemical staining. The slides containing glioblastoma tumors were deparaffinized by 2 Xylene and subsequent rehydration was done by decreasing concentrations of ethanol-water mixture. 3 Antigen retrieval was done by citrate buffer immersion and steaming the slides for 45 minutes. Tissue 4 was treated with 200-400 ul 1% BSA+5% serum PBS solution for 1hr. Primary incubation was done at 5 4o C overnight using OGT, O-GlcNAc RL2 (Santa Cruz 1:50), p-S267 ACSS2 (1:100) antibodies. 6 Secondary antibody incubation was done for an hour at RT with respective antibodies at 1: 200 dilution. 7 The stain was developed using the DAB kit by Vectastain (Vector Labs, Burlingame, CA, USA). 8 Finally, slides were mounted and imaged under a light microscope. The staining patterns of tumor tissues 9 of GBM were assessed by a board-certified pathologist. 10 11 Immunoprecipitation. Cells were lysed and extracted with radioimmune precipitation assay buffer (150 12 mM NaCl, 1% NP40, 0.5% DOC, 50 mM Tris HCL at pH 8, 0.1% SDS, 10% glycerol, 5 mM EDTA, 20 13 mM NaF, and 1 mM Na3VO4) supplemented with 1 μg/ml each of pepstatin, leupeptin, aprotinin, and 14 200 μg/ml PMSF. For each sample, 1 mg of protein lysate was added to an Eppendorf tube and 15 precleared with 15 μl of prewashed protein G sepharose beads by rotating at 4°C for 30 minutes 16 followed by a 1-minute centrifugation at 2,500 x g at 4°C. These precleared supernatants were 17 transferred to fresh tubes and were incubated with the indicated antibodies and lysates overnight at 40C. 18 The following day, 30 μl of prewashed protein G sepharose beads were added to the 19 immunoprecipitations and incubated for 2-3 hours by rotating at 4°C. The immunoprecipitation reactions 20 were centrifuged at 2,500 x g at 4°C for 5 minutes followed by a wash with 750 μl of 1X PBST and this 21 process was repeated three more times. After the final wash, the antibody-protein-bound beads were 22 collected via centrifugation at 4°C and removal of supernatant. Beads were resuspended in 5x SDS 23 loading buffer, boiled for 5 min and loaded. Immunoprecipitated proteins were resolved by SDS-PAGE 24 sent for mass spectrometry or transferred to a PVDF membrane. Immunoblotting protocol was followed 25 as per methods above. 26 27 LC-MS/MS Analyses and Data Processing. Quantitative comparisons of post-translational 28 modifications via mass spectrometric analysis on immunoprecipitated HA-ACSS2 treated with DMSO 29 or 100 μM NButGT was performed by The Wistar Institute Proteomics & Metabolomics facility 30 (Philadelphia, PA, USA). Briefly, liquid chromatography tandem mass spectrometry (LC-MS/MS) 31 analysis was performed using a Q Exactive Plus mass spectrometer (ThermoFisher Scientific, Waltham, 32 MA, USA) coupled with a Nano-ACQUITY UPLC system (Waters). Samples were digested in-gel with 33 trypsin and injected onto a UPLC Symmetry trap column. Tryptic peptides were separated by reversed 34 phase HPLC on a BEH analytical column. Eluted peptides were analyzed by the mass spectrometer. 35 Peptide sequences were identified using MaxQuant 1.5.2.8 (Cox and Mann, 2008). MS/MS spectra were 36 searched against a UniProt human protein database. Consensus identification lists were generated with 37 false discovery rates of 1% at protein, and peptide levels. 38 39 Soft-Agar Colony Formation Assay and Neurosphere Assay. Soft agar assays have been previously 40 described (Lynch et al., 2012). Briefly, cells (1 x 104/well) infected with lentiviral shRNA or 41 overexpression vectors, selected and plated in triplicate on top layers consisting of growth medium 42 containing 0.3% agarose. The top layer was overlaid with 1 ml of medium. The cells were grown for 14 43 days, having the media changed every other day. After 14 days, the colonies were stained with 1 ml of 44 0.05% p-iodonitrotetrazolium violet overnight, and colonies measuring > 50 μm were counted manually. 45 For neurosphere assays, SN310 primary glioblastoma cells (1 x 103) infected with shRNA, selected and 46 were plated in polyhema-coated (1.2%) 24-well plates with the number of neurospheres formed being 47 determined at Day 14. 48 49 In Vitro Kinase Assay. Wildtype ACSS2 and S267A mutant were cloned into a pET28a vector into the 50 NotI and BamH1 sites and transformed into BL21 cells. The BL21 cultures were induced with 1mM 51 IPTG at 37°C for 3 hours. Cells were centrifuged and resuspended in His Lysis buffer (50mM Tris, pH

1 8.0, 5 mM imidazole pH 8.0, 500mM NaCl), supplemented with protease inhibitors (1 μg/mL each of 2 pepstatin, leupeptin, and aprotinin and 200 μg/mL phenylmethylsulfonylfluoride (PMSF) and 100mg/ml 3 lysozyme. The lysate was sonicated on ice and centrifuged at 15000 x g for 15 minutes at 4°C. The 4 supernatant was rotated over Nickel NTA Agarose beads (Gold Biotechnology, Cat# H-350-25) in a 5 column (Gold Biotechnology, Cat# P-301) for 2 hours at 4°C. Upon collecting flow-through, beads were 6 washed with wash buffer (50 mM Tris, pH 8.0, 500 mM NaCl, 40 mM imidazole, pH 8.0), and eluted 7 with His Elution buffer (500mM NaCl, 50mM Tris, pH 8.0, 250 mM imidazole , pH 8.0). Dialysis was 8 performed in Slide-A-Lyzer G2 Dialysis Cassette (Thermo Scientific, Prod# 88251) for 2 hours at 4°C in 9 dialysis buffer (20 mM Tris, pH 8.0, 150 mM NaCl, 1 mM DTT). Recombinant CDK5/p25 (60 ng) 10 (EMD Millipore, Burlington, MA, USA) was combined with purified ACSS2 (2ug) in kinase buffer (50 11 mM HEPES, pH 7.5, 0.625 mM MgCl2, 0.625 mM MnCl2, 12.5 mM NaCl) and 1mM ATPγS. The 12 kinase reaction incubated for 5 minutes at 30°C, then was alkylated with 2.5mM PNBM. The alkylating 13 reaction proceeded for 1 hour at room temperature, followed by the addition of 6× boiling sample buffer 14 to stop the reaction. Reactions were then resolved by SDS–PAGE, followed by immunoblotting with the 15 indicated antibodies. 16 17 Nile Red Staining of Cells. Cells were fixed using 4% Formalin and washed in 1xPBS prior to staining. 18 Working solution (5 µg/ml) in PBS was gently added to cells and incubated for 30 minutes away from 19 light. Cells were then washed three times in 1x PBS and visualized and photographed on EVOS FL (Life 20 technologies) using Texas Red filter. 21 22 Free Fatty Acid and Acetyl-CoA Extraction and Quantification. Free Fatty Acid concentrations were 23 measured with the Free Fatty Acid Quantification Kit (BioVision Inc., Milpitas, CA, USA) according to 24 the manufacturer’s protocol. Acetyl-CoA concentrations were measured with the Acetyl-Coenzyme A 25 Assay Kit (Sigma Aldrich) according to the manufacturer’s protocol. 26 13 27 C2-Acetate Labeling. Cells were grown to ~80% confluency in a 6 cm dish in normal growth medium. 28 24 hours prior to labeling cells were grown in serum-free DMEM. Cells were incubated for 4 hours in 29 100 μM 13C2-sodium acetate. Cells were collected in cold PBS then centrifuged at 1,000 rpm for 5 30 minutes at 4 °C. Acetyl-CoA was then extracted from the cell pellets using 80% methanol – 20% dH2O 31 and the samples were then analyzed via LC/MS. 32 33 Ex vivo brain slice model. Organotypic hippocampal cultures were prepared as described previously 34 (Jackson et al., 2014) with some modifications. Briefly, adult mice (6-8 week) or mice after 12 days 35 following intracranial GBM injection, as described above, were decapitated and their brains rapidly 36 removed into ice-cold (4°C) sucrose-aCSF composed of the following (in mM): 280 sucrose, 5 KCl, 2 37 MgCl2, 1 CaCl2, 20 glucose, 10 HEPES, 5 Na+-ascorbate, 3 thiourea, 2 Na+-pyruvate; pH=7.3. Brains 38 were blocked with a sharp scalpel and sliced into 250 µm sections using a McIlwain-type tissue chopper 39 (Vibrotome inc). Four to six slices were placed onto each 0.4 µm Millicell tissue culture insert 40 (Millipore) in six-well plates, 1 ml of medium containing the following: Neurobasal medium A (Gibco), 41 2% Gem21-Neuroplex supplement (Gemini), 1% N2 supplement (Gibco), 1% glutamine (Invitrogen), 42 0.5% glucose, 10 U/ml penicillin, and 100 µg/ml streptomycin (Invitrogen), placed underneath each 43 insert. One-third to one half of the media was changed every 2 d. Tumor growth was monitored via 44 bioluminescence imaging on the IVIS 200 system (Perkin Elmer) and results analyzed using Living 45 Image software (Caliper Life Sciences, Waltham, MA, USA). For MTS assay, individual brain slices 46 were transferred to a 96-well plate and subjected to Promega CellTiter 96® Aqueous One Solution (Cat: 47 G3582) mixed in a 1:5 ratio with culture media and treated as previously described (Mewes et al., 2012). 48 Tissues were incubated at 37℃, 5% CO2 for 4 hours and absorbance at 490nm was measured with Tecan 49 Spark Microplate reader. 50

1 Statistical Analysis and reproducibility. All results shown are results of at least three independent 2 experiments and shown as averages and presented as mean ± s.e. P-values were calculated using a 3 Student’s two-tailed test (* represents p-value ≤ 0.05 or **p-value ≤ 0.01 or as marked in figure legend). 4 Statistical analysis of growth rate of mice was performed using ANCOVA. *p-value < 0.05. 5 6 SUPPLEMENTAL INFORMATION 7 Supplemental information can be found online at…. 8 9 ACKNOWLEDGMENTS 10 This work was supported by PA CURE grant (to M.J.R., N.W.S and J.G.J.), Drexel University Dean’s 11 Fellowship award (to Z.A.B. and L.C.). The authors thank Chaitali Bhadiadra for technical assistance, 12 Dr. Valerie Sodi and Dr. Edward Hartsough for helpful discussions. In memoriam Christos D. Katsetos. 13 14 Author contributions 15 L.C. and Z.A.B. performed most of the experimental work; J.J., R.A.M., and R.H.L. helped with 16 experimental work; C.M.F helped establish intracranial mouse model; S.F., M.T.D., and N.W.S. 17 performed acetate labeling and analyzed data. W.A.G., L.D. and C.D.K. helped with IHC and C.D.K. 18 performed pathological analysis; W.S. provided GBM tissue array; J.G.J., L.C., R.A.M. helped establish 19 ex vivo brain slice model. L.C., Z.A.B. and M.J.R participated in study conception and design as well as 20 data analysis and interpretation; L.C., Z.A.B. and M.J.R drafted the manuscript; All co-authors reviewed 21 the final manuscript version. 22 23 Competing interests 24 The authors declare no competing financial interests. 25 26 FIGURE LEGENDS 27 28 Fig 1. OGT and O-GlcNAcylation levels are elevated in human glioblastoma. 29 (a) Immunohistochemical staining for OGT in different grades of glioma. (b) Immunohistochemical 30 staining for O-GlcNAc on a tissue microarray (n=69) of Grade IV glioblastoma patient biopsies (4X 31 scale bar 1000 um). (c) Cell lysate from normal human astrocytes and primary cells isolated from three 32 different GBM patients were collected for immunoblot analysis with the indicated antibodies. (d) Cell 33 lysates of normal human astrocytes, U87-MG and T98G glioblastoma cell lines were collected for 34 immunoblot analysis with the indicated antibodies. 35 36 Fig 2. OGT is required for glioblastoma growth in vitro and in vivo. 37 (a) Cell lysates from U87-MG cells expressing control or OGT shRNA were collected for immunoblot 38 analysis with the indicated antibodies. (b) U87-MG cells infected with shControl or shOGT lentivirus 39 effect on cell growth visualized with crystal violet staining. (c) Cell lysates from T98G cells expressing 40 control or OGT shRNA were collected for immunoblot analysis with the indicated antibodies. (d) T98G 41 cells infected with shControl or shOGT lentivirus effect on cell growth visualized with crystal violet 42 staining. (e) Anchorage-independent growth assay comparing the colony formation of control or OGT 43 shRNA expressing in indicated cells. Data are quantified and presented as average relative to control 44 from three independent experiments. Student’s t-test reported as mean ± SEM; *p<0.05. (f) Cell lysates 45 from SN310 (left) or SN186 (right) primary GBM cells expressing control or OGT shRNA where 46 collected for immunoblot analysis with the indicated antibodies. (g) Cells from (f) were then plated for a 47 neurosphere formation assay for 8 days and representative image taken. (h) Neurospheres were 48 quantified for SN310 and SN186 cells and presented as average relative to control from three 49 independent experiments. Student’s t-test reported as mean ± SEM. * = p-value < 0.05. (i) 20

1 Representative images of bioluminescent (top) detection of tumors from mice injected with shControl 2 and shOGT U87-MG cells 21 days post-injection. Representative images of H&E analysis (middle) on 3 coronal sections from mice harboring shControl or shOGT tumors at Day 21. Data are quantified and 4 presented as average from mice injected with U87-MG cells expressing shControl (n=5) or shOGT mice 5 (n=7). (bottom). Student’s t-test reported as mean ± SEM; *p<0.005. (j) Kaplan-Meier survival plot 6 comparing overall survival of mice inoculated with shControl (n=7) or shOGT (n=4) U87-MG cells. 7 Mantel-Cox log rank test P = 0.008. 8 9 Fig 3. OGT promotes acetate and lipid accumulation in glioblastoma cells. 10 (a) Cell lysates from U87-MG cells stably overexpressing control or OGT were collected for 11 immunoblot analysis with the indicated antibodies. (b) Control or stably overexpressing OGT U87-MG 12 cells were placed in soft agar assay. Representative images from anchorage-independent growth assay 13 (top) and colonies were counted and quantified (bottom). Student’s t-test reported as mean ± SEM. * = 14 p-value < 0.005. (c) Representative images of nile red staining of U87-MG cells under same conditions 15 as in (a). (d) Measurement of relative free fatty acids in U87-MG cells stably overexpressing control or 16 OGT. Student’s t-test reported as mean ± SEM. * = p-value < 0.05. (e) Measurement of acetyl-CoA 17 extracted from U87-MG cells stably overexpressing control or OGT. Student’s t-test reported as mean ± 13 18 SEM. * = p-value < 0.05. (f) Graphical representation of the concentration of C2-acetate remaining in 13 19 the media following 1 and 4 hours of exposure to 100μM C2-acetate supplemented serum-free media in 20 U87-MG cells stably overexpressing control or OGT. Student’s t-test reported as mean ± SEM. * = p- 21 value < 0.05. (g) Graphical representation of the percent molar enrichment of unlabeled acetyl-CoA in 22 U87-MG cells stably overexpressing control or OGT for 4 hours. Student’s t-test reported as mean ± 23 SEM. * = p-value < 0.05. (h) U87-MG control and OGT overexpressing cells were labeled with 100 μM 13 24 C2-acetate for 4 hours. Measurement of the percent molar enrichment for labeled (M2) acetyl-CoA. 25 Student’s t-test reported as mean ± SEM. * = p-value < 0.05. 26 27 Fig 4. Ser267-ACSS2 phosphorylation is mediated by O-GlcNAcylation in a CDK5-dependent 28 manner. 29 (a) Cell lysates from SN310 (left) or SN186 (right) primary GBM cells expressing control or OGT 30 shRNA were collected for immunoblot analysis with the indicated antibodies. (b) Cell lysates from U87- 31 MG cells stably expressing shRNA against endogenous ACSS2 and overexpressing control, wildtype 32 ACSS2 or ACSS2 S267A mutant were collected for immunoblot analysis with the indicated antibodies. 33 (c) Cell lysates from of U87-MG cells stably expressing shRNA against control or CDK5 were collected 34 for immunoblot analysis with the indicated antibodies. (d) Cell lysates from U87-MG cells treated for 48 35 hrs with pan-CDK inhibitor dinaciclib (5 nM) were collected for immunoblot analysis with the indicated 36 antibodies. (e) Cell lysate from U87-MG cells that were transfected with control plasmid with and 37 without treatment of 100 μM OGA inhibitor (NButGT) for 24 hours or HA-CDK5 plasmid were 38 collected for immunoblot analysis with the indicated antibodies. (f) Cell lysate from U87-MG cells 39 stably expressing control or CDK5 shRNA and treated with DMSO or 100 μM NButGT for 24 hours 40 were collected for immunoblot analysis with the indicated antibodies (left). Relative expression of p- 41 S267 ACSS2/total ACSS2 was quantified (right). Student’s t-test reported as mean ± SEM. * = p-value < 42 0.05. 43 44 Fig 5. Phosphorylation of Ser267 enhances stability of ACSS2 and is required for GBM growth. (a) 45 Cell lysate from U87-MG cells stably expressing control or OGT shRNA and treated with the 46 proteasomal inhibitor 10 μM lactacystin for 6 hours were collected for immunoblot analysis with the 47 indicated antibodies. (b) Immunoprecipitation was performed with the indicated antibodies from U87- 48 MG cell lysates stably expressing wild-type (WT)-, S267A-, or S267D- HA-ACSS2 and transfected with 49 Ub-WT or Ub-K48. (c) Cell lysate from U87-MG cells stably expressing wild-type (WT)-, S267A-, or 50 S267D- HA-ACSS2 in U87-MG glioblastoma cells treated with 10 μg/μl cycloheximide for indicated 51 time (hours) were collected for immunoblot analysis with the indicated antibodies (top). Densitometry

1 quantification of three independent time-course experiments presented as relative expression (HA/actin) 2 to 0 hours (bottom). Green dotted line represents 0.5 relative expression. Student’s t-test reported as 3 mean ± SEM. * = p-value < 0.05. (d) Cell lysates from U87-MG cells stably expressing ACSS2 shRNA 4 against endogenous 3’ UTR of ACSS2 (left) and stably overexpressing wildtype ACSS2, ACSS2-S267A 5 and ACSS2-S267D mutant (right) were collected for immunoblot analysis with the indicated antibodies. 6 (e) Representative image of cells in (d) seeded into an anchorage-independent growth assay and imaged 7 at day 14 (top). Data are quantified and presented as average from at least three independent 8 experiments (bottom). Student’s t-test reported as mean ± SEM. * = p-value < 0.05. (f) Representative 9 images of tumor growth detected via bioluminescence at Day 16 following injection of U87-MG- 10 luciferase cells WT-ACSS2 or S267A-ACSS2 (left). Quantification of tumor size (WT n=4, S267A n=4) 11 (right). Student’s t-test reported as mean ± SEM. * = p-value < 0.05 12 13 Fig 6. CDK5 is a critical regulator of GBM growth and requires ACSS2 phosphorylation. 14 (a) Cell lysates from of U87-MG cells stably expressing shRNA against control or CDK5 were collected 15 for immunoblot analysis with the indicated antibodies. (b) Representative images of U87-MG cells 16 stained with crystal violet stably expressing of shRNA targeting control or CDK5. (c) Cell lysates from 17 SN310 primary GBM cells expressing control or CDK5 shRNA were collected for immunoblot analysis 18 with the indicated antibodies (left). Representative images from neurosphere growth assay (right) at day 19 6 comparing the neurosphere formation of control or CDK5 shRNA expressing SN310 cells. (d) 20 Measurement of acetyl-CoA extracted from U87-MG cells stably overexpressing control or CDK5 21 shRNA. Student’s t-test reported as mean ± SEM. * = p-value < 0.05. (e) U87-MG cells stably 22 expressing shRNA against control or CDK5 were labeled with 13C₂-acetate for four hours and 13C₂- 23 acetyl-CoA concentrations were measured and shown. Student’s t-test reported as mean ± SEM. **p- 24 value < 0.0001 (f) Cell lysate from U87-MG-Luciferase cells stably expressing control or CDK5 shRNA 25 were collected for immunoblot analysis with the indicated antibodies (left). Representative images of 26 tumor growth detected via bioluminescence and H&E staining at Day 16 following injection of U87- 27 MG-luciferase cells expressing control or CDK5 shRNA (middle). Quantification of tumor size at Day 28 16 (shControl n=5, shCDK5 n=5) (right). Student’s t-test reported as mean ± SEM. * = p-value < 0.05. 29 (g) Cell lysates from U87-MG cells stably expressing shRNA against control or CDK5 and 30 overexpressing HA-ACSS2-WT (wildtype), HA-ACSS2-S267A, or HA-ACSS2-S267D mutants were 31 collected for immunoblot analysis with the indicated antibodies. (h) Representative images of U87-MG 32 cells stained with crystal violet containing shRNA targeting control or CDK5 and overexpressing 33 ACSS2-WT (wildtype), ACSS2-S267A, or ACSS2-S267D mutants. 34 35 Fig 7. Phosphorylation of S267-ACSS2 is required for OGT-mediated GBM growth. 36 (a) Cell lysates from of U87-MG cells stably expressing shRNA against control or OGT and 37 overexpressing HA-ACSS2-WT, HA-ACSS2-S267A, and HA-ACSS2-S267D were collected for 38 immunoblot analysis with the indicated antibodies (b) Representative images of cells generated in (a) 39 and seeded into anchorage-independent growth assay and imaged at day 14. (c) Average colony 40 formation quantified and presented as average from three independent experiments corresponding to 41 Figure 7b showing U87-MG cells stable expressing ACSS2-WT, ACSS2-S267A and ACSS2-S267D 42 mutants and expressing shControl or shOGT as indicated. Student’s t-test reported as mean ± SEM. * = 43 p-value < 0.05. (d) Representative images of tumor growth detected via bioluminescence (top) and H&E 44 staining (bottom) U87-MG-luciferase cells subjected to the same treatment as in (a) and then used for 45 orthotopic intracranial injections in mice. (e) Quantification of tumor size at Day 16 corresponding to 46 Figure 7d (shControl n=5, shOGT n=8, shOGT+ACSS2-S267A n=4, shOGT+ACSS2-S267D n=4). 47 Student’s t-test reported as mean ± SEM. * = p-value < 0.05. 48 49 Fig 8. Targeting OGT or CDKs blocks GBM growth ex vivo. 50 (a) Representative images depicting tumor growth in organotypic brain slices derived from mice 51 intracranially injected with U87-MG-luc cells detected via bioluminescence. Brain slices containing 22

1 tumors are treated with vehicle Control (DMSO) or Ac-5S-GlcNAc (200 µM) for indicated days (top) 2 (image magnification 10x, scale bar: 400 µm). Slices were fixed and assayed for H&E, Ki-67, phospho- 3 ACSS2-S267, cleaved caspase-3 staining. (b) Quantification of tumor growth at indicated day (Control: 4 DMSO n=3, Ac-5S-GlcNAc n=3) (bottom). Student’s t-test reported as mean ± SEM. * = p-value < 5 0.05. (c) Luciferase images of ex vivo brain explants containing preformed tumors U87-MG-luc treated 6 with indicated dose of Dinaciclib for indicated days. (d) Quantification of tumor growth at indicated day 7 treated with Control: DMSO (n=3), dinaciclib 100 nM (n=3) or 500 nM (n=3). Student’s t-test reported 8 as mean ± SEM. * = p-value < 0.05. (e) Immunohistochemical staining for ACSS2 pSer267 on a tissue 9 microarray of Grade IV glioblastoma patient biopsies (n=69). (f) Model. Increased levels and activity of 10 OGT in GBM leads to a CDK5-depepndent phosphorylation of ACSS2 on Ser267 that increases its 11 stability and blocks ubiquitination and increases acetate conversion to acetyl-CoA and contributes to 12 growth and survival of GBM tumors. 13

14 15 REFERENCES 16 Antoniou, X., Gassmann, M., and Ogunshola, O.O. (2011). Cdk5 interacts with Hif-1alpha in 17 neurons: a new hypoxic signalling mechanism? Brain Res 1381, 1-10. 18 Bond, M.R., and Hanover, J.A. (2015). A little sugar goes a long way: the cell biology of O- 19 GlcNAc. The Journal of cell biology 208, 869-880. 20 Bulusu, V., Tumanov, S., Michalopoulou, E., van den Broek, N.J., MacKay, G., Nixon, C., 21 Dhayade, S., Schug, Z.T., Vande Voorde, J., Blyth, K., et al. (2017). Acetate Recapturing by 22 Nuclear Acetyl-CoA Synthetase 2 Prevents Loss of Histone Acetylation during Oxygen and 23 Serum Limitation. Cell Rep 18, 647-658. 24 Caldwell, S.A., Jackson, S.R., Shahriari, K.S., Lynch, T.P., Sethi, G., Walker, S., Vosseller, K., 25 and Reginato, M.J. (2010). Nutrient sensor O-GlcNAc transferase regulates breast cancer 26 tumorigenesis through targeting of the oncogenic transcription factor FoxM1. Oncogene 27 29, 2831-2842. 28 Catania, A., Urban, S., Yan, E., Hao, C., Barron, G., and Allalunis-Turner, J. (2001). Expression 29 and localization of cyclin-dependent kinase 5 in apoptotic human glioma cells. Neuro 30 Oncol 3, 89-98. 31 Chandrashekar, D.S., Bashel, B., Balasubramanya, S.A.H., Creighton, C.J., Ponce-Rodriguez, 32 I., Chakravarthi, B., and Varambally, S. (2017). UALCAN: A Portal for Facilitating Tumor 33 Subgroup Gene Expression and Survival Analyses. Neoplasia 19, 649-658. 34 Chau, V., Tobias, J.W., Bachmair, A., Marriott, D., Ecker, D.J., Gonda, D.K., and Varshavsky, A. 35 (1989). A multiubiquitin chain is confined to specific lysine in a targeted short-lived 36 protein. Science 243, 1576-1583. 37 Chen, X.X., Xie, F.F., Zhu, X.J., Lin, F., Pan, S.S., Gong, L.H., Qiu, J.G., Zhang, W.J., Jiang, Q.W., 38 Mei, X.L., et al. (2015). Cyclin-dependent kinase inhibitor dinaciclib potently synergizes 39 with cisplatin in preclinical models of ovarian cancer. Oncotarget 6, 14926-14939. 40 Comerford, S.A., Huang, Z., Du, X., Wang, Y., Cai, L., Witkiewicz, A.K., Walters, H., Tantawy, 41 M.N., Fu, A., Manning, H.C., et al. (2014). Acetate dependence of tumors. Cell 159, 1591- 42 1602. 43 Cox, J., and Mann, M. (2008). MaxQuant enables high peptide identification rates, 44 individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat 45 Biotechnol 26, 1367-1372.

1 Dunn, G.P., Rinne, M.L., Wykosky, J., Genovese, G., Quayle, S.N., Dunn, I.F., Agarwalla, P.K., 2 Chheda, M.G., Campos, B., Wang, A., et al. (2012). Emerging insights into the molecular and 3 cellular basis of glioblastoma. Genes Dev 26, 756-784. 4 Feldmann, G., Mishra, A., Bisht, S., Karikari, C., Garrido-Laguna, I., Rasheed, Z., Ottenhof, 5 N.A., Dadon, T., Alvarez, H., Fendrich, V., et al. (2011). Cyclin-dependent kinase inhibitor 6 Dinaciclib (SCH727965) inhibits pancreatic cancer growth and progression in murine 7 xenograft models. Cancer Biol Ther 12, 598-609. 8 Ferrer, C.M., Lynch, T.P., Sodi, V.L., Falcone, J.N., Schwab, L.P., Peacock, D.L., Vocadlo, D.J., 9 Seagroves, T.N., and Reginato, M.J. (2014). O-GlcNAcylation regulates cancer metabolism 10 and survival stress signaling via regulation of the HIF-1 pathway. Mol Cell 54, 820-831. 11 Ferrer, C.M., Sodi, V.L., and Reginato, M.J. (2016). O-GlcNAcylation in Cancer Biology: 12 Linking Metabolism and Signaling. J Mol Biol 428, 3282-3294. 13 Fu, A.K., Fu, W.Y., Ng, A.K., Chien, W.W., Ng, Y.P., Wang, J.H., and Ip, N.Y. (2004). Cyclin- 14 dependent kinase 5 phosphorylates signal transducer and activator of transcription 3 and 15 regulates its transcriptional activity. Proc Natl Acad Sci U S A 101, 6728-6733. 16 Futatsugi, A., Utreras, E., Rudrabhatla, P., Jaffe, H., Pant, H.C., and Kulkarni, A.B. (2012). 17 Cyclin-dependent kinase 5 regulates E2F transcription factor through phosphorylation of 18 Rb protein in neurons. Cell Cycle 11, 1603-1610. 19 Gao, Y., Wells, L., Comer, F.I., Parker, G.J., and Hart, G.W. (2001). Dynamic O-glycosylation 20 of nuclear and cytosolic proteins: cloning and characterization of a neutral, cytosolic beta- 21 N-acetylglucosaminidase from human brain. J Biol Chem 276, 9838-9845. 22 Gloster, T.M., Zandberg, W.F., Heinonen, J.E., Shen, D.L., Deng, L., and Vocadlo, D.J. (2011). 23 Hijacking a biosynthetic pathway yields a glycosyltransferase inhibitor within cells. Nat 24 Chem Biol 7, 174-181. 25 Hornbeck, P.V., Zhang, B., Murray, B., Kornhauser, J.M., Latham, V., and Skrzypek, E. (2015). 26 PhosphoSitePlus, 2014: mutations, PTMs and recalibrations. Nucleic Acids Res 43, D512- 27 520. 28 Hothi, P., Martins, T.J., Chen, L., Deleyrolle, L., Yoon, J.G., Reynolds, B., and Foltz, G. (2012). 29 High-throughput chemical screens identify disulfiram as an inhibitor of human 30 glioblastoma stem cells. Oncotarget 3, 1124-1136. 31 Jackson, J.G., O'Donnell, J.C., Takano, H., Coulter, D.A., and Robinson, M.B. (2014). Neuronal 32 activity and glutamate uptake decrease mitochondrial mobility in astrocytes and position 33 mitochondria near glutamate transporters. J Neurosci 34, 1613-1624. 34 Jin, X., Demere, Z., Nair, K., Ali, A., Ferraro, G.B., Natoli, T., Deik, A., Petronio, L., Tang, A.A., 35 Zhu, C., et al. (2020). A metastasis map of human cancer cell lines. Nature 588, 331-336. 36 Kumar, S.K., LaPlant, B., Chng, W.J., Zonder, J., Callander, N., Fonseca, R., Fruth, B., Roy, V., 37 Erlichman, C., and Stewart, A.K. (2015). Dinaciclib, a novel CDK inhibitor, demonstrates 38 encouraging single-agent activity in patients with relapsed multiple myeloma. Blood 125, 39 443-448. 40 Lenjisa, J.L., Tadesse, S., Khair, N.Z., Kumarasiri, M., Yu, M., Albrecht, H., Milne, R., and 41 Wang, S. (2017). CDK5 in oncology: recent advances and future prospects. Future Med 42 Chem 9, 1939-1962. 43 Lewis, C.A., Brault, C., Peck, B., Bensaad, K., Griffiths, B., Mitter, R., Chakravarty, P., East, P., 44 Dankworth, B., Alibhai, D., et al. (2015). SREBP maintains lipid biosynthesis and viability of 45 cancer cells under lipid- and oxygen-deprived conditions and defines a gene signature 46 associated with poor survival in glioblastoma multiforme. Oncogene 34, 5128-5140. 24

1 Li, X., Yu, W., Qian, X., Xia, Y., Zheng, Y., Lee, J.H., Li, W., Lyu, J., Rao, G., Zhang, X., et al. 2 (2017). Nucleus-Translocated ACSS2 Promotes Gene Transcription for Lysosomal 3 Biogenesis and Autophagy. Molecular cell 66, 684-697 e689. 4 Lin, H., Chen, M.C., Chiu, C.Y., Song, Y.M., and Lin, S.Y. (2007). Cdk5 regulates STAT3 5 activation and cell proliferation in medullary thyroid carcinoma cells. J Biol Chem 282, 6 2776-2784. 7 Lindqvist, J., Imanishi, S.Y., Torvaldson, E., Malinen, M., Remes, M., Orn, F., Palvimo, J.J., and 8 Eriksson, J.E. (2015). Cyclin-dependent kinase 5 acts as a critical determinant of AKT- 9 dependent proliferation and regulates differential gene expression by the androgen 10 receptor in prostate cancer cells. Mol Biol Cell 26, 1971-1984. 11 Liu, R., Tian, B., Gearing, M., Hunter, S., Ye, K., and Mao, Z. (2008). Cdk5-mediated 12 regulation of the PIKE-A-Akt pathway and glioblastoma cell invasion. Proceedings of the 13 National Academy of Sciences of the United States of America 105, 7570-7575. 14 Lowman, X.H., McDonnell, M.A., Kosloske, A., Odumade, O.A., Jenness, C., Karim, C.B., 15 Jemmerson, R., and Kelekar, A. (2010). The proapoptotic function of Noxa in human 16 leukemia cells is regulated by the kinase Cdk5 and by glucose. Molecular cell 40, 823-833. 17 Lynch, T.P., Ferrer, C.M., Jackson, S.R., Shahriari, K.S., Vosseller, K., and Reginato, M.J. 18 (2012). Critical role of O-Linked β-N-acetylglucosamine transferase in prostate cancer 19 invasion, angiogenesis, and metastasis. Journal of Biological Chemistry 287, 11070-11081. 20 Magistretti, P.J., and Allaman, I. (2015). A cellular perspective on brain energy metabolism 21 and functional imaging. Neuron 86, 883-901. 22 Marshall, S., Bacote, V., and Traxinger, R.R. (1991). Discovery of a metabolic pathway 23 mediating glucose-induced desensitization of the glucose transport system. Role of 24 hexosamine biosynthesis in the induction of insulin resistance. J Biol Chem 266, 4706- 25 4712. 26 Mashimo, T., Pichumani, K., Vemireddy, V., Hatanpaa, K.J., Singh, D.K., Sirasanagandla, S., 27 Nannepaga, S., Piccirillo, S.G., Kovacs, Z., Foong, C., et al. (2014). Acetate is a bioenergetic 28 substrate for human glioblastoma and brain metastases. Cell 159, 1603-1614. 29 Mewes, A., Franke, H., and Singer, D. (2012). Organotypic brain slice cultures of adult 30 transgenic P301S mice--a model for tauopathy studies. PLoS One 7, e45017. 31 Ning, X., Tao, T., Shen, J., Ji, Y., Xie, L., Wang, H., Liu, N., Xu, X., Sun, C., Zhang, D., et al. (2017). 32 The O-GlcNAc Modification of CDK5 Involved in Neuronal Apoptosis Following In Vitro 33 Intracerebral Hemorrhage. Cell Mol Neurobiol 37, 527-536. 34 Obenauer, J.C., Cantley, L.C., and Yaffe, M.B. (2003). Scansite 2.0: Proteome-wide prediction 35 of cell signaling interactions using short sequence motifs. Nucleic Acids Res 31, 3635- 36 3641. 37 Parry, D., Guzi, T., Shanahan, F., Davis, N., Prabhavalkar, D., Wiswell, D., Seghezzi, W., 38 Paruch, K., Dwyer, M.P., Doll, R., et al. (2010a). Dinaciclib (SCH 727965), a novel and potent 39 cyclin-dependent kinase inhibitor. Mol Cancer Ther 9, 2344-2353. 40 Parry, D., Guzi, T., Shanahan, F., Davis, N., Prabhavalkar, D., Wiswell, D., Seghezzi, W., 41 Paruch, K., Dwyer, M.P., Doll, R., et al. (2010b). Dinaciclib (SCH 727965), a novel and 42 potent cyclin-dependent kinase inhibitor. Mol Cancer Ther 9, 2344-2353. 43 Piedrahita, D., Hernandez, I., Lopez-Tobon, A., Fedorov, D., Obara, B., Manjunath, B.S., 44 Boudreau, R.L., Davidson, B., Laferla, F., Gallego-Gomez, J.C., et al. (2010). Silencing of CDK5 45 reduces neurofibrillary tangles in transgenic alzheimer's mice. J Neurosci 30, 13966- 46 13976. 25

1 Pozo, K., and Bibb, J.A. (2016). The Emerging Role of Cdk5 in Cancer. Trends Cancer 2, 606- 2 618. 3 Schild, T., Low, V., Blenis, J., and Gomes, A.P. (2018). Unique Metabolic Adaptations Dictate 4 Distal Organ-Specific Metastatic Colonization. Cancer Cell 33, 347-354. 5 Schug, Z.T., Peck, B., Jones, D.T., Zhang, Q., Grosskurth, S., Alam, I.S., Goodwin, L.M., 6 Smethurst, E., Mason, S., Blyth, K., et al. (2015). Acetyl-CoA synthetase 2 promotes acetate 7 utilization and maintains cancer cell growth under metabolic stress. Cancer Cell 27, 57-71. 8 Schug, Z.T., Vande Voorde, J., and Gottlieb, E. (2016). The metabolic fate of acetate in 9 cancer. Nat Rev Cancer 16, 708-717. 10 Sharma, S., Zhang, T., Michowski, W., Rebecca, V.W., Xiao, M., Ferretti, R., Suski, J.M., 11 Bronson, R.T., Paulo, J.A., Frederick, D., et al. (2020). Targeting the cyclin-dependent kinase 12 5 in metastatic melanoma. Proc Natl Acad Sci U S A 117, 8001-8012. 13 Sodi, V.L., Bacigalupa, Z.A., Ferrer, C.M., Lee, J.V., Gocal, W.A., Mukhopadhyay, D., Wellen, 14 K.E., Ivan, M., and Reginato, M.J. (2018). Nutrient sensor O-GlcNAc transferase controls 15 cancer lipid metabolism via SREBP-1 regulation. Oncogene 37, 924-934. 16 Sodi, V.L., Khaku, S., Krutilina, R., Schwab, L.P., Vocadlo, D.J., Seagroves, T.N., and Reginato, 17 M.J. (2015). mTOR/MYC Axis Regulates O-GlcNAc Transferase Expression and O- 18 GlcNAcylation in Breast Cancer. Mol Cancer Res 13, 923-933. 19 Ubeda, M., Kemp, D.M., and Habener, J.F. (2004). Glucose-induced expression of the cyclin- 20 dependent protein kinase 5 activator p35 involved in Alzheimer's disease regulates insulin 21 gene transcription in pancreatic beta-cells. Endocrinology 145, 3023-3031. 22 Yoshii, Y., Furukawa, T., Yoshii, H., Mori, T., Kiyono, Y., Waki, A., Kobayashi, M., Tsujikawa, 23 T., Kudo, T., Okazawa, H., et al. (2009). Cytosolic acetyl-CoA synthetase affected tumor cell 24 survival under hypoxia: the possible function in tumor acetyl-CoA/acetate metabolism. 25 Cancer Sci 100, 821-827. 26 Yushan, R., Wenjie, C., Suning, H., Yiwu, D., Tengfei, Z., Madushi, W.M., Feifei, L., Changwen, 27 Z., Xin, W., and Roodrajeetsing, G. (2015). Insights into the clinical value of cyclin- 28 dependent kinase 5 in glioma: a retrospective study. World journal of surgical oncology 29 13, 223. 30 Zachara, N.E., and Hart, G.W. (2004). O-GlcNAc modification: a nutritional sensor that 31 modulates proteasome function. Trends Cell Biol 14, 218-221. 32 Zachara, N.E., and Hart, G.W. (2006). Cell signaling, the essential role of O-GlcNAc! 33 Biochimica et Biophysica Acta (BBA)-Molecular and Cell Biology of Lipids 1761, 599-617. 34 35

O-GlcNAc

Medium (50%) OGT OGT

Grade III Glioma Grade IV Glioma

O-GlcNAc

High (32%)

OGT OGT

O-GlcNAc Normal Primary GBM (SN) c. Human d. Astrocytes 186 275 310 Normal Human GBMs OGT Astrocytes U87-MG T98G

OGT

O-GlcNAc

ACSS2 ACSS2

CDK5 CDK5

Actin Actin bioRxiv preprint doi: https://doi.org/10.1101/2021.05.10.443157; this version posted May 11, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Ciraku, et. al., Figure 2 a. U87-MG c. f. T98G SN310 SN186 shRNA: Cont OGT#1 OGT#2 shRNA: Cont OGT#1 OGT#2 shRNA: Cont OGT#1 Cont OGT#1 OGT OGT OGT

O-GlcNAc O-GlcNAc O-GlcNAc

Actin Actin Actin * SN310 g. b. T98G shCont shOGT1 U87-MG d. shOGT2 shCont shOGT1 shOGT2 shCont shOGT1

SN186 shCont shOGT1

e. 1.2 * * h. * * 1 ContshCont 1.2 * * shOGTshOGT1 1 0.8 1 shOGTshOGT2 2 shConts… 0.6 Formation 0.8 shOGT1s… 0.6 0.4

Colony Formation 0.4 (Relative to control) to (Relative 0.2 (Relative to control) to (Relative 0.2 Neurospheres 0 U87U8-MG 7 T98GT98 0 SN310 SN186 Day 21 i. shCont shOGT j. K a p la n M e ie r S u rv iv a l P lo t Kaplan-MeierK a pSurvivalla n M e Plotie r S u rv iv a l P lo t shCont 1 0 0 1 0 0 s h C o n tro l s h C o n tro l l l shOGT shO G T a shO G T a v i v i v r v u r s u

s 5 0

t P-value = 0.008 5 0 e n c

1000000 Control shOGT r e e c P r

) 100000 e

* Percent Survival sr / 10000 P 2 1000 0 0 2 0 4 0 6 0 100 0 * DaysD a yElapseds E la p s e d 10 0 2 0 4 0 6 0 (p/sec/cm 1 Bioluminescence D a y s E la p s e d Day 1 Day 21 bioRxiv preprint doi: https://doi.org/10.1101/2021.05.10.443157; this version posted May 11, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. U87-MG Ciraku, et. al., Figure 3 a. Control OGT e. OGT Cellular Acetyl-CoA: )

* O-GlcNAc nmole CoA ( -

CDK5

Rb pS780

Total Rb Cellular Acetyl Control OGT

ACSS2 13 ConcentrationConcentration of of13C ₂C-Acetate2-Acetate in in Media Media Actin f. 140

M) Control M) 120 μ b. Anchorage-Independent Growth: µ * 100 OGTOGT o/e Control OGT 80 Acetate (

Acetate ( 60 - - ₂ 2

C 40 13 13C 20 0 1 h 4 h 2 * 1.5 g. Acetyl-CoA M0 1 t 0.5 Formation

Relative Colony * 0 Control N-Flag OGT c. Control OGT Enrichmen Nile Red Stain:

Control OGT Molar %

Control OGT

Nile Red Nile Red h. Acetyl-CoA M2 d. Free Fatty Acids: *

1.4 t 1.2 * 1 0.8

0.6 Enrichmen 0.4

0.2 Molar 0 % Relative Free Fatty Acids Control N-FlagOGT OGT Control OGT bioRxiv preprint doi: https://doi.org/10.1101/2021.05.10.443157; this version posted May 11, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Ciraku et al. Figure 4 a. SN310 SN186 b. U87-MG- shRNA: Cont OGT Cont OGT U87-MG shACSS2 OGT Ctrl shACSS2 Crtl WT S267A CDK5 ACSS2 ACSS2 pS267 Rb pS780 Actin ACSS2 Total Rb HA ACSS2 pS267 Actin ACSS2

Actin

U87-MG c. d. e. Cont +NButGT HA-CDK5 shCont shCDK5 DMSO Dinaciclib Rb CDK5 pS780Rb pS780 Rb Rb O-GlcNAc pS780 Rb ACSS2ACSS2 Rb pS267 pS267 HA ACSS2 ACSS2ACSS2 pS267 ACSS2 ActinActin ACSS2 pS267 ACSS2 Actin Actin f. shCont shCDK5 NButGT (24h): - + - + **" CDK5

*" **" O-GlcNAc 2.5

ACSS2 *" 1.5 pS267

ACSS2 1 n.s." RelativeExpression Relative Expression Relative S267 ACSS2/total ACSS2) ACSS2/total S267

Rb - 0.5 (pS267-ACSS2/total ACSS2) (pS267-ACSS2/total pS780 (p

0 Rb DMSO NButGTNButGT DMSO NButGTNButGT shCont shCDK5 Actin shCont shCDK5 a. b. Ciraku et al. Figure 5 U87-MG +Lactacystin IP: IgG IP: ACSS2 Ctrl shOGT Ctrl shOGT ACSS2: WT S267A S267D WT S267A S267D OGT Ubiquitin: WT WT WT WT K48R WT K48R WT K48R

170 ACSS2 WB: 130 K48 100 polyUb 75 Actin 50

100 WT WB: c. 75 ACSS2 CHX: 0 0.5 1 2 4 HA-Ub-WT HA-Ub-K48R HA HA Actin WCL: Actin S267A U87-shACSS2 CHX: 0 0.5 1 1.5 2 4 d. HA-ACSS2 HA U87-MG Actin Cont WT S267A S267D shCont shACSS2 S267D ACSS2 ACSS2 CHX: 0 0.5 1 1.5 2 4 Actin HA HA

Actin Actin

1.2 e. WT ACSS2- ACSS2- Control ACSS2-WT 1 S267A S267A S267D S267D 0.8 * 0.6

0.4 * * 0.2 * * *

Relative Expression (HA/Actin) 0 0 h 0.5 h 2 h 4 h 40 * * * f. 35 WT-ACSS2 30 10000000 25 1000000 * ) 20

sr 100000 / 2

10000 Formation 15

S267A-ACSS2 1000 Average Colony 10 100 5

(p/sec/cm 10

Bioluminescence 0 1 ControlControl ACSS2WT -WT S267AACSS2- ACSS2S267D - ACSS2WT-WT ACSS2S267A-S267A S267A S267D Ciraku et al. Figure 6 a. U87-MG c. shCont shCDK5 #1 shCDK5 #2 Primary GBM (SN310): shControl CDK5 shRNA: shCtrl shCDK5

Rb CDK5 pS780 ACSS2 shCDK5 Rb pS267 ACSS2 ACSS2 pS267 Actin

ACSS2 shCDK5 g. Actin Ctrl Cont WT S267A S267D

CDK5 b. shCont shCDK5 #1 shCDK5 #2 ACSS2 pS267

ACSS2 d. 50 HA CoA

- 40

) Actin * 30 *

nmole 20 shCtrl shCDK5 ( h. 10 Control Cellular Acetyl Cellular 0 Control shCdk5 #1 shCdk5 #2 e. 1.2 1.0 HA-ACSS2- WT

CoA 0.8 -

0.6 HA-ACSS2- ** Acetyl

- S267A ₂ 0.4 C 13

(Relative to Control) to (Relative 0.2 HA-ACSS2- 0.0 Control shCDK5 S267D f. shCont shCDK5 10000000 U87-Luc ) * sr 1000000 / Cont shCDK5 2 100000 10000 CDK5 1000 100 ACSS2 (p/sec/cm

Bioluminescence 10 Actin 1 Control shCDK5 a. shOGT Ciraku et al. Figure 7 Ctrl shOGT WT SA SD

OGT

ACSS2

Actin

shOGT b. Control shOGT HA-ACSS2- HA-ACSS2- HA-ACSS2- WT S267A S267D

* c. * * * * c. 50 40 30 20 Formation

Average Colony Colony Average 10 0 shCont shOGT ACSS2- ACSS2- ACSS2- WT S267A S267D Control shO GT d. shOGT shOshOGT GT_S267A-… shO GT_S267D-…shOGT shO GT_WT-ACSS2 Control shOGT ACS2-S267A ACSS2-S267D

n.s. * * e. 10000000 1000000 100000 /sr) 2 10000 1000 100

(p/sec/cm 10 Bioluminescence 1 ControlControl shOGTshOGT S267AshOGT S267DshOGT S267A S267D a. Ciraku et al. Figure 8 Day 6: Day 6: Day 6: Day 1 Day 6 Day 6 Ki67 ACSS2-pS267 Cv.-Casp-3

Control

Ac-5S- GlcNAc b. Control Ac-5s-GlcNAc e. ACSS2 pSer267

Low (12%) Medium (64%) High (24%) * * c. Day 0 Day 2 Day 4 Dinaciclib:

Control f.

100 nM

500 nM

d. 30 DMSOControl * 25 100nM100 nM 20 500nM500 nM

15 * 10

Bioluminescent pixel count DAY0 DAY2 DAY4 -5