Defining the Host Protective Antigens Secreted by the Murine Whipworm, Trichuris Muris

Defining the host protective antigens secreted by the murine whipworm, Trichuris muris

A thesis submitted to The University of Manchester for the degree of Doctor of Philosophy in the Faculty of Biology, Medicine and Health

2017

Rebecca K Shears

School of Biological Sciences

Division of Infection, Immunity and Respiratory Medicine

Table of contents

List of Figures ...... 5 List of Tables ...... 8 Abbreviations ...... 10 Abstract ...... 12 Acknowledgements ...... 13 Declaration ...... 14 Copyright statement ...... 14 Chapter 1: Introduction ...... 15 1.1 Gastrointestinal nematodes: their prevalence, disease burden and the need for prophylactic vaccines ...... 16 1.2 T. muris as a model for T. trichiura ...... 18 1.2.1 The life cycle of T. muris ...... 18 1.2.2 Immune response during acute and chronic T. muris infection ...... 20 1.2.3 Mechanisms of T. muris expulsion ...... 23 1.2.3.1 Mucus production and other goblet cell secretions ...... 26 1.2.3.2 Increased rate of epithelial cell turnover ...... 28 1.2.3.3 Intestinal muscle hyper-contractility ...... 29 1.2.3.4 Mast cells and IgE production ...... 30 1.2.3.5 IgG antibody production and B cells ...... 30 1.2.3.6 Innate lymphoid cells and other early sources of Th2 cytokines 31 1.2.3.7 Regulation of the immune response during T. muris infection .... 32 1.3 Clinical and pre-clinical helminth vaccine candidates ...... 33 1.3.1 Hookworm vaccine candidates ...... 33 1.3.2 Pre-clinical Ascaris vaccine candidates ...... 35 1.3.3 Experimental Trichuris vaccines ...... 35 1.3.4 Schistosome vaccines ...... 39 1.3.5 Cestode vaccine candidates ...... 40 1.3.6 The role of adjuvants in vaccines ...... 40 1.4 Extracellular vesicles as a source of antigenic material ...... 43 1.4.1 Exosome biogenesis and isolation from biological samples ...... 43 1.4.2 Exosome release by parasitic helminths ...... 45 1.5 Aims and objectives ...... 48 Chapter 2: Materials and methods ...... 49 2.1 Maintenance of animals ...... 50 2.2 Maintenance of parasites, ELV removal and preparation of adult ES 50 2.3 Preparation of larval ES ...... 51 2.4 Egg infectivity and dosage ...... 52 2.5 Quantification of worm burdens ...... 52 2.6 Collection of sera ...... 53 2.7 Anti-parasite IgG1 and IgG2a ELISAs ...... 53 2.8 Lymphocyte re-stimulation assay ...... 53 2.8.1 Measuring cytokine production in cell supernatants ...... 54 2.9 Fractionation of adult ES ...... 56

2 2.9.1 Fractionation of adult ES by gel filtration chromatography ...... 56 2.9.2 Fractionation of adult ES and pool 3 by anion exchange and gel filtration chromatography ...... 57 2.10 SDS-PAGE ...... 57 2.10.1 Coomassie blue staining ...... 58 2.10.2 Silver staining of SDS-PAGE gels ...... 58 2.11 Assessing protein concentration of samples ...... 58 2.12 Western blotting ...... 58 2.12.1 Western blotting using serum from T. muris infected mice ...... 59 2.12.2 Western blotting to detect His-tagged recombinant proteins ...... 59 2.13 Mass spectrometry and proteomic analysis of ES components .... 60 2.13.1 Mass spectrometry analysis of T. muris ELVs ...... 61 2.14 Vaccination studies ...... 62 2.14.1 Proteinase K treatment of ES and subsequent vaccination ...... 63 2.14.2 Serum transfer from vaccinated to unvaccinated mice ...... 63 2.14.3 ELV vaccination studies...... 64 2.15 DNA synthesis, transfections and collection of recombinant proteins ...... 65 2.16 Purification of recombinant proteins ...... 66 2.17 TEM analysis of ELV samples ...... 67 2.18 DLS of ELVs ...... 67 2.19 ELV fusion assay ...... 68 2.20 Graphing and statistical analysis ...... 68 Chapter 3: Defining the host protective components within the soluble portion of T. muris ES ...... 70 3.1 Introduction ...... 71 3.2 Preparation of T. muris ES for fractionation using gel filtration chromatography ...... 73 3.2.3 Investigating the suitability of gel filtration media to fractionate ES into smaller sub-groups...... 74 3.2.2 Division of ES into four sub-groups using Superose 12 gel filtration media ...... 76 3.2.3 Investigating the cellular immune response to pools 2-4 ...... 78 3.2.4 Assessment of anti-parasite IgG serum antibody response during acute T. muris infection ...... 80 3.3 Vaccination with pools 2 to 4 stimulates protective immunity ...... 82 3.3.1 Assessment of antibody response following vaccination with pools 2 to 4 and subsequent infection ...... 84 3.4 Vaccination with ES induces long-lasting protection against a subsequent low dose infection ...... 89 3.4.1 Assessment of antibody response following long-term vaccination and subsequent infection ...... 90 3.5 Proteinase K degradation of ES abrogates its protective properties …………………………………………………………………………………94 3.6 Transfer of serum from ES vaccinated mice does not confer resistance to unvaccinated mice ...... 95 3.7 Fractionation of ES by anion exchange chromatography ...... 97 3.8 Fractionation of pool 3 by anion exchange chromatography ...... 99 3.9 Vaccination with L2 ES induces protective immunity ...... 101

3 3.10 Evaluation of the AKR mouse model for vaccination studies ...... 104 3.11 Discussion ...... 105 Chapter 4: Identification of immunogenic candidates within T. muris ES ………………………………………………………………………………………..112 4.1 Chapter introduction ...... 113 4.2 Identification of immunogenic candidates using a size exclusion chromatography and proteomics approach ...... 114 4.2.1 Fractionating ES using Superose 12 gel filtration media ...... 114 4.2.2 Fractionation of pool 3 using Superdex 75 gel filtration media ...... 122 4.3 Identification and synthesis of potential immunogenic candidates 128 4.4 In vitro assessment of the immunogenicity of candidate proteins 133 4.6 Discussion ...... 140 Chapter 5: T. muris ELVs as a source of immunogenic material ...... 148 5.1 Chapter introduction ...... 149 5.2 ELVs can be isolated from T. muris ES by ultracentrifugation ..... 149 5.3 Mass spectrometry analysis shows that T. muris ELVs contain typical exosome markers and are enriched for proteins lacking a signal peptide ...... 151 5.4 Exosomes are able to fuse with colonic epithelial cells in vitro ... 154 5.5 Vaccination with T. muris ELVs can induce protective immunity and protection is dependent on intact vesicles ...... 156 5.6 Vaccination with ELVs boosts IgG1 serum antibody response to soluble ES components ...... 157 5.7 Identification of ELV components targeted by serum IgG antibodies following vaccination ...... 158 5.8 Discussion ...... 160 6 Summary discussion ...... 166 6.1 Identification of immunogenic candidates within T. muris ES ...... 167 6.2 Identification of immunogenic candidates within T. muris ELVs . 171 6.3 Other considerations for Trichuris vaccine design ...... 173 6.4 Conclusions and future perspectives ...... 175 References...... 177 Appendix 1...... 201 Appendix 2...... 205 Appendix 3...... 215

Word count: 40,277

4 List of Figures

Figure 1.1. Life cycle of T. muris…………………………………………………...19 Figure 1.2. Spectrum of immune responses to T. muris in different mouse strains...... 20 Figure 1.3. Immune response during acute T. muris infection………………….25 Figure 1.4. Biogenesis of exosomes……………………………………………....44 Figure 3.1. Preparation of ES by removing P43 using nickel affinity chromatography………………………………………………………………………74

Figure 3.2. Investigating the suitability of Superdex 75, Superdex 200 and Superose 12 gel filtration media for fractionating ES by size exclusion chromatography………………………………………………………………………75

Figure 3.3. Fractionation of ES using the 24 ml Superose 12 column…………77

Figure 3.4. Cellular immune response to pools 2-4 and unfractionated ES…..79

Figure 3.5. Anti-parasite IgG1 serum antibody response to pools 2 to 4 and unfractionated ES…………………………………………………………………….81

Figure 3.6. Western blots showing anti-parasite IgG serum antibody response for T. muris infected (A) and naïve (B) C57BL/6 mice……………………………82

Figure 3.7. Vaccination of male C57BL/6 mice with pools 2 to 4 or unfractionated ES induces protective immunity…………………………………..83

Figure 3.8. Anti-parasite IgG1 serum antibody response for mice vaccinated with pools 2 to 4 or unfractionated ES……………………………………………..85

Figure 3.9. Anti-parasite IgG2a serum antibody levels for mice vaccinated with pools 2 to 4 or unfractionated ES…….…………………………………………….87

Figure 3.10. Western blots showing anti-ES serum antibody response for the sham, pool 2, 3, 4 or unfractionated ES vaccination groups…………………….88

Figure 3.11. Vaccination with pool 3 or unfractionated ES can induce long- lasting protective immunity…….……………………………………………………90

Figure 3.12. Anti-parasite IgG1 serum antibody levels following long-term vaccination and subsequent infection…….………………………………………..91

Figure 3.13. Anti-parasite IgG2a serum antibody levels following long-term vaccination and subsequent infection………..…………………………………….93

5 Figure 3.14. Proteinase K treatment of ES abrogates its protective properties……………………………………………………………………………...94

Figure 3.15. Worm burdens following transfer of serum from sham or ES vaccinated mice…….………………………………………………………………...94 Figure 3.16. Anti-parasite serum IgG1 and IgG2a antibody response for serum transfer groups…….………………………………………………………………….97

Figure 3.17. Fractionation of ES by anion exchange chromatography…....…..98

Figure 3.18. Worm burdens for male C57BL/6 mice vaccinated with ES sub-groups A to F…………………………………………………………………….99

Figure 3.19. Fractionation of pool 3 by anion exchange chromatography…...100

Figure 3.20. Worm burdens for male C57BL/6 mice vaccinated with pool 3 sub-groups A to D…….…………………………………………………………….101

Figure 3.21. Vaccination with L2 or adult ES can induce protective immunity……………………………………………………………………………..102

Figure 3.22. Western blots showing IgG antibody response to L2 and adult ES …….………………………………………………………………………………….103

Figure 3.23. SDS-PAGE separation of L2 and adult ES………………………104

Figure 3.24. Vaccination of male AKR mice with ES components protects against a subsequent high dose infection……………………………………….105

Figure 4.1. Cytokine production by infection-primed and naïve lymphocytes in response to stimulation with Superose 12 fractions 22 to 32………………….116

Figure 4.2. Cytokine production by infection-primed and naïve lymphocytes in response to Superdex 75 fractions 17 to 23……………………………………..123

Figure 4.3. Strategy for selecting immunogenic candidates for further investigation…….…………………………………………………………………...128

Figure 4.4. Purification of T. muris recombinant proteins……………………...131

Figure 4.5. Cytokine release by infection-primed and naïve lymphocytes following stimulation with recombinant proteins…………..…………………….134

Figure 4.6. Vaccination with recombinant T. muris proteins formulated with aluminum hydroxide does not induce protective immunity in male C57BL/6 mice …….………………………………………………………………………………….136

6 Figure 4.7. Vaccination with recombinant T. muris proteins formulated with Freund’s adjuvants or Montanide ISA 720 does not induce protective immunity in male C57BL/6 mice…….………………………………………………………..138

Figure 4.8. Vaccination with T. muris recombinant proteins induced production of IgG1 antibodies specific for these proteins…….…………………………..…139

Figure 5.1. Visualisation of ELVs isolated from T. muris ES………………….149

Figure 5.2. Size range of a typical T. muris ELV sample…….………………..150

Figure 5.3. Uptake of PKH26 labeled ELVs by colonic epithelial (HT-29) cells …….………………………………………………………………………………….155

Figure 5.4. Vaccination with T. muris ELVs induces protective immunity……156

Figure 5.5. IgG1 and IgG2a serum antibody response against ES following vaccination with ELVs..…….……………………………………………………....157

Figure 5.6. Western blots showing anti-ELV and anti-ES serum IgG response for sham, ELV and ES vaccination groups…….………………………………...158

Figure A1.1. Sequence for pCep-His vector used for expression of recombinant T. muris proteins.…….……………………………………………………………..201

Figure A2.1. BLAST search results for Ion trans 2 and Pfam-B 17708-domain containing protein (TMUE_s0066001200) …….………………………………...207

Figure A2.2. Anti-parasite IgG1 serum antibody levels for mice vaccinated with recombinant T. muris proteins formulated with Montanide ISA 720…………..208

Figure A2.3. Anti-parasite IgG2a serum antibody levels for mice vaccinated with recombinant T. muris proteins formulated with Montanide ISA 720…….209

Figure A2.4. Anti-parasite IgG1 serum antibody levels for mice vaccinated with recombinant T. muris proteins formulated with aluminum hydroxide…………210

Figure A2.5. Anti-parasite IgG2a serum antibody levels for mice vaccinated with recombinant T. muris proteins formulated with aluminum hydroxide……211

Figure A2.6. Anti-parasite IgG1 serum antibody levels for mice vaccinated with recombinant T. muris proteins formulated with Freund’s adjuvants…………..212

Figure A2.7. Anti-parasite IgG2a serum antibody levels for mice vaccinated with recombinant T. muris proteins formulated with Freund’s adjuvants……..213

Figure A2.8. Vaccination with T. muris recombinant proteins induced production of IgG2a antibodies specific for these proteins…………………….214

7 Figure A3.1. BLAST search results for T. muris TSP-1 domain containing protein (TMUE_s0070003500) …….……………………………………………..215

Figure A3.2. Worm burden and IgG1/IgG2a serum antibody response for ES titration experiment…….…………………………………………………………...216

List of Tables

Table 2.1. Description of mouse strains and infection dose used for experiments described in this thesis……………………………………………….50

Table 2.2. Mascot search criteria…….…………………………………………….55

Table 4.1. List of identified proteins with peak abundance around Superose 12 fractions 24 to 27…….…………………………………………………………..…118

Table 4.2. List of identified proteins with peak abundance around Superdex 75 fractions 20 to 22. …….……………………………………………………………125

Table 4.3. List of potential immunogenic candidates…….……………………..128

Table 5.1. List of exosome markers identified in T. muris ELV samples……..151

Table 5.2. List of shared ELV and ES proteins …...….…...……………………152

Table 5.3. Possible identities of ELV components targeted by IgG antibodies following vaccination…….……………………………………………………….…159

Table A1.1. List of proteins identified within adult T. muris ES………………...CD

Table A1.2. List of proteins identified within pool 1……………………………..CD

Table A1.3. List of proteins identified within pool 2………………………...…...CD

Table A1.4. List of proteins identified within pool 3……………………………..CD

Table A1.5. List of proteins identified within pool 4………………………...…...CD

Table A1.6. List of L2 larval ES protein……………………………………...…...CD

Table A2.1. Mass spectrometry analysis of recombinant Serpin…….……….205

Table A2.2. Mass spectrometry analysis of recombinant Lactoglutathione lyase ………………………………………………………………………………………..205

Table A2.3. Mass spectrometry analysis of recombinant Translationally controlled tumour protein…….………….…………………………………………205

8 Table A2.4. Mass spectrometry analysis of recombinant TPD52 domain containing protein…….………………………………………………………….....206

Table A2.5. Mass spectrometry analysis of recombinant Hypothetical protein ………………………………………………………………………………………..206

Table A2.6. Comparison of protein sequences for T. muris immunogenic candidates with T. trichiura homologues…………………………………………206

Table A2.7. BLAST search results for T. muris Ion trans 2 and Pfam-B 17708- domain containing protein (TMUE_s0066001200). ………….…………………207

Table A3.1. List of T. muris ELV proteins………………………………………...CD

Table A3.2. BLAST search results show that there is significant homology between the T. muris TSP-1 domain containing protein (TMUE_s0070003500) and S. mansoni proteins…….…………………………………………………….215

Table A3.3. BLAST search results for T. muris Vacuolar protein sorting associated protein (TMUE_s0093001800) …….………………………………..217

9 Abbreviations

ABTS 2, 2'-azino-bis (3-ethylbenzthiazoline)-6-sulphonic acid Alix Apoptosis linked gene 2 interacting protein X 1 ANOVA Analysis of variance BCA Bicinchoninic acid BCIP 5-bromo-4-chloro-3-indolyl phosphate BSA Bovine serum albumin CaCl2 Calcium chloride cDNA Complementary DNA CFA Complete Freund’s adjuvant CO2 Carbon dioxide DC Dentritic cell dH2O Distilled water ddH2O Double-distilled water DIR Drug induced resistance DLS Dynamic light scattering DMEM Dulbecco’s modified Eagle’s medium DTT Dithiothreitol DNA Deoxyribonucleic acid ELISA Enzyme-linked immunosorbent assay EM Electron microscopy ES Excretory/secretory product without P43 and ELVs ES+P43 Native excretory/secretory product EV Extracellular vesicle ELV Exosome-like vesicle FBS Foetal bovine serum HCl Hydrochloric acid HEK293 Human embryonic kidney 293 His Histidine IFA Incomplete Freund’s adjuvant IFN-γ Interferon gamma Ig Immunoglobulin IL Interleukin ILV Intraluminal vesicle LC-MS Liquid chromatography-tandem mass spectrometry MACS Magnetic affinity cell sorting MHC Major histocompatibility complex mRNA Messenger ribonucleic acid miRNA Micro ribonucleic acid MLN Mesenteric lymph node MS/MS Tandem mass spectrometry MVB Multi-vesicular body Mw Molecular weight

10 MWCO Molecular weight cut off NaCl Sodium chloride Na2CO3 Sodium carbonate NBT Nitro blue tetrazolium P43 Poly-cysteine and histidine tailed protein isoform 2 PBS Phosphate buffered saline PBST 0.05% v/v Tween 20 in PBS PCR Polymerase chain reaction p.i. Post infection Ripa Radioimmunoprecipitation assay RNA Ribonucleic acid RPMI Roswell park memorial institute medium SA-POD Streptavidin peroxidase SCID Severe combined immunodeficiency SDS Sodium dodecyl sulphate SIV Simian immunodeficiency virus SDS-PAGE Sodium dodecyl sulphate-polyacrylamide gel electrophoresis SEM Standard error of mean STH Soil-transmitted helminth TBST Tris-buffered saline-Tween TFE Trifluoroethylene TGF Transforming growth factor Th T helper cell TLR Toll-like receptor TNF-α Tumour necrosis factor α Treg T regulatory cell TSP Tetraspanin Tween 20 Polyoxyethylene(20)sorbitan monolaurate

11 Abstract

Soil-transmitted helminths are a major cause of morbidity for humans and their livestock. A combination of better sanitation, anthelminthic drugs and vaccines are predicted to reduce the morbidity of these parasites in humans. The drugs currently used to treat these infections, albendazole and mebendazole, are fairly ineffective against Trichuris trichiura (human whipworm), and there are reports of drug resistance arising within parasite populations in Vietnam and Zanzibar. There are also no commercially available vaccines against human STH species, and very few against their veterinary counterparts. The murine whipworm, T. muris, has been used for over 50 years as a model for T. trichiura. These parasites share homology at the genomic and transcriptomic levels, and the immune responses associated with both acute and chronic infection have been well studied using the T. muris mouse model.

T. muris excretory/secretory products have been studied in the context of vaccination for over four decades, however relatively little progress has been made towards identifying the molecular components that stimulate protective immunity following vaccination or during acute infection. Here, a stringent selection protocol was developed using chromatography and mass spectrometry methods combined with a measurement of T cell cytokine production. The work presented in this thesis provides a novel framework for identifying potential immunogenic candidates within adult T. muris excretory/secretory products. Exosome-like vesicles isolated from adult T. muris ES were also explored as a source of host protective material. Vaccination with exosome-like vesicles protected male C57BL/6 mice from a subsequent low dose infection, which would ordinarily progress to chronicity, and a number of potential immunogenic candidates were identified.

Over the course of this thesis, several important observations were made relating to characteristics of the immune response induced by vaccination with ES. Firstly, proteinaceous material is likely to be responsible for the host protective properties of ES. Secondly, vaccination with ES products stimulates long-lasting immunity. Thirdly, vaccination with ES collected from both larval and adult stages stimulates protective immunity. The number of potential immunogenic candidates has also been narrowed down from over four hundred to just eleven. Given the homology between T. muris and T. trichiura at both the genomic and transcriptomic levels, this work has the potential to advance vaccine design for T. trichiura and other Trichuris parasites.

12 Acknowledgements

First and foremost I would like to thank my supervisors, Dave and Richard for the continued help and guidance throughout my PhD. Thank you for being such supportive supervisors and for making the PhD so enjoyable. I am also grateful to the Wellcome Trust for funding this project.

I want to thank Dr Allison Bancroft for the excellent training and invaluable discussions over the years and Dr Caroline Ridley for teaching me everything I know about chromatography and protein purification.

Thank you to all members of the Thornton and Grencis labs for the useful advice I have received in lab meetings and for keeping me smiling throughout the PhD.

I want to thank my friends – old and new – particularly the Come Dine With Me girls, who have helped make so many fun memories.

Lastly, I’d like to thank my parents and Rory for their continued love, support and motivation.

13 Declaration

I declare that that no portion of the work referred to in this thesis has been submitted in support of an application for another degree or qualification at this or any other university or institute of learning.

The author of this thesis (including any appendices and/or schedules to this thesis) owns certain copyright or related rights in it (the “Copyright”), and she has given The University of Manchester certain rights to use such Copyright, including for administrative purposes.

Copies of this thesis, either in full or in extracts and whether in hard or electronic copy, may be made only in accordance with the Copyright, Designs and Patents Act 1988 (as amended) and regulations issued under it or, where appropriate, in accordance with licensing agreements which the University has from time to time. This page must form part of any such copies made.

The ownership of certain Copyright, patents, designs, trademarks and other intellectual property (the “Intellectual Property”) and any reproductions of copyright works in the thesis, for example graphs and tables (“Reproductions”), which may be described in this thesis, may not be owned by the author and may be owned by third parties. Such Intellectual Property and Reproductions cannot and must not be made available for use without the prior written permission of the owner(s) of the relevant Intellectual Property and/or Reproductions.

Further information on the conditions under which disclosure, publication and commercialisation of this thesis, the Copyright and any Intellectual Property and/or reproductions described in it may take place is available in the University IP Policy (see http://documents.manchester.ac.uk/display.aspx?DocID=24420), in any relevant Thesis restriction declarations deposited in the University Library, The University Library’s regulations (http://www.library.manchester.ac.uk/about/regulations/) and in The University’s policy on Presentation of Theses.

Chapter 1: Introduction

15 1.1 Gastrointestinal nematodes: their prevalence, disease burden and the need for prophylactic vaccines

Gastrointestinal nematodes are a major source of morbidity in humans and their livestock (1). The four main species of clinical relevance are the hookworms Necator americanus and Ancylostoma duodenale, the roundworm Ascaris lumbricoides, and whipworm Trichuris trichiura (2, 3). Infections occur following the ingestion of embryonated eggs (A. lumbricoides and T. trichiura) or after contact with larvae (hookworms) in the soil, hence why these parasites are also known as soil-transmitted helminths (STHs) (2, 3). These parasites are endemic in many parts of tropical and subtropical Africa, Asia and Central America (2, 4). Over a billion people are infected with one or more STH, and estimates for the disease burden of these parasites range from 4.5 to 39 million disability adjusted life years (5, 6). STH infections have a profound effect on school attendance and economic productivity in endemic areas, and the combined morbidity of these infections is equal to that of malaria, tuberculosis or HIV, yet they receive comparatively little research attention (2, 7).

For T. trichiura, heavy worm burdens are associated with Trichuris dysentery syndrome, symptoms of which include stomach pain, chronic, bloody diarrhea, and in extreme cases, rectal prolapse (8). Population studies demonstrate that the distribution of worm burdens is highly overdispersed, meaning that the majority of people harbour low-level infections, while relatively fewer people have heavy worm burdens (9, 10). In endemic areas, T. trichiura infections are acquired from a young age, with 90% of children under 5 infected (9). Infection rates remain high across each age group, with 85% of 40 year olds infected (9, 10). Studies have also been carried out to investigate re-infection rates following anthelminthic treatment (9, 10). These reports demonstrate that people with low-level infections tend to acquire low-level infections following anthelminthic treatment, whereas individuals with high worm burdens tend to acquire high worm burdens (9, 10). These data suggest a direct relationship between initial worm burden and worm burden upon re-infection, which may

16 suggest that some people are naturally more resistant to T. trichiura than others (9, 10).

The major anthelminthics used to treat STH infections are the benzamidizole drugs, albendazole and mebendazole, which bind to and inhibit nematode β-tubulin, preventing microtubule depolymerisation and killing the worm over a number of days (2). Some studies have shown that treating children regularly with anthelminthics as part of mass drug administration programs has a positive effect on children’s iron levels and physical development (11-13), however, a more recent meta-analysis found that a single dose of albendazole or mebendazole has poor efficacy against T. trichiura, and that treatment with benzamidazoles alone had little impact on hookworm-associated anaemia (7, 14). Combining albendazole with praziquantel did however improve haemaglobin levels in hookworm patients with moderate anaemia (11). Recently a new class of anthelminthics, the dihydrobenz[e][1,4]oxazepin-2(3H)- ones have been shown to have in vitro and in vivo efficacy against T. muris (14, 15). This suggests that new anthelminthic drug treatments may be available in the near future, however studies show that post-treatment rates of re-infection are high, and that drug treatment may prevent the development of protective immunity (16-19). There is also evidence of benzamidazole resistance arising, based on field studies carried out in Vietnam and Zanzibar (20, 21).

A combination of anthelminthic drugs, vaccines and improvements to sanitation are predicted to reduce the morbidity of STHs (22). There are currently no anthelminthic vaccines licensed for use in humans, however there are two hookworm vaccine candidates undergoing clinical trials, and several pre-clinical vaccine candidates for schistosome species and A. lumbricoides (3, 22-27). Comparatively little progress has been made towards identifying vaccine candidates for T. trichiura, although vaccination with material excreted/secreted by the parasite (known as ES) has been shown to stimulate protective immunity in a number of mouse models (19, 28, 29). In addition, a recent paper showed that vaccination of mice with recombinant serine/threonine phosphatase 2A

17 (from Angiostrongylus costaricensis) linked to a synthetic lipid, oleic-vinyl sulphone, lead to expulsion of an established T. muris infection in AKR mice (30). These advances will be discussed in section 1.3.

1.2 T. muris as a model for T. trichiura

The approach used in this thesis to identify vaccine candidates for Trichuris parasites will focus on identifying T. muris antigens that induce protective immunity in mice. T. muris is a naturally-occurring murine parasite that has been used for decades as a model for T. trichiura (31, 32). The T. muris model has enabled researchers to dissect the immune responses associated with acute (resolving) and chronic infection (reviewed in section 1.2.2) (31, 33). There is extensive homology between the genome and transcriptome of T. muris and T. trichiura (33), and therefore the work presented in this thesis has the potential to advance vaccine design for T. trichiura and other Trichuris parasites.

1.2.1 The life cycle of T. muris

Trichuris species are transmitted via the faecal-oral route, and the host is infected following the ingestion of embryonated eggs in contaminated food, water or soil (31). The eggs hatch upon reaching the caecum in response to specific microbial cues, releasing the first stage larvae, L1, which burrow into the caecal epithelium using the stichosome at the anterior end of the worm (31, 34). The burrowing of larvae into the epithelium leads to the formation of structures resembling syncytial tunnels, and the parasite appears to be in direct contact with the cytoplasm of host cells throughout the infection (35). The larvae grow outwards into the lumen and undergo four moults to become adults. Adult worms have a characteristic whip-like shape, with a thin anterior that is embedded in the caecal epithelium, and a thick

18 posterior that protrudes out into the lumen to facilitate mating (31). The parasite is dioecious, and females release eggs into the caecal lumen following mating. These eggs are expelled in the faeces and must undergo a period of embryonation outside the host before they are infective (Figure 1.1) (31).

Lumen

Ingestion of Day 9-11 p.i. embryonated eggs L2 larvae 90 mins Lamina propria Eggs hatch in caecum, L1 larvae burrow into epithelium

L3 larvae

Mating produces eggs, which are expelled in the faeces Adult L4 larvae Day 32 p.i.

Figure 1.1. Life cycle of T. muris. Infection occurs via the faecal-oral route. Eggs hatch in the host caecum releasing L1 larvae, which burrow into the caecal epithelial crypts. Larvae undergo four moults to become adults at the time points specified on the diagram. Male and female worms mate and eggs are released into the caecal lumen, where they exit the host in the faeces. Eggs must undergo a period of embryonation before they are infective. P.i. = post- infection.

There are over 50 species within the Trichuris genus, and each species has a specific mammalian host (34). Egg hatching is triggered by host body temperature and is reliant on the host microflora, which may explain why these parasites reside in the caecum and colon, where the largest number of bacteria are found within the body (34). Hayes and co-workers showed that treating mice with antibiotics prior to and during T. muris infection lead to a reduction in worm burden, while incubating embryonated eggs with faecal explants or with various laboratory strains of bacteria and yeast triggered egg hatching over a period of 30 minutes to 18 hours. The authors found that bacteria cluster at the opercula, the sticky plugs at either end of the egg, which is also where the worm emerge (34).

19 1.2.2 Immune response during acute and chronic T. muris infection

Studies with inbred mice and gene knock out animals have been key for dissecting the immune responses associated with acute and chronic T. muris infection (31, 36). These studies have highlighted the role of host genetics, gender, infection dose, and parasite strain in the relative resistance/susceptibility to infection (Figure 1.2) (31, 36).

Unable to expel high and low dose infections.

Possible to induce resistance by vaccination with ES. Susceptibility Resistance Th2 SCID (42) AKR (19, 29) C57BL/6 (48) BALB/c (39, 42, 48) NUDE (39) Unable to expel low dose Unable to expel both high infection. (200 eggs) and low (20 eggs) dose infections. Able to expel high dose infection.

Figure 1.2. Spectrum of immune responses to T. muris in different mouse strains. Diagram was constructed based on published data (references in brackets) and observations from our laboratory.

The importance of T cells during T. muris expulsion was recognised as early as 1974 by Wakelin and Selby, who demonstrated that thymectomised and irradiated NIH mice were unable to expel worms, but that transferring MLN cells or thymocytes from untreated animals could reverse this (37). Lee and colleagues also showed that transferring T cell (but not B cell) enriched lymphocyte populations from T. muris infected CBA/Ca mice protected naïve mice of the same strain from a subsequent T. muris infection (38). Ito and co-workers reported similar findings, showing that transferring splenocytes or thymocytes from wild type BALB/c mice led to T. muris expulsion in normally susceptible athymic Nude mice (BALB/c background) (39). Researchers recognised a specific role for CD4 T cells in worm expulsion by demonstrating that depleting these cells using neutralising antibodies rendered wild type

20 BALB/c mice susceptible to T. muris infection, while depleting CD8 T cells had no effect (40). Depleting natural killer T cells also had no effect on the susceptibility of B10.BR mice to T. muris (40, 41). Similarly, researchers found that transferring CD4 T cells from wild type BALB/c to SCID mice, which lack both B and T cells, resulted in worm expulsion (42).

It is well known that different CD4 T helper (Th) cell subsets are associated with acute and chronic T. muris infection. Naturally susceptible strains such as AKR mice, and resistant strains such as BALB/c have been key in dissecting these responses (31, 36). Worm expulsion is brought about by Th2 cells, which secrete IL-4, 5, 9, 10 and 13, whereas Th1 cells, which secrete IFN-γ, are associated with chronic infection (31, 36). The interplay between these Th1/Th2 cytokines is emphasised by studies whereby depleting IFN-γ or administering recombinant IL-4 enabled worm expulsion in AKR mice, while blocking IL-4 function rendered BALB/k mice susceptible to T. muris infection (43). These studies highlight the influence of host genetics on the relative resistance/susceptibility to T. muris infection. The effector mechanisms that bring about worm expulsion in response to Th2 cytokine release will be discussed in section 1.2.3.

In addition to host genetics, gender is known to influence worm expulsion. For example, male and female IL-4 deficient mice (BALB/c background) respond differently to T. muris infection. Females have delayed worm expulsion relative to wild type mice, whereas males are unable to expel worms, leading to chronic infection (44). Bancroft and colleagues showed that this gender difference was due to IL-13, as depleting IL-13 in female IL-4 deficient mice lead to chronic infection, whereas administering recombinant IL-13 allowed male IL-4 deficient mice to expel worms (44). Another example of gender differences in T. muris expulsion is evident in TNF-α (p55/p75) deficient mice. As with IL-4 deficient mice, female p55/p75 deficient mice (C57BL/6 background) are resistant to infection, while males are susceptible. This gender difference can be reversed by neutralising IL-13 in female mice or by IL-13 treatment of males (45). These studies also emphasise the importance of the Th2 cytokine, IL-13, in driving

21 worm expulsion and suggest that male mice naturally produce less IL-13 than females (44, 45).

Further studies showed that sex hormones are responsible for the gender differences in worm expulsion reported for IL-4 deficient mice. Hepworth and co-workers showed that the androgen dihydrotestosterone is associated with a reduction in T cell activation by dendritic cells (DCs) and a diminished immune response in male IL-4 deficient mice (46). This effect was reversed when males were castrated, enabling mice to expel worms. Lower levels of IL-18 mRNA were reported in castrated mice, suggesting that androgens may promote a Th1 environment (47). The authors showed that IL-18 neutralisation allowed male IL-4 deficient mice to expel worms (46) and administering recombinant IL-18 to C57BL/6 mice resulted in decreased IL-4 and IL-13 production (47). The female-related hormone 17-β-estradiol has also been shown to enhance Th2 responses in vitro (46).

Infection dose is also known to influence resistance/susceptibility to T. muris infection. Most laboratory strains, including C57BL/6 and BALB/c mice, are resistant to a high dose infection (200-400 eggs), typically expelling worms before they reach patency, however when given a low dose infection (10-40 eggs), these mice are unable expel worms, leading to long-lasting, chronic infection (48). The exceptions are AKR mice and immuno-compromised strains, such as SCID mice, which are unable to expel both high and low dose infections (49, 50). Interestingly, Bancroft and colleagues demonstrated that BALB/c and C57BL/6 mice are protected from a low dose T. muris infection if it is preceded by a high dose infection, while mice are susceptible to a high dose if a low dose is administered first (48). The authors also showed that it is possible to induce resistance by giving multiple low dose infections (known as a trickle infection regime) once a critical worm threshold is reached. These data suggest that antigen dose can affect T helper cell polarisation and ultimately the outcome of T. muris infection (48).

Similar findings were reported for wild house mice and field mice (51). Behnke and Wakelin demonstrated that laboratory-bred wild mice expelled high dose

22 T. muris infections, while low dose infections progressed to chronicity (51). They also sampled a population of wild house mice, and showed that the majority had low-level infections, while 6 female mice harboured larger worm burdens (51). The authors suggest that the larger worm burdens in female mice may be attributed to an altered immune response due to pregnancy and/or lactation (51). Human population studies also demonstrate that the majority of individuals have low-level infections (9, 10), and this is reflected in the cytokine response following re-stimulation of blood leukocytes with T. trichiura antigens, since IL-4, IL-5 and IL-9 production was restricted to a small proportion (7 to 17%) of the study group, while a larger proportion (32 to 96%) produced IL-10, IFN-γ and TNF-a (52). These studies demonstrate that the observations made with laboratory strains of mice reflect natural infection in wild populations (51), and mirror the infection dynamics described for T. trichiura within human populations (9, 10).

Different T. muris isolates can also affect the host immune response. Most inbred mouse strains are able to expel a high dose of the Edinburgh (E) and Japan (J) isolates, but may be susceptible to the Sobreda (S) isolate (31). The S isolate appears to abrogate Th2 immunity, by increasing IFN-γ production, leading to higher titres of anti-parasite serum IgG2a (53, 54). A more recent study found that mice infected with the S isolate had higher numbers of regulatory T cells (Tregs) compared to those infected with the E isolate (55). However, the E isolate has been used in the experiments reported in this thesis.

1.2.3 Mechanisms of T. muris expulsion

The IL-4 and TNF-α knock out studies described in the previous section emphasised the importance of the Th2 cytokine, IL-13, for T. muris expulsion (44, 45). IL-13 is known to stimulate a number of effector mechanisms that drive worm expulsion, including de novo production of the intestinal mucin, Muc5ac, and increasing the rate of epithelial cell turnover (56, 57). Another important effector mechanism is intestinal muscle hyper-contractility, which is brought

23 about by the Th2 cytokine, IL-9 (58). This cytokine is also responsible for the mastocytosis and IgE production observed during gastrointestinal nematode infections, while IL-5 and CCL11 induce eosinophilia (59-62). Although the intestinal influx of these cells is considered a hallmark of gastrointestinal nematode infections, these responses appear to be dispensable for T. muris worm expulsion (59-62). This section will examine the effector mechanisms induced by Th2 cytokines during T. muris infection and will discuss the relative contribution of these to worm expulsion. These are summarised in Figure 1.3.

24 Damage caused by worm burrowing into epithelium may stimulate release of IL-25, IL-33 and TSLP

IgG1

Uptake and processing of IL-33 IL-25 antigen by APCs TSLP IgG1

Early sources of Th2 cytokines APC

IgG1 ILC2 IL-4 IL-13 IL-9 IL-5 IL-13 NK cells IL-4 IL-4 IL-4 IL-4 Baso IL-5 IL-13 IL-9 IL-4 IL-4 IL-4 Antigen presentation and IL-4 Eosino Thn activation of T cells

Polarisation towards Th2 Activation of B cells by T cells phenotype due to IL-4 in local environment A proportion of B cells become antibody-secreting plasma cells Eosinophilia Intestinal hypercontractility Antibody class switching and IL-5 production of anti-parasite IgG1 Mastocytosis, IgE Th2 IL-4 in response to Th2 cytokine IL-9 IL-13 IL-9 environment IL-13 Mucus production IL-4 IgM Setd7 RELM-β Epithelial escalator BB cecellll

IgG1

Figure 1.3. Immune response during acute T. muris infection. Damage caused by T. muris burrowing into the host epithelium may stimulate release of alarmins, such as IL-25, IL-33 and TSLP. ILC2s release Th2 cytokines in response to these alarmins, along with basophils, eosinophils and NK cells. Antigen presenting cells (APCs) such as DCs phagocytose antigens (such as ES components). Antigens are processed and presented to naïve T cells on MHC class II (MHCII). T cell activation occurs if the T cell receptor recognises antigen presented on MHCII, and T cells become polarised towards the Th2 phenotype due to high levels of IL-4 in the local environment. IL-9 and IL-13 trigger effector mechanisms (purple boxes), leading to worm expulsion. In addition, activated T cells can provide a second signal for activation of B cells. A proportion of B cells become antibody-secreting plasma cells. Antibody class switching (towards IgG1) occurs in response to Th2 cytokines. Anti-parasite IgG1 antibodies recognise native antigens in ES (top of figure).

25 1.2.3.1 Mucus production and other goblet cell secretions

The intestinal mucus barrier is the first line of defense against gastrointestinal nematodes (36). Mucins are the main components of mucus and are responsible for its gel-like properties. Muc2 is the major intestinal mucin, and is produced by goblet cells (36). Goblet cell hyperplasia has been reported during T. muris, Nippostrongylus brasiliensis, Heligosomoides polygyrus and Trichinella spiralis infections (63-66). The importance of intestinal mucus for worm expulsion is clear from Muc2 deficient mice, which lack an effective mucus barrier and exhibit delayed T. muris expulsion compared to their wild type counterparts (67). During acute T. muris infection, the mucus layer thickens and production of Muc2 as well as the transmembrane mucins, Muc4 and Muc13 is increased (68). Resistant strains of mice (BALB/c and C57BL/6) also produce Muc5ac in the intestinal tract in response to T. muris infection. Muc5ac expression is normally restricted to the eyes, lungs and stomach and is absent from the intestine during homeostasis (56). Hasnain and colleagues demonstrated that Muc5ac deficient mice (C57BL/6 background) are unable to expel T. muris, despite generating a strong Th2 response, indicating that intestinal Muc5ac production is critical for worm expulsion (56).

Hasnain and co-workers demonstrated that intestinal Muc5ac production during T. muris infection was dependent on the cytokine IL-13 (Figure 1.3). The authors showed that IL-4 deficient mice (BALB/c background) produce Muc5ac in response to a high dose infection, enabling them to expel worms, whereas (IL-4R) deficient mice, which are unable to respond to both IL-4 and IL-13, fail to produce Muc5ac, and infection progresses to chronicity (56). The authors also used an ATP assay to measure the viability of worms following incubation with human MUC2 and MUC5AC produced by HT29 and LS174T cells in vitro. They reported a dose-dependent decrease in worm viability following incubation with MUC5AC, while MUC2 had no effect on worm viability. This suggests that MUC5AC/Muc5ac is a pharmacological agent that directly damages worms (56). De novo Muc5ac synthesis was also observed in wild type C57BL/6 mice following infection with N. brasiliensis and T. spiralis, while

26 Muc5ac deficient mice showed delayed expulsion of these parasites. However, the authors could not detect intestinal Muc5ac in C57BL/6 mice given a primary infection of H. polygyrus, a parasite that persists for months in most strains of mice (56). These studies suggest that Muc5ac plays a crucial role in the resolution of gastrointestinal nematodes infections (56).

Muc5ac also appears to contribute to the network properties and viscosity of the intestinal mucus. Hasnain and colleagues reported that the intestinal mucus of Muc5ac deficient mice is more porous than that of wild type mice, and proposed that the increased viscosity may be important for retaining anti-parasitic molecules, such as serine proteases and resistin-like molecule beta (RELM-β), which may also contribute to worm damage (68). The authors also found that during acute infection, a large proportion of goblet cell-associated mucins were sulphated, whereas during chronic infection the majority were sialylated (69). Hasnain and colleagues demonstrated that mucin sulphation is driven by IL-13, and that sulphate anion transporter-1 (Sat-1) deficient mice (C57BL/6 background) had significantly fewer sulphated goblet cell-associated mucins. The authors found that high dose infections progressed to chronicity in Sat-1 deficient mice, despite a strong Th2 response (69). These studies demonstrate an important role for mucins in influencing mucus barrier properties and driving worm expulsion.

IL-13 also induces RELM-β secretion by goblet cells during T. muris infection. As with Muc5ac, Artis and co-workers demonstrated that IL-4 deficient mice produce RELM-β during acute infection, whereas IL-4R deficient mice do not (63). The authors demonstrated that RELM-β binds to the bacillary band of T. muris, specifically binding to pore structures that may contain chemosensory apparatus (63). The authors also demonstrate that RELM-β impairs chemoattractant-driven migration of Strongyloides stercoralis L3 larvae in vitro. Taken together, this suggests that RELM-β may impair the chemosensory functions of T. muris such that the worm is less equipped to navigate the intestinal environment, which may in turn contribute to worm expulsion (63). However, Nair and co-workers demonstrated that T. muris is expelled from

27 RELM-β deficient mice and reported an alternative role for RELM-β in promoting Th1 immunity during infection through activating inflammatory macrophages (70, 71). These experiments suggest a less important (or even a negative) role for RELM-β in T. muris expulsion (70, 71). Herbert and colleagues found that RELM-β inhibited the feeding of H. polygyrus on host tissue in vivo, and that this molecule plays an important role in H. polygyrus and N. brasiliensis expulsion, but had no effect on T. spiralis viability (71). These studies suggest that RELM-β may contribute to the expulsion of luminal, but not tissue-dwelling, gastrointestinal nematodes.

1.2.3.2 Increased rate of epithelial cell turnover

The rate of epithelial cell turnover in the caecum is also increased in response to IL-13 during acute T. muris infection (Figure 1.3) (57). For BALB/c mice, the rate of turnover peaks at day 14 post infection (p.i.), which coincides with parasite expulsion, whereas the turnover rate in AKR mice, where infection progresses to chronicity, is half that of BALB/c mice. Cliffe and colleagues showed that the epithelial turnover rate for IL-13 deficient mice (BALB/c background) was lower than for wild type BALB/c mice, suggesting that IL-13 is responsible for the increased turnover (57). They found that the chemokine CXCL10 has a negative affect on the rate of turnover in AKR mice, and that blocking CXCL10 with antibodies allows AKR mice to expel worms effectively through an increase in cell turnover (57). This suggests that during acute infection, IL-13 counteracts the regulatory effect of CXCL10 on epithelial cell turnover, which contributes to worm expulsion (57). Cliffe and colleagues also showed that blocking CXCL10 significantly increased the rate of turnover in SCID mice, enabling worm expulsion despite a lack of T cells and lower levels of IL-13. The authors propose a model whereby increasing the rate of turnover acts as an ‘epithelial escalator’, moving worm-embedded epithelial cells from the crypts towards the lumen, where the cells are shed and worms are then expelled from the body (57).

28 Oudhoff and colleagues recently reported that Setd7 deficient mice (C57BL/6 background), which lack the lysine methlytransferase, Setd7, have increased resistance to T. muris (72). The authors found that Sedt7 deficient mice were able to expel a high dose T. muris infection at an earlier time point compared to their wild type counterparts, with 75% fewer worms at day 14 p.i. compared to wild type mice. They provide evidence to suggest that Sedt7 controls intestinal epithelial cell turnover through methylation of members of the Hippo and Wnt signalling pathways, and that the rate of turnover is increased in Setd7 deficient mice, enabling rapid worm expulsion (72). The authors showed that worm expulsion in Setd7 deficient mice was independent of adaptive immunity, as Setd7/Rag-1-/- mice were able to expel worms despite a lack of B and T cells (albeit not to the same degree as Setd7-/- mice). Oudhoff and co-workers found that specifically deleting Setd7 in intestinal epithelial cells rendered mice more resistant to high and low dose T. muris infections, but had no effect on H. polygyrus expulsion (72). These experiments are strongly supportive of epithelial cell turnover as an important effector mechanism for expulsion of gut epithelial-dwelling nematodes and suggest that manipulation of the Sedt7 pathway can increase resistance to Trichuris parasites (72).

1.2.3.3 Intestinal muscle hyper-contractility

Another effector mechanism that contributes to T. muris expulsion is intestinal hyper-contractility, mediated by intestinal smooth muscle cells (Figure 1.3) (58). Khan and co-workers demonstrated that treating C57BL/6 mice with IL-9 during the early stages of infection (day 7 or 14 p.i.) increased intestinal contractility and promoted earlier expulsion of both T. spiralis and T. muris (58). The authors also showed that stimulating splenocytes from T. spiralis infected animals with IL-9 led to increased IL-4 and IL-13 production in vitro, and that IL-9 increased mucosal mast cell protease-1 levels and goblet cell hyperplasia in T. spiralis infected animals (58). Furthermore, they showed that blocking IL-9 function, either by treating mice with anti-IL-9 antibodies or by vaccinating against IL-9, significantly impaired muscle contractility and nematode expulsion in T. muris

29 infected mice, but had no significant effect on T. spiralis infected mice. T. muris and T. spiralis reside in different niches within the intestine (caecum and upper small intestine respectively), which might explain these differences (58).

1.2.3.4 Mast cells and IgE production

IL-9 is also responsible for the mastocytosis and IgE response that accompany gastrointestinal nematode infections, however these do not appear to play major roles in T. muris worm expulsion (62). Lee and colleagues showed that NIH mice (a resistant strain) expel worms ten days before mastocytosis develops (73), while Betts and co-workers demonstrated that blocking mast cell development with anti-c-kit antibodies (c-kit is the major transcription factor required for mast cell development) did not impair worm expulsion (59). Koyama and colleagues also concluded that mucosal mast cells are not required for T. muris expulsion from studies with mast cell deficient W/Wv mice (74).

1.2.3.5 IgG antibody production and B cells

In addition to IgE, acute T. muris infections are associated with anti-parasite IgG1 class switching, while IFN-γ promotes IgG2a production, particularly during chronic infection (75). Early studies suggested a role for antibodies in generating immunity to T. muris (76, 77), however a more recent study has suggested a role for B cells in Th2 cytokine production (78). Blackwell and colleagues described a susceptible phenotype for B cell deficient μMT mice (C57BL/6 background), reporting that MLN-derived lymphocytes harvested from these mice produced very low levels of Th2 cytokines in response to antigen re-stimulation (78). The authors demonstrated that administration of anti-IL-12 neutralising antibodies enabled μMT mice to expel worms, suggesting that the susceptible phenotype of these mice is a result of an inability to block a Th1 immune response, presumably through diminished Th2 cytokine release (78).

30 The authors show that transferring anti-parasite IgG1 antibodies from naturally resistant NIH mice enabled μMT mice to expel worms (78). However, given that resistance can be induced in SCID mice (deficient in B and T cells) by transferring CD4 T cells alone, it would seem that B cells and antibodies play a minor role in generating immunity to T. muris (50).

1.2.3.6 Innate lymphoid cells and other early sources of Th2 cytokines

Recently there has been great interest within the field of immunology in understanding the molecular events that bridge innate and adaptive immunity, particularly concerning the cell populations that are responsible for the initial increase in cytokines that drive T cell polarisation (36). Innate lymphoid cells (ILCs) are likely to be important in this process. ILCs are divided into three groups: group 1 includes type 1 ILCs and natural killer cells, which secrete IFN-γ, group two refers to type 2 ILCs (also known as ILC2s), which secrete Th2 cytokines, and group 3 includes Rorγt+ type 3 ILCs and lymphoid tissue inducers, which both secrete IL-17 and IL-22 (79). ILC2s are the most relevant in terms of gastrointestinal nematode expulsion as these secrete Th2 cytokines (particularly IL-5 and IL-13) in response to epithelial derived IL-33, IL-25 and thymic stromal lymphopoietin (TSLP) (36). Basophils and NK cells are also thought to be an early source of Th2 cytokines during gastrointestinal nematode infection (80-83).

IL-33, IL-25 and TSLP are all upregulated in the intestine during early gastrointestinal nematode infection (84). IL-33 and IL-25 behave similarly during gastrointestinal infection – mice deficient in either cytokine have impaired (85-87) or delayed (88, 89) worm expulsion, and treating susceptible AKR mice with recombinant IL-33 or IL-25 during early infection enhances Th2 immunity and worm expulsion (84, 87). However, neither cytokine could prevent a chronic T. muris infection developing in SCID mice, suggesting that these cytokines are dependent on adaptive immunity to exert their anti-nematode functions (84, 87). IL-25 is known to induce multi-potent progenitor type 2 cells, which secrete Th2

31 cytokines during early infection (90), while TSLP appears to neutralise the effects of IFN-γ and IL-12/23, which indirectly enhances Th2 immunity (91).

1.2.3.7 Regulation of the immune response during T. muris infection

Chronic T. muris infection can lead to severe intestinal inflammation, resulting in changes to gut architecture and physiology similar to those observed during inflammatory bowel disease (92). IL-10, TGF- and Tregs are thought to regulate the immune response in order to minimise intestinal damage (31). The importance of IL-10 in regulating inflammation during T. muris infection is emphasised by the severe pathology seen in IL-10 deficient mice (C57BL/6 background), with mice eventually succumbing to infection (93). An IL-35- dependent subset of Tregs, iTR35, has also been implicated in regulating inflammation during T. muris infection (94). These cells lack the typical Treg transcription factor, Foxp3, and are thought to suppress intestinal inflammation through IL-35 secretion in the absence of IL-10 and TGF- (94).

There is also some evidence to suggest that TGF- regulates the development of Th2 immunity. Veldhoen and colleagues show that TGF- can re-program Th2 cells so that they no longer express GATA-3 (the transcription factor associated with Th2 cells) or express the signature Th2 cytokines IL-4, IL-5 and IL-13, but instead secrete high levels of IL-9 (95). This re-programming fails to occur in CD4dnTGFβRII mice (C57BL/6 background), which have a truncated form of the TGF- receptor II, rendering them unresponsive to this cytokine. These mice have delayed worm expulsion, suggesting that TGF- mediated re-programming is involved in the resolution of infection (95). In contrast, Worthington and colleagues showed that TGF- signalling interferes with the development of Th2 immunity during the early stages of a low dose infection, leading to production of an inappropriate Th1 response and chronic infection (96). These studies show that the role of IL-10, TGF- and Tregs during T. muris infection is complex, however, these factors do not appear to play a major role in worm expulsion.

32 1.3 Clinical and pre-clinical helminth vaccine candidates

As outlined at the start of this thesis, a combination of better sanitation, anthelminthic drugs and prophylactic vaccines is predicted to reduce the morbidity caused by STHs in humans (22). This section will review the progress made towards identifying vaccine candidates for medically important helminths, including N. americanus, A. lumbricoides, T. trichiura and Schistosoma species. Highly effective recombinant vaccines have been developed for some cestode species, including Taenia solium, a porcine cestode that causes neurocysticercosis in humans (97, 98).

1.3.1 Hookworm vaccine candidates

The identification and development of vaccine candidates for N. americanus, which is thought to cause the majority of hookworm infections worldwide, is led by the human hookworm vaccine initiative (HHVI). This group was set up with the aim of identifying vaccine candidates from both the L3 larval and adult stage of the parasite (99, 100). The rationale for targeting the L3 larval stage is based on the success of a radiation-attenuated L3 larval vaccine for the canine hookworm, A. caninum in the 1970s (100). The first vaccine candidate to reach clinical trials was N. americanus Activation Secreted Protein-2 (Na-ASP-2), which is one of the most abundant antigens secreted by L3 larvae (101). Recombinant Na-ASP-2 was expressed by yeast and insect cells, and proof-of- principal animal studies showed that vaccinating hamsters and dogs with the recombinant protein prior to hookworm infection resulted in reduced worm burdens (101, 102). There were no noticeable side effects when a cohort of young healthy adults was vaccinated with recombinant Na-ASP-2 in the United States, however when humans were vaccinated in endemic areas in Brazil, three of the seven adults developed urticaria, an allergic reaction in the skin, within two hours of vaccination (103). This appeared to be due to high levels of pre-existing anti-Na-ASP-2 IgE antibodies resulting from prior infection, which led to an immediate hypersensitivity type reaction. The adverse reaction to the

33 vaccine led to the clinical trial being terminated and the antigen was abandoned (103).

An alternative recombinant vaccine is now being developed, consisting of two proteins, N. americanus aspartic protease-1 (Na-APR-1) and N. americanus glutathione-S-transferase-1 (Na-GST-1), formulated with an aluminum hydroxide adjuvant (100). The candidates are being tested separately in clinical trials, with the ultimate aim of administering these proteins together as a single vaccine (100). Both candidates were selected based on their putative role in the breakdown of host haemoglobin by adult stages in the gut to provide the parasite with iron. Na-APR-1 is a 24 kDa aspartic protease that digests haemoglobin, whereas Na-GST-1 is a 45 kDa glutathione-S-transferase that detoxifies haem (100). These candidate proteins are being expressed in yeast and tobacco plants respectively, however, for safety reasons the Na-APR-1 has been modified so that its proteolytic activity is removed (100, 104-106). Vaccination of laboratory animals with the modified recombinant Na-APR-1 has been shown to protect against subsequent infection by inducing neutralising antibodies that target the native hookworm enzyme, meaning that the parasite is unable to digest host haemoglobin (106). This also led to a reduction in iron loss during infection (106). Similar results have been reported for Na-GST-1 (107).

An effective hookworm vaccine should reduce the number of gut-dwelling parasites such that symptoms (namely anaemia) are reduced, however the HHVI team argue that this may be possible without achieving sterilising immunity (99, 100). These pre-clinical results are therefore very encouraging, and the two recombinant proteins are now being tested in combination in a phase II clinical trial in Gabon, having successfully completed phase I trials in the US and Brazil (107). Clinical studies are also being carried out to assess whether using an additional adjuvant, such as the synthetic Toll-like receptor (TLR) 4 agonist, glucopyranosyl, or the TLR9 agonist, CpG oligodeoxynucleotide, can induce better protection (107).

34 1.3.2 Pre-clinical Ascaris vaccine candidates

The porcine roundworm, A. suum, is often used as a model for A. lumbricoides. These species are antigenically identical, and the life cycle of these parasites involves the migration of larvae from the small intestine to the lungs via the portal and systemic circulation. A. suum can complete this part of its life cycle in rodents such as mice and rabbits, which are often used as experimental models of A. suum infection in place of pigs (22). A number of Ascaris vaccine candidates have been identified by antibody-based screening methods using sera from immunised rabbits or pigs. Some of these candidates have been tested in Ascaris challenge models, including As14 and As16, which are 14 and 16 kDa-sized proteins found in Ascaris ES material and worm homogenate. Vaccinating mice intranasally with recombinant forms of these proteins formulated with cholera toxin B subunit resulted in a 60% reduction in migrating larvae (108, 109). Two other candidates of unknown function, As24 and As37 were also identified by antibody-based screening methods, and vaccinating mice with recombinant forms of these proteins formulated with Freund’s complete adjuvant (CFA) reduced migrating larvae by 58 and 69% respectively (22, 110-112). Finally, a DNA vaccine coding for a glycolytic enzyme, As-Enol-1, has been demonstrated to reduce the lung larval burden by 61% in vaccinated mice (113, 114).

1.3.3 Experimental Trichuris vaccines

In the 1980s, Jenkins and colleagues demonstrated that the ES material released by the mouse whipworm, T. muris, could stimulate protective immunity in mice (28). They showed that vaccinating NIH mice subcutaneously with 100 μg of ES formulated with either aluminum hydroxide or CFA promoted earlier expulsion of a high dose infection (around 70-75% reduction in worm burden at day 9 p.i. compared to sham vaccinated mice) (28). The authors also demonstrated that subcutaneous vaccination was more effective than peritoneal vaccination – mean worm burden was reduced by 70% compared to sham

35 vaccinated controls when mice were vaccinated subcutaneously with 100 μg of ES (formulated without adjuvant), compared to 33% for intraperitoneal vaccination. Jenkins and others have shown that subcutaneous vaccination with worm homogenate (formulated with CFA) induced similar levels of protection as ES, and that oral vaccination with worm homogenate formulated with cholera toxin could also induce protective immunity in BALB/c and C57BL/6 mice (115, 116).

Jenkins and colleagues demonstrated that ES can be fractionated into a number of smaller sub-groups using ammonium sulphate precipitation and isoelectric focusing. They vaccinated NIH mice with the resulting sub-fractions, and assessed worm burdens at day 9 p.i., to determine which fractions contained protective material. They found that vaccinating mice with material precipitated with 85-100% ammonium sulphate or at pH 6.9 to 7.3 lead to a significant reduction in worm burden compared to sham vaccinated mice at day 9 p.i. (28). Similar approaches were used in this thesis to fractionate ES into a smaller sub-fractions based on the size and charge of its components. The immunogenicity of these sub-fractions has been tested using in vitro assays and vaccination experiments, and mass spectrometry has enabled the identification of proteins within the immunogenic sub-fractions.

More recent studies show that subcutaneous vaccination of AKR mice with 100 μg of T. muris ES formulated with either aluminum hydroxide or incomplete Freund’s adjuvant (IFA) induced expulsion of a high dose infection in this naturally susceptible strain (19, 29). Dixon and colleagues demonstrated that subcutaneous vaccination of AKR mice with ES formulated with CFA increased Th2 cytokine production by MLN lymphocytes following infection, compared to sham vaccinated controls (29). The authors also report increased goblet cell hyperplasia and an influx of alternatively activated macrophages, offering clues about the protective immune response following vaccination (29).

36 Sequencing of the T. trichiura and T. muris transcriptomes identified a number of functional groups that are upregulated in the anterior end of the worm, which is postulated to be the site of ES release (33). These include proteases, particularly chymotrypsin-like serine proteases, protease inhibitors/WAP domain containing proteins, and DNases. As such, these proteins may be of interest to vaccine research. T. muris has 75 genes encoding chymotrypsin-like serine proteases, which is more than the other nematodes studied to date (33). Three-quarters of these are upregulated in the anterior portion of the worm and two-thirds are secreted (33). Hasnain and colleagues have demonstrated that serine proteases released in T. muris ES are able to degrade Muc2, the major component of the mucus barrier, which may alter the barrier properties, allowing the worms to persist to chronic infection (117). Foth and colleagues suggest that by altering the environment in such a way, Trichuris proteases may be targeted by the host immune system, as part of the evolutionary arms race between pathogen and host (33).

Foth and colleagues also report that 72% of the 111 T. muris protease inhibitors are serine protease inhibitors (serpins) and many of these are WAP domain- containing proteins (33). Mammalian secretory leukocyte protease inhibitor protein (SLPI) is a WAP protein and has several additional functions, including anti-inflammatory, anti-microbial and immunomodulatory roles, as well as roles in innate immunity and wound healing (33). As such, Foth and colleagues suggest that the T. muris WAP proteins could have similar additional functions (33). The archetypal WAP domain is composed of eight cysteine residues arranged in a 4-disulphide core, however only one of the T. muris WAP proteins contains this typical structure and this is also true for T. trichiura (33). Interestingly, this protein shares some homology to Caenorhabditis elegans mesocentin, a protein that gives an RNA interference phenotype (33), suggesting that this Trichuris protein could perhaps play an immunomodulatory role. The remaining 19 T. muris WAP proteins have a novel structure consisting of a six cysteine core, which raises the possibility that these proteins carry out Trichuris specific functions, and as such may be key targets for the host immune system (11).

37 Transcripts for several DNases were upregulated at the anterior end of T. muris, however, aside from one exception, these share little homology with mammalian DNases and are only distantly related (33). This was also the case for T. trichiura and the closely related tricephalid parasite, Trichinella spiralis, which suggests that these DNases could carry out nematode-specific functions (33). An interesting suggestion put forward by Foth and colleagues is that these DNases degrade host DNA which is released when the epithelium is damaged as a result of worm burrowing, a process which would normally stimulate an inflammatory response (33). It is of course beneficial for Trichuris species to minimise inflammation and immunopathology to allow prolonged infection (118). These DNases also warrant further investigation as vaccine candidates due to their possible role in promoting chronicity.

Gomez-Samblas and colleagues have recently identified a vaccine candidate with immunoprotective properties against a number of helminth parasites, including T. muris (30). The candidate is a recombinant serine-threonine phosphatase 2 enzyme from the nematode A. costaricensis, and is linked to a synthetic self-adjuvant oleic-vinyl sulphone group. The authors showed that vaccinating AKR mice with this protein induced expulsion of established T. muris infection. The group also showed that egg output was reduced as early as 7 days following vaccination (30). The ability of this recombinant subunit vaccine to drive expulsion of a chronic infection is interesting, as it would suggest that the vaccine is potent enough to reverse an ongoing Th1 response (30). This is an important consideration for vaccinating people in endemic areas, as they are likely to be infected from an early age and could be infected prior to vaccination (2). This candidate protein has also been shown to induce protective immunity against ovine helminth species, namely Haemonchus contortus and Teladorsagia circumcincta (119).

38 1.3.4 Schistosome vaccines

There are several schistosome vaccine candidates in clinical or pre-clinical trials. Although schistosomes are trematodes (flatworms) rather than nematodes (roundworms), these vaccine candidates could still offer some useful insights for helminth vaccine design. The most advanced of these vaccine candidates is the S. haematobium glutathione-S-transferase, Sh28GST, which was deemed safe and effective in Phase I clinical trials (23). The other vaccine candidates target S. mansoni, the major cause of intestinal schistosomiasis. These candidates were identified using a protein array containing S. mansoni and S. japonicum proteins (27). IgG antibody responses to these proteins were measured for individuals with drug induced resistance (DIR) and rhesus macaques, which, unlike humans, are naturally resistant to schistosome infections (27). The term DIR refers to individuals who develop resistance to schistosome infection following praziquantel treatment (27). Praziquantel destroys flukes, which exposes the host immune system to a range of schistosome proteins that it may not normally come into contact with, and some individuals develop at least some level of resistance to subsequent schistosome infections (termed DIR). This resistance can last a year or more, and appears to correlate with anti-parasite IgG levels (27). Rhesus macaques naturally expel schistosome infections once the parasite reaches patency if worm burdens reach a certain threshold, and this expulsion mechanism is also thought to be antibody-mediated (27).

Pearson and co-workers have taken advantage of these phenomena to guide candidate selection (27). Serum IgG antibodies from DIR individuals and macaques recognised several proteins, including Smp80 (calpain), tetraspanins (such as Sm-TSP-1 and 2), glutathione-S-transferases, and glucose transporters (27). Out of these vaccine candidates, Sm-TSP-2 is currently undergoing Phase I clinical trials in the USA (23), while Sm80, Sm-TSP-1 and Sm29, all S. mansoni tegument proteins, are being evaluated in pre-clinical studies (23-26). The latter has been tested in non-human primates, and the authors showed that three vaccinations resulted in a 10-36% decrease in parasite burdens compared to sham vaccinated controls (26).

39 Another S. mansoni protein, the fatty acid binding protein, Sm14 was declared safe and effective in Phase I clinical trials in Brazil (120). Recombinant Sm14 was expressed in yeast, and healthy volunteers were vaccinated intramuscularly with 50 μg of protein plus a glucopyranosyl lipid adjuvant a total of three times. Vaccination induced anti-Sm14 IgG antibody production and a Th1 polarised CD4 T cell response (120). Interestingly, cross-reactivity between Sm14 and the Fasciola hepatica (an ovine liver fluke) F15 protein has been reported (121). Recombinant Sm14 was shown to induce protective immunity against F. hepatica in a murine model, as well as the natural host, sheep (121, 122). Other parasites of great medical and agricultural importance have been shown to express fatty acid binding proteins with homology to Sm14, including the canine tapeworm, E. granulosus, and the Chinese liver fluke, Clonorchis sinensis, suggesting that this vaccine candidate could be effective against several parasites of clinical and veterinary importance (123, 124).

1.3.5 Cestode vaccine candidates

Highly effective recombinant vaccines have been developed for a number of cestodes, including T. ovis, T. solium, T. saginata and E. granulosus (98). Antibody-based screening methods were employed to identify immunogenic candidates within the ES collected from Taenia oncospheres (the infective larval stage found within Taenia eggs) (92). The rationale for this approach was based on studies carried out in the 1930s, showing that vaccination with Taenia oncospheres induces protective immunity in a range of veterinary species, and the transfer of serum or colostrum from infected or vaccinated animals can protect naïve individuals from a subsequent infection (125-127). Several immunogenic candidates were identified by combining SDS-PAGE fractionation of oncosphere ES and immunoblot analysis, including To16, To18 and To45W (128, 129).

Previous studies also showed that there was significant cross-reactivity between the oncosphere antigens of different Taenia species (98). This was

40 reflected in vaccination experiments whereby antigens from one taeniid species were able to induce protective immunity against heterologous species, and passive transfer of immunity was achieved using immune sera raised against heterologous species (125-127). Homologues of To16, To18 and To45W were identified in T. solium (porcine tapeworm) and T. saginata (bovine tapeworm) oncospheres. Vaccination with recombinant Tsol18, the T. solium homologue of To18, was highly effective at protecting pigs against a subsequent T. solium infection (close to 100% protection), in both experimental settings and field studies (130, 131). However, unlike T. solium, vaccination with TSA-18, the T. saginata homologue of To18, was not sufficient to protect cattle against a subsequent T. saginata infection. However, vaccination with TSA-18 in combination with TSA-9 (the T. saginata homologue of To45W), resulted in 94 to 99% protection (132). These studies demonstrate that is possible to achieve close to 100% protection against a metazoan parasite by vaccinating with one or two recombinant antigens.

Antibody screening and fractionation methods were also used to identify a suitable vaccine candidate for E. granulosus, a 25 kDa protein called EG95 (98). Experimental vaccine studies showed that vaccinating sheep with EG95 resulted in 96-100% protection against E. granulosus (133, 134). A homologue of EG95 has been identified in E. multicularis, suggesting that it may be possible to develop an effective vaccine for this parasite, as well as other zoonotic Echinococcus species, as has been possible for Taenia species (98).

1.4 The role of adjuvants in vaccines Adjuvants are used to enhance the magnitude and breadth of vaccinations (135). Often, adjuvant usage means that less material is required in order to stimulate protective immunity (this phenomena is known as antigen sparing) and fewer vaccinations may be required to achieve an appropriate level of protection (135). A range of adjuvants are available, and these can be broadly divided into three classes: emulsions, immunostimulatory complexes (ISCOMs), and mineral salts (135). Freund’s adjuvants (CFA and IFA) are

41 amongst the most widely used adjuvants in experimental vaccines (135). These fall under the emulsions category and are very effective at inducing both B and T cell responses (135). However, CFA and IFA are not used in a clinical setting due to safety reasons (135). Since the advent of Freund’s in 1930s, safer alternatives have been developed, namely water-in-oil adjuvants such as Montanide ISA 51 and ISA 720, which have been licenced for use in humans (135). These adjuvants have been used with great success in pre-clinical and phase I clinical trials for vaccines against malaria, Epstein-Barr virus, hepatitis C virus and simian immunodeficiency virus (SIV) (136-141). Montanide ISA 720 was also used in pre-clinical studies with the schistosome vaccine candidate, cathepsin B, where vaccination reduced worm burden by 60% compared to sham vaccinated control mice (142). Other emulsion adjuvants include MF59, which is an oil-in-water adjuvant (like Freund’s) licenced for use in humans (135). This adjuvant forms part of a licenced influenza vaccine, and has been used in clinical trials for hepatitis B virus, herpes simplex virus and HIV (135).

Aluminum hydroxide is the most common mineral salt adjuvant (135). Like the majority of adjuvants, the exact mechanism by which aluminum hydroxide exerts its adjuvanticity is unknown (135). It was proposed that aluminum hydroxide acts as an antigen ‘depot’, allowing slow release of antigen over time (143). However, Hutchinson and colleagues showed that removal of the antigen ‘depot’ 2 hours after vaccination had no appreciable effect on antigen-specific T and B cell activation (144). Another study suggests that the damage caused by aluminum hydroxide causes cell death, leading to release of host DNA, which can act as a damage associated molecular pattern (DAMP) and drive immune cell activation through various Toll-like receptors (145). There is also some evidence that activation of the NLRP3 inflammasome by aluminum hydroxide mediates adjuvanticity (146-148).

Lastly, ISCOM adjuvants, such as QuilA, which is composed of a mixture of saponins from Quillaia saponaria, encapsulate antigens in 40 nm cages (135). These adjuvants stimulate potent CD8 T cell responses in mice and humans (149-151).

42 1.5 Extracellular vesicles as a source of antigenic material

Helminth vaccination studies have traditionally focussed on identifying antigenic proteins within parasite secretions or homogenates. However, there is increasing recognition of vesicular components within parasite secretions, and these have been somewhat overlooked in terms of identifying host protective components (152-154). Two recently published papers describe a protective role for parasite-derived extracellular vesicle (EV) vaccinations. Coakley and colleagues report a significant reduction in H. polygyrus worm burden and egg output when mice were vaccinated intraperitoneally with H. polygyrus exosome- like vesicles (ELVs) prior to infection, while Trelis and co-workers showed that subcutaneous vaccination of mice with Echinostoma caproni ELVs prior to infection lead to significant improvement of clinical symptoms and reduced mortality (155, 156). A sub-objective of this thesis was to investigate the potential of T. muris vesicular components as a source of protective antigens, and as such the following sections will provide an overview of exosome biogenesis, and will discuss the potential for helminth-derived EVs as vaccine candidates, immunomodulators and mediators of host-parasite communication.

1.5.1 Exosome biogenesis and isolation from biological samples

The three key types of EVs are exosomes, microvesicles and apoptotic bodies. These vesicles are mostly spherical in shape and are composed of a phospholipid bilayer with a protein/RNA core (157). Exosomes are the smallest type of EVs, ranging from 30 to 100 nm in size, and are formed via the endosomal pathway (157). Exosomes have been shown to play an important role in the transfer of proteins, messenger RNAs (mRNAs) and micro RNAs (miRNAs) between cells (158-161). This transfer can alter the behaviour of recipient cells, which may be of particular importance in the context of host- parasite interactions, where parasite exosomes have been shown to stimulate and/or modulate host immunity through ELV release (162-165). The first step in exosome biogenesis is the invagination of the plasma membrane to form

43 endosomes. The second step is the inward budding of the late endosomal membrane to form intraluminal vesicles (ILVs) inside a multivesicular body (MVB). These ILVs are released upon fusion with the plasma membrane, and once extracellular, they are referred to as exosomes (Figure 1.4) (132).

Figure 1.4. Biogenesis of exosomes. Exosomes are formed by the invagination of the endosomal membrane to form intraluminal vesicles (ILVs, yellow) inside a multivesicular body (MVB). These vesicles are released following fusion of the MVB with the plasma membrane. Once released into the extracellular environment, vesicles are referred to as exosomes. PM is plasma membrane.

Isolation of microvesicles and exosomes from biological samples is often carried out using differential ultracentrifugation. This involves centrifuging the material at progressively higher speeds, starting at around 200 g to pellet cells, followed by 10,000 g to pellet microvesicles and 100,000 g to pellet exosomes (166). This is considered the ‘gold standard’ for exosome isolation, however other methods include using density gradient centrifugation, size exclusion chromatography or commercially available kits (157, 163, 166). Isolation of exosomes and microvesicles is confirmed by electron microscopy, and where possible, by the presence of certain markers. Typical exosome markers include Alix, and TSG101, which are both involved in MVB biogenesis,

44 and tetraspanins such as CD9, CD63 and CD81, while CD40 is a key marker of microvesicles (157, 167).

1.5.2 Exosome release by parasitic helminths

Helminths are parasitic worms belonging to several phyla, including nematodes (roundworms), trematodes (flukes) and platyhelminths (flatworms) (168). There are examples in the literature of members of all three of these phyla secreting ELVs (152, 165, 169-171). The first examples of ELVs isolated from parasitic helminth species were E. caproni and F. hepatica (152). These were isolated from parasite ES by differential ultracentrifugation and contained roughly half of the proteins identified in the soluble portion of the ES produced by these parasites, suggesting that vesicle trafficking may be an important mechanism for releasing these proteins into the extracellular environment, especially those lacking a signal peptide (152). Host proteins were also detected in both E. caproni and F. hepatica ELVs, suggesting that these vesicles may enable two-way communication between the parasite and host. The authors found that E. caproni ELVs are internalised by rat intestinal epithelial cells (IEC-18), further suggesting that the parasite uses these vesicles to communicate with the host, delivering antigens and/or immunomodulatory components to host cells (152). More recently, Trelis and colleagues demonstrated that E. caproni ELVs have potential as vaccines, showing that vaccinating mice with these ELVs prior to infection reduced symptom severity and increased survival (156). Although there was no reduction in parasite burden compared to non-immunised mice, the authors show that ELV vaccination promoted IL-10 and TGF-ß production during infection, suggesting that the decrease in symptom severity may be as a result of the anti-inflammatory environment that ensues (156).

ELVs have also been isolated from Dicrocoelium dendriticum, S. japonicum and S. mansoni (169, 172, 173). S. japonicum ELVs have been shown to modulate the phenotype of RAW 264.7 macrophages in vitro, skewing the population

45 towards a classical M1 phenotype, with a significant increase in surface CD16/32 expression (a marker of classical macrophage activation), increased TNF-α production and elevated NO activity (169). Four of the top five most abundant proteins in S. mansoni ELVs are previously identified vaccine candidates – Sm-TSP-1, Sm29, saposin B domain-containing protein and cytoplasmic dynein light chain, suggesting that ELVs may be an important source of protective antigens (174-177). Triose phosphate isomerase and glyceraldehyde-6-phosphate dehydrogenase were also identified, both of which induce a protective response when recombinant forms were administered by vaccination (173). ELVs have also been isolated from S. mansoni schistosomula (the tissue migrating life cycle stage) ES products, and have been identified on the surface of cercariae, the free-swimming form that penetrates the mammalian host’s skin to initiate infection (178).

The first parasitic nematode known to release ELVs is the rodent intestinal parasite, H. polygyrus (165). The vesicles released by this parasite fit the definition of exosomes, as they are 50-100 nm in size, and the authors identified several known exosome markers associated with the vesicles, including Alix, enolase and HSP70. The authors report the presence of an Argonaute protein as well as several small RNAs, suggesting that the parasite may be able to alter host protein expression using RNA silencing, although the exact mechanism by which this occurs is yet to be determined (165). The authors demonstrate that H. polygyrus ELVs are internalised by murine epithelial cells in vitro, which would allow these small RNAs and Argonaut to be delivered to host cells (165). Buck and co-workers also show that H. polygyrus ELVs can modulate the inflammatory airway response to the fungal allergen, Alternaria alternata in vivo, by preventing the activation of ILC2s, thereby blocking eosinophil recruitment (165). More recently, Coakley and colleagues demonstrated that intraperitoneal vaccination with H. polygyrus ELVs prior to infection resulted in a significant reduction in worm burden compared to sham vaccinated controls (153).

Brugia malayi, which causes lymphatic filariasis, was the first human parasitic helminth shown to release ELVs (179). L3 larvae are transmitted by mosquitos

46 and migrate to the lymphatics, where they undergo two moults to become adults (179). The adults live in the lymphatic vasculature and are responsible for the morbidity caused by this parasite (179). Interestingly, ELV release appears to be primarily a feature of L3 larvae, with adult worms releasing far fewer ELVs. The larval ELVs were shown to contain a number of typical exosome markers including HSP70, enolase and elongation factor-1α (179). The authors report significant overlap with proteins identified in E. caproni and F. hepatica exosomes, and found several miRNAs with identical sequences to human miRNAs with known immunomodulatory functions, suggesting that this could be a mechanism used by the parasite to promote its own survival (179). The authors demonstrated that B. malayi ELVs are internalised by J774A.1 macrophages and stimulate an increase in granulocyte colony-stimulating factor, monocyte chemoattractant protein-1, IL-6, and macrophage inflammatory protein-2 production by these cells. This suggests the ELVs promote classical M1 macrophage activation, rather than the alternative M2 phenotype (179).

ELVs have been isolated from Trichuris spcies, as well as from the ovine parasitic nematode T. circumcinta and canine heartworm Dirofilaria immitis (154, 180-182). Hansen and colleagues report the presence of both ELVs and microvesicle-like structures in the secretory products of T. suis L1 larvae, and also observed vesicles budding from the surface of larvae (154). Tritten and colleagues isolated ELVs from adult T. muris ES, showing that these vesicles contain at least 14 parasite-derived miRNAs and 73 proteins (180), while Eichenberger and co-workers demonstrated that T. muris ELVs can fuse with murine colonic organoids in vitro (183).

These studies show that helminth ELVs may be a source of both immunomodulatory and antigenic material. The potential for T. muris ELVs as vaccine candidates will be investigated in this thesis.

47 1.6 Aims and objectives

Acquired immunity to T. muris is mediated by IL-13, derived mainly from Th2 cells (44, 184). Previous work shows that vaccination with material excreted by T. muris can induce protective immunity in a range of mouse models (19, 28). An ideal vaccine might include ES antigens that stimulate IL-13 secretion by Th2 cells. The aim of this thesis is to identify such antigens as a pipeline to develop anti-Trichuris vaccines. A stringent vaccination protocol involving subcutaneous vaccination of male C57BL/6 mice followed by administration of a low dose infection was developed in order to assess the immunogenicity of various native T. muris proteins and recombinant immunogenic candidates in vivo. A sub-objective was to explore the potential of T. muris ELVs as a source of anti-Trichuris vaccine candidates.

The specific objectives of this thesis are as follows: 1. Identify methods for fractionating T. muris ES into smaller sub-groups and assess the immunogenicity of these using in vitro assays and vaccination experiments. 2. Develop a stringent vaccination protocol to assess the efficacy of various ES vaccines. 3. Identify potential vaccine candidates using a proteomics approach and assess the immunogenicity of these proteins (in recombinant form) both in vitro and in vivo. 4. Investigate T. muris ELVs as a potential source of immunogenic components.

Chapter 2: Materials and methods

49 2.1 Maintenance of animals

C57BL/6 (Envigo), SCID and AKR mice (bred at the University of Manchester) were used for the experiments described in this thesis (Table 1). All mice were maintained in individually ventilated cages at 22oC ± 1°C and 65% humidity with a 12 hour light-dark cycle. Mice had free access to food and water, and all procedures were carried out on mice 6-8 weeks of age or older, under the Home Office Scientific Procedures Act (1986). Animals were humanely killed by

CO2 inhalation followed by terminal exsanguination or cervical dislocation.

Infection Strain Sex Use dose SCID Male/female High Adult ES collection C57BL/6 Male High L2 ES collection Studies involving acute infection (eg C57BL/6 Female High re-stimulation assays) C57BL/6 Male Low Vaccine studies AKR Male High Vaccine studies

Table 2.1. Description of mouse strains and infection dose used for experiments described in this thesis.

2.2 Maintenance of parasites, ELV removal and preparation of adult ES

The Edinburgh (E) strain of T. muris was used for all experiments. The parasite was maintained in SCID mice, which were infected with 400 T. muris embryonated eggs by oral gavage. Adult worms were harvested between 42 and 45 days p.i. Upon killing, the caecum of each animal was removed, cut open longitudinally, and the caecal content was removed by shaking. The worms were carefully removed from the caeca using forceps, and were transferred to clean petri dishes of RPMI media supplemented with 500 U/ml penicillin and 500 µg/ml streptomycin (all Sigma). Once all worms were removed, they were transferred to 6-well plates (Corning) with 4 ml media (plus antibiotics) per well, and were incubated at 37oC and 100% humidity. Media

50 was collected after 4 hours, and worms were transferred to fresh 6-well plates for overnight incubation in 6 ml media per well.

The next day, worms were removed from the overnight culture using sterile forceps. The 4-hour and overnight worm cultures were centrifuged at 720 g for 15 minutes to separate the eggs (pellet) from the ES (supernatant). The pellet was re-suspended in ultrapure water (ddH2O) and eggs were collected after passing through a 100 μm sterile cell strainer (Fisher Scientific). Eggs were allowed to embryonate in tissue culture flasks (Helena Biosciences) at room temperature in the dark for three to four months, and were stored under these conditions until required.

The ES was passed through a 0.22 μm filter (Millipore), and ELVs were removed by ultracentrifugation at 100,000 g for 2 hours in polyallomer tubes (Beckman Coulter, UK). The ELV pellet was washed by ultracentrifugation at 100,000 g for 2 hours in PBS. The poly-cysteine and histidine tailed protein isoform 2 (P43) was removed from ES samples using NTA-Nickel affinity beads (Qiagen). The ES was centrifuged at 2000 g to pellet the NTA-Nickel affinity beads and attached P43. Unless otherwise stated, ‘ES’ refers to samples that have undergone both ultracentrifugation and the P43 removal step, while ‘ES+P43’ refers to whole ES (with P43) that has not undergone these steps. These samples were stored at -20oC until required.

2.3 Preparation of larval ES

In order to collect ES from T. muris L2 larvae, male C57BL/6 mice were given a high dose T. muris infection and were killed at day 15 p.i. The caeca were removed, cut into small sections (approximately 5 mm in length) and incubated in PBS with 0.9% (w/v) NaCl for 2 hours at 37oC, with regular vigorous shaking to remove L2 larvae from the epithelium. Worms were individually isolated using a pipette, and were transferred to RPMI media supplemented with 500 U/ml

51 penicillin and 500 µg/ml streptomycin. Worms were transferred to fresh media o for overnight culture at 37 C, 5% CO2. L2 ES was collected after 72 hours, and was concentrated using a pre-washed Amicon Ultra 0.5 ml centrifugal filter with a 10 kDa molecular weight cut off (MWCO, Merck Millipore). PBS was added to dilute out the media, and this was then concentrated to approximately 200 µl.

2.4 Egg infectivity and dosage

The infectivity of each batch of eggs was tested prior to usage in experiments. SCID mice were infected with 400 eggs by oral gavage and worm burdens were assessed after 35-42 days. Infectivity was calculated as a percentage of embryonated eggs gavaged (typically between 45 and 60%).

Eggs were washed before each infection by pelleting eggs at 720 g for 15 minutes, pouring away the supernatant, and then re-suspending the eggs in ddH2O. To prepare eggs for a high dose infection, the washed eggs were diluted to 90-100 eggs per 50 μl, and mice were infected with 200 μl of the suspension by oral gavage, so that each mouse received approximately 200 infective eggs (48). For low dose infections, eggs were individually isolated using a pipette and mice were infected with 25 eggs in 200 μl ddH2O by oral gavage (48).

2.5 Quantification of worm burdens

Upon sacrifice, the caecum of each mouse was removed and worms were counted using a binocular dissection microscope (Leica).

52 2.6 Collection of sera Blood was collected post mortem by cardiac puncture. Serum was collected following centrifugation at 13,000 g for 15 minutes and stored at -20oC until required.

2.7 Anti-parasite IgG1 and IgG2a ELISAs

Unless otherwise stated, 96-well immunograde plates (Brand GmbH) were coated with ES+P43 diluted to 5 μg/ml in 0.05 M carbonate bicarbonate buffer (pH 7.6, 50 μl/well) (185). Plates were incubated at 4oC overnight in the dark. The following day, plates were washed three times with PBST (0.05% v/v Tween 20 in PBS) using a Skatron Scan washer 400 (Molecular Devices) and blocked with 3% (w/v) BSA (Melford) in PBST for 60 minutes. Serum was serially diluted in PBST from 1/20 to 1/2560, and this was added to the plates following another wash step (50 μl per well, 90 minutes incubation). Plates were washed in PBST, following which bound IgG1 and IgG2a were detected using biotinylated rat anti-mouse IgG1 (BioRad, 1:2000 dilution) and anti-IgG2a (BD Biosciences, 1:1000 dilution) respectively (50 μl per well, 60 minutes incubation). Following another wash step, streptavidin-peroxidase conjugate (Roche, 1:1000 dilution) was added (75 μl per well). Plates were washed for a final time before ABTS substrate (10% 2,2’azino 3-ethyl benzthiazoline in 0.045 M citrate buffer) was added (100 μl per well). Plates were read at 405 nm with a reference of 490 nm on a VersaMax microplate reader (Molecular devices, UK).

2.8 Lymphocyte re-stimulation assay

Female C57BL/6 mice were used for re-stimulation assays. These mice were given a high dose infection and sacrificed at day 20 p.i., which corresponds to peak Th2 cytokine response during acute infection (Bancroft, personal

53 communication). Age-matched naïve controls were also sacrificed. The mesenteric lymph nodes (MLNs) were removed and were transported back to the laboratory on ice in RPMI media supplemented with 2% FBS, 2 mM L-glutamine (GIBCO/Invitrogen), 100 U/ml penicillin, 100 µg/ml streptomycin (wash media). Each MLN was disrupted using the piston of a 2.5 ml syringe, and cells were passed through a 100 μm sterile cell strainer (Fisher Scientific) to make a cell suspension in wash media. The cell suspension was centrifuged at 430 g for 5 minutes to pellet the cells, the supernatant was removed and cells were re-suspended in 10 ml wash media. This wash step was repeated twice, and after the second time, the cells were re-suspended in 1 ml (for cells taken from naïve mice) or 2 ml (for cells from infected mice) RPMI supplemented with 20% FBS, 100 U/ml penicillin, 100 µg/ml streptomycin and 2 mM L-glutamine.

The number of cells in each sample was measured using a CASYcounter® (Scharfe systems) and the volume was adjusted to give a concentration of 1x107 cells/ml. For re-stimulation assays, the cells from three infected mice were pooled and the cells from two naïve mice were pooled in order to allow multiple antigen fractions to be tested. Cells were re-stimulated with various ES proteins diluted to 50 μg/ml in RPMI media supplemented with 100 U/ml penicillin, 100 μg/ml streptomycin in a 1:1 (v/v) ratio of cell suspension to o protein. Cells were incubated for 42 hours at 37 C and 5% CO2 in sterile 96-well flat bottom tissue culture plates (Corning). Plates were centrifuged at 430 g for 5 minutes to pellet cells and the supernatants were transferred to sterile 96-well round bottom tissue culture plates (Corning). Supernatants were stored at -20oC until required.

2.8.1 Measuring cytokine production in cell supernatants

Cytokine levels in the cell supernatants (see above) were measured by cytometric bead array, using a Mouse/Rat Soluble Protein assay kit (BD Biosciences). The kit contained wash buffer, assay diluent, capture bead diluent and detection reagent diluent. Cytokine-specific Mouse/Rat Soluble Protein Flex

54 Kits, each containing capture beads, detection reagent, and cytokine standards were purchased separately from BD Biosciences. Levels of the following cytokines were assessed: IL-6, IL-9, IL-10, IL-13, IL-17A, IFN-γ and TNF-α. To assess IFN-γ production, supernatants were diluted 1:10 with RPMI plus antibiotics.

Cytokine standards were prepared according to the manufacturer’s instructions and were serially diluted 2-fold from 2500 to 10 pg/ml in assay diluent. The serially diluted cytokine standards and cell supernatants were pipetted into individual wells of a pre-washed (with wash buffer) 96-well round bottom tissue culture plate (16.6 μl per well). Next, the capture beads were prepared in capture bead diluent. The volume to be prepared was determined by multiplying the number of test wells by 16.6 μl. Each test well received 0.33 μl of each capture bead in 16.6 μl capture bead diluent, so the volume of each bead to add to the capture bead diluent was determined by multiplying the number of test wells by 0.33 μl. Beads were vortexed for 10 seconds before they were added to the capture bead diluent and this was vortexed regularly as it was added to the plate (16.6 μl per well). Plates were incubated on a digital shaker (500 rpm) for 60 minutes at room temperature to allow capture beads to bind the samples.

The detection reagent was prepared in detection reagent diluent. As with the preparation of the capture bead reagent, the volume to be prepared was determined by multiplying the number of test wells by 16.6 μl. Each test well received 0.33 μl of each detection reagent in 16.6 μl detection reagent diluent, so the volume of each detection reagent to add to the detection reagent diluent was determined by multiplying the number of test wells by 0.33 μl. The detection reagent was mixed by gentle pipetting and 16.6 μl were added to each test well. Plates were incubated on a digital shaker (500 rpm) in the dark for 60 minutes at room temperature to allow detection reagents to bind.

Wash buffer was added to the test wells (150 μl per well), following which, plates were centrifuged at 430 g to pellet beads. Plates were tipped upside

55 down to remove wash buffer, following which 70 μl wash buffer were added to each well. The assay plates were read using a MACSQuant Analyzer 10 (Miltenyi Biotech) and data was extracted using FCAP array software, Version 3.01 (BD Bioscience).

2.9 Fractionation of adult ES

2.9.1 Fractionation of adult ES by gel filtration chromatography

Prior to fractionation, adult ES was dialysed in 25 mM Tris-HCl, 10 mM NaCl (pH 7.4) and concentrated by approximately 50-fold. All 2.4 ml columns (Superdex 75, Superdex 200 and Superose 12) were attached to an ӒKTA Ettan purification system (all GE Healthcare). Samples were injected and separated on the column at a flow rate of 0.05 ml/min. Protein was eluted in 0.05 ml fractions in 25 mM Tris, 10 mM NaCl (pH 7.4) and the column effluent was monitored for UV absorbance at 280 nm.

The 24 ml Superose 12 and Superdex 75 columns were attached to an ӒKTAprime plus purification system (all GE Healthcare). Samples were injected and separated on the column at a flow rate of 0.5 ml/min. Protein was eluted in 0.5 ml fractions in 25 mM Tris, 10 mM NaCl (pH 7.4) and the column effluent was monitored for UV absorbance at 280 nm. Unicorn software was used to control these fractionation processes, and elution profiles were viewed using the PrimeView software (GE Life Sciences). The protein content of the resulting fractions was separated by SDS-PAGE and gels were visualised using either Coomassie blue or silver nitrate staining (see section 2.10).

56 2.9.2 Fractionation of adult ES and pool 3 by anion exchange and gel filtration chromatography

Adult ES was also fractionated using a 2.4 ml MiniQ anion exchange column. This column was attached to an ӒKTA Ettan plus purification system, and fractionation was controlled by Unicorn software. Samples were injected onto the column and proteins were eluted by increasing the salt concentration of the buffer (25 mM Tris, pH 7.4) from 10 to 300 mM NaCl over 15 column volumes, followed by a gradient of 300 to 1000 mM NaCl over 8 column volumes.

Pool 3 (the product of pooling Superose 12 fractions 24-27) was further fractionated using a Resource Q anion exchange column. This column was attached to an ӒKTAprime plus purification system and proteins were also eluted by increasing the salt concentration of the buffer (25 mM Tris, pH 7.4) from 10 to 300 mM NaCl over 15 column volumes, followed by 1000 mM NaCl for 5 column volumes. The protein content of the resulting fractions was separated by SDS-PAGE and gels were stained using either Coomassie blue or silver nitrate staining (see section 2.10).

2.10 SDS-PAGE

SDS-PAGE was carried out using NuPage Novex 4-12% BisTris Mini-gels in 1x MOPs running buffer (both Invitrogen, Life Technologies). Samples were reduced in 10 mM dithiothreitol (DTT), 1 x NuPAGE LDS sample buffer (Invitrogen) and heated at 100oC for 5 minutes. Precision Plus Protein All Blue Standards (Bio-Rad Laboratories) were run along side samples, to enable molecular weight assessment of protein bands. Electrophoresis was carried out using XCell II Mini-cell electrophoresis tanks (Novex) at 200 V for 48 minutes. Protein bands were visualised using either Coomassie blue or silver nitrate staining.

57 2.10.1 Coomassie blue staining

Gels were washed briefly in dH2O, and were stained with InstantBlue

(Expedeon Ltd) for at least 1 hour. Gels were washed extensively with dH2O, and were imaged using a ChemiDoc MP Imaging system (Bio-Rad).

2.10.2 Silver staining of SDS-PAGE gels

Gels were washed briefly in dH2O, fixed for 20 minutes in 50% (v/v) methanol, 5% (v/v) acetic acid, and then rinsed in 50% (v/v) methanol for 10 minutes. Gels were washed for 10 minutes in dH2O, sensitised in 0.02% sodium thiosulphate for 1 minute, and were then washed in dH2O for 5 minutes. Gels were submerged in 0.1% (w/v) silver nitrate in dH2O for 20 minutes, followed by another wash step. Gels were developed in 0.04% (v/v) formalin, 2% (w/v)

Na2CO3 in dH2O. Once bands were visualised, development of gels was terminated using 5% (v/v) acetic acid. Gels were rinsed in dH2O and were imaged using a ChemiDoc MP Imaging system.

2.11 Assessing protein concentration of samples

Protein concentration was assessed using either a Nanodrop 1000 (Labtech International) or a bicinchoninic acid (BCA) assay kit (Fisher Scientific), according to the manufacturer’s instructions. For ELV samples, vesicles were lysed with 0.1% (v/v) SDS prior to assessment of protein concentration.

2.12 Western blotting

Samples were loaded onto NuPAGE Novex 4-12% BisTris mini gels alongside a protein ladder (Precision Plus Protein All Blue Standards if assessing serum

58 antibody binding, or Odyssey® One-Color Protein Molecular Weight Marker, Li-cor, if assessing His-probe binding) and electrophoresis was carried out as described in section 2.10. Electrotransfer of proteins from NuPAGE gels to nitrocellulose membrane was carried out using an XCell IITM semi-wet Blot Module (Invitrogen) run at 35 V for one hour with 20% (v/v) methanol, 1x NuPAGE® transfer buffer. Membranes were blocked with 5% skimmed milk (Marvel) in Tris-buffered saline-Tween (TBST; 10 mM Tris-base / 150 mM NaCl / 0.1 % (v/v) Tween-20, pH 8.0) for 15 to 30 minutes, and were then rinsed 4 times in TBST for a total of 20 minutes.

2.12.1 Western blotting using serum from T. muris infected mice

Following the block and washing steps, membranes were probed with serum from ES vaccinated and/or T. muris infected mice (1:300 dilution) overnight. The following day, membranes were washed in TBST for 20 minutes and bound antibody was detected using an anti-mouse IgG (whole molecule) alkaline phosphatase conjugated antibody (1:10,000 dilution in TBST, Sigma). Following a wash step in TBST for 20 minutes, immunoblots were revealed using chromogenic substrates, BCIP (5-bromo-4-chloro-3-indolyl-phosphate, 100% v/v in dimethylformamide) and nitro blue tetrazolium (NBT, 70% v/v in dimethylformamide) in a 1:2 ratio in TBST. Membranes were washed for 20 minutes in TBST and were imaged using a ChemiDoc MP Imaging system.

2.12.2 Western blotting to detect His-tagged recombinant proteins

Following the block and washing steps, membranes were probed with a His-probe (H-3 mouse monoclonal IgG1, Santa Cruz Biotechnology). Membranes were washed in TBST for 20 minutes, and bound His-probe was detected using an AlexaFluor 680 goat anti-mouse IgG (H+L) antibody (Life Technologies). Following a wash step in TBST for 20 minutes, His blots were

59 visualised at 700 and 800 nm using the Odyssey CLx infrared imaging system (LI-COR Biosciences).

2.13 Mass spectrometry and proteomic analysis of ES components

Samples were reduced with 20 mM DTT for 2 hours and alkylated with 50 mM iodoacetemide for 20 minutes in the dark. Ammonium bicarbonate was added to make a final concentration of 0.1 M, following which sequencing grade trypsin (Promega) was added at a ratio of 1:50 (trypsin to protein by weight), and samples were incubated at 37oC overnight. The resultant peptides were acidified to pH 2 with formic acid and purified using ZipTip desalting pipette tips (Millipore). ZipTips were pre-washed four times in acetonitrile, then six times in 0.1% (v/v) formic acid. The ZipTips were loaded with sample, washed eight times in 0.1% (v/v) formic acid, and then peptides were eluted using 50% (v/v) acetonitrile, 0.1% (v/v) formic acid. A centrifugal vacuum evaporator was used to dry the samples, and these were then re-suspended in 10 μl 5% (v/v) acetonitrile, 0.1% (v/v) formic acid.

The BioMS core facility team at the University of Manchester performed liquid chromatography-tandem mass spectrometry (LC-MS) on each sample using a NanoAcquity LC coupled to a LTQ Velos mass spectrometer, and the results were analysed using Mascot MS/MS ion search (Matrix Science, see Table 2.2 for search criteria) and searched against the T. muris proteome, version 2.2 (Sanger Centre). Scaffold Proteome Software (Scaffold, USA) was used to calculate the exclusive unique peptide count for each protein (criteria set to 95% protein threshold, 50% peptide threshold, minimum 2 peptides identified). The Sanger Centre FTP site (ftp://ftp.sanger.ac.uk/pub/project/pathogens/Trichuris/muris/genes/) was used to search for T. muris protein and cDNA sequences. The SignalP Server version 4.1 (http://www.cbs.dtu.dk/services/SignalP/, Technical University of Denmark) was used to predict whether proteins had signal peptides. The

60 homology between T. muris candidate proteins and those of other species was analysed using the BLAST protein search tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastp&PAGE_TYPE=Blast Search&LINK_LOC=blasthome, National Institute of Health).

Enzyme Trypsin Maximum Missed Cleavages 1 Carbamidomethyl Fixed modifications (C) Quantitation method None Variable modifications Oxidation (M) Peptide Mass Tolerance 1.2 Peptide Mass Tolerance Units Da Fragment Mass Tolerance 0.6 Fragment Mass Tolerance Units Da Mass values Monoisotopic Instrument type Default Isotope error mode 0

Table 2.2. Mascot search criteria.

2.13.1 Mass spectrometry analysis of T. muris ELVs

Mass spectrometry analysis of ELV samples was performed as described by Marcilla et al. (2012). ELVs were precipitated with 100 μl chloroform/methanol (1:1 ratio) and then dissolved in 50 μl 50% (v/v) trifluoroethylene (TFE), 50 mM ammonium bicarbonate. Samples were treated with 2 mM DTT for 30 minutes at 60oC, followed by 5 mM iodoacetamide for 30 minutes at room temperature (in the dark), and finally 10 mM DTT at room temperature for 30 minutes. The samples were diluted with 50 mM ABC such that the final concentration of TFE was <5%. Samples were incubated with 500 ng trypsin overnight at 37oC, following which samples were acidified using formic acid and peptides were

61 purified using a ZipTip step, as described in section 2.13. Samples were dried in a vacuum centrifuge, reconstituted in 10 μl 5% (v/v) acetonitrile, 0.1% (v/v) formic acid and mass spectrometry analysis was carried out as described above.

2.14 Vaccination studies

All vaccination studies were carried out using male C57BL/6 or AKR mice. Unless otherwise stated, mice were vaccinated subcutaneously with 30 μg of protein (either native ES proteins, or recombinant proteins) diluted in Tris buffer (pH 7.4), followed by a second vaccination 14 days later with 15 μg antigen. Vaccinations were formulated with aluminum hydroxide (1:1 v/v ratio of protein to adjuvant), and 100 μl was administered using a 25-gauge needle (BD Microlance). Vaccinations were prepared by adding aluminum hydroxide drop-wise to the antigen preparation on a digital shaker. The antigen/adjuvant solution was then mixed on a 360o rotator for approximately 40 minutes. For the recombinant proteins vaccination study, an additional group was included, whereby mice were vaccinated with each of the 5 recombinant proteins in a single vaccination, formulated with aluminum hydroxide (30 μg of each protein, 150 μg protein in total), followed by a second vaccination 14 days later (15 μg of each protein, 75 μg in total).

Vaccinations with Freund’s adjuvants and Montanide ISA 720 were prepared using two luer lock syringes and one I-connector. Material was pushed back and forth between the two syringes to produce a thick emulsion. Freund’s adjuvants were prepared in 1:1 dilution (v/v) of antigen to adjuvant; the first of the three vaccinations was formulated with CFA, while the second and third were formulated with IFA (both Sigma). Montanide ISA 720 vaccinations were prepared in 70:30 ratio (v/v) of adjuvant to antigen. All sham vaccinations were carried out by diluting adjuvant with Tris buffer (pH 7.4), according to the ratios stated above.

62 Mice were infected with 25 T. muris eggs 28 to 30 days after the first vaccination and were sacrificed at day 32 p.i., as this is when the worms reach adulthood and the infection is considered to have reached patency (31). Worm burdens were assessed, along with anti-parasite IgG1 and IgG2a serum antibody levels.

2.14.1 Proteinase K treatment of ES and subsequent vaccination

ES was denatured by heating at 95oC in 6M guanidinium chloride, 50 mM Tris (pH8), 5 mM DTT for 5 minutes. The denatured material was buffer exchanged to 50 mM Tris, 5 mM CaCl2 (pH 8.0) using a pre-washed Amicon Ultra 0.5 ml centrifugal filter (10 kDa MWCO) and 100 μg/ml proteinase K was added. The reaction was incubated overnight at 40oC and the following day, peptides were collected using a pre-washed Amicon Ultra 0.5 ml centrifugal filter (10 kDa MWCO). A small sample of the treated ES was separated by SDS-PAGE (gel stained with Coomassie blue) to confirm degradation. C57BL/6 mice were vaccinated subcutaneously with 30 μg of the digested material (protein concentration measured before proteinase K addition), followed by vaccination with 15 μg of material 14 days later (antigen diluted in Tris buffer, pH 8.0). As a negative control, a group of 3 mice were vaccinated with proteinase K in Tris buffer (pH 8.0) prepared as described above. All vaccinations were formulated with aluminum hydroxide as described in section 2.14.

2.14.2 Serum transfer from vaccinated to unvaccinated mice

C57BL/6 mice were vaccinated with ES formulated with aluminum hydroxide as described in section 2.14. These mice were sacrificed 14 days after the second vaccination and serum was collected as described in section 2.6. The serum was heated at 54oC for 30 minutes to inactivate cytokines and other serum proteins. Naïve C57BL/6 mice were injected intraperitoneally with 500 μl of

63 serum from ES or sham-vaccinated mice. These mice were infected with 25 T. muris eggs by oral gavage immediately following the serum transfer and were sacrificed at day 32 p.i. to assess worm burdens.

2.14.3 ELV vaccination studies

C57BL/6 mice were vaccinated subcutaneously with 3 µg of ELV material (formulated without adjuvant), followed by a second vaccination with 1.5 µg of material 14 days later. The sham group was vaccinated subcutaneously with 100 μl of PBS only. A positive control group was included, whereby mice were vaccinated subcutaneously with 30 μg ES, followed by 15 μg of ELV material 14 days later (vaccinations formulated with aluminum hydroxide as described in section 2.14). Mice were infected with 25 T. muris eggs 14 days after the second vaccination and were sacrificed at day 32 p.i. as described above.

Experiments were also carried out to determine the effect of vesicle lysis on ELV vaccinations. To do this, ELV samples were lysed by adding 0.1% (v/v) SDS, followed by three freeze/thaw cycles, whereby vesicles were frozen in liquid nitrogen and thawed in a 37oC water bath. ELV samples were vortexed between each step. Lysis was confirmed using dynamic light scattering (DLS, see section 2.16). Mice were vaccinated subcutaneously with 3 μg of lysed ELV material, followed by 1.5 μg of lysed ELV material 14 days later. Mice were subcutaneously vaccinated with unlysed ELV samples (as described above) as a positive control. Mice were infected with 25 T. muris eggs by oral gavage 14 days following the second vaccination and were sacrificed at day 32 p.i. to assess worm burdens.

64 2.15 DNA synthesis, transfections and collection of recombinant proteins

Immunogenic candidates were identified as described in Chapter 4. For each candidate, cDNA synthesis and cloning into the pCepHis vector, which encodes ampicillin and puromycin resistance genes, (see Figure A1.1 for full sequence) were carried out by Thermo Fisher Scientific Geneart GmbH. One Shot® TOP10 Chemically Competent Escherichia coli (Thermo) were transformed with each construct according to the manufacturer’s instructions. The bacteria were streaked out onto carbenicillin (Melford) antibiotic selection plates (0.1 mg/ml carbencillin in Luria broth, LB, agar) and left to grow overnight at 37oC. For each construct, a single colony was picked and this was grown overnight in LB. Bacteria were lysed and DNA was collected using the PureLink® Quick Plasmid Miniprep Kit (Thermo) according to the manufacturer’s instructions.

HEK293 EBNA cells were grown to 80% confluency in T75 flasks (Corning) for transfections. DNA-lipid complexes were prepared for transfections by adding 20 to 30 µg DNA and 30 µl lipofectamine 2000 (Life Technologies) to 3 ml Opti- MEM reduced serum media I (Thermo). DNA-lipid complexes were incubated for 12 to 15 minutes. Cells were washed in PBS (sterile) and were incubated o with the DNA-lipid complexes for 3 days at 37 C, 5% CO2, after which the transfection medium was collected and antbiotic selection with DMEM supplemented with 10% FBS, 100 U/ml penicillin, 100 µg/ml streptomycin and 0.5 μg/μl puromycin was commenced. Antibiotic selection was applied for 2-3 weeks to kill non-transfected cells and selection media was replaced twice a week. Following the 2-3 week antibiotic selection period, cells were grown in DMEM supplemented with 10% FBS, 100 U/ml penicillin, 100 µg/ml streptomycin and 0.05 μg/μl puromycin. Once cells were confluent, they were split into six T75 flasks using trypsin-EDTA solution (Sigma). Once these were confluent, cells were divided into three triple layer flasks to enable efficient protein collection. Once cells were fully confluent in the triple layer flasks, cells were washed with PBS and then the media was replaced with DMEM, high glucose, GlutaMAX™ Supplement media (Thermo) for protein collection. Media

65 was collected in 50 ml falcon tubes (Corning) twice a week. Medium was centrifuged at 2000 g for 5 minutes to pellet cells, following which medium was transferred to sterile bottles and stored at -20oC until required.

2.16 Purification of recombinant proteins

DMEM media containing recombinant protein was dialysed overnight with 20 mM Tris, 400 mM NaCl, 10 mM imidazole (pH 7.9) using BioDesignDialysis tubing with either 3,000 or 14,000 MWCO (Fisher Scientific). The buffer was changed the following morning to allow for thorough dialysis. The buffer containing the dialysed proteins was filtered using a 0.22 μm filter. Each protein was purified by nickel affinity chromatography, followed by size exclusion chromatography. For the nickel affinity step, protein was pumped through a HisTrap FF 1 ml column to enable the His-tagged recombinant proteins to bind. Bound protein was eluted using 200 mM imidazole followed by 500 mM imidazole (both in 20 mM Tris, 400 mM NaCl, pH 7.9) and protein was collected in 1 ml fractions. The fractions were separated by SDS-PAGE to determine in which fractions the recombinant proteins were eluted. Size exclusion chromatography was carried out on those fractions containing the recombinant protein, in order to further purify the protein and remove the imidazole.

The size exclusion chromatography step was carried out using a Superdex 75 gel filtration column and the AKTAPurifier protein purification system, under the control of Unicorn software. Fractions were analysed by SDS-PAGE and mass spectrometry analysis was carried out to confirm the identity of each purified recombinant protein. The fractions containing the recombinant protein of interest were pooled and concentrated. Proteins were stored at -20oC until required.

HEK293 cells were not able to express five of the recombinant proteins. In order to determine whether the proteins were expressed but not secreted, transfected

66 cells were lysed with Radioimmunoprecipitation assay (Ripa) buffer (Thermo Scientific). Western blotting was carried out to determine whether cell lysates contained His-tagged proteins corresponding to the predicted molecular weight for each protein.

2.17 TEM analysis of ELV samples

Samples were transferred to formvar-carbon-coated EM grids and negatively stained with 2% (w/v) uranyl acetate. Samples were imaged using a Tecnai BioTwin microscope, at 100 Kv under low-dose conditions. Images were recorded using a Gatan Orius CCD camera at 3.5 Å/pixel. ImageJ v1.46r (NIH) was used to view images and to add scale bars.

2.18 DLS measurements

DLS was used to identify the size distributions of the exosome preparations. DLS measurements were performed using a Zetasizer Nano-S (Malvern) at a controlled temperature of 25°C. Scattering at 90° gives rise to the z-average particle scattering intensity, which is deduced from the correlation function (186). Sample polydispersity was deduced from the slope of the correlation function and mean particle diameter from the diffusion coefficient according to Mie theory (186). The diffusion coefficient and therefore size of the particles were calculated using a refractive index of 1.39. Particle size was measured 13 times for each sample. The number distribution of particles was used to report the relative amounts of each peak distribution and this transformation assumes that all particles are spherical and that the sample density is homogenous (186).

67 2.19 ELV fusion assay

In order to determine whether ELVs could fuse with mammalian colonic epithelial cells, HT-29 cells were grown to 80% confluency in RPMI medium supplemented with 10% (v/v) FBS, 1% (v/v) L-glutamine, 100 U/ml penicillin and 100 µg/ml streptomycin on μ-slide 8-well Ibitreat plates (Ibidi). Once the cells were confluent, they were washed with sterile PBS (Sigma) and cells were starved of FBS for 16 hours. During this period, cells were incubated with RPMI supplemented with 1% (v/v) L-glutamine, 100 U/ml penicillin and 100 µg/ml streptomycin.

ELVs were labeled with PKH26 red fluorescent cell linker (Sigma) and excess dye was removed using exosome spin columns (Life Technologies), according to the manufacturer’s instructions. The labeled ELVs were incubated with the HT-29 cells for 4 hours. Cells were washed thoroughly in PBS to remove extracellular PKH26 labeled vesicles, and then imaged using a Swept Field confocal (Nikon), with a [60x/ 1.40 Plan Apo] objective on an inverted TE2000 inverted microscope. The settings were as follows, pinholes [30μm], scan speed [1400Hz or 100fps], format [512 x 512]. The PKH26-stained ELVs were excited with the 543 nm laser line and images were acquired on a Cascade 512B EM CCD camera (Photometrics) through the Elements Software (Nikon).

2.20 Graphing and statistical analysis

All graphing and statistical analysis was carried out using GraphPad Prism version 7. One-way ANOVA is a common way to compare three or more variables, however in order to carry out such an analysis, data must be normally distributed (187). For each experiment, a Shapiro-Wilk normality test was carried out to confirm that data was normally distributed. All experiments passed the normality test, which meant that one-way ANOVA (followed by a Dunn’s Multiple Comparison Test) was appropriate. Unless otherwise stated,

68 error bars represent SEM. Statistical significance is represented by * (P< 0.01), ** (P<0.05), *** (P< 0.001) or **** (P< 0.0001).

Chapter 3: Defining the host protective components within the soluble portion of T. muris ES

70 3.1 Introduction

With over 465 million people infected worldwide, T. trichiura is one of the four most clinically important STHs. Heavy worm burdens are associated with Trichuris dysentery syndrome, symptoms of which include stomach pain, diarrhoea and in extreme cases, rectal prolapse (2, 8). A combination of anti- helminthic drugs, sanitation improvements and prophylactic vaccines are predicted to reduce the morbidity associated with these infections (22). However a recent meta-analysis showed that the benzamidazole drugs currently used to treat STH infections have poor efficacy against T. trichiura, and there are reports of drug resistance arising within parasite populations in Vietnam and Zanzibar (20, 21, 188). In addition, there are no commercially available vaccines against human STH species, and few against their veterinary counterparts (3).

The naturally-occurring murine whipworm, T. muris, has been used for over 50 years as a model for T. trichiura (32). These parasites share extensive homology at the genomic and transcriptomic levels, and the immune responses associated with both acute and chronic infection have been well studied using the T. muris mouse model (31, 33). Infection dose can influence the relative resistance/susceptibility of mice to T. muris. Most standard laboratory strains are capable of expelling a high dose infection (200 eggs), while a low dose infection (10-25 eggs), which is more reflective of natural challenge, promotes an IFN-γ rich CD4+ T helper cell type 1 (Th1) response, leading to chronic infection and colitis (48). During acute infection, worm expulsion is driven by a Th2 response, and the Th2 cytokines, IL-9 and IL-13, are known to stimulate effector mechanisms that drive worm expulsion (31). These effector mechanisms include increasing mucus production and epithelial turnover in the caecum (IL-13), and inducing intestinal hypercontractility (IL-9) (57, 68, 189). Natural immunity is acquired during acute infection, and mice are protected against all subsequent infections (both high and low dose) (48).

71 Vaccination with ES collected from adult worms has previously been shown to protect naturally susceptible AKR mice against a subsequent high dose infection and promote earlier expulsion of an acute infection in NIH mice (19, 28, 115). However, relatively little progress has been made towards identifying the parasite antigens responsible for triggering expulsion, and crucially the potential for ES vaccinations to protect mice against a low dose infection, which is more reflective of natural infection and primes for chronicity (48), has yet to be investigated.

In this chapter, a stringent vaccination protocol in which to test various combinations of ES components was developed using a chronic infection model (low dose infection in male C57BL/6 mice). This was used in combination with an acute infection model (high dose infection in female C57BL/6 mice) in order to assess cytokine production and antibody response to various ES components in a setting where immunity is acquired in response to infection. Various chromatography media were investigated to fractionate adult T. muris ES, in order to narrow down the search for protective components.

Experiments were performed to investigate whether the protective properties of adult ES are dependent on the protein content, and whether vaccination with adult T. muris ES can induce long-lasting immunity. For the latter experiment, a low dose infection was administered to male C57BL/6 mice a total of 50 days following vaccine boost (as opposed to 14 days after, as was performed for the other experiments described in this chapter). This time point was chosen as it is generally accepted that in order for immunological memory to develop, a period of at least 30 days should have elapsed (190-192). Larval ES was also investigated as a source of protective antigens. For this experiment, ES was collected from larvae at day 15 p.i. (L2 stage), which is around the time that worms are expelled during acute infection (31). The protective capacity of larval ES vaccinations was compared to that of the adult ES vaccinations and proteomic analysis was also carried out in order to assess the similarities and differences between the protein content of the two ES collections.

72 The results of these experiments showed that vaccination with ES proteins (collected from the larval and adult stages) stimulates long-lasting protection against a subsequent low dose infection in C57BL/6 mice, and a sub-fraction of ES (pool 3) was identified as a potent source of protective antigens that will be investigated further in Chapter 4.

3.2 Preparation of T. muris ES for fractionation using gel filtration chromatography

T. muris ES contains a myriad of proteins, ranging from 10 to 250 kDa in size (Figure 3.1A). Unpublished data from our laboratory shows that the major ES component, a 43 kDa protein referred to as the P43 (indicated by red box on Figure 3.1A), is poorly immunogenic, and therefore the work presented here has focused on the other ES components. The P43 has a natural poly-histidine tag, enabling the removal of this protein from ES using nickel affinity chromatography (Allison Bancroft, University of Manchester, personal communication). To do this, ES was incubated with nickel beads on a rotator for two hours, after which it was centrifuged to pellet the beads (with captured P43, Figure 3.1B), and the supernatant (containing the other ES proteins) was removed for further study. For the purpose of this thesis, ‘ES’ refers to the material remaining after P43 removal (Figure 3.1C), while ‘ES+P43’ refers to the native form (Figure 3.1A). VivaSpin concentrators were used to concentrate and buffer exchange the ES to 25 mM Tris, 10 mM NaCl (pH 7.4), a buffer suitable for both size exclusion and anion exchange chromatography.

73 A) B) Fractions containing P43 eluted using C) kDa +P43 ES 250 mM imidazole ES kDakDa kDa kDa 1 2 3 4 5 6 7 8 250250 250250 150 250 150150 100100 150 100 100100 7575 75 75 50 75 50 50 37 37 5050 25 25 20 3737 15 20 2525 15 20 10 20 1515 1010 10

Figure 3.1. Preparation of ES by removing P43 using nickel affinity chromatography. The major ES component, the P43 (red box, A), was removed from ES+P43 (A) using nickel beads. The protein was eluted using 250 mM imidazole in 20 mM Tris, 400 mM NaCl, pH 7.9 (B) and the remaining ES proteins (C, referred to from hereon in as ‘ES’) were concentrated using a Vivaspin concentrator. The left hand lane of each gel shows the molecular weight markers in kilodaltons (kDa).

3.2.1 Investigating the suitability of gel filtration media to fractionate ES into smaller sub-groups

Tandem mass spectrometry analysis of tryptic peptides showed that ES contains over 460 proteins (see Appendix 1, Table A1.1), and therefore it was necessary to identify a method to divide ES into smaller sub-groups in order to refine the search for protective material. A number of gel filtration media, including Superdex 75, Superdex 200 and Superose 12 were investigated, in order to determine which would most effectively divide ES into different size groups. Anion exchange chromatography was also investigated, as discussed in section 3.7. The Superdex 75 gel filtration resin was able to divide the ES into two broad groups – the higher molecular weight (Mw) group (80 to 120 kDa) was eluted between 0.9 and 1 ml, while the lower Mw group (10 to 60 kDa) was eluted between 1.2 and 1.3 ml (Figure 3.2A). Similarly, the Superdex 200 gel filtration resin was able to separate larger ES proteins from medium-sized and smaller proteins – the larger proteins (120 to 160 kDa) were eluted between 1.15 and 1.25 ml, and continued to be eluted up until 1.5 ml, along with the medium-sized proteins (30 to 70 kDa), while the smaller proteins (10 to 70 kDa)

74 were eluted between 1.6 and 1.7 ml (Figure 3.2B). In contrast, the ES proteins were fractionated more effectively by the Superose 12 gel filtration resin, so that the protein composition of the fractions progressively decreased in size (Figure 3.2C).

A) Superdex 75 UV trace B) SDS-PAGE gel for Superdex 75 Volume (ml) Volume (ml)

5 5

5 0 5

2 2 3 3 4 5

8 8 9 9 0 0 1 1

......

1 1 1 1 1 1

0 0 0 0 1 1 1 200 1 kDa

kDa

e 250 e 250

c 150

n n 150 150

r b 100 100 100

s 75 75

s A 50 b 50 50

A 37 37 0 25 25 0.0 0.5 1.0 1.5 2.0 2.5 3.0 20 20 VoVolulumee ( m(ml) l) 15 15 10 10

C) Superdex 200 UV trace D) SDS-PAGE gel for Superdex 200 Volume (ml) Volume (ml)

5 0 5 0 5 0 0

5 0 5 0 5 0

1 2 2 3 3 4 5

5 6 6 7 7 8

......

1 1 1 1 1 1 1

1 1 1 1 1 80 1

kDa kDa

c 60 250 250

a a 150

b 150

b r 40

r 100 o 100

s o 75

b s 75

A 20 b 50 50

A 0 37 37 0.0 0.5 1.0 1.5 2.0 2.5 3.0 25 25 20 20 VolVoumlume e(m (mll) 15 15 10 10

E) Superose 12 UV trace F) SDS-PAGE gel for Superose 12 Volume (ml)

5 0 5 Small Sup12 5

7 8 8 9 9 0 0 1 1 1

......

0 0 0 0 0 1 1 1 1 100 1

kDa

c 75 c 250

b 150

r b 50

r o 100

s 75 A 25

A 50 0 37 0.0 0.5 1.0 1.5 2.0 25 Volume (ml) 20 Volume (ml) 15 10

Figure 3.2. Investigating the suitability of Superdex 75, Superdex 200 and Superose 12 gel filtration media for fractionating ES by size exclusion chromatography. The UV trace (absorption measured at 280 nm) for each fractionation is shown in (A), (C) and (E). The resulting fractions were separated by SDS-PAGE and visualised by silver nitrate staining as shown in (B), (D) and (F). The left hand lane of each gel shows the molecular weight markers in kDa.

75 Based on these preliminary studies, Superose 12 gel filtration media appeared to be the most effective for fractionating ES into distinct sub-groups. These initial studies were carried out using 2.4 ml columns. The next step was to confirm that the 24 ml Superose 12 column fractionated ES in a manner similar to the 2.4 ml column, as the larger column would enable fractionation of a greater amount of material in each chromatography run.

3.2.2 Division of ES into four sub-groups using Superose 12 gel filtration media

The 24 ml Superose 12 column appeared to fractionate ES in a similar manner to the smaller column. For both columns, the first few protein containing fractions contained material of 30 to 150 kDa in size, the middle fractions contained material of between 10 and 100 kDa in size, and the last fractions contained material less than 50 kDa in size (Figure 3.3). Protein was eluted in 25 mM Tris, 10 mM NaCl (pH 7.4) and 0.5 ml fractions were collected. Fractions were pooled into four groups based on the UV trace (absorption at 280 nm), which gives an indication of when protein was eluted from the column (Figure 3.3A), and their protein composition was visualised by SDS-PAGE (Figure 3.3B). Pool 1 consisted of fractions 16-18, pool 2 consisted of fractions 20-22, fractions 24-27 were pooled to make a third group, and fractions 29-32 were pooled to make a fourth. There was some overlap in protein size between these groups, however it is clear from both SDS-PAGE gels and mass spectrometry analysis (see Appendix 1, Tables A1.2-5) that each pool is enriched in a different set of proteins. As pool 1 contained very little material, most of the experiments shown in this thesis have involved pools 2 to 4.

76 A) UV trace for Superose 12 column

U 150 4

e 0

100

t a

r e 100 2

)

c o

A b 5080

(

s c 60

b r 0

o 40

s 5 10 15 20

a 20

8 VVoolume ((mmll))

2 0 10 15 20 25 30 35 10 15 20 25 30 35 Fraction Fraction

B) Fractions eluted from Superose 12

Pool 1 Pool 2 Pool 3 Pool 4 kDa 16 17 18 19 20 21 22 23 24 25 26 kDa 28 29 30 31 32 250 250 150 150 100 100 75 75

50 50

37 37 25 25 20 20 15 15 10 10

Figure 3.3. Fractionation of ES using the 24 ml Superose 12 column. (A) Shows UV trace (measured at 280 nm) for fractionation. (B) Shows SDS-PAGE separation of fractions (visualised by Coomassie blue staining). Labels on (A) and (B) indicate which fractions were pooled to make pools 1-4 and the numbers above the lanes in (B) indicate fraction number. The left hand lanes of the gels in (B) show the molecular weight markers in kDa.

Next, the cellular and humoral immune responses to pools 2 to 4 were investigated during acute T. muris infection. For these studies, female C57BL/6 mice were infected with 200 T. muris eggs. Mice were sacrificed at day 20 p.i., and the MLNs were collected to assay for cytokine production following antigen re-stimulation of lymphocytes, while blood was collected to measure serum anti-parasite IgG1 and IgG2a antibody levels. Cytokine production by infection- primed lymphocytes was compared to that of naïve lymphocytes harvested from age-matched mice on the same day, and anti-parasite IgG1 antibody levels in the serum of infected and naïve mice was also compared. Interestingly, these analyses showed that the cellular and humoral arms of the immune system responded differently to pools 2 to 4. This will be discussed in more detail in sections 3.2.3 and 3.2.4.

77 3.2.3 Investigating the cellular immune response to pools 2-4

MLN cells pooled from T. muris infected (day 20 p.i.) and naïve female C57BL/6 mice were stimulated with pools 2 to 4 or unfractionated ES, and supernatant cytokine levels were measured by cytometric bead array after 42 hours. Samples were assayed for Th2 cytokines (IL-9 and IL-13), Th1/Th17 cytokines (IFN-γ and IL-17A), inflammatory cytokines (IL-6 and TNF-α), and the anti-inflammatory cytokine, IL-10.

The most noticeable difference in cytokine production in response to pools 2 to 4 was for IL-13 and IL-9. Infection-primed lymphocytes produced high levels of these cytokines in response to stimulation with pools 3 and 4, but little in response to pool 2. In fact, IL-13 production was 30 to 40-fold higher when primed lymphocytes were stimulated with pools 3 and 4 compared to pool 2, whereas IL-9 production was 100-fold higher (Figure 3.4A and B). Stimulation of infection-primed lymphocytes with unfractionated ES resulted in similarly high levels of these cytokines. Naïve lymphocytes released relatively less IL-13 and IL-9 in response to unfractionated ES and pools 2-4, suggesting that these cytokines are released in response to antigenic peptides that are encountered specifically during T. muris infection.

Other than IL-13 and IL-9, there was little difference in the level of cytokines produced by infection-primed lymphocytes in response to pools 2 to 4. However, with the exception of TNF-α, much greater cytokine levels were measured following stimulation of infection-primed lymphocytes compared to the naïve controls (Figure 3.4). This experiment was repeated three times, and the results shown here are representative of the three experiments. Based on these results, pools 3 and 4 appear to stimulate the strongest Th2 response, suggesting that these may be good sources of potential protective immunogens. The protective properties of pools 2 to 4 were evaluated in vivo by vaccinating male C57BL/6 mice with these sub-groups (plus adjuvant) and assessing whether vaccination protected these mice against a subsequent low dose infection. These data are presented in section 3.3.

78 A) IL-13 production in response to B) IL-9 production in response to stimulation with pools 2 to 4 stimulation with pools 2 to 4

800 Infected 150 Naive

) 600 l

)

l / 100

m /

g ( 400

(

I L 50 200 I

0 0 2 3 4 S E 2 3 4 S E Pool Pool C) IL-10 production in response to D) IFN-Υ production in response to stimulation with pools 2 to 4 stimulation with pools 2 to 4 800 1500

)

) 600

m 1000

/ /

( ( 400

- N 500

I I 200

0 0 2 3 4 S 2 3 4 S E E Pool Pool

E) IL-17A production in response to F) IL-6 production in response to stimulation with pools 2 to 4 stimulation with pools 2 to 4

600 2500

2000

)

m 400

g / 1500

p g

(

6 7 1000

L - 200

L I 500

0 0 2 3 4 S 2 3 4 S E E Pool Pool G) TNF-α production in response to stimulation with pools 2 to 4 800

)

l 600

m /

(

400

N T 200

0 2 3 4 S E Pool

Figure 3.4. Cellular immune response to pools 2-4 and unfractionated ES. Lymphocytes harvested from the MLNs of infected C57BL/6 mice (female, n=3, day 20 p.i.) were pooled and re-stimulated with pools 2 to 4 or unfractionated ES. MLN lymphocytes were also harvested from age-matched naïve mice (female, n=2) and stimulated in the same way. Supernatants were taken after 42 hours and levels of the following cytokines were measured by cytometric bead array: IL-6, 9, 10, 13, 17A, TNF-α and IFN-γ. Cytokine levels detected in supernatants taken from infection-primed (black) and naïve (grey) lymphocytes were plotted (A-G). This experiment was repeated 3 times and the results displayed are representative of all three repeats.

79 3.2.4 Assessment of anti-parasite IgG serum antibody response during acute T. muris infection

The strategy used in this thesis to identify potential immunogens has focussed on material that induces Th2 cytokine release from infection-primed lymphocytes. However, assessing antibody response may also provide valuable information about the immune response to ES sub-groups during acute infection. The anti-parasite IgG serum antibody response to pools 2 to 4 was assessed both quantitatively (by ELISA) and qualitatively (by Western blotting) for female C57BL/6 mice at day 20 p.i.

The highest anti-parasite IgG1 serum antibody levels were measured in response to pool 2 (Figure 3.5). This was greater than the response to unfractionated ES, suggesting that pool 2 is enriched for proteins targeted by the humoral response. The anti-parasite IgG1 serum antibody levels measured in response to pools 3 and 4 were similar to those measured in response to unfractionated ES (Figure 3.5E). No anti-parasite IgG1 antibodies were detected in the serum of naïve mice, suggesting that there is little cross- reactivity with other antigens that the mice may be exposed to (Figure 3.5). In addition, no anti-parasite IgG2a antibodies were detected in the serum of infected or naïve mice at this time point (data not shown).

80 A) Serum dose response curve for B) Serum dose response curve for pool 2 pool 3 0.8 0.8 Infected Naive 0.6 0.6

. D 0.4 . 0.4

0.2 0.2

0.0 0.0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 4 8 6 2 4 8 6 2 4 8 6 2 4 8 6 n n n 1 3 6 2 5 n n n 1 3 6 2 5 i i i n n n 1 2 i i i n n n 1 2 1 1 1 i i i n n 1 1 1 i i i n n 1 1 1 i i 1 1 1 i i 1 1 1 1 Dilution Dilution

C) Serum dose response curve for D) Serum dose response curve for pool 4 unfractionated ES 0.8 0.8

0.6 0.6

. . 0.4 0.4

0.2 0.2

E) Mean O.D. (1:40 serum dilution)

0.6 Infected Naive

0.4

O 0.2

0.0 2 3 4 S E Pool

Figure 3.5. Anti-parasite IgG1 serum antibody response to pools 2 to 4 and unfractionated ES. The sera of three infected (female, day 20 p.i.) and two naïve mice were pooled and the anti-parasite IgG1 antibody response to pools 2 to 4 was measured by ELISA. Immunograde plates were coated with 5 µg/ml of pools 2 to 4 or unfractionated ES and were incubated with serially diluted serum from infected or naïve mice (A to D, circles and squares represent infected and naïve respectively). Anti-parasite IgG1 levels were measured by adding biotinylated anti-mouse IgG1 secondary antibody, followed by streptavidin peroxidase, and lastly ABTS substrate. Optical density was measured at 405 nm. (E) Shows the O.D. for each sub-group measured at 1:40 serum dilution. Black and grey bars represent infected and naïve serum respectively. This experiment was repeated 3 times and the results displayed are representative of all three repeats.

Qualitative assesment of the anti-parasite IgG serum antibody response for infected (day 20 p.i.) and naïve female C57BL/6 mice was carried out by Western blotting after separation of ES by SDS-PAGE. Sera for three infected mice were pooled, and sera two naïve mice were pooled. Bound antibody was detected using an anti-mouse IgG (whole molecule) alkaline phosphatase antibody, and proteins were visualised using BCIP and NBT. The anti-parasite serum IgG antibody response targets a wide range of ES proteins, however, it appears to favour larger proteins (40-250 kDa, Figure 3.6A). This is in line with the ELISA data presented in Figure 3.5, since pool 2 contains proteins of a similar size range (Figure 3.3B). No anti-parasite IgG antibodies were detected in naïve sera, confirming that there is no cross-reactivity from normal mouse sera.

A) Infected B) Naïve C) SDS-PAGE Figure 3.6. Western blots separation of ES showing anti-parasite IgG serum antibody response for T. muris kDa kDa kDa infected and naïve C57BL/6 mice. ES+P43 was separated by 250 250 SDS-PAGE and the proteins were 150 150 250 transferred onto nitrocellulose 100 100 100 membrane, along with 10 to 250 150 kDa marker proteins (left of each 75 75 75 panel). Sera was pooled from three infected and two naïve mice. (A) 50 50 50 Shows membrane probed with infected sera, while (B) shows 37 37 37 membrane pooled with naïve sera. (C) Shows SDS-PAGE separation 25 25 25 of ES (Coomassie blue staining). 20 20 20 15 15 15 10 10 10

3.3 Vaccination with pools 2 to 4 stimulates protective immunity

The data presented in section 3.2 demonstrated that re-stimulating infection-primed lymphocytes with pools 3 and 4 resulted in greater levels of IL-13 and IL-9 production than pool 2. In order to investigate whether these protective properties translated in vivo, a vaccination protocol was developed,

82 involving subcutaneous vaccination of male C57BL/6 mice with 30 µg of protein (pools 2, 3, 4 or unfractionated ES) followed by a second vaccination with 15 µg of material 14 days later (vaccinations formulated with aluminum hydroxide). Two weeks after the second vaccination, these mice were infected with 25 T. muris eggs by oral gavage, and worm burdens were assessed at day 32 p.i. (Figure 3.7A). Vaccinating mice with pools 2 to 4 or unfractionated ES resulted in a statistically significant reduction in worm burden compared to the sham vaccination group (P= 0.0048, 0.00001, 0.0001 and 0.0004 respectively, Figure 3.7B). These results suggest that there are protective components in all three ES sub-groups, however it was decided that the search for protective immunogens should focus on pool 3, given that subcutaneous vaccination with this sub-group consistently induced sterile immunity. This will be explored further in Chapter 4.

Vaccine 1 Vaccine 2 Low dose infection Sacrifice (Day 0) (Day 14) (Day 28) (Day 32 p.i.)

B) *** 30 *** **** **

e 20

o 10

0 m 2 3 4 S a E h S Vaccination group

Figure 3.7. Vaccination of male C57BL/6 mice with pools 2 to 4 or unfractionated ES induces protective immunity. (A) Male C57BL/6 mice, n=8 to 10 per group, were vaccinated with 30 µg of pools 2 to 4 or unfractionated ES (day 0) followed by a second vaccination fourteen days later with 15 µg of protein (day 14). Two weeks after the second vaccination (day 28), mice were infected with 25 T. muris eggs by oral gavage. (B) Mice were sacrificed at day 32 p.i. to assess worm burden. The data displayed are the results of two independent studies. Error bars show SEM, central bar shows mean, ** P < 0.01, *** P < 0.001, **** P< 0.0001.

83 3.3.1 Assessment of antibody response following vaccination with pools 2 to 4 and subsequent infection

Anti-parasite IgG1 and IgG2a serum antibody levels were measured by ELISA following vaccination (and subsequent infection) of mice with pools 2 to 4 or unfractionated ES. Anti-parasite IgG1 serum antibody levels were highest for the pool 2 vaccination group, however all vaccinations stimulated a statistically significant increase in anti-parasite IgG1 serum antibody production compared to the sham vaccination group (Figure 3.8; P= 0.0001, 0.0469, 0.0031 and 0.0004 for pool 2, 3, 4 and unfractionated ES vaccination groups respectively). This suggested that all three ES sub-groups contain material capable of promoting anti-parasite IgG1 antibody production. The results shown here are from the first vaccination study, however these are representative of the two experiments performed.

84 A) Serum dose response curve for B) Serum dose response curve for sham vaccination group pool 2 vaccination group 1.2 1.2 1.0 1.0

0.8 0.8

. . 0.6 0.6

O O 0.4 0.4 0.2 0.2 0.0 0.0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 8 6 2 4 8 6 2 4 8 6 2 4 8 6 2 n n 1 3 6 2 5 1 n n 1 3 6 2 5 1 i i n n n 1 2 6 i i n n n 1 2 6 1 1 i i i n n n 1 1 i i i n n n 1 1 1 i i i 1 1 1 i i i 1 1 1 1 1 1 Dilution Dilution

C) Serum dose response curve for D) Serum dose response curve pool 3 vaccination group for pool 4 vaccination group 1.2 1.2 1.0 1.0 0.8 0.8

. 0.6 . 0.6

O 0.4 0.4

0.2 0.2

0.0 0.0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 8 6 2 4 8 6 2 4 8 6 2 4 8 6 2 n n 1 3 6 2 5 1 n n 1 3 6 2 5 1 i i n n n 1 2 6 i i n n n 1 2 6 1 1 i i i n n n 1 1 i i i n n n 1 1 1 i i i 1 1 1 i i i 1 1 1 1 1 1 Dilution Dilution

E) Serum dose response curve for F) Mean O.D. (1:320 serum dilution) ES vaccination group **** 1.2 * 1.0 ** 1.0 *** 0.8 0.8

. 0.6 . 0.6

0.4 O 0.4 0.2 0.2 0.0 0 0 0 0 0 0 0 0 0.0 4 8 6 2 4 8 6 2 n n 1 3 6 2 5 1 i i n n n 1 2 6 m 2 3 4 S 1 1 i i i n n n a E 1 1 1 i i i h 1 1 1 S Dilution Vaccination group

Figure 3.8. Anti-parasite IgG1 serum antibody response for mice vaccinated with pools 2 to 4 or unfractionated ES. Mice, n=5 per group, were vaccinated with pools 2, 3, 4 or unfractionated ES. Two weeks following the second vaccination, mice were infected with 25 T. muris eggs and were sacrificed at day 32 p.i. The anti-parasite IgG1 serum antibody response to ES+P43 was measured for each individual by ELISA (reading at 405 nm) and these are displayed for each vaccination group (A-E). The symbols on each graph represent individual mice within the same vaccination group. (F) Shows the mean O.D. for each vaccination group at 1:320 serum dilution. Sham= mice vaccinated with aluminum hydroxide only. Data representative of two experiments. Error bars show SEM, * P <0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001.

85 Mice that were vaccinated with pools 3 or 4 had lower anti-ES IgG2a serum antibody levels compared to the sham vaccination group, however this was not statistically significant (Figure 3.9). There was significant variation in the anti-ES IgG2a serum antibody levels measured between individuals within the pool 2 and unfractionated ES vaccination groups. In both cases, there were some individuals whose anti-ES IgG2a serum antibody levels were comparable to the sham group, while some had much higher levels (Figure 3.9). The results shown here are from the first vaccination study, however these are representative of the two experiments performed.

86 A) Serum dose response curve for B) Serum dose response curve for sham vaccination group pool 2 vaccination group

0.6 0.6

0.4 0.4

O 0.2 0.2

C) Serum dose response curve for D) Serum dose response curve for pool 3 vaccination group pool 4 vaccination group

0.6 0.6

0.4 0.4

O 0.2 0.2

E) Serum dose response for F) Mean O.D. (1:80 serum dilution) ES vaccination group

0.6 0.15

0.4 0.10

O 0.2 0.05

0.0 0.00 0 0 0 0 0 0 0 0 m 2 3 4 S 4 8 6 2 4 8 6 2 a E n n 1 3 6 2 5 1 h i i n n n 1 2 6 1 1 i i i n n n S 1 1 1 i i i 1 1 1 Vaccination group Dilution

Figure 3.9. Anti-parasite IgG2a serum antibody levels for mice vaccinated with pools 2 to 4 or unfractionated ES. Mice, n=5 per group, were vaccinated with pools 2 to 4 or unfractionated ES. Two weeks following the vaccine boost, mice were infected with 25 T. muris eggs and were sacrificed at day 32 p.i. The anti-parasite IgG2a serum antibody response to ES+P43 was measured for each individual by ELISA (reading at 405 nm) and these are displayed for each vaccination group (A-E). The symbols on each graph represent individual mice within the same vaccination group. (F) Shows the mean O.D. for each vaccination group at 1:80 serum dilution. Sham= mice vaccinated with aluminum hydroxide only. Data representative of two experiments. Sham= mice vaccinated with aluminum hydroxide only. Error bars show SEM.

87 In order to qualitatively assess the anti-parasite serum IgG antibody response of male C57BL/6 mice following vaccination with pools 2, 3 or 4 (and subsequent low dose infection), ES was separated by SDS-PAGE and transferred onto nitrocellulose membrane. The membrane was probed with pooled sera (taken at day 32 p.i.) from mice vaccinated with aluminum hydroxide only (sham), pools 2, 3, or 4 and unfractionated ES (Figure 3.10). Bound antibody was detected using an anti-mouse IgG (whole molecule) alkaline phosphatase antibody, and proteins were visualised using BCIP and NBT. Each of the pooled sera bound to a diverse array of proteins, however the IgG antibody response for mice vaccinated with pools 2, 3 or 4 was biased towards higher molecular weight proteins (30 to 250 kDa, Figure 3.10B-D). This result is particularly surprising for mice vaccinated with pool 4, given that this sub-group is enriched in smaller proteins (10-60 kDa, Figure 3.3). The anti-parasite IgG antibody response for the sham vaccination group and mice vaccinated with unfractionated ES targeted a wide range of proteins, including smaller sized proteins (Figure 3.10A and E).

A) Sham B) Pool 2 C) Pool 3 D) Pool 4 E) ES F) SDS-PAGE separation of ES kDa kDa 250 150 250 100 100 150 75 75

50 50 37 37

25 25 20 20 15 15 10 10

Figure 3.10. Western blots showing anti-ES serum antibody response for the sham, pool 2, 3, 4 or unfractionated ES vaccination groups. ES+P43 was separated by SDS-PAGE and the proteins were blotted onto nitrocellulose membrane, along with 10 to 250 kDa marker proteins (left of each panel). Membranes were probed with serum from the sham, pools 2, 3, 4 or ES vaccination groups taken at day 32 p.i. (left to right). Bound antibody was detected using an anti-mouse IgG (whole molecule) alkaline phosphatase antibody and proteins were visualised using BCIP and NBT. Sham= mice vaccinated with aluminum hydroxide only. (F) Shows SDS-PAGE separation of adult ES.

88 3.4 Vaccination with ES induces long-lasting protection against a subsequent low dose infection

In order to determine whether vaccination with ES could induce longer-lasting protection against a subsequent T. muris infection, male C57BL/6 mice were subcutaneously vaccinated with either pool 3 or unfractionated ES formulated with aluminum hydroxide as described in section 3.3. However, for this experiment mice were infected with 25 T. muris eggs 50 days after the second vaccination (see Figure 3.11A). Vaccination with either pool 3 or unfractionated ES led to a statistically significant reduction in worm burden by day 32 p.i. compared to the sham vaccination group (P= 0.0001 for both). Notably, sterile immunity was induced in 4 out of 5 mice vaccinated with pool 3, and 3 out of 5 mice vaccinated with unfractionated ES. This was comparable to the positive control group, who were infected 14 days after the second vaccination, as described in Figure 3.7. These results suggest that vaccination with ES material can induce immunological memory that is able to protect against future infections.

89 A)

Vaccine 1 Vaccine 2 Low dose infection Sacrifice (Day 0) (Day 14) (Day 64) (Day 32 p.i.)

**** 20 **** ****

n 15

W 5

0 3 l m l S o a o E tr h o n S P o c e iv it s o P Vaccination group

Figure 3.11. Vaccination with pool 3 or unfractionated ES can induce long-lasting protective immunity. (A) Male C57BL/6 mice, n=5 per group, were vaccinated with 30 µg of pool 3 or unfractionated ES, followed by a second vaccination fourteen days later with 15 µg of protein (day 14). Fifty days after the second vaccination, mice were infected with 25 T. muris eggs by oral gavage. (B) Mice were sacrificed at day 32 p.i. to assess worm burden. Sham= mice vaccinated with aluminum hydroxide only, positive control indicates mice that were vaccinated twice and then given a low dose infection two weeks after the second vaccination. Error bars show SEM, central bar shows mean, ****P <0.0001.

3.4.1 Assessment of antibody response following increased time to parasite challenge

The anti-parasite IgG1 and IgG2a serum antibody response to ES was measured for mice infected 50 days post vaccination with pool 3 and ES. Both vaccination groups had significantly higher anti-parasite IgG1 serum antibody levels compared to sham vaccinated mice (P= 0.0001). The anti-parasite IgG1 serum antibody response for both vaccination groups was comparable to that of the positive control group, which were infected 14 days after the second vaccination (Figure 3.12).

90 A) Serum dose response curve for B) Serum dose response curve for sham vaccination group long-term pool 3 vaccination group

2.5 2.5

2.0 2.0

. 1.5

O 1.0 O 1.0

0.5 0.5

0.0 0.0 0 0 0 0 0 0 0 0 2 4 8 6 2 4 8 6 0 0 0 0 0 0 0 0 1 3 6 2 5 2 4 8 6 2 4 8 6 in in in 1 2 n n n 1 3 6 2 5 in in in i i i n n n 1 2 1 1 1 in in 1 1 1 i i i n n 1 1 1 1 1 1 i i 1 1 1 1 Dilution Dilution

C) Serum dose response curve for D) Serum dose response curve for long-term ES vaccination group positive control group

2.5 2.5

2.0 2.0

. 1.5 . 1.5

O 1.0 O 1.0

0.5 0.5

E) Mean O.D.(1:40 dilution) **** 2.0 **** **** 1.5

D . 1.0

0.5

0.0 l m rm rm ro a e e t h -t -t n S g g o n n c o o e l l v 3 ti l S i o E s o o P P Vaccine group

Figure 3.12. Anti-parasite IgG1 serum antibody levels following long-term vaccination and subsequent infection. Mice, n=5 per group, were vaccinated with pool 3 or unfractionated ES. Fifty days following the second vaccination, mice were infected with 25 T. muris eggs and were then sacrificed at day 32 p.i. The anti-parasite IgG1 serum antibody response to ES+P43 was measured for each individual by ELISA (reading at 405 nm) and these are displayed for each vaccination group (A-D). The symbols on each graph represent individual mice within the same vaccination group. (E) Shows the mean O.D. for each vaccination group at 1:40 serum dilution. Sham= mice vaccinated with aluminum hydroxide only, positive control indicates mice that were vaccinated twice and then given a low dose infection two weeks after the second vaccination. Error bars show SEM, **** P <0.0001.

91 Both vaccination groups had significantly lower anti-parasite IgG2a serum antibody levels compared to the sham vaccination group (P= 0.0056 for pool 3 vaccination group, P= 0.0158 for ES vaccination group). The anti-parasite IgG2a serum antibody response for both vaccination groups was comparable to that of the positive control group (Figure 3.13).

92 A) Serum dose response curve for B) Serum dose response curve for sham vaccination group long-term pool 3 vaccination group 2.0 2.0

1.5 1.5

. 1.0 . 1.0

0.5 0.5

C) Serum dose response curve for D) Serum dose response curve for long-term ES vaccination group positive control group

2.0 2.0

1.5 1.5

. 1.0 . 1.0

0.5 0.5

E) Mean O.D. (1:40 dilution) * ** 1.5 **

1.0

O 0.5

0.0 l m rm rm ro a e e t h -t -t n S g g o n n c o o e l l v 3 ti l S i o E s o o P P Vaccine group

Figure 3.13. Anti-parasite IgG2a serum antibody levels following long-term vaccination and subsequent infection. Mice, n=5 per group, were vaccinated with pool 3 or unfractionated ES. Fifty days following the second vaccination, mice were infected with 25 T. muris eggs and were then sacrificed at day 32 p.i. The anti-parasite IgG2a serum antibody response to ES+P43 was measured for each individual by ELISA (reading at 405 nm) and these are displayed for each vaccination group (A-D). The symbols on each graph represent individual mice within the same vaccination group. (E) Shows the mean O.D. for each vaccination group at 1:40 serum dilution. Sham= mice vaccinated with aluminum hydroxide only, positive control indicates mice that were vaccinated twice and then given a low dose infection two weeks after the second vaccination. Error bars show SEM, * P <0.05, ** P < 0.01.

93 3.5 Proteinase K degradation of ES abrogates its protective properties

ES was treated with 100 µg of proteinase K in order to determine whether degradation of proteinaceous material within ES abrogated its protective properties. Peptides were collected using a VivaSpin concentrator (10 kDa MWCO) and separated by SDS-PAGE in order to assess degradation (Figure 3.14A). Male C57BL/6 mice were vaccinated with 30 µg of treated ES (protein concentration determined before degradation) or untreated ES, followed by 15 µg of material two weeks later. These mice were infected with 25 T. muris eggs by oral gavage and worm burdens were assessed at day 32 p.i. (Figure 3.14B). The mean worm burden for the group vaccinated with untreated ES was significantly lower than that of the sham vaccination group (P= 0.0001), however there was no significant difference between the mean worm burden for mice vaccinated with treated ES compared to the sham vaccination group (P= 0.2527).

A) B) **** ES d ES NS te d ea te tr a 20 n e U Tr kDa

n 15

d 250 r

b 150 10

r 100 o

W 5 75 0 m S S 50 a E E h d d S te te a a e e tr r 37 n T U Vaccination group 25 20 15 10

Figure 3.14. Proteinase K treatment of ES abrogates its protective properties. The protein content of ES was degraded using 100 µg proteinase K. Peptides were collected using a Vivaspin concentrator and separated by SDS-PAGE to assess degradation (A). Male C57BL/6 mice, n=5 per group, were vaccinated with 30 µg of treated or untreated ES (protein concentration assessed prior to degradation) formulated with aluminum hydroxide, followed by a second vaccination fourteen days later with 15 µg of material plus adjuvant. Mice were infected with 25 T. muris eggs by oral gavage and were sacrificed at day 32 p.i. to assess worm burden (B). Untreated ES= native ES. Treated ES= degradation with proteinase K. Error bars show SEM, central bar shows mean. **** P < 0.0001, NS= non-significant.

94 3.6 Transfer of serum from ES vaccinated mice does not confer resistance to unvaccinated mice

In order to determine the importance of serum antibodies in driving protective immunity following vaccination with ES, 500 µl of heat-treated serum from ES vaccinated male C57BL/6 mice were transferred to unvaccinated mice of the same sex and strain. For comparison, another group received serum from sham-vaccinated mice (vaccinated with aluminum hydroxide only). Both groups were infected with 25 T. muris eggs by oral gavage immediately after the serum transfer and worm burdens were assessed at day 32 p.i. There was no significant difference between the mean worm burden of the Transfer (sham) group, who received serum from sham vaccinated mice, and the Transfer (ES) group, who received serum from ES vaccinated mice (Figure 3.15, P= 0.5724). In contrast, most mice in the positive control group, who were vaccinated with ES and infected as described in Section 3.3 had expelled worms by day 32 p.i. (Figure 3.15, P= 0.0001).

NS Figure 3.15. Worm burdens following NS transfer of serum from sham or ES vaccinated mice. Transfer (sham) group 20 **** received 500 µl of serum from sham vaccinated male C57BL/6 mice. Transfer (ES) group received 500 µl of serum from ES

n 15

e vaccinated mice. The negative control group

u received two sham vaccinations, while

b 10 individuals in the positive control group were

m r vaccinated with 30 µg of ES formulated with

W 5 aluminum hydroxide, followed by 15 µg two weeks later. Mice were infected with 25 T. muris eggs by oral gavage on the same day 0 as the serum transfer (2 weeks following the ) ) l l m S ro ro a E t t second vaccination for the control groups). h ( n n s r o o ( fe c c Error bars show SEM, central bar shows r s e e fe n v v s a ti ti mean. **** P < 0.0001, NS= non-significant. n r a i a T g s r e o T N P Experimental group

95 The anti-parasite IgG1 and IgG2a serum antibody response was measured for each experimental group as well as for the pooled transfer serum (Figure 3.16). Groups 1 and 3 represent pooled sera from mice given sham and ES vaccinations respectively. Groups 2 and 4 received sera from Groups 1 and 3 respectively, and were then infected with T. muris (these represent Transfer (sham) and Transfer (ES) groups in Figure 3.15). The negative control group (Group 5) received two sham vaccinations followed by a low dose infection, while the positive control group (Group 6) received two ES vaccinations followed by a low dose infection.

The serum from sham vaccinated naïve animals (Group 1) contained no detectable anti-parasite IgG1 and IgG2a antibodies. Low levels of anti-parasite IgG1 and high levels of anti-parasite IgG2a were measured for Group 2, who received serum from Group 1 and were infected with T. muris. This was similar to Group 5, who received two sham vaccinations followed by a low dose infection (Figure 3.16).

The serum from ES vaccinated naïve mice (Group 3) contained high levels of anti-parasite IgG1 and no detectable anti-parasite IgG2a antibodies. Group 4 (who received sera from Group 3) had low levels of anti-parasite IgG1 and high levels of anti-parasite IgG2a. This was also similar to Group 5 (negative control group, Figure 3.16).

The positive control group (Group 6), who received two ES vaccinations followed by a low dose infection, had high levels of anti-parasite IgG1 and low levels of IgG2a (Figure 3.16).

96 A) Serum IgG1 response B) Serum IgG2a response

2.5 2.0

2.0 1.5

. 1.5 .

D D . . 1.0 O 1.0 O 0.5 0.5

0.0 0.0 1 2 3 4 5 6 1 2 3 4 5 6 Experimental group Experimental group Figure 3.16. Anti-parasite serum IgG1 and IgG2a antibody response for serum transfer groups. (A) and (B) Show anti-parasite serum IgG1 and IgG2a response at 1:320 and 1:40 serum dilution respectively. Group 1: Sham vaccination only. Group 2: Transfer of serum from Group 1 plus infection. Group 3: ES vaccination only. Group 4: Transfer of serum from Group 3 plus infection. Group 5: Negative control – sham vaccination plus infection. Group 6: Positive control – ES vaccination plus infection.

The results in Figures 3.15 and 3.16 may suggest that the protection conferred by vaccination with ES is not mediated by anti-parasite IgG1 alone. However further experiments are required in order to confirm this, since low levels of IgG1 were detected in the sera of pool 4, despite high levels of IgG1 being transferred in the sera from group 3.

3.7 Fractionation of ES by anion exchange chromatography

In addition to fractionating ES using size exclusion chromatography, anion exchange chromatography was investigated as a method to divide ES into smaller sub-groups. A Mini Q column was employed and elution of proteins was achieved with a salt gradient of 0-300 mM NaCl over 15 column volumes followed by 300-1000 mM NaCl over 8 column volumes (Figure 3.17A). Protein was eluted in 0.05 ml fractions and the content of these fractions was separated by SDS-PAGE and visualised by Coomassie blue staining. Fractions were pooled into six groups (A to F, Figure 3.17B) and these were used for vaccinations.

97 A) UV trace for MiniQ fractionation of ES (absorbance measured at 280 nm)

1000 1001000 AbsoranceAbsorbance

[ %[NaCl] NaCl 80 800 N

a a 600

]

m r 500

s s 40400

A A 20200

0 0 0 2 4 6 8 Volume (ml)

B) SDS-PAGE separation of MiniQ fractions

Volume (ml)

5 0 5 5 0 0 0 5 0 5 5

0 0 0 5 0 5 0 5 5 0 5

4 6 7 0 3 5 7 8 1 2 3

5 3 0 1 3 4 6 7 9 1 2

......

4 4 4 5 5 5 5 5 6 6 7

0 2 3 3 3 3 3 3 3 4 kDa 4 kDa 250 250 150 150 100 100 75 75

50 50 37 37

25 25 20 20 15 15 10 10 A B C D D E F (cont.)

Figure 3.17. Fractionation of ES by anion exchange chromatography. ES was fractionated by anion exchange chromatography using a Mini Q column. Protein was eluted in 25 mM Tris (pH 7.4) using a salt gradient of 0-300 mM NaCl over 15 column volumes, followed by 300-1000 mM NaCl over 8 column volumes and 1 M salt for 8 column volumes. The UV trace for this fractionation process is shown in (A), while (B) shows separation of the resulting fractions by SDS-PAGE (proteins visualised by Coomassie blue staining). The left hand lanes in (B) shows the molecular weight markers in kDa.

Male C57BL/6 mice were vaccinated subcutaneously with 30 µg of A to F, followed by 15 µg two weeks later (vaccinations formulated with aluminum hydroxide). Mice were then infected with 25 T. muris eggs two weeks following the second vaccination (as described in Figure 3.7) and worm burdens were assessed at day 32 p.i. Vaccination with pools A to E prior to a low dose challenge resulted in a significant reduction in worm burden compared to the sham vaccination group (P=0.0001 for A to C, P=0.0063 for D and 0.0061 for E), however vaccination with F did not significantly reduce the worm burden of subsequently infected mice (Figure 3.18).

98 **** Figure 3.18. Worm burdens for male NS C57BL/6 mice vaccinated with ES sub- ** groups A to F. Male C57BL/6 mice, n=3 to 5 ** per group, were vaccinated with 30 μg A, B, **** C, D, E or F, followed by 15 μg of these **** proteins 14 days later. Vaccinations were 20 **** formulated with aluminum hydroxide. Mice were challenged with a low dose infection 14 days after the second vaccination and worm

n 15

e burden was assessed at day 32 p.i. Sham=

u mice vaccinated with aluminum hydroxide

b 10 only. Error bars show SEM, central bars

r show mean, **** P< 0.0001, *** P < 0.001, o ** P < 0.01. W 5

0 m A B C D E F S a E h S Vaccination group

3.8 Fractionation of pool 3 by anion exchange chromatography

As outlined in section 3.3, the decision was made to focus the search for protective T. muris antigens on pool 3, given that vaccination with this material consistently resulted in sterile immunity (Figure 3.7). In addition, in vitro stimulation of infection-primed lymphocytes with pool 3 resulted in high levels of Th2 cytokine production (Figures 3.4A and B), which suggests that material found within pool 3 may contribute towards driving worm expulsion during acute infection in C57BL/6 mice. Pool 3 contained a large number of proteins – this was evident from the number of bands visible following separation of pool 3 by SDS-PAGE (Figure 3.3B) and from the mass spectrometry data in Appendix 1 (Table A1.4).

In order to narrow down the search for protective immunogens within pool 3, it was further fractionated by anion exchange chromatography. A Resource Q column was employed and elution of proteins was achieved in 25 mM Tris (pH 7.4) with a salt gradient of 0-300 mM NaCl over 15 column volumes, followed by 1 M salt for 5 column volumes (Figure 3.19A). Eluted proteins were

99 collected in 0.5 ml fractions. These fractions were pooled as shown in Figure 3.19B to make four sub-groups (A to D). Vaccination studies were carried out as described in section 3.3 (two vaccinations followed by infection with 25 T. muris eggs). All vaccinations were formulated with aluminum hydroxide and mice were sacrificed at day 32 p.i. to assess worm burdens.

A) UV trace for fractionation of pool 3 by anion exchange chromatography

1000600 1001001000 AbsoranceAbsorbance 500 [NaCl]% NaCl 80 80800

[

c 400 %

n 60600

60 l

]

m 300 a

500 C

40400l s 40

b 200

A A 20 20200 100 0 0 0 0 0 0 2 10 4 20 6 308 40 Volume (ml) Volume (ml)

B) SDS-PAGE gel for fractionation of pool 3 by anion exchange chromatography

Volume (ml)

5 5 5 5 5 5 5 0 0

......

. 2 3 4 5 6 7 8 1 2

8 2 2 2 2 2 2 2 3 3 kDa

250

150

100 75

25 20 15 10 A B C D

Figure 3.19. Fractionation of pool 3 by anion exchange chromatography. Pool 3 was further fractionated by anion exchange chromatography using a Resource Q column. Protein was eluted in 25 mM Tris (pH 7.4) using a salt gradient of 0-300 mM NaCl over 15 column volumes, followed by 1 M salt for 5 column volumes. The UV trace for this fractionation process is shown in (A), while (B) shows the protein content of various fractions eluted from the column (SDS-PAGE gel visualised by Coomassie blue staining). The left hand lane in (B) shows the molecular weight markers in kDa.

100 Vaccination with any of the four vaccination preparations protected mice against a subsequent T. muris infection, with a statistically significant reduction in worm burden compared to the sham vaccination group (P= 0.0028, 0.0080, 0.0015 and 0.0006 for A, B, C and D respectively, Figure 3.20).

*** Figure 3.20. Worm burdens for male *** C57BL/6 mice vaccinated with pool 3 sub- ** groups A to D. Male C57BL/6 mice, n=3 to ** 5 per group, were vaccinated 30 ** subcutaneously with 30 μg of A, B, C, D, or pool 3, followed by 15 μg of these proteins 14 days later. All vaccinations were

n e 20 formulated with aluminum hydroxide. Mice

u were challenged with a low dose infection 14

b days after the second vaccination and worm

m r burden was assessed at day 32 p.i. Sham= o 10

W mice vaccinated with aluminum hydroxide only. Error bars show SEM, central bars show mean, *** P < 0.001, ** P < 0.01. 0 3 m A B C D l a o h o S P Vaccination group

3.9 Vaccination with L2 ES induces protective immunity

The experiments carried out thus far have involved vaccination with adult T. muris ES. However, during acute infection, worms are expelled before they reach patency (31), and therefore the host is not ordinarily exposed to adult ES. Instead, larval components must be recognised by the host immune system in order to trigger worm expulsion. To investigate this, a vaccination experiment was carried out whereby male C57BL/6 mice were subcutaneously vaccinated with 30 μg of ES collected from L2 larvae (L2 ES). Mice were vaccinated a second time 14 days later (with 15 μg), and a low dose infection was administered two weeks after. Mice that were vaccinated with L2 ES had significantly lower worm burdens compared to the sham vaccination group (P= 0.0001), and sterile immunity was achieved in 4 out of 5 mice. The level of protection conferred by vaccination with L2 ES was similar to that conferred by

101 vaccinating with adult ES, suggesting that both types of ES contain protective material (Figure 3.21).

**** Figure 3.21. Vaccination with L2 or adult ES can induce protective immunity. Male 20 **** C57BL/6 mice, n=3 to 5 per group, were vaccinated with 30 µg of L2 or adult ES

n 15 formulated with aluminum hydroxide,

d followed by a second vaccination fourteen

u days later with 15 µg of protein plus

10 adjuvant. Two weeks later, mice were

o infected with 25 T. muris eggs by oral

W 5 gavage. Mice were sacrificed at day 32 p.i. to assess worm burden. Error bars show SEM, central bar shows mean, 0 **** P < 0.0001. m S S a E E h 2 lt S L u d A Vaccination group

Western blotting was carried out in order to determine whether there was much overlap between the antibody repertoire of mice vaccinated with L2 and adult ES. L2 and adult ES were separated by SDS-PAGE and proteins were transferred onto nitrocellulose membrane. The membrane was probed with pooled sera from mice vaccinated with either L2 or adult ES, and antibody binding was detected using an anti-mouse IgG antibody. Both sera were able to bind a range of L2 and adult ES components (Figure 3.22), suggesting that there is significant overlap between the antibody repertoire of mice vaccinated with L2 and adult ES.

102 L2 ES probed with sera from mice Adult ES probed with sera from mice vaccinated with L2 (A) or adult (B) ES. vaccinated with L2 (C) or adult (D) ES.

A) B) C) D) kDa kDa kDa kDa 250 250 250 150 250 150 150 150 100 100 100 100 75 75 75 75

50 50 50 50 37 37 37 37 25 25 25 25 20 20 20 20 15 15 15 10 15 10 10 10

Figure 3.22. Western blots showing IgG antibody response to L2 and adult ES. L2 (A, B) and adult (C, D) ES was separated by SDS-PAGE and the proteins were transferred onto nitrocellulose membrane, along with 10 to 250 kDa marker proteins (left of each panel). The membrane was probed with pooled sera from mice that were vaccinated with either L2 (A, C) or adult (B, D) ES, followed by a low dose infection. After incubating with an anti-mouse IgG antibody, proteins were visualised using BCIP and NBT.

L2 and adult ES were also separated by SDS-PAGE in order to compare their protein content. Whilst it is clear that some bands are shared between the two ES samples, for example the bands at approximately 80, 100, 150 and 200 kDa, there are also some differences (Figure 3.23). Notably, the P43 (TMUE_s0083002300), which is amongst the most abundant adult ES proteins, appeared to be absent from L2 ES, and this was confirmed by mass spectrometry (Appendix 1, Table A1.6). One hundred and fourteen proteins were identified within L2 ES by mass spectrometry (identification criteria set to 95% protein threshold, 50% peptide threshold, minimum 2 peptides identified per sample and proteins must be identified in 2 or more samples), while 468 proteins were identified within adult ES (list generated by collating the proteins identified in Superose 12 fractions 16 to 32, see Appendix 1, Table A1.1). A comparison of the two samples showed that 76% of L2 proteins were identified within adult ES.

103 A) L2 ES B) Adult ES kDa kDa 250 250 150 150 100 100 75 75

50 50 P43

37 37

25 25 20 20 15 15 10 10

Figure 3.23. SDS-PAGE separation of L2 and adult ES. L2 (A) and adult (B) ES were separated by SDS-PAGE. Gels were stained with Coomassie blue to visualise proteins. The position of the P43 is indicated in blue on (B). The left hand lane on both gels shows marker proteins in kDa.

3.10 Evaluation of the AKR mouse model for vaccination studies

Previous vaccination studies have used the naturally susceptible AKR mouse strain to assess protective immunity following vaccination with T. muris ES (19). In order to investigate the utility of pools 2 to 4, a similar vaccination study was carried out, whereby AKR mice were vaccinated with pools 2 to 4 or unfractionated ES, and subsequently infected with 200 T. muris eggs. Whilst all three ES sub-groups showed potential (sterile immunity was achieved for all mice vaccinated with pools 2 to 4, Figure 3.24), this model did not enable discrimination between different sub-groups in terms of immunogenicity. The C57BL/6 (low dose) model used earlier in this chapter is arguably more stringent, since a low dose infection naturally primes for susceptibility (31), and strong vaccine candidates are more likely to be identified using a model that can distinguish between more and less immunogenic candidates, and therefore, the low dose C57BL/6 model was used going forward.

104 Figure 3.24. Vaccination of male AKR **** mice with ES components protects **** 400 against a subsequent high dose **** infection. Male AKR mice were vaccinated **** with 30 µg of pools 2 to 4 or unfractionated

n 300 ES formulated with aluminum hydroxide,

r followed by a second vaccination 2 weeks

b later with 15 µg of protein plus adjuvant. Two

200

m weeks after the second vaccination, mice

o were given a high dose infection (200 eggs)

W 100 by oral gavage. Worm burden was assessed at day 32 p.i. Sham= mice vaccinated with aluminum hydroxide only. Error bars show 0 SEM, central bars show mean, m 2 3 4 S a E h **** P= 0.0001. S Vaccine group

3.11 Discussion

This chapter describes experiments carried out to fractionate ES and to test the immunogenicity of various sub-fractions in vitro and in vivo. Prior to these studies, little was known about the immunogenic components of T. muris ES. The first experiments to demonstrate that ES contained protective material were carried out in the 1970s and 1980s by Jenkins and co-workers (28, 115). They showed that vaccinating NIH mice with T. muris ES formulated with CFA lead to earlier expulsion of a subsequent high dose infection – by day 9 p.i. 80% of worms had been expelled. Jenkins and colleagues also attempted to divide ES into smaller groups of proteins in order to narrow down the search for protective antigens. They did this using size exclusion and anion exchange chromatography, as well as isoelectric focussing, and were able to divide the ES into different sub-groups of varying immunogenicity (28). Similar approaches were used in this thesis, experimenting with both gel filtration and anion exchange chromatography.

The first experiments carried out in this chapter investigated the suitability of three different gel filtration media to divide the ES into smaller sub-groups. Superose 12 gel filtration media appeared to be most effective, and material

105 was divided into four sub-groups (pools 1 to 4). The amount of material in pool 1 was minimal, and therefore the rest of this chapter mainly focussed on pools 2 to 4. In vitro assays showed that during acute infection, the strongest anti- parasite serum IgG1 response was directed towards pool 2 (which contains larger sized material), while re-stimulating infection-primed lymphocytes with pools 3 and 4 resulted in high levels of IL-13 and IL-9 production. This suggests that ES may be targeted differentially by the humoral and cellular immune response during acute T. muris infection. Vaccination with any of these ES sub- groups (pools 2 to 4) afforded mice some protection against a subsequent low dose infection, however vaccination with pool 3 consistently induced sterile immunity (Figure 3.7). These results suggest that the efficacy of experimental vaccinations can be predicted by assaying for Th2 cytokine production by infection-primed lymphocytes in vitro.

The majority of vaccination experiments carried out in this chapter have involved subcutaneous vaccination of male C57BL/6 mice with ES material formulated with aluminum hydroxide. The decision to administer material subcutaneously was based on data published by Jenkins and co-workers in the 1980s, who showed that subcutaneous vaccination with ES (formulated without adjuvant) induced better protection than intraperitoneal vaccination (70% mean worm expulsion at day 9 p.i. following subcutaneous vaccination of NIH mice, compared to 33% following intraperitoneal vaccination) (25). Jenkins and colleagues showed that vaccinations formulated with aluminum hydroxide conferred similar levels of protection as those formulated with CFA (68% worm expulsion for aluminum hydroxide versus 77% expulsion for CFA) (25). Aluminum hydroxide is safer than CFA and is licensed for use in humans (193-196), which was an important consideration since the ultimate goal is to identify vaccine candidates for the human whipworm, T. trichiura, and therefore it was decided that aluminum hydroxide would be used for the vaccination experiments described in this chapter.

The vaccination model used by Jenkins and colleagues is based on assessing protection in NIH mice by looking for earlier expulsion (day 9 p.i.) of a high dose

106 infection (28). This challenge dose would ordinarily be completely expelled before the worms reach patency (31). The approach used to investigate the efficacy of vaccinations in this thesis was arguably more scientifically rigorous, since it involved administering a low dose infection (25 eggs), which would ordinarily progress to chronicity in C57BL/6 mice (197). If, following vaccination, mice expel a low dose infection, it would suggest that the vaccination induces a protective Th2 response in an environment where a Th1 response would normally prevail (197). Male C57BL/6 mice were used for these vaccination studies to ensure that expulsion was not influenced by gender differences in cytokine production (see section 1.2.2) (43).

The suitability of the AKR mouse model for vaccination studies was also assessed in this chapter. A high dose infection ordinarily progresses to chronicity in this strain, as AKR mice mount a strong Th1 response (198). Data presented here showed that vaccinating male AKR mice with unfractionated ES or pools 2 to 4 resulted in sterile immunity for all vaccination groups (Figure 3.24). Although this is an interesting result and largely confirmed the data from the C57BL/6 vaccination model, these results made it difficult to discriminate between the efficacies of different combinations of proteins. Not only were the vaccination studies carried out using the C57BL/6 (low dose) model more informative than the AKR (high dose) model in terms of narrowing down the search for protective immunogens, low dose infection is more reflective of natural challenge (48), and therefore it was decided that the C57BL/6 (low dose) model would be utilised for the rest of the thesis.

As well as developing a stringent vaccination protocol in which to assess the protective capacity of various ES sub-fractions, a number of important observations were made relating to the immune response induced by vaccination. Firstly, vaccination with pool 3 or unfractionated ES was able to protect mice from a low dose infection administered 50 days after the second vaccination (Figure 3.11). This suggests that vaccination with ES material can induce longer-lasting protection. To our knowledge, this is the first study to investigate whether immunological memory can be achieved by vaccinating with

107 T. muris ES. Future work should include further investigation of this memory response, including characterisation of the immune components involved. For example, Smith and colleagues have isolated memory T cells (CD45+/CD3+/CD4+/CD11ahi/CD69+/CD62Llo/CD44hi) from Streptococcus pneumoniae infected mice using flow cytometry, and demonstrated that these cells secrete inflammatory cytokines upon re-stimulation with heterotypic pneumococcal strains (199). Similar approaches could be used in our experimental vaccination model, perhaps to determine whether the transfer of memory T cells from vaccinated mice can protect naïve mice from a subsequent low dose infection.

Secondly, data presented in this chapter demonstrated that treating ES with proteinase K abrogated its protective properties, suggesting that the protective properties of ES are likely dependent on the protein content (Figure 3.14). Similar findings were reported by Jenkins and colleagues, who showed that vaccinating NIH mice with peptides derived from treating ES with trypsin was not as effective as vaccinating mice with untreated ES (28). These data support the rationale for focussing on the protein content of ES in Chapter 4.

Thirdly, data presented here suggest that transferring serum from ES vaccinated naïve mice does not confer protective immunity to unvaccinated naïve mice, despite high levels of anti-parasite IgG1 antibodies being transferred. However, since low levels of anti-parasite IgG1 were measured in the serum of these mice following transfer, this requires further investigation in order to confirm that antibody production is not required for vaccine-induced immunity. Future experiments could also investigate whether the transfer of CD4 T cells from vaccinated mice can protect against infection in naïve mice. Nevertheless, this data provides further justification for focussing on ES material that stimulates Th2 cytokine production, rather than using antibody-based screening methods to identify potential vaccine candidates, as have been used for other helminths (27, 108, 109). These approaches will be discussed in more detail in Chapter 4.

108 Vaccination experiments were also carried out using L2 ES, demonstrating that subcutaneous vaccination with this material induced sterile immunity in the majority of mice. The rationale for this experiment was that larval components must be responsible for driving worm expulsion during acute infection, since worms are normally expelled before they reach patency (31). Adult worms produce much larger quantities of ES than larval stages (data not shown), making fractionation and vaccination experiments much more practical, hence why this material was used for the majority of experiments described in this thesis. However, it would appear that the levels of protection induced by vaccination with adult ES were comparable to those generated by larval ES, and comparing the protein content of larval and adult ES may inform vaccine design.

Mass spectrometry analysis showed that there is significant overlap between the protein content of L2 and adult ES (76% of L2 ES proteins were identified in adult ES, Appendix 1, Table A1.6). This is reflected in the serum antibody response of vaccinated mice. Western blot analysis showed that serum from mice vaccinated with L2 ES contains IgG antibodies that bind a range of adult ES proteins and vice versa. These results reflect those reported by Dixon and colleagues, who showed that serum from AKR mice vaccinated with adult T. muris ES could bind L3 ES, suggesting that there was significant overlap between larval and adult ES antigens (19). Hewitson and colleagues used a similar approach, comparing the protein content of L4 and adult H. polygyrus ES to that of H. polygyrus eggs. Vaccination with L4 or adult ES protected mice from a subsequent infection, however vaccination with egg material did not. The authors used this information to inform vaccine design, by focussing on material shared between the L4 and adult ES but absent from H. polygyrus egg content (200).

Many more proteins were identified within adult T. muris ES compared to L2 ES (468 versus 114 proteins). This is likely due to the process by which the list of identified proteins was compiled, rather than a reflection of the complexity of the samples. The list of proteins identified within adult ES was compiled by collating

109 the mass spectrometry data for multiple gel filtration fractions (Superose 12 fractions 16 to 32). This may enable the detection less abundant proteins, which would ordinarily be below the detection threshold in unfractionated ES. Far fewer proteins were identified following mass spectrometry analysis of unfractionated ES (data not shown), which is why this approach was used. A similar approach could be carried out in future to enable a more definitive list of L2 ES proteins to be generated.

In addition to gel filtration chromatography, experiments were carried out to fractionate ES and pool 3 by anion exchange chromatography. The resulting fractions were pooled into 7 groups for the ES fractionation experiment (A-F) and 4 groups for the fractionation experiment with pool 3 (A-D). All of the mice that were vaccinated with ES pools A, B or C were protected from subsequent infection. Vaccination with pool 3 subgroups A to D was also very effective at protecting mice from subsequent infection, and sterile immunity was achieved for the majority of mice. It was hoped that these fractionation/vaccination experiments would enable us to refine the search for protective immunogens within pool 3, or to focus on proteins shared between pool 3 and various immunogenic sub-groups resulting from the ES anion exchange step. However, given that almost all of the sub-fractions stimulated protective immunity, this was not possible. As a result, the focus of Chapter 4 was to develop methods to fractionate ES and pool 3 using gel filtration chromatography, assess the immunogenicity of these sub-fractions in vitro using a measure of T cell cytokine production, and identify potential immunogenic candidates within the sub- fractions that induced the highest IL-13 and IL-9 production.

In summary, the data presented here describe the methods by which T. muris ES can be fractionated by gel filtration and anion exchange chromatography to produce smaller sub-groups of proteins in which to search for immunogenic components. The immunogenicity of various ES sub-groups was assessed using in vitro methods, and a vaccination protocol was developed to assess the protective properties of these sub-groups in vivo. Data presented in this chapter showed that long-lasting immunity can be induced by vaccination with T. muris

110 ES, and that proteins within ES are likely to be responsible for this protective immunity. Pool 3, a group of proteins resulting from fractionating ES using Superose 12 gel filtration media, will form the basis of the search for protective immunogens described in Chapter 4.

111

Chapter 4: Identification of immunogenic candidates within T. muris ES

112 4.1 Chapter introduction

The data presented in Chapter 3 showed that the protective properties of T. muris ES are dependent on protein material and that the efficacy of experimental vaccinations can be predicted by assaying for Th2 cytokine production by infection-primed lymphocytes in response to re-stimulation with ES products. Pool 3, which arose from the pooling of fractions resulting from a size exclusion chromatography step using Superose 12 gel filtration media, consistently induced sterile immunity. Likewise, pool 4 induced high levels of Th2 cytokine release from infection-primed lymphocytes, and was also very effective at inducing protective immunity in vivo.

The following chapter describes the proteomics-based approach used to identify immunogenic candidates within pool 3. Recombinant forms of these candidate proteins were expressed using HEK293 cells, since other laboratories have successfully used this expression system to synthesise helminth proteins with comparable antigenic and/or immunogenic activity to their native forms (Maizels, personal communication). The immunogenicity of these proteins was assessed both in vitro and in vivo. Recombinant proteins were tested in the low dose/C57BL/6 vaccine model described in Chapter 3, both in isolation and in combination with the other recombinant proteins. The initial vaccines were formulated with aluminum hydroxide, however, when these vaccines failed to protect against subsequent infection, alternative adjuvants were investigated. Freund’s adjuvants were selected on the basis of their ability to stimulate potent T cell responses (135), and based on previous studies, which showed that vaccination of NIH and AKR mice with ES formulated with Freund’s adjuvants induced protective immunity (19, 28, 29). Montanide ISA 720 was also selected, since it is considered a safer alternative to Freund’s adjuvant and is licenced for use in the clinic (135), which is an important consideration, considering the end goal is to produce a vaccine against T. trichiura that is suitable for use in humans. Montanide ISA 720 has also been used in pre-clinical vaccines against S. mansoni, demonstrating that it is an effective adjuvant for use in helminth vaccines (142).

113 4.2 Identification of immunogenic candidates using a size exclusion chromatography and proteomics approach

The approach used to identify immunogenic candidates involved two size exclusion chromatography steps, in combination with in vitro cytokine assays and tandem mass spectrometry of tryptic peptides. The two size exclusion chromatography steps involved fractionating ES using Superose 12 gel filtration media and subsequently further fractionating pool 3 (fraction numbers 24-27; Figure 3.3) using Superdex 75 media. Infection-primed (high dose) and naïve lymphocytes were stimulated for 42 hours with the fractions resulting from each chromatography step and supernatant cytokine production was measured by cytometric bead array. Tandem mass spectrometry of tryptic peptides was used to analyse the protein content of each fraction. The total number of spectral counts for each protein was used as a surrogate marker of protein abundance (201). The abundance of proteins was mapped across the size exclusion chromatography fractions, and proteins whose abundance profile matched the pattern of IL-13 production from infection-primed lymphocytes were considered immunogenic candidates. The immunogenic candidates identified in both chromatography steps were investigated further.

4.2.1 Fractionating ES using Superose 12 gel filtration media

ES was fractionated using Superose 12 gel filtration media. Protein elution was assessed by UV absorption measured at 280 nm (Figure 4.1A), and the proteins in each fraction were separated by SDS-PAGE (gel stained with Coomassie blue, Figure 4.1B). Infection-primed and naïve lymphocytes were stimulated with fractions 22 to 32 and supernatant cytokine levels were measured after 42 hours by cytometric bead array. These fractions were selected based on data presented in Chapter 3, showing that pools 3 (fractions 24-27) and 4 (fractions 29-32) stimulated the highest levels of Th2 cytokine release from infection-primed lymphocytes. There were two major peaks of IL-13 production by infection-primed lymphocytes – the first was between

114 fractions 24 and 27 and the second was between fractions 29 and 31 (Figure 4.1C). IL-13 production was also high in response to fraction 28 – this is likely due to an overlap in the immunogenic material found in the first and second IL-13 peaks. IL-9 production by infection-primed lymphocytes was also highest in response to fractions 25 to 28, with a second peak at fraction 30 (Figure 4.1D). There was very little IL-13 and IL-9 produced by naïve lymphocytes in response to stimulation with these fractions, suggesting that these fractions contain parasite-specific antigens that drive Th2 cytokine release during acute infection. Supernatant levels of IL-10, IFN-γ, TNF-α, IL-6 and IL-17A were also measured across fractions 22 to 32, however no obvious pattern emerged for these cytokines (Figure 4.1E-I).

115

116

Figure 4.1. Cytokine production by infection-primed and naïve lymphocytes in response to stimulation with Superose 12 fractions 22 to 32. (A) Shows UV trace (absorbance measured at 280 nm) from Superose 12 fractionation of ES. (B) Shows separation of fractions 22-32 by SDS-PAGE (gel stained with Coomassie blue). Molecular weight markers (in kDa) are shown on left hand side of gel and numbers above gel indicate fraction number. (C-I) Infection- primed and naïve lymphocytes were stimulated with these fractions and supernatant cytokine production was measured by cytometric bead array. Black and grey bars indicate cytokine production by infection-primed and naïve lymphocytes respectively. Striped bars indicate cytokine production in response to stimulation with unfractionated ES.

The protein content of fractions 22 to 32 was analysed by tandem mass spectrometry of tryptic peptides, which identified 325 proteins across the eleven fractions. For each fraction, a standardised amount of protein (10 μg) was used for mass spectrometry analysis to enable comparison of protein abundance between fractions, and total spectral count (the total number of spectra detected for each protein) was used as a surrogate for protein abundance (201). Proteins whose spectral count peaked around fractions 24 to 27 were considered potential immunogenic candidates, as high levels of IL-13 were detected in these fractions, and vaccinating mice with these fractions (in the form of pool 3) protected mice against a subsequent T. muris infection (see Chapter 3). The number of potential immunogenic candidates identified in this step was 63, and these are shown in Table 4.1.

117 Spectral count Mw Frac Frac Frac Frac Frac Frac Frac Frac Frac Frac Accession number Protein (kDa) 23 24 25 26 27 28 29 30 31 32 TMUE_s0015001100 Pancreatic alpha amylase 66 7 18 19 8 7

TMUE_s0005004200 Malate dehydrogenase 39 3 5 17 9 3 4

TMUE_s0256000200 Hypothetical protein 70 3 4 7 13 12 12 8 6 5 2 78 kDa glucose regulated TMUE_s0086000700 73 11 11 10 12 5 2 3 5 3 protein TMUE_s0016004100 Serpin protein 177 3 3 7 12 2 5 3 3 2

NADH dependent fumarate TMUE_s0013010700 57 8 11 7 7 reductase TMUE_s0055003300 Elongation factor 2 91 11 6 5 2 3

TMUE_s0084003500 CAP-domain containing protein 39 3 6 9 10 7 6 3 2

TMUE_s0058002100 Conserved hypothetical protein 26 4 9 7 6 4 3 3

TMUE_s0093000600 Protein disulfide isomerase A6 48 5 6 8 3 5 2 4 4 2

Rab GDP dissociation inhibitor TMUE_s0003017400 48 6 8 5 4 alpha TMUE_s0016007600 Hypothetical protein 23 3 8 5 4 4

TMUE_s0036003800 Parathyroid hormone 2 receptor 45 2 6 5 7 6 4 3

Ion trans 2 and Pfam-B 17708- TMUE_s0066001200 132 3 6 3 6 3 5 3 5 domain containing protein TMUE_s0076003900 Trans sialidase 156 3 2 6 3 3 4 4

TMUE_s0074001100 Hypothetical protein 53 4 6 3 5 2 2

TMUE_s0051004900 Sulfhydryl oxidase 1 70 6 5 2

TMUE_s0083000200 Inorganic pyrophosphatase 63 2 5 6 3

Translationally controlled tumor TMUE_s0009001300 21 6 5 4 2 protein TMUE_s0165000700 Cysteine glycine protein 2 12 3 5 4 3 5 5 5

TMUE_s0293000700 Hypothetical protein 23 2 3 5 4 5 5 3 3

TMUE_s0004017800 Porin 41 2 5 4 3 4 3 2 2

TMUE_s0106000600 Moesin:ezrin:radixin 1 69 4 2 4 5 3 3 2

TMUE_s0085005000 Venom allergen 5 39 3 5 2 3

118 Trypsin-domain containing TMUE_s0146001900 52 2 5 3 2 protein ADP ribose pyrophosphatase, TMUE_s0072000900 29 5 2 3 mitochondrial Neurogenic locus notch protein TMUE_s0012011300 103 2 2 4 2 2 2 TMUE_s0002013500 Conserved hypothetical protein 56 3 4 3 2

Independent phosphoglycerate TMUE_s0072003400 46 4 3 4 mutase TMUE_s0098000400 Protein wos2 21 4 2 3

Pfam-B 11092 and MBOAT- TMUE_s0217000400 269 4 domain containing protein NUC194 and PI3 PI4 kinase TMUE_s0104003200 and FATC-domain containing 442 3 3

protein TMUE_s0048003100 Vinculin 123 2 2 3

Pfam- TMUE_s0037007000 B_927_and_Beach_and_WD40 369 3

-domain_containing_protein Pkinase-domain containing TMUE_s0241001300 43 3 protein TMUE_s0010008400 Disks large 5 208 3

DUF21-domain containing TMUE_s0019001900 63 3 protein TMUE_s0428000200 Lactoylglutathione lyase 20 3 2

TMUE_s0132001200 Gut specific cysteine proteinase 39 3 2

TMUE_s0006005400 Autophagy protein 2 protein B 225 3

PAN 1-domain containing TMUE_s0326000200 34 3 protein TPD52 domain containing TMUE_s0071003300 17 3 protein E3 SUMO protein ligase TMUE_s0175001100 235 2 RanBP2 TMUE_s0189000300 Eukaryotic initiation factor 4A 50 2

TMUE_s0145001100 Pfam-B 10329 and zf-CCHC- 57 2

119 domain containing protein Trypsin-domain containing TMUE_s0004005500 33 2 protein TMUE_s0009011100 la protein 45 2 2

rve and Pfam-B 10329 and TMUE_s0017002000 RVT 1 and Pfam-B 2707- 159 2

domain containing protein Arginine glutamic acid dipeptide TMUE_s0138001500 148 2 repeats TMUE_s0004000500 Gut specific cysteine proteinase 48 2 2

Glyco hydro 38 and Alpha- TMUE_s0013011900 mann mid and Glyco hydro 126 2

38C-domain containing protein TMUE_s0037005700 Thioredoxin 18 2 2

Pfam-B 1842 and Pfam-B 3141 and tRNA int end N2 and TMUE_s0005009900 uDENN and DENN and dDENN 231 2

and Pfam-B 2124-domain containing protein Pfam-B 16788-domain TMUE_s0071006300 123 2 containing protein Peptidase S9 prolyl TMUE_s0049001100 150 2 oligopeptidase active site Dsrm-domain containing TMUE_s0011000700 25 2 protein Nascent polypeptide associated TMUE_s0062003000 22 2 complex protein Probable nuclear transport TMUE_s0033004300 15 2 factor nuclear transport factor DEAD and Helicase C and TMUE_s0090002300 dsRNA bind-domain containing 74 2

protein TMUE_s0026000400 Alpha amylase 69 2

Pfam-B 2621-domain TMUE_s0082003700 34 2 containing protein TMUE_s0304000500 Phenylalanine 4 hydroxylase 59 2

120 Table 4.1. List of identified proteins with peak abundance around Superose 12 fractions 24 to 27. The protein content of fractions 23 to 32 was analysed by mass spectrometry. The total spectral count is displayed for each protein in each fraction (criteria set to 95% protein threshold, 50% peptide threshold, minimum 2 peptides identified). Proteins were sorted by spectral count in fraction 26 and those with peak abundance around fractions 24 to 27 are displayed here. Bold indicates proteins that were identified in both the Superose 12 and Superdex 75 chromatography steps. Mw= molecular weight in kDa. Frac = fraction.

121 4.2.2 Fractionation of pool 3 using Superdex 75 gel filtration media

The second size exclusion chromatography step involved fractionation of Superose 12 fractions 24-27 using Superdex 75 gel filtration media, as these fractions were consistent with pool 3 (Figure 3.3). The Superdex 75 and Superose 12 gel filtration media have different molecular size resolution capabilities (202, 203), and therefore they are likely to fractionate material differently. Protein was eluted from the Superdex 75 column across seven fractions (Figure 4.2A and B). Infection-primed lymphocytes were re-stimulated with each of these fractions and supernatant cytokine production was measured by cytometric bead array.

The pattern of IL-13 production by infection-primed lymphocytes in response to the Superdex 75 fractions was very clear; there was a steady increase in IL-13 in response to stimulation with fractions 17 to 21. IL-13 production peaked at fraction 21, and this was followed by a decrease in IL-13 production in response to fractions 22 and 23 (Figure 4.2C). The pattern of IL-9 production by infection- primed lymphocytes was very similar, although cytokine production peaked slightly earlier, at fraction 20 (Figure 4.2D). Naïve lymphocytes produced very little IL-13 and IL-9 in response to stimulation with fractions 17 to 23, again demonstrating that these fractions contain parasite-specific antigens capable of driving Th2 cytokine production during acute infection. The pattern of cytokine production across these fractions was similar for IL-10 and IFN-γ, however, there was no obvious pattern of cytokine production for TNF-α, IL-6 or IL-17A (Figure 4.2).

122 A) UV trace from Superdex 75 B) Protein profile of fractions 17-23 fractionation of pool 3 17 18 19 20 21 22 23

U kDa

A 100 250

m 150 0 80

8 100

80A

t 60

0 50

40608

n 37

a 20

b 40

n r 0 25

t s 10 12 14

b b -20 20

20r

o Volume (ml)

s 15 b 0

A 16 18 20 22 24 26 28 10 Fraction

C) IL-13 production in response to D) IL-9 production in response to fractions 17-23 fractions 17-23 500 200

400

) 150

)

300 /

(

100

(

1 200

I I 50 100

0 0 7 8 9 0 1 2 3 7 8 9 0 1 2 3 1 1 1 2 2 2 2 1 1 1 2 2 2 2 Fraction Fraction

F) IFN-γ production in response to E) IL-10 production in response to fractions 17-23 fractions 17-23 800 2000

) 1500

) 600

(

400 1000

I 200 I 500

0 0 7 8 9 0 1 2 3 7 8 9 0 1 2 3 1 1 1 2 2 2 2 1 1 1 2 2 2 2 Fraction Fraction

G) TNF-α production in response to H) IL-6 production in response to fractions 17-23 fractions 17-23

1000 2500

800 2000

)

/ g 600 1500

(

- 400 6 1000

T 200 500

0 0 7 8 9 0 1 2 3 7 8 9 0 1 2 3 1 1 1 2 2 2 2 1 1 1 2 2 2 2 Fraction Fraction

123

I) IL-17A production in response to fractions 17-23

1000

800

)

g 600

(

7 400

I 200

17 18 19 20 21 22 23 Fraction

Figure 4.2. Cytokine production by infection-primed and naïve lymphocytes in response to Superdex 75 fractions 17 to 23. (A) Shows UV trace (absorbance measured at 280 nm) from Superdex 75 fractionation of pool 3. (B) Shows separation of fractions 17-23 by SDS- PAGE (gel stained with Coomassie blue). Molecular weight markers (in kDa) are shown on left hand side of gel and numbers above gel indicate fraction number. (C-I) Infection-primed and naïve lymphocytes were stimulated with these fractions and supernatant cytokine production was measured by cytometric bead array. Black and grey bars represent cytokine levels secreted by infection-primed and naïve lymphocytes respectively.

The protein content of fractions 17 to 23 was analysed by tandem mass spectrometry of tryptic peptides, and 190 proteins were identified across the seven fractions. For each fraction, a standardised amount of protein (10 μg) was used for mass spectrometry analysis to enable comparison of protein abundance between fractions and spectral count was used as a surrogate for protein abundance (201). A total of 70 proteins were identified whose abundance peaked around fractions 20 to 22, matching the peak in IL-13 and IL-9 levels. These proteins are listed in Table 4.2.

124 Spectral count Frac Frac Frac Frac Frac Frac Frac2 Accession number Protein Mw (kDa) 17 18 19 20 21 22 3 MULE and Pfam-B 516 and WAP-domain TMUE_s0016011400 71 50 68 77 67 13 containing protein TMUE_s000300760 WAP type 'four disulfide core' 41 6 11 34 45 46 37 15 TMUE_s0175001500 54 13 19 39 34 41 9 Porin TMUE_s0256000200 70 2 5 16 27 10 7 Hypothetical protein TMUE_s0090001300 19 26 27 9 Porin TMUE_s0269000200 27 2 11 12 19 14 10 Triosephosphate isomerase TMUE_s0191000800 79 3 8 13 17 4 Trypsin domain containing protein TMUE_s0256000600 48 7 17 7 4 Conserved hypothetical protein TMUE_s0048003500 45 6 13 16 6 5 Serine protease TMUE_s0103000900 23 3 14 4 2 Glutathion S transferase TMUE_s0014006600 15 7 12 9 5 Motile sperm domain containing protein TMUE_s0016004100 177 2 3 9 12 2 Serpin TMUE_s0033003400 37 12 Trypsin domain containing protein TMUE_s0023000300 32 5 10 11 9 5 Pfam-B 9093-domain containing protein TMUE_s0208001600 43 5 4 8 5 11 2 Pathogenesis protein 1B TMUE_s0003017400 48 10 17 11 3 0 Rab GDP dissociation inhibitor alpha TMUE_s0012009900 45 2 4 7 5 10 Hypothetical protein TMUE_s0009001300 21 2 10 4 3 Translationally controlled tumour protein TMUE_s0013010700 57 11 11 10 2 NADH dependent fumarate reductase TMUE_s0177000800 71 6 9 9 4 Heat shock protein 70 TMUE_s0072003400 46 2 7 9 2 2 Independent phosphoglycerate mutase TMUE_s0078002100 41 2 9 Conserved hypothetical protein TMUE_s0047003900 58 4 4 8 2 Cap domain containing protein TMUE_s0006008700 22 3 8 2 Thioredoxin TMUE_s0031002800 17 8 2 Hypothetical protein TMUE_s0005016100 52 2 3 8 Peptidy proly cis trans isomerase FKBP4 TMUE_s0042004400 164 2 5 7 3 Low density lipo receptor repeat

125 TMUE_s0204000100 21 4 3 7 3 2 Motile sperm domain containing protein TMUE_s0003007400 49 2 7 2 2 Peptidase, S1 subfamily TMUE_s0023000500 26 2 7 7 2 Pfam-B 9093-domain containing protein TMUE_s0137001000 43 5 7 5 Hypothetical protein TMUE_s0016007600 23 7 7 2 Hypothetical protein TMUE_s0078004700 20 7 Copper:zinc superoxide dismutase TMUE_s0037003400 41 2 6 6 4 2 Pathogenesis protein 1B TMUE_s0078001400 11 3 5 6 DUF290-domain containing protein TMUE_s0010006100 18 5 6 3 Calmodulin TMUE_s0007005500 121 2 6 Peroxiredoxin 2 TMUE_s0085003400 20 6 Motile sperm domain containing protein TMUE_s0042005600 24 4 5 5 3 Motile sperm domain containing protein TMUE_s002200550 21 3 5 5 2 Eukaryotic elongation factor 1 delta TMUE_s0013012700 14 5 Motile sperm domain containing protein TMUE_s0074002600 75 5 Alcohol dehydrogenase NADP+ A TMUE_s0281000600 202 5 CBM 14 and TIL-domain containing protein TMUE_s0132001200 39 4 4 4 Gut specific cysteine proteinase TMUE_s0004002000 16 4 2 Chymotrypsin inhibitor TMUE_s0014013200 81 2 4 2 Heat shock protein 90 TMUE_s0066002300 16 4 4 Hypothetical protein TMUE_s0133001900 95 3 3 4 Heat shock 70 kDa protein 4 TMUE_s0328000400 19 4 4 Hypothetical protein TMUE_s0004019100 14 2 4 Major sperm protein 1 DDE Tnp IS1595 and Pfam-B 9093-domain TMUE_s0038007500 25 3 3 containing protein TMUE_s0003006100 225 2 3 Hypothetical protein TMUE_s0009000200 19 3 3 Pathogenesis protein 1B TMUE_s0428000200 20 2 3 Lactoylglutathione lyase TMUE_s0007006700 15 3 Chymotrypsin inhibitor TMUE_s0071006300 123 2 3 Pfam-B 16788-domain containing protein TMUE_s0071003300 17 3 TPD52 domain containing protein

126 TMUE_s0146001900 52 3 Trypsin domain containing protein TMUE_s0074002400 37 3 Alcohol dehydrogenase NADP+ A Ion trans 2 and Pfam-B 17708-domain TMUE_s0066001200 132 3 containing protein TMUE_s0045002900 8 2 Serine protease inhibitor Kazal type 4 TMUE_s0024004400 38 2 Conserved hypothetical protein TMUE_s0003007500 15 2 Coagulation factor IX TMUE_s0031002200 39 2 Uncharacterised transposase protein Pfam-B 18137 and Pfam-B 15771 and Pfam-B 9463 and Pfam-B 8674 and Pfam-B 2154 and TMUE_s0136001600 Pfam-B 244 and Pfam-B 19705 and Pfam-B 3092 63 2

and ubiquitin and Pfam-B 9754-domain containing protein TMUE_s0009009900 28 2 Protein asteroid TMUE_s0208000600 25 2 WAP domain containing protein TMUE_s0005009800 91 2 Aminomethyltransferase, mitochondrial TSP 1 and Reeler and Spond N and Peptidase TMUE_s0024001300 124 2 M23 and Kunitz BPTI-domain containing protein TMUE_s0071007100 55 2 Cathepsin F TMUE_s0078001800 15 2 DUF290-domain containing protein

Table 4.2. List of identified proteins with peak abundance around Superdex 75 fractions 20 to 22. The protein content of fractions 17 to 23 was analysed by mass spectrometry. The total spectral count is displayed for each protein in each fraction (criteria set to 95% protein threshold, 50% peptide threshold, minimum 2 peptides identified). Proteins were sorted by spectral count in fraction 21 and those with peak abundance around fractions 20 to 22 are displayed here. Bold text indicates proteins that were identified in both the Superose 12 and Superdex 75 chromatography steps. Mw= molecular weight in kDa. Frac = fraction.

127 4.3 Identification and synthesis of potential immunogenic candidates

Eleven potential immunogenic candidates were selected for further investigation based on the overlap between the 63 candidates identified in the first size exclusion chromatography step (using Superose 12 gel filtration media) and the 70 candidates identified in the second step (using Superdex 75 gel filtration media, Figure 4.3). These proteins are listed in Table 4.3 and highlighted in bold in Tables 4.1 and 4.2.

Figure 4.3. Strategy for selecting immunogenic candidates for further investigation. Eleven potential Step 1 Step 2 immunogenic candidates were identified 11 based on the overlap between the 63 proteins 70 proteins proteins identified from the Superose 12 (step 1) and Superdex 75 (step 2) fractionation steps.

Mw Accession number Protein (kDa) TMUE_s0016004100 Serpin protein 41 TMUE_s0009001300 Translationally controlled tumour protein 21 Ion trans 2 and Pfam-B 17708-domain TMUE_s0066001200 132 containing protein TMUE_s0146001900 Trypsin domain containing protein 52 TMUE_s0016007600 Hypothetical protein 23 TMUE_s0072003400 Independent phosphoglycerate mutase 46 TMUE_s0071003300 TPD52 domain containing protein 17 TMUE_s0132001200 Gut specific cysteine proteinase 39 TMUE_s0428000200 Lactoylglutathione lyase 20 TMUE_s0003017400 Rab GDP dissociation inhibitor alpha 48 TMUE_s0013010700 NADH dependent fumarate reductase 57

Table 4.3. List of potential immunogenic candidates. The list was compiled based on the overlap between the candidates identified in the two size exclusion chromatography steps (with Superose 12 and Superdex 75 gel filtration media). Proteins that were identified in L2 ES are indicated in bold text, while those with no homologue in T. trichiura are displayed in grey. Mw= molecular weight.

128 Ten of the eleven potential immunogenic candidates had homologues in T. trichiura; the Trypsin domain containing protein was the only protein without a direct homologue (indicated in grey, Table 4.3). Four of the eleven candidate proteins were identified in L2 ES: Serpin, Translationally controlled tumour protein, Ion trans 2 and Pfam-B 17708-domain containing protein and Trypsin- domain containing protein (see Appendix 1, Table A1.6 for full list of L2 ES proteins). These are indicated in bold in Table 4.3. The reason for investigating which of these candidates are secreted by L2 larvae is that during acute infection, worms are expelled before they reach patency, suggesting that expulsion is triggered in response to larval components. The data presented in Chapter 3 showed that vaccinating C57BL/6 mice with either L2 or adult ES induced protective immunity. Identifying material shared between L2 and adult ES should aid the search for immunogenic material, and the identification of four of the candidates in L2 larval ES suggests that these proteins could be important immunogenic components secreted by multiple life cycle stages. Although the other candidates were not identified in L2 ES, the possibility that these proteins are present at low levels in L2 ES (below the cut off for mass spectrometry detection) cannot be excluded.

The cDNA for each candidate protein was synthesised and sub-cloned into a pCepHis expression vector (see Appendix 1, Figure A1.1 for sequence). The constructs were amplified in E. coli, purified using a commercially available kit, and HEK293 cells were transfected with each of the constructs. Secreted proteins were purified from the cell culture media collected from transfected HEK293 cells by nickel affinity chromatography, since the expression vector encodes a poly-histidine tag. Fractions eluted from the nickel affinity step were separated by SDS-PAGE and gels were stained with Coomassie blue (left of each panel, Figure 4.4). The fractions containing bands corresponding to the predicted molecular weight for each protein were pooled and the proteins were further purified using Superdex 75 gel filtration media. Protein elution was assessed by UV absorption measured at 280 nm (middle of each panel in Figure 4.4). The resulting fractions were also separated by SDS-PAGE (gels stained with Coomassie blue), as shown on the right of each panel. The identity

129 of each recombinant protein was confirmed by tandem mass spectrometry of tryptic peptides from gel digests (Appendix 2, Tables A2.1-5) and the fractions containing the protein of interest were pooled.

130 Serpin

Nickel affinity chromatography UV trace for Sx75 purification step Gel for Sx75 purification step Serpin Conc. Imidazole (mM) Volume (ml) 2000 20 50 100 200 500 500 500 5 0 .5 .5 .0 .5 .0 .5 0 kDa . 7. 7 10 1 11 2 2 3. m kDa 6 1 1 1 1

n 250 0 1500

8 250

150 150

100 a 100

75 e 1000 c 75

50 b 50

o 500 37 s 37

A 25 0 25 20 20 15 0 5 10 15 20 15 10 Volume (ml) 10

Lactoylglutathione_lyase

Nickel affinity chromatography UV trace for Sx75 purificaLactotion step Gel for Sx75 purification step Conc. Imidazole (mM) 3000 Volume (ml)

20 50 100 200 500 500 500 0 5 0 .5 .0 .0 .0 m . . . 0 kDa 8 8 9 1 11 12 13

kDa

250 0

2 250 2000

150 t

a 150 100 e 100 75 c n 75

b 1000

50 r

o 50

37 b 37

A 25 0 25 20 0 5 10 15 20 20 15 15 10 Volume (ml) 10

Translationally controlled tumour protein

Nickel affinity chromatography UV trace for Sx75 purification step Gel for Sx75 purification step Trans Conc. Imidazole (mM) Volume (ml) 400 20 50 100 200 500 500 500 .5 .0 .5 .0 .5 .0 .5 .0 7 8 8 9 9 10 10 11 m kDa

0 300 8 250

250 2

t 150

150

100 e 200 100

n 75

b r 50 50 o 100

b 37

37 A 0 25 25 0 5 10 15 20 20 20 15 Volume (ml) 15 10 10

TPD52 domain containing protein

Nickel affinity chromatography UV trace for Sx75 purifiTPDcation step Gel for Sx75 purification step Conc. Imidazole (mM) Volume (ml) 200 .5 .0 .5 .5 .0 20 50 100 200 500 500 500 7 8 8 9 10

kDa n kDa

0 150 250 8

2 250

150 a 150

100 e 100

c 100

75 n

a 75

50 o 50

s 50

37 A 37 0 25 0 5 10 15 25 20 20 15 Volume (ml) 15 10 10

131 Hypothetical protein

Nickel affinity chromatography UV trace for Sx75 purification step Gel for Sx75 purification step Hypo Volume (ml) Conc. Imidazole (mM) .5 5 5 0 0 0 2 3. 4. . 7. 8. .0 100 200 500 500 500 300 1 1 1 16 1 1 19 kDa m kDa

250 0

8 250

150 2

200 t 150 100 a

75 e 100

n 75 50 a

b 100

37 o 50

25 A 37 20 0 15 0 5 10 15 20 25 20 Volume (ml) 15 10 10

Figure 4.4. Purification of T. muris recombinant proteins. Histidine-tagged recombinant forms of the candidate proteins were expressed using HEK293 cells. These proteins were purified by nickel affinity followed by size exclusion chromatography. Each panel shows SDS-PAGE separation of nickel affinity fractions (left), UV trace from Superdex 75 purification step (middle) and SDS-PAGE separation of Superdex 75 fractions (right). Sx75= Superdex 75.

In these studies, the HEK293 cells did not express four of the immunogenic candidate proteins (Ion trans 2 and Pfam-B 17708-domain containing protein, Gut specific cysteine proteinase, Independent phosphoglycerate mutase and NADH dependent fumarate reductase), despite multiple transfection attempts. Rab GDP dissociation inhibitor alpha was only expressed at low levels, and therefore it was not possible to test this protein in any vaccination studies, although it did show potential in in vitro assays.

132 4.4 In vitro assessment of the immunogenicity of candidate proteins

The recombinant forms of Translationally controlled tumour protein, TPD52 domain containing protein, Lactoylglutathione lyase and Rab GDP dissociation inhibitor alpha induced IL-13 production by infection-primed lymphocytes (Figure 4.5A), suggesting that these proteins may be recognised by lymphocytes during acute infection and are able to induce Th2 cytokine production. These recombinant proteins also induced IFN-γ, IL-10, IL-6, IL-17A and TNF-α release from infection-primed lymphocytes. For the majority of these proteins, higher levels of each cytokine were measured in the supernatants from infection-primed lymphocytes compared to the naïve supernatants. The exceptions were IL-13 and IL-17A production in response to recombinant Lactoylglutathione lyase. In addition, all of the recombinant proteins induced TNF-α release from naïve lymphocytes.

133 A) IL-13 production in response to B) IFN-γ production in response to stimulation with recombinant T. muris stimulation with recombinant T. muris proteins proteins

S S E E

C) IL-10 production in response to D) IL-6 production in response to stimulation with recombinant T. muris stimulation with recombinant T. muris proteins proteins

S S E E

E) IL-17A production in response to F) TNF-α production in response to stimulation with recombinant T. muris stimulation with recombinant T. muris proteins proteins

S S E E

Figure 4.5. Cytokine release by infection-primed and naïve lymphocytes following stimulation with recombinant proteins. Infection-primed lymphocytes were re-stimulated with recombinant Translationally controlled tumour protein (Trans), TPD52 domain containing protein (TPD), Lactoylglutathione lyase (Lacto) and Rab GDP dissociation inhibitor alpha (Rab). Cells were also incubated with native pool 3 and ES proteins for comparison. Supernatant cytokine levels were measured by cytometric bead array and were compared to those of naïve lymphocytes. Black and grey bars represent cytokine levels secreted by infection-primed and naïve mice respectively.

134 4.5 In vivo assessment of immunogenicity of candidate proteins

In order to assess the protective properties of the recombinant T. muris proteins in vivo, a vaccination study was carried out, whereby male C57BL/6 mice were vaccinated with each protein, either singularly (30 μg of protein, followed by a second vaccination with 15 μg) or a multi-protein vaccination (30 μg of each of the five recombinant proteins, 150 μg in total, followed by a second vaccination with 75 μg of material). All vaccinations were formulated with aluminum hydroxide and mice were infected with 25 T. muris eggs two weeks after the second vaccination (Figure 4.6A). Worm burdens were assessed at day 32 p.i., and were compared to the sham vaccinated mice (vaccinated with aluminum hydroxide diluted in Tris buffer). None of the recombinant proteins were able to protect mice from a subsequent infection when administered as single or multi- protein vaccinations formulated with aluminum hydroxide. In contrast, sterile immunity was achieved for all individuals in the positive control group (vaccinated with ES formulated with aluminum hydroxide, Figure 4.6B).

135

Vaccine 1 Vaccine 2 Low dose infection Sacrifice (Day 0) (Day 14) (Day 28) (Day 32 p.i.)

Single protein vaccinations: 30 µg of recombinant protein

Multi-protein vaccinations: 30 µg of each protein, 150 µg in total

Single protein vaccinations: 15 µg of recombinant protein

Multi-protein vaccinations: 15 µg of each protein, 75 µg in total

B) 20

n 15

W 5

**** 0 m s D to in o in S a n P c p p e E h ra T a r y t S T L e H ro S p i- lt u M Vaccine group

Figure 4.6. Vaccination with recombinant T. muris proteins formulated with aluminum hydroxide does not induce protective immunity in male C57BL/6 mice. (A) Mice, n=5 per group, were vaccinated with recombinant T. muris proteins (either singularly or a combination of all 5 proteins) formulated with aluminum hydroxide. For the single protein vaccinations, mice were vaccinated with 30 μg of protein, followed by a 15 μg boost two weeks later. For the multi- protein vaccinations, mice were vaccinated with a total of 150 μg protein (30 μg of each protein), followed by a 75 μg boost (15 μg of each protein). Mice were infected with 25 T. muris eggs 14 days following the second vaccination. (B) The mean worm burden at day 32 p.i. was compared to that of the sham vaccination group. Sham vaccinations were performed with aluminum hydroxide diluted in Tris buffer. The ‘ES’ group (positive control) represents mice that were vaccinated with 30 μg of ES, followed by a 15 μg boost two weeks later (both formulated with aluminum hydroxide). Error bars represent SEM, **** P < 0.0001. Trans= Translationally controlled tumour protein, TDP= TPD52 domain containing protein, Lacto= Lactyoglutathione lyase, Hypo= Hypothetical protein.

136 Experiments were also carried out to determine whether formulating recombinant proteins with other adjuvants could boost protective immunity. For these experiments, multi-protein vaccinations were administered, consisting of 150 μg of recombinant proteins (30 μg of each of the five proteins), followed by a second and third vaccination with 75 μg of protein, each ten days apart (Figure 4.7A). Vaccinations were formulated with Freund’s adjuvants (CFA for first vaccination, IFA for subsequent vaccinations, Figure 4.7B) or Montanide ISA 720 (Figure 4.7C). These multi-protein vaccinations were unable to protect mice against a subsequent low dose infection (Figure 4.7B and C).

Alongside each of these recombinant protein vaccinations, a group of mice were vaccinated with 30 μg of ES formulated with the appropriate adjuvant, in order to determine the efficacy of these adjuvants when used in combination with a known source of immunogenic material. ES vaccinations formulated with Freund’s adjuvants were able to induce protective immunity, albeit not sterile immunity (Figure 4.7B). ES vaccinations formulated with Montanide ISA 720 afforded mice some protection, however these were not as effective as ES vaccinations formulated with aluminum hydroxide (Figure 4.7C).

137 A)

Vaccine 1 Vaccine 2 Vaccine 3 Low dose infection Sacrifice (Day 0) (Day 10) (Day 20) (Day 30) (Day 32 p.i.)

B) Freund’s vaccination study C) Montanide vaccination study

*** ** *** 25 15 **** 20

d 10

r 15

r m 10

o 5

W W 5

0 0 m ts e m m ts 's m a n id u a n d u h a n l h a n l S n a a n u a i t + S i e + b n b r m o S m F S o M E o + E c c e + e S R S R E E Vaccination group Vaccination group

Figure 4.7. Vaccination with recombinant T. muris proteins formulated with Freund’s adjuvants or Montanide ISA 720 does not induce protective immunity in male C57BL/6 mice. (A) Mice, n=5 per group, were vaccinated with recombinant T. muris proteins formulated with Freund’s adjuvants or Montanide ISA 720. For both experiments, mice were vaccinated with 150 μg of the pooled recombinant proteins (30 μg of each protein, blue bars), followed by two further vaccinations with 75 μg of protein, each ten days apart. Mice were infected with 25 T. muris eggs by oral gavage ten days after the last vaccination, and were sacrificed at day 32 p.i. (B) and (C) show mean worm burden at day 32 p.i. for vaccinations formulated with Freund’s adjuvants and Montanide ISA 720 respectively. Sham vaccinations (grey bars) were performed with adjuvant diluted in Tris buffer, and alongside these vaccinations, a group of mice was vaccinated with 30 μg ES formulated with either Freund’s or Montanide ISA 720 (purple bars). Another group of mice was vaccinated with 30 μg ES formulated with aluminum hydroxide (alum, green bars), as a positive control. The mean worm burden at day 32 p.i. was compared to that of the sham vaccination group, **** P < 0.0001, *** P< 0.001, ** P< 0.01. Error bars indicate SEM.

Although the recombinant protein vaccinations did not induce protective immunity, vaccination with recombinant Translationally controlled tumour protein, TPD52 domain containing protein, Lactoglutathione lyase and Serpin all led to significant induction of IgG1 antibodies specific for that particular protein compared to acutely infected mice, or mice vaccinated with pool 3 (Figure 4.8A-D). This suggests that these recombinant proteins are immunogenic, despite a lack of protective immunity. However, since a high

138 dose infection does not generate IgG1 antibodies capable of binding these recombinant proteins (nor does vaccination with pool 3), the conformation of the recombinant proteins may be different to the native proteins.

A) IgG1 antibody response to B) IgG1 antibody response to TPD52 TranslSerumationa responselly contr againstolled tu Tmransour protein domaiSerumn con responsetaining p againstrotein TPD52 0.5 ** 1.0 * 0.4 0.8

. 0.3 . 0.6

O 0.2 O 0.4

0.1 0.2

0.0 0.0 n d d n d d o te te o ti a a ti te te c n n c a a fe i i in in n c c fe c c i c c n c c e a a i a a s v v e v v o 3 s s l n o 3 d o a d l PD h r o T g Po T h i ig Po H H Source of serum Source of serum

C) IgG1 antibody response to D) IgG1 antibody response to Serpin LactoySerumlgluta responsethione lyase against Lacto Serpin

1.5 1.5

**** **** 1.0 1.0

O 0.5 0.5

0.0 0.0 n d d n d d o o te te ti te te ti a a c a a c n n in in fe i i fe c c n c c in c c i c c a a e a a e v v s v v s 3 o 3 n o l to d l i d c o rp h o a h ig Po L ig Po Se H H Source of serum Source of serum

Figure 4.8. Vaccination with T. muris recombinant proteins induced production of IgG1 antibodies specific for these proteins. IgG1 antibodies specific for Translationally controlled tumour protein (A), TPD52 domain containing protein (B), Lactoylglutathione lyase (C) and Serpin (D) were measured in sera from infected (high dose) mice, pool 3 vaccinated mice, or mice vaccinated with each of the recombinant proteins (single protein vaccinations formulated with aluminum hydroxide). IgG1 serum antibody levels were measured for each individual by ELISA (reading at 405 nm) and graphs show mean antibody titres at 1:40 serum dilution. Error bars show SEM, * P < 0.05, ** P < 0.01, **** P < 0.0001. Trans= Translationally controlled tumour protein, TDP= TPD52 domain containing protein, Lacto= Lactyoglutathione lyase.

139 4.6 Discussion

This chapter describes the process by which immunogenic candidates were identified using a combination of gel filtration chromatography, in vitro re-stimulation assays and mass spectrometry. Similar approaches were used by Jenkins and colleagues to search for T. muris antigens (28), and by Santos and co-workers to identify immunomodulatory material within T. trichiura homogenate (204). Vaccine candidates for other gastrointestinal helminths have been identified using antibody-based screening methods, whereby immune sera (and other sources of protective antibodies) were used to probe for antigenic material. For example, Pearson and colleagues identified a number of S. mansoni vaccine candidates using sera from DIR individuals and naturally resistant rhesus macaques (27). These candidates included Sm-TSP-1, which is currently undergoing Phase I clinical trials (27). Redmond and co-workers identified potential vaccine candidates within T. circumcincta larval secretions, including a cathepsin F protein (Tci-CF-1), a 20 kDa protein of unknown function (Tci-ES20), an astacin-like metalloproteinase-1 (Tci-MEP) and an activation-associated secretory protein-1 (Tci-ASP-1) by probing with IgA antibodies in the gastric lymph of infected sheep (205, 206). These proteins have been used as part of an effective multivalent vaccination for sheep, where vaccinated animals showed significant reductions in worm burden and egg output compared to unvaccinated controls (206). Highly effective vaccines against Taenia parasites have also been developed using antibody-based screening methods (98). Clearly, antibody-based screening approaches have been greatly successful for identifying vaccine candidates for these parasites, however such an approach may not be effective for T. muris, given that worm expulsion is not antibody mediated (39, 42, 207).

Instead of using antibodies from pre-immune animals to identify protective antigens, the approach used in this thesis has focussed on identifying material capable of inducing Th2 cytokine release in the context of acute infection. The experiments carried out in this chapter have centred on material that had previously been demonstrated to induce protective immunity both in vitro and

140 in vivo (pool 3). Eleven immunogenic candidates were identified, and ten of these candidates had direct homologues in T. trichiura, which emphasises the potential for the T. muris model to inform vaccine design for T. trichiura. For most proteins, the amino acid sequence was highly conserved between T. muris and T. trichiura, with the majority of proteins sharing between 40 and 90% sequence homology over 85 to 95% of the sequence (see Appendix 2, Table A2.6). Five of the ten recombinants were expressed and purified without difficulty, however four of the proteins were not expressed at all, and the Rab GDP dissociation inhibitor alpha protein (TMUE_s0003017400) was expressed at low levels. For those proteins lacking expression by HEK293 cells, the transfections were repeated a total of three times, however, expression did not improve with these attempts. The Ion trans 2 and Pfam-B 17708-domain containing protein was very large (an estimated 132 kDa), which may explain why it was difficult to express. The protein sequence of Ion trans 2 and Pfam-B 17708-domain containing protein (TMUE_s0066001200) was searched against all organisms using the BLAST protein search tool, and the results revealed that the predicted protein sequence listed in the T. muris database may have arisen by incorrectly pairing together two proteins (see Appendix 2, Figure A2.1). The search results revealed homology between the C-terminal portion (approximately amino acids 780 to 1200) and ion transporter proteins of other trichocephalid parasites (Appendix 2, Table A2.7). In future, attempts should be carried out to express the C-terminal portion of the protein.

Another reason why expression may have failed was that the proteins were toxic to the cells, although for the most part the cells appeared to be viable. To rule out that these proteins were being expressed but not released from cells, transfected cells were lysed with Ripa buffer and Western blotting was carried out with a His-probe to determine whether the His-tagged proteins were present within the lysis material, however no His-tagged proteins were detected (data not shown). In future, alternative expression systems should be investigated, to determine whether these cells are capable of expressing the four proteins. Yeast, insect cells and tobacco plants all warrant further investigation, as these expression systems have been used to express recombinant proteins for other

141 parasitic helminths (102, 105). For example, recombinant Na-GST-1 from the hookworm N. americanus was expressed using Pichia pastoris, while the S. mansoni protein, Sm14, was expressed using Saccharomyces cerevisiae (23, 104). Spodpotera frugiperda Sf9 insect cells were used to express N. americanus ASP-2, and tobacco plants were used to express Na-APR-1 (100, 101). Protein yield is also an important consideration when choosing a protein expression system (208). This is of particular importance for T. muris recombinant proteins, given that there were issues with protein yield for the Rab GDP dissociation inhibitor alpha protein. Goud and colleagues report that 1.5 g of Na-GST-1 were purified from 20 litres of P. pastoris culture, demonstrating that this is an effective expression system for purifying large quantities of recombinant helminth proteins (104). E. coli have also been used to express recombinant T. circumcincta proteins (206), although bacterial expression is not always suitable for expression of helminth proteins, as exemplified by O. ostertagi (discussed below) (209).

The recombinant proteins were first tested for their ability to stimulate Th2 cytokine release from infection-primed lymphocytes in vitro. Four proteins induced IL-13 release from infection-primed cells – these were Translationally controlled tumour protein, TPD52 domain containing protein, Lactoylglutathione lyase and Rab GDP dissociation inhibitor alpha. Equally high levels of IL-13 were produced in response to each recombinant protein compared to pool 3. This is particularly striking given that there are likely to be relatively fewer T cells specific for each recombinant protein, compared to the number of T cells capable of recognising material within pool 3. The recombinant proteins were then tested in vaccination studies, however none of the proteins could protect mice from a subsequent low dose infection, when administered as single or multi-protein vaccinations formulated with a range of adjuvants. One possibility for the lack of protection conferred by vaccination with the recombinant proteins was that the post-translational modification of proteins by HEK293 cells was different to the modifications added to the native proteins. Little is known about the post-translational modifications of Trichuris parasites, however a recent report found that T. suis had some distinctive post-translational modifications,

142 for example glycans carrying N,N′-diacetyllactosamine (LacdiNAc) modified by phosphorylcholine and/or fucose, as well a number of typical invertebrate glycan modifications such as paucimannosidic and oligomannosidic N-glycans (210, 211). Further characterisation of the glycome of Trichuris parasites is required to enable researchers to choose the most appropriate expression system (210).

Other gastrointestinal nematode vaccine projects have encountered similar problems translating native antigens into an effective recombinant vaccine. These include vaccines for H. contortus, the barber’s pole worm of sheep, and O. ostertagi, the brown stomach worm of cattle (209). Following the partial success of an irradiated larvae vaccine for H. contortus, work began on the so-called ‘hidden’ gut membrane antigens (212-214). H. contortus is a blood- feeding parasite and therefore the rationale for this vaccination approach was based on inducing antibodies to gut membrane antigens, leading to damage of these intestinal components upon ingestion of host blood, reduced worm viability and parasite expulsion (209). Initial studies showed that native antigen combinations were highly protective (213, 214). Detailed studies were then carried out on the major components of this gut membrane preparation, an aminopeptidase called H11 and a galactose containing glycoprotein complex H-gal-GP (215-217). Vaccination with the native H11 protein lead to 95% reduction in egg output and around 90% reduction in worm burden, while vaccination with native H-gal-GP lead to 93% reduction in egg output and 72% reduction in worm burden (215-217). These studies clearly show the therapeutic potential of native forms of these proteins, however, recombinant forms of these proteins failed to induce consistent protection when administered as vaccines (218-220). Since then, a vaccine based on the native gut proteins, Barbervax, has launched in Australia, and H11 and H-gal-GP are predicted to be the key protective components (209). The vaccine requires purifying these components from worms extracted from experimentally infected sheep (209). H. contortus ES proteins are now being explored as potential vaccine candidates, in the hope that this will identify alternative vaccine candidates that will be more effective as recombinant protein vaccines (209).

143 The main focus for vaccine design for O. ostertagia has been the activation- associated secretory proteases (ASPs) (221, 222). However, despite success with native ASP proteins purified from O. ostertagi and Cooperia oncophora (a related gastrointestinal nematode), recombinant ASPs expressed by E. coli conferred poor protection against infection challenge (209). The authors postulate that this could be due to inappropriate folding of the protein backbone and a lack of protein glycosylation (209). However, technologies to engineer P. pastoria to add complex mammalian glycosylation patterns during recombinant protein expression are becoming available (223, 224), and this technology could be applied to helminth recombinant protein expression, although this would require more in depth knowledge of N- and O-linked glycosylation patterns in helminths (209). In addition, attempts have been made to express helminth proteins (the H11 protein of H. contortus) using the free-living nematode, C. elegans (225). However, immunization with recombinant H11 purified from C. elegans did not reduce egg output or worm burden following infection challenge, and low quantities of protein were expressed (225), which may prevent this strategy being used for other helminth vaccines.

The first recombinant vaccinations described in this chapter were formulated with aluminum hydroxide, since data presented in Chapter 3 showed that it is an effective adjuvant for vaccinations involving native T. muris proteins. Aluminum hydroxide has also been used for experimental H. polygyrus ES and ELV vaccinations, for Phase I clinical trials for the hookworm vaccine candidates, Na-GST-1 and Na-APR-1, and for clinical studies with the S. mansoni vaccine candidate, rSh28GST, suggesting that it is a suitable adjuvant for inducing Th2 immunity against helminths (23, 100, 155). After finding that the recombinant T. muris protein vaccines formulated with aluminum hydroxide failed to induce protective immunity, alternatives were sought. Freund’s adjuvants were selected as Jenkins and colleagues showed that ES vaccinations formulated with CFA were highly effective (28). CFA is considered one of the most potent adjuvants, inducing strong T and B cell responses (135), and therefore it was decided that CFA should be investigated as an adjuvant for the recombinant

144 protein vaccines, despite it not being licenced for use in humans (135). CFA is an oil-in-water emulsion, however, recently water-in-oil alternatives (such as Montanide ISA 51 and ISA 720), which have better safety profiles due to the reduced oil content, have been developed (135). Since Montanide ISA 720 is licenced for use in humans (226) and was used in pre-clinical vaccine studies involving schistosome cathepsin B, where vaccination reduced worm burden by 60% compared to sham vaccinated control mice (142), the potential for this novel adjuvant to boost antigenicity when formulated with a mixture of the T. muris recombinant proteins was investigated.

Montanide ISA 720 is thought to exert its adjuvant effects through slowly releasing antigen over time, aiding diffusion of antigen to draining lymph nodes and recruiting antigen presenting cells (227). Montanide ISA 720 has been used in several phase I clinical trials for malaria vaccine candidates, which have emphasised the safety and immunogenicity of this adjuvant, inducing anti-recombinant IgG1 and IgG3 antibodies in healthy volunteers with no previous exposure to Plasmodium parasites (139-141, 226, 228). Montanide ISA 720 has also been used as an adjuvant for Phase I and pre-clinical Epstein-Barr, hepatitis C and simian immunodeficiency virus (SIV) peptide vaccinations (136-138). Interestingly, four of the adults who volunteered for the Epstein-Barr Phase I trial later encountered the virus and seroconverted asymptomatically, while the SIV vaccination protected a third of rhesus macaques from a subsequent SIV infection (136, 138).

These studies demonstrate that Montanide ISA 720 is a safe and effective adjuvant in the context of these infections, however when this adjuvant was formulated with T. muris ES, it did not perform as well as aluminum hydroxide or Freund’s adjuvants (Figure 4.7). Despite this, ES vaccinations formulated with Montanide ISA 720 induced a robust anti-parasite IgG1 antibody response, as well as a strong anti-parasite IgG2a antibody response (Appendix 2, Figures A2.2 and A2.3). However, the multi-protein recombinant vaccinations formulated with either Montanide ISA 720 or Freund’s adjuvants were unable to protect mice from a subsequent T. muris infection (Figure 4.7).

145 The lack of protective immunity following vaccination with recombinant T. muris antigenic candidates was surprising given that some of the proteins induced IL-13 production from infection-primed lymphocytes in vitro, which would suggest that these proteins are capable of inducing Th2 cytokine production in the context of an acute infection. Vaccination did, however, induce production of IgG1 antibodies specific for each of the recombinant proteins, which further suggesting that these proteins are antigenic. These studies emphasise the difference between antigenicity and protection. Clearly, the recombinant proteins are antigenic, as they induce Th2 cytokine release in the context of acute infection, however administration of these recombinant proteins in vaccines did not protect mice against subsequent infection.

The anti-parasite IgG antibody response is mainly skewed towards IgG2a following vaccination with the recombinant proteins (Appendix 2, Figure A2.4 to A2.7), and therefore it is surprising that IgG1 antibodies were generated against each of the recombinant proteins following vaccination, particularly as IgG1 class switching is largely regulated by a Th2 cytokine environment (75). Little or no anti-recombinant IgG1 antibodies were measured in the serum of infected (high dose) or pool 3 vaccinated mice, which may suggest that the conformation of the recombinant proteins is different to that of the native proteins. However, conformation is arguably less important for stimulating T cells, as antigen presenting cells present peptides to T cells (229). Low levels of anti- recombinant IgG2a antibodies were detected in the sera of recombinant- vaccinated animals, and could also be detected (in some cases) in the sera of infected (high dose) and pool 3 vaccinated mice (Appendix 2, Figure A2.8). Future experiments should investigate whether sera from recombinant vaccine recipients (prior to infection) recognises native parasite antigen, as this may shed light on whether the recombinant proteins are folded correctly.

Antigenic homologues of Gut specific cysteine proteinase and Independent phosphoglycerate mutase, both of which HEK293 cells were unable to express, have been identified in other helminths. Vermeire and colleagues showed that treating A. ceylanicum infected hamsters orally with cysteine proteinase

146 inhibitors reduced worm burdens by over 90%, while an older study showed that vaccinating dogs with a recombinant A. caninum cysteine protease induced IgG antibodies capable of binding to (and presumably neutralising) native cysteine proteases in the gut of worms (230, 231). Little is known about the feeding processes of Trichuris parasites (33), however gut cysteine proteinases may be involved in the breakdown of nutrients by the worm, and therefore targeting these may reduce the viability of the parasite.

The immunogenic potential of B. malayi Independent phosphoglycerate mutase is highlighted by vaccination and RNA interference experiments (232, 233). Vaccination with recombinant B. malayi Independent phosphoglycerate mutase protected BALB/c mice from a subsequent infection, with a 58% reduction in worm burden, while RNA silencing of Independent phosphoglycerate mutase in female adult worms resulted in a 90% decrease in worm motility and an 80% reduction in the number of microfilariae released (232, 233). Furthermore, only 55% of L3 larvae treated with Independent phosphoglycerate mutase-specific siRNA survived to adulthood, suggesting that this protein plays an important role across several life cycle stages (233).

In addition to investigating alternative expression systems in order to identify a suitable platform for expression of those antigenic candidates which HEK293 cells were unable to express, another round of antigen selection could be carried out in order to identify other potential candidates. For example pool 4 could be investigated further, since this material was also effective at stimulating protective immunity as shown in Chapter 3. Pool 4 arose from pooling Superdex 12 fractions 29 to 32, which is where the second peak in IL-13 production was observed (Figure 4.1C), and these fractions also induce IL-9 production from infection-primed lymphocytes (Figure 4.1D). It may also be advantageous to investigate Superose 12 fraction 28 as this stimulated high levels of IL-9 and IL-13 production from infection-primed lymphocytes, however a larger amount of starting material (ES) would be required to do so. Another potential source of antigens are T. muris ELVs – this will be discussed in more detail in Chapter 5.

147

Chapter 5: T. muris ELVs as a source of immunogenic material

148 5.1 Chapter introduction

ELVs have been isolated from the secretions of several parasitic nematodes, including Trichuris species, H. polygyrus and B. malayi (154, 165, 179, 180). There are numerous reports describing the ability of parasite-derived ELVs to stimulate and/or modulate host immunity (165, 169, 173). In addition, recent studies have described the potential for helminth-derived ELVs as vaccine candidates (155, 156). The majority of pre-clinical helminth vaccinations are based on material identified within parasite homogenates or the soluble portion of parasite secretions (27, 28, 108, 109, 115), while the potential for parasite- derived ELVs as a source of protective antigens remains relatively unexplored. This chapter aims to address this, showing for the first time that vaccination with T. muris ELVs can protect mice against a subsequent low dose infection in the absence of adjuvant.

5.2 ELVs can be isolated from T. muris ES by ultracentrifugation

ELVs were isolated from adult T. muris ES by ultracentrifugation at 100,000 g for 2 hours. Pelleted material was viewed by transmission electron microscopy, and a heterogeneous population of cup-shaped vesicles, approximately 30-100 nm diameter, was observed (Figure 5.1).

Figure 5.1. Visualisation of ELVs isolated from T. muris ES. ELVs were isolated from T. muris ES by ultracentrifugation at 100,000 g. The pelleted material was transferred to formvar-carbon-coated EM grids and negatively stained with 2% uranyl acetate for TEM analysis. Images displayed are representative of three preps. Scale bars represent 100 nm.

149 The size range of a typical T. muris ELV sample as measured by DLS is shown in Figure 5.2. The raw scattering intensity as defined by the z-average intensity plot showed two major peaks below 1 µM (those above this value are deemed to be aggregates or dust particles) (160). The major scattering peak was at ~ 200 nm in diameter with a smaller intensity peak at ~ 40 nm (Figure 5.2A). De-convolution to a distribution by number, which is a direct comparison of the number of particles of each peak distribution according to Mei Theory (186), showed that the majority of vesicles (82%) are between 37 and 60 nm in diameter (Figure 5.2B). The raw correlation data showed a smooth single exponential decay function (Figure 5.2C), indicating that ELVs were evenly dispersed within the sample with low overall polydispersity (186).

Figure 5.2. Size range of a typical T. muris ELV sample. DLS was used to measure the diameter of particles within ELV samples. (A) Shows the z-average intensity plot, (B) Shows size distribution (diameter) by number, and (C) shows raw correlation data.

150 5.3 Mass spectrometry analysis shows that T. muris ELVs contain typical exosome markers and are enriched in proteins lacking a signal peptide

A number of known of exosome markers were identified within T. muris ELV samples (Table 5.1). These include tetraspanins (tetraspanin 9 and TSP-1 domain containing protein), heat shock proteins, enolase, Rab proteins and apoptosis linked gene 2 interacting protein X 1 (Alix) (157, 165). These data strongly suggest that the vesicles isolated by ultracentrifugation of adult ES are exosomes.

No. of peptides Mw Sample Sample Sample Accession Number Protein (kDa) 1 2 3 TMUE_s0037005100 Tetraspanin 9 43 0 5 4 TSP-1 domain TMUE_s0070003500 46 3 5 3 containing protein TMUE_s0177000800 Heat shock protein 70 71 4 9 5 TMUE_s0014013200 Heat shock protein 90 81 2 6 2 Small heat shock TMUE_s0203001300 16 0 2 6 protein TMUE_s0102000900 Enolase 48 3 5 2 TMUE_s0163002000 Ras protein Rab 11B 31 0 2 2 Apoptosis linked gene TMUE_s0078002300 2 interacting protein X 122 0 2 0 1 (Alix)

Table 5.1. List of exosome markers identified in T. muris ELV samples. The protein content of T. muris ELVs was analysed by mass spectrometry. Table shows known exosome markers identified within T. muris ELV samples. Mw= molecular weight. No. of peptides= number of unique peptides identified in each ELV sample (samples 1-3, criteria set to 95% protein threshold, 50% peptide threshold, minimum 2 peptides identified).

Comparison of the protein content of T. muris ES and ELVs revealed that 77% of ELV proteins were also identified within ES depleted of ELVs, and 65% of these lack a signal peptide (Table 5.2, see Appendix 3, Table A3.1 for full list of ELV proteins). This suggests that ELVs may be an important mechanism by which proteins lacking a signal peptide are released by parasites into the external environment.

151 Signal Mw Accession Number Protein peptide (kDa) (Y/N) VWD and Vitellogenin N and DUF1943-domain TMUE_s0245000500 190 Y containing protein TMUE_s0134000500 CAP domain containing protein 32 Y TMUE_s0049005700 Protein crumbs 382 N TMUE_s0004007100 Trypsin domain containing protein 107 Y TMUE_s0052001100 Hypothetical protein 38 Y TMUE_s0093001800 Vacuolar protein sorting associated protein 52 175 N TMUE_s0175000100 Pfam-B 9093 domain containing protein 34 N TMUE_s0003000700 Histone H4 11 N TMUE_s0029005700 Actin 42 N TMUE_s0071005500 Angiotensin converting enzyme 153 N TMUE_s0201000900 Pfam-B 9093 domain containing protein 39 Y TMUE_s0028000200 Phosphoenolpyruvate carboxykinase GTP 80 N TMUE_s0033001500 CAP domain containing protein 40 Y TMUE_s0175000200 Pfam-B 9093 domain containing protein 37 Y TMUE_s0091002200 Fasciclin domain containing protein 81 Y TMUE_s0177000800 Heat shock protein 70 71 N TMUE_s0005010900 Neurogenic locus notch protein 367 Y TMUE_s0003006100 Hypothetical protein 225 Y TMUE_s0033006300 Hypothetical protein 40 Y TMUE_s0094001000 Glyceraldehyde 3 phosphate dehydrogenase 41 N TMUE_s0004006800 Trypsin domain containing protein 129 Y TMUE_s0042005600 Motile sperm domain containing protein 24 N TMUE_s0173000900 Delta protein 4 54 N Vitellogenin N and VWD and C8 and DUF1943 TMUE_s0002015700 354 Y domain containing protein TMUE_s0001012400 Phosphoprotein phosphatase 1 86 N TMUE_s0003006600 Pfam B 13663 domain containing protein 164 Y TMUE_s0147001700 Hypothetical protein 15 Y TMUE_s0302000300 Fructose bisphosphate aldolase class I 44 N TMUE_s0022011000 Hypothetical protein 21 N TMUE_s0119001000 Membrane metallo endopeptidase 1 like protein 173 N TMUE_s0001012300 Hypothetical protein 39 Y TMUE_s0062004700 Ubiquitin domain containing protein 95 N TMUE_s0049001500 Trypsin domain containing protein 139 N TMUE_s0037005100 Tetraspanin 9 43 N TMUE_s0117003000 Eukaryotic translation elongation factor 1A 49 N TMUE_s0014013200 Heat shock protein 90 81 N TMUE_s0027006600 ASP domain containing protein 44 N TMUE_s0102000900 Enolase 48 N TMUE_s0106000600 Moesin:ezrin:radixin 1 69 N TMUE_s0019006300 Hypothetical protein 39 Y

152 TMUE_s0008014600 Hypothetical protein 34 N TMUE_s0157001800 Trans 2 enoyl coenzyme A reductase 32 N TMUE_s0053003800 Trypsin domain containing protein 33 Y TMUE_s0022000400 Na+,K+ ATPase alpha subunit 1 118 N TMUE_s0037003800 NADP dependent malic enzyme, mitochondrial 71 N TMUE_s0327000100 Pfam-B 9093 domain containing protein 39 Y TMUE_s0042008400 Peptidase M2 domain containing protein 40 N TMUE_s0070003500 TSP-1 domain containing protein 46 N TMUE_s0024002900 Hypothetical protein 32 Y TMUE_s0049001600 Trypsin domain containing protein 215 N TMUE_s0120000600 Tubulin alpha chain 50 N TMUE_s0028001200 VAB 10a protein 829 Y TMUE_s0060000200 Prominin domain containing protein 76 Y TMUE_s0117002800 Trypsin and CUB domain containing protein 71 N TMUE_s0201000800 Conserved hypothetical protein 51 N TMUE_s0191000800 Trypsin domain containing protein 79 Y TMUE_s0005001100 Kunitz protease inhibitor 25 Y TMUE_s0006000700 Solute carrier family 2, facilitated glucose 62 N TMUE_s0281000600 CBM 14 and TIL domain containing protein 202 N TMUE_s0116002200 Ubiquitin associated and SH3 41 N TMUE_s0064002700 Hypothetical protein 27 N TMUE_s0037003400 Pathogenesis protein 1B 41 N TMUE_s0189001400 Neurogenic locus notch protein 54 Y TMUE_s0012010600 EGF domain containing protein 78 N TMUE_s0014006600 Motile sperm domain containing protein 15 Y TMUE_s0086000700 78 kDa glucose regulated protein 73 Y TMUE_s0009007500 14-3-3 protein 28 N TMUE_s0013012700 Motile sperm domain containing protein 14 N TMUE_s0033006400 CAP domain containing protein 35 Y TMUE_s0096005200 Ubiquitin associated and SH3 protein 39 N TMUE_s0007005500 Peroxiredoxin 2 121 N TMUE_s0001022900 Conserved hypothetical protein 40 N TMUE_s0089001100 Conserved hypothetical protein 54 Y TMUE_s0006008700 Thioredoxin 22 Y TMUE_s0022008100 BTB domain containing protein 41 N TMUE_s0038006700 32 kDa beta galactoside binding lectin 39 N TMUE_s0058002600 Hypothetical protein 25 N TMUE_s0030008500 Conserved hypothetical protein 36 N TMUE_s0005011400 Peptidyl prolyl cis trans isomerase 7 23 N TMUE_s0023004600 Pfam-B 9093 domain containing protein 27 N TMUE_s0081001900 Protein disulfide isomerase 55 Y TMUE_s0015006100 Peptidase M8 domain containing protein 50 N TMUE_s0058002100 Conserved hypothetical protein 26 N TMUE_s0122001100 Pol poly protein 43 N

153 Pfam-B 18698 and PLAT and DCX domain TMUE_s0002004000 118 N containing protein TMUE_s0291000100 Prominin domain containing protein 36 N TMUE_s0012010900 Neurogenic locus notch protein 43 Y TMUE_s0131003400 Hypothetical protein 23 N TMUE_s0005004200 Malate dehydrogenase 39 N TMUE_s0036001700 Conserved hypothetical protein 37 N TMUE_s0104001300 Hypothetical protein 10 N TMUE_s0119002100 Galectin 31 N TMUE_s0004012300 LIM domain containing protein 24 N TMUE_s0041006400 Hypothetical protein 33 Y TMUE_s0034006900 T complex protein 1 subunit beta 58 N TMUE_s0172001800 CH domain containing protein 41 N

Table 5.2. List of shared ELV and adult ES proteins. A comparison of the proteins identified within T. muris ELVs and ES (depleted on ELVs) was carried out. Table shows list of shared proteins. Table also indicates whether each protein has a signal peptide (Y/N = yes and no respectively). Mw = molecular weight in kDa.

5.4 Exosomes are able to fuse with colonic epithelial cells in vitro

Marcilla and colleagues demonstrated that E. caproni ELVs were able to fuse with rat intestinal epithelial cells in vitro, suggesting that these ELVs could deliver protective antigens and/or immunomodulatory material to host cells in vivo (152). T. muris is in constant contact with the caecal epithelium during infection (35), and therefore the potential for T. muris ELVs to fuse with intestinal epithelial cells in vitro was investigated. This involved labeling ELVs with a red fluorescent dye, PKH26, which integrates into the phospholipid bilayer of vesicles (234). The fluorescently labeled ELVs were then incubated with HT-29 cells (a human colonic epithelial cell line) for 4 hours and vesicle uptake was visualised by confocal microscopy. Fluorescently labeled vesicles were observed inside HT-29 cells (Figure 5.3), suggesting that uptake of T. muris ELVs by caecal epithelial cells may be possible during infection.

154 Brightfield 543 nm excitation Merge

Figure 5.3. Uptake of PKH26 labeled ELVs by colonic epithelial (HT-29) cells. +Exo 1 and 2 show representative areas of the HT-29 monolayer after incubation with fluorescently labeled ELVs, while control image was taken after incubation with the fluorescent dye alone. Exo 1 and Exo 2 refer to two separate experiments. Left of each panel shows bright field Z-stack of HT-29 monolayer after addition of PKH26 labeled vesicles, middle of each panel shows fluorescence microscopy images (543 nm excitation), right of each panel show bright field and fluorescence channels merged. Scale bars represent 10 μm.

155 5.5 Vaccination with T. muris ELVs can induce protective immunity and protection is dependent on intact vesicles

In order to investigate whether T. muris ELVs contain antigenic material capable of stimulating protective immunity, male C57BL/6 mice were subcutaneously vaccinated with 3 μg of ELV material, followed by 1.5 μg of material two weeks later (these vaccinations were formulated without adjuvant). Mice were infected with 25 T. muris eggs by oral gavage and worm burden was assessed at day 32 p.i. Vaccination with T. muris ELVs lead to a statistically significant reduction in worm burden compared to the sham vaccination group (vaccinated with PBS only, P= 0.0001, Figure 5.4). However, vaccination did not induce sterile immunity for all individuals. The data shown in Figure 5.4 is the result of combining three individual vaccination studies. For each study, there were a number of mice that expelled worms following vaccination, some individuals who developed chronic infection, and one or two mice where some, but not all, worms were expelled. As a result, the protection afforded by ELV vaccination was more variable than that induced by vaccination with 30 μg ES formulated with aluminum hydroxide, which was used as a positive control (Figure 5.4). The mean worm burden for mice vaccinated with lysed ELVs was similar to that of the sham vaccination group (P=0.0754, Figure 5.4), suggesting that the protective properties of T. muris ELVs are dependent on intact vesicles.

**** NS Figure 5.4. Vaccination with T. muris ELVs **** induces protective immunity. Male C57BL/6 20 mice, n= 10 to 15 per group, were subcutaneously vaccinated with 3 μg of ELVs or lysed ELVs, followed by 1.5 μg of material 14 n 15 e days later. Mice were infected with 25 T. muris

u eggs by oral gavage and sacrificed at day 32 p.i.

b 10 to assess worm burden. The mean worm burden

o of ELV (and lysed ELV) vaccinated mice was

W 5 compared to the sham vaccination group (vaccinated with PBS only). As a positive control, mice were vaccinated with 30 μg followed by 0 15 μg of ES (formulated with aluminum m s s S a V V E h L L hydroxide). The results displayed are a S E E d e combination of three independent experiments. s y L Error bars indicate SEM, central bar shows Vaccination group mean. **** P= 0.0001, NS= non-significant.

156 5.6 Vaccination with ELVs boosts IgG1 serum antibody response to soluble ES components

As discussed previously, anti-parasite IgG1 and IgG2a/c serum antibodies are often used as surrogate markers of resistance/chronicity during T. muris infection (29). The serum IgG1 and IgG2a antibody response against ES depleted of ELVs was measured for each vaccination group. Significantly higher IgG1 antibody levels (which correlate with resistance) were measured for the ELV vaccination group compared to the sham vaccination group (P= 0.0001, Figure 3A). High levels of anti-parasite IgG2a/c, which correlates with chronicity, were also measured for the ELV vaccination group (Figure 3B), which may suggest that ELV vaccinated mice mount a mixed Th1/Th2 response. High levels of anti-parasite IgG1 (Figure 3A) and low levels of anti-parasite IgG2a (Figure 3B) were detected for the ES vaccination group, confirming that successful vaccination stimulates Th2 immunity, while high levels of anti- parasite IgG2a antibodies were measured for the sham vaccination group, confirming that low dose infection naturally primes for chronicity (Figure 3B).

A) IgG1 to response to ES depleted of ELVs B) IgG2a response to ES depleted of ELVs

**** NS 2.0 2.0 **** ***

1.5 1.5

. 1.0 . 1.0

0.5 0.5

0.0 0.0 m s S m s S a V E a V E h L h L S E S E Vaccination group Vaccination group

Figure 5.5. IgG1 and IgG2a serum antibody response against ES following vaccination with ELVs. The IgG1 (A) and IgG2a (B) serum antibody response targeting ES depleted of ELVs was measured by ELISA. The mean O.D. value (reading at 405 nm) for each vaccination group (sham, ELV or ES vaccinated mice, 10 per group) is shown at 1:320 (IgG1) and 1:40 (IgG2a) serum dilution. Error bars show SEM, **** P< 0.0001, *** P< 0.001, NS= non-significant.

157 5.7 Identification of ELV components targeted by serum IgG antibodies following vaccination

Western blotting was performed to investigate which ELV and ES components are bound by serum IgG antibodies following vaccination of mice with PBS (sham), ELVs or adult ES and subsequent T. muris infection (Figure 3A-C). Infection alone does not generate IgG antibodies against ELV material (Figure 5.6A), however vaccination with ELVs primes for IgG antibodies that target a range of ELV components between 50 and 200 kDa in size (indicated by asterisks on Figure 5.6B). Sera collected from the ES vaccination group contained IgG antibodies that target 80 and 100 kDa ELV components (indicated by asterisks on Figure 5.6C). Sera taken from all three groups also recognised a wide range of ES components (Figure 5.6A-C).

A) Sham vaccination group B) ELV vaccination group C) ES vaccination roup D) SDS-PAGE separation of ELVs and ES ELVs ELVs ELVs ELVs ES 1 2 ES 1 2 ES 1 2 ES kDa kDa kDa kDa 250 250 250 250 * 150 150 150 150 * 100 * 100 100 100 * 75 * 75 * 75 75 *

50 50 * 50 50 37 37 37 37

25 25 25 25 20 20 20 20 15 15 10 15 15 10 10 10 Figure 5.6. Western blots showing anti-ELV and anti-ES serum IgG response for sham, ELV and ES vaccination groups. For each blot, ELV and ES components were separated by SDS-PAGE. Samples were electrotransferred onto nitrocellulose membrane and this was probed with sera from the sham (A), ELV (B) or ES (C) vaccination groups. Bound antibody was detected using an anti-mouse IgG (whole molecule) alkaline phosphatase antibody, and proteins were visualised using BCIP and nitro blue tetrazolium. * Indicates major ELV components bound by sera. (D) Shows ELV and ES material separated by SDS-PAGE. Left of each panel shows molecular weight markers in kDa. 1 and 2 refer to two separate ELV preparations.

158 Figure 5.6D shows SDS-PAGE separation of ELV and ES material. Bands corresponding to 100, 80 and 70 kDa ELV components were excised from the gel, since these were the most prominent bands in Figure 5.6B. The protein composition of these bands was determined by mass spectrometry (Table 2).

Band Band Band Mw Accession number Protein 1 2 3 (kDa) VWD and Vitellogenin N and *TMUE_s0245000500 DUF1943-domain containing 9 17 190

protein Vacuolar protein sorting *TMUE_s0093001800 5 4 164 associated protein 52 TSP-1 domain containing *TMUE_s0070003500 3 39 protein *TMUE_s0189001400 Neurogenic locus notch protein 3 53

Peptidase M8 domain TMUE_s0015006300 4 60 containing protein TMUE_s0037004100 Conserved hypothetical protein 4 51

Na+ K+ ATPase alpha subunit *TMUE_s0022000400 3 118 1 Trypsin and CUB domain TMUE_s0117002800 3 69 containing protein TMUE_s0093001400 Nicastrin family protein 3 78

TMUE_s0106000600 Moesin:ezrin:radixin 1 3 64

TMUE_s0011007600 Anoctamin 2 96

Prominin domain containing TMUE_s0060000200 2 75 protein TMUE_s0059000500 Neurogenic locus notch protein 2 62

Neurogenic locus notch protein TMUE_s0320000100 2 49 2

Table 5.3. Possible identities of ELV components targeted by IgG antibodies following vaccination. Bands corresponding to 100 (Band 1), 80 (Band 2) and 70 kDa (Band 3) were excised from the SDS-PAGE gel shown in Figure 5.6D and their protein content was analysed by mass spectrometry. The proteins identified within these bands are listed. The number of unique peptides identified for each protein is displayed (criteria set to 95% protein threshold, 50% peptide threshold, minimum 2 peptides identified). *= proteins identified within ES depleted of ELVs.

The proteins identified within band 1 (100 kDa) include the Vacuolar protein sorting associated protein 52 and Conserved hypothetical protein. The predicted molecular weights of these proteins are 164 and 51 kDa respectively, however fragments or dimers of these proteins may be present within this band. This may also be the case for band 2 (80 kDa), where the Vacuolar protein sorting associated protein 52 has also been identified, along with VWD and

159 Vitellogenin N and DUF1943-domain containing protein (predicted molecular weight of 190 kDa). The VWD and Vitellogenin N and DUF1943-domain containing protein was also identified in band 3 (70 kDa), along with the TSP-1 domain containing protein, a protein with multiple tetraspanin domains (Appendix 3, Figure A3.1). The S. mansoni tetraspanins, Sm-TSP-1 and Sm-TSP-2, have been identified as vaccine candidates (27), and there appears to be significant homology between TMUE_s0070003500 and four S. mansoni proteins (Appendix 3, Table A3.2).

Many of these proteins were also identified within the soluble portion of ES (indicated by * on Table 5.3), confirming that although there are differences between the protein content of T. muris ES and ELV samples, the two are not mutually exclusive.

5.8 Discussion

The vesicles isolated from T. muris ES fit the size and shape characteristics for classification as exosomes, and previously described exosome markers (including tetraspanins, heat shock proteins and Alix (157) were identified within these samples. These vesicles are described here as ELVs, since a lack of commercially available antibodies against T. muris exosome markers prevents unequivocal classification of these vesicles as exosomes by Western blotting. Mass spectrometry analysis showed that the majority of T. muris ELV proteins lack a signal peptide (68%) and that there was significant overlap between the protein content of ELVs and ES (77% of ELV proteins were identified within adult ES). This suggests that ELVs may be an important mechanism by which these proteins are released into the external environment. Similarly, Marcilla and colleagues reported significant overlap between the protein content of F. hepatica and E. caproni ES and ELV samples (152). Data presented in this chapter also showed that T. muris ELVs fused with human colonic epithelial cells in vitro, suggesting that these vesicles may be able to fuse with host cells

160 in vivo. This is particularly relevant for T. muris since the parasite is in constant contact with the caecal epithelium.

ELVs have been isolatated previously from T. muris ES by Tritten and colleagues and Eichenberger and co-workers (180, 183). Tritten and colleagues carried out proteomic analysis on the isolated ELVs, however there are differences between the protein content of ELVs isolated for this project and those isolated by Tritten and co-workers. Notably, Tritten and colleagues report that the most abundant protein within T. muris ELV samples was the P43 (180), whereas this protein was absent from our proteomic analyses. The P43 was removed from T. muris ES following ELV isolation, and therefore the removal step should not have effected the P43 content of ELVs. Tritten and colleagues used a commercially available kit to isolate ELVs from ES samples (180), whereas ultracentrifugation was used for this project. It is possible that the kit used by Tritten and colleagues led to greater contamination of ELV samples with ES proteins.

The total number of ELV proteins identified for this project was also greater than the number identified by Tritten and colleagues (125 versus 73) (180). Again, these differences may be due to variation in the methods used to isolate ELVs and/or perform proteomic analysis. Ultracentrifugation is considered the ‘gold standard’ within the field of EV research and the size of vesicles isolated at different speeds has been well characterised (166). The commercially available kit used by Tritten and colleagues may enrich for vesicles of a certain size range whilst excluding others, which could affect the protein content of samples. In addition, ELV samples were precipitated before mass spectrometry analysis was carried out (as described by Marcilla and colleagues) (152), whereas Tritten and colleagues did not perform a precipitation step (180). Another key difference between the two data sets is that Tritten and colleagues analysed the protein content of a single sample (180), whereas our data set is arguable more stringent, since proteomic analysis was carried out on three biological replicates and only proteins identified in two or more samples were included.

161 Data presented in this chapter showed that vaccination with T. muris ELVs can induce protective immunity against a subsequent T. muris infection. The protection afforded by these ELV vaccinations was variable; sterile immunity was achieved for some individuals, while others developed chronic infection. This has also been reported for H. polygyrus ELV vaccinations, although these vaccinations were formulated with aluminum hydroxide (155), whereas the ELV vaccinations performed for this thesis were formulated without adjuvant. Vaccinating mice with 3 μg of T. muris ES formulated with aluminum hydroxide induced sterile immunity against a subsequent low dose infection (Appendix 3, Figure A3.2), demonstrating that the right combination of antigens and adjuvant can stimulate protective immunity, even when low quantities of antigen are used. Based on these observations, the potential for aluminum hydroxide to boost immunity to T. muris ELVs should be investigated further.

The protective properties of T. muris ELVs are dependent on intact vesicles, as vaccination with lysed ELVs did not protect mice from a subsequent infection. Vaccine research using liposomes and microparticles may offer insight into why ELVs make effective vaccines (235). It has been suggested that encapsulating antigens in lipid spheres protects them from degradation and enables slow release of antigen over time (235-237). In addition, Fifis and colleagues have demonstrated that 40 to 50 nm-sized nanoparticles are preferentially taken up by DEC205+ CD40+ CD86+ murine DCs compared to larger particles of up to 2 μm in size (238). Therefore it is reasonable to suggest that presentation of Trichuris proteins within ELVs makes them better suited for uptake by antigen presenting cells, thus increasing their antigenicity. This should be explored further as encapsulating recombinant or purified native Trichuris antigens within ELVs may be a viable alternative to traditional vaccinations formulated with adjuvant.

The data presented here shows that vaccination with ELVs boosts IgG1 antibody production against soluble ES proteins. This may be explained by the extensive overlap between proteins identified in ELV samples and ES depleted of ELVs (Table 5.2). Coakley and colleagues report similar findings,

162 demonstrating that vaccinating mice with H. polygyrus exosomes prior to infection boosted antibody response to ES depleted of ELVs, and that rats vaccinated with H. polygyrus ELVs make antibodies against ELV and ES material in the absence of infection (155). High levels of anti-parasite IgG2a/c were measured in all mice that received the ELV vaccine, and anti-parasite IgG2a/c did not appear to correlated with worm burden (data not shown), which suggests that ELV vaccinated mice mount a mixed Th1/Th2 response to a low dose T. muris infection.

Figure 5.6B shows that the IgG in sera of ELV vaccinated mice binds to a number of components that are enriched within ELV samples. The strongest antibody response was directed towards approximately 100, 80 and 70 kDa components. Figure 5.6D shows SDS-PAGE separation of the lysed ELV material; although it is difficult to identify distinct bands that correlate with these molecular weights, mass spectrometry analysis of the protein content within these regions revealed a number of potential antigens. These include VWD and Vitellogenin N and DUF1943-domain containing protein, TSP-1 domain containing protein and Vacuolar protein sorting associated protein 52, which are amongst the most abundant ELV proteins (Appendix 3, Table A3.1). Although antibody responses may not reflect protection, the therapeutic value of related proteins has been demonstrated in other helminths (34-41), suggesting that these proteins are major candidates for protective antigens. Vitellogenin proteins isolated from the ES of gravid adult female Litomosoides sigmodontis, a filarial nematode of rodents, and Ostertagia ostertagi, an intestinal nematode of cattle, have been identified as novel vaccine candidates using immunoscreening and proteomics approaches (239, 240). In addition, Vitellogenin proteins have been recognised as potential vaccine candidates for ectoparasites, such as ticks and mites (241-244). Tritten and colleagues also identified this protein within T. muris ELV samples (180).

There are no published reports relating to Vacuolar sorting protein associated protein 52, however there appear to be homologues of this protein in other tricephalid parasites, including Trichuris and Trichinella species (Appendix 3,

163 Table A3.3), and this protein was also identified in pool 3 (Appendix 1, Table A1.4), which formed the basis for the experiments carried out in Chapter 4. The TSP-1 domain containing protein could also be a promising immunogenic candidate, given that S. mansoni TSP proteins have shown great potential in pre-clinical and Phase I clinical trials (23, 245). In future, 2D Western blotting should be carried out in order to get better resolution and more certain protein identification.

This is the first example of successful vaccination against a Trichuris parasite using ELVs, and the first example of an ELV vaccination formulated without adjuvant. Recent reports have demonstrated that vaccination with H. polygyrus ELVs can protect mice against a subsequent infection, while vaccinating mice with E. caproni ELVs can improve the clinical outcome of infection (155, 156). There are also a number of examples of protective immunity induced by vaccination with ELVs derived from host cells, for example, vaccinating CBA/J mice with ELVs collected from splenic DCs pulsed with T. gondii antigens before pregnancy induced protective immunity in pups, resulting in fewer brain cysts and lower mortality following congenital exposure (246). Similarly, del Cacho and co-workers demonstrated that immunising chickens with ELVs derived from DCs pulsed with Eimeria parasites lead to reduced mortality, intestinal inflammation and faecal oocyst shedding (247). Martin-Jaular and co- workers also report a protective role for reticulocyte-derived ELVs containing Plasmodium yoelii material, showing that vaccination with these ELVs stimulated IgG antibodies capable of binding infected red blood cells, with 83% of mice surviving an otherwise lethal P. yoelii infection. Previously described S. mansoni vaccine candidates have also been identified in ELV samples (173-177), supporting the data presented here, which suggest that helminth ELVs may be an important source of protective material.

In conclusion, the data presented here show that vaccination with T. muris ELVs can protect mice against a subsequent T. muris infection, and these vaccinations boost antibody response to ES depleted of ELVs. A number of potential immunogenic candidates were identified by Western blotting; these

164 include VWD and Vitellogenin N and DUF1943-domain containing protein, Vacuolar protein sorting associated protein 52 and TSP-1 domain containing protein. Future work should investigate recombinant forms of these proteins as protective antigens and explore opportunities for ELVs to boost their antigenicity.

165

6 Summary discussion

166 The aim of this thesis was to identify Trichuris-specific antigens that prime the host for worm expulsion. Recent figures suggest that 800 million people are infected with T. trichiura worldwide, and Trichuris parasites are also a huge source of morbidity in livestock (1, 7). The need for vaccines against T. trichiura is arguably greater than ever, due to reports showing that drug resistance has arisen in some parasite populations (20, 21). Trichuris ES was identified as a potent source of host protective material as far back as 1977 (115), however relatively little progress has been made towards identifying the molecular components involved. Over the course of this thesis, a number of important observations were made relating to the characteristics of the immune response induced by vaccination with ES (Chapter 3), and several immunogenic candidates were identified using chromatography and mass spectrometry methods combined with measures of T cell cytokine production (Chapter 4). In addition, Chapter 5 explored the potential of T. muris ELVs as a source of protective material. This research represents significant progress towards identifying vaccine candidates for T. trichiura and other Trichuris parasites.

6.1 Identification of immunogenic candidates within T. muris ES

To date, there are no commercially available vaccines for human STH infections, and very few against their veterinary counterparts (248). However, in the last decade, remarkable progress has been made towards a vaccine for the hookworm, N. americanus (100, 106, 107). The selection of vaccine candidates was based on identifying parasite components involved in the breakdown of host haemoglobin (Na-APR-1) and detoxification of haem (Na-GST-1) (100). These processes are essential for parasite survival, and it was predicted that vaccination with recombinant forms of these proteins would induce antibodies capable of inhibiting the native hookworm proteins, thus affecting parasite viability (100). These vaccine candidates are currently undergoing Phase II clinical trials in Gabon, having successfully completed phase I trials in the US and Brazil (107). Comparatively little is known about the biology of T. trichiura,

167 and unlike N. americanus, there were no immediately obvious vaccine candidates for this parasite. A detailed analysis of the genomes and transcriptomes of T. trichiura and T. muris published in 2014 identified a number of key functional groups that are upregulated in the anterior end of the worm, which was speculated to be the site of ES release (although precise details of how ES is released are unknown) (33). These include chymotrypsin-like serine proteases, protease inhibitors/WAP proteins and DNases, however, the large number of proteins within these groups may be a barrier to investigating these components as vaccine candidates (33).

Other researchers have used antibody-based screening methods to identify potential immunogenic candidates for helminth parasites. One of the most clinically advanced examples is S. haematobium Sh28GST, a glutathione-S- transferase, which was shown to reduce worm viability (by 38%) and egg output (by 55 to 74%) in a range of experimental animal models, and was deemed safe and effective against urinary schistosomiasis in Phase I clinical trials (23, 249, 250). Field studies demonstrated that resistance to schistosomiasis is associated with anti-Sh28GST IgA and IgG3 neutralising antibodies, re-enforcing the rationale for using antibody-screening methods to identify vaccine candidates for this parasite (251, 252). Highly effective recombinant protein vaccines have also been developed for a range of taeniid parasites using antibody-based screening methods, and these studies demonstrate that it is possible to induce protective immunity against metazoan parasites using a single recombinant protein (although this may not be the case for all parasitic helminths) (92).

The results presented in Chapter 3 showed that transfer of serum from ES vaccinated naïve mice did not protect unvaccinated mice from a subsequent low dose infection, despite the fact that high levels of anti-parasite IgG1 antibodies were detected in the transfer serum. Based on these results, antibody-based screening methods may not identify potent vaccine candidates for Trichuris parasites, particularly as ES appears to be targeted differentially by the humoral and cellular branches of the immune system (Chapter 3). Instead, the approach used to identify vaccine candidates in this thesis focused on material that

168 stimulates Th2 cytokine release, particularly IL-13 and IL-9, since previous studies have demonstrated a crucial role for these cytokines in resistance to T. muris, through increasing intestinal mucus production, accelerating caecal epithelial cell turnover and inducing intestinal hypercontractility (44, 56, 57). This assumes that vaccination primes for effector mechanisms similar to those induced by natural infection, however this should be investigated further.

Chapter 3 included other important observations relating to the immune response following vaccination with ES products. Firstly, degradation of ES using proteinase K abrogated its ability to stimulate protective immunity following vaccination, suggesting that proteins are likely to be responsible for the protective properties of ES. This reinforces the rationale for focussing on the protein content of ES in terms of identifying immunogenic candidates. Alternatively, this result may suggest that even though CD4 T cells recognise small peptide fragments (as presumably proteinase K would generate), they do not enter the processing/presentation pathway in antigen presenting cells to effectively prime the T cells, or that the aluminum hydroxide adjuvant does not function very effectively with small sized peptides.

Secondly, vaccination with ES products stimulates long-lasting immunity against a subsequent challenge, suggesting that vaccination stimulates immunological memory. It is generally accepted that in order to confirm that memory cells are generated in mouse studies, at least 30 days should have elapsed post antigen dosage (190-192). Here, mice were infected a total of 50 days after the second vaccination, which strongly suggests that vaccination with T. muris ES products stimulates immunological memory. This should be explored further in order to characterise the immune components involved.

Thirdly, the experiments described in Chapter 3 suggest that vaccination at a peripheral (subcutaneous) site is able to prime cells that can operate at an intestinal site. This is surprising as it is believed that for primed T cells to move into intestinal tissue, gut-specific homing molecules need to be upregulated on the T cells during activation (253). The present data would suggest that this may not be the case, or that a subcutaneous injection of antigen does prime

169 sufficient numbers of T cells in the MLN, where appropriate homing molecules can be acquired (253).

Dixon and colleagues provide some insight into the immune response following subcutaneous vaccination of AKR mice with T. muris ES (29). They showed that the peripheral lymph node cells proliferate and produce Th2 cytokines and IFN-γ following vaccination (in the absence of infection) in response to re-stimulation with ES (29). However, when vaccination was followed by a high dose infection, the MLN was the major source of Th2 cytokines, leading to goblet cell hyperplasia and influx (and alternative activation) of macrophages (29). Although the vaccinated AKR mice did expel a high dose infection, the authors did not observe an increase in epithelial cell turnover, suggesting that there are some differences between the mechanisms of expulsion in mice that have acquired resistance through acute infection and in response to vaccination (29). In future, further characterisation of the immune response following vaccination should be carried out. Vaccination experiments could be performed in IL-13 or IL-4R knock out mice in order to confirm that vaccine-driven immunity is dependent on IL-13 production, and experiments could be carried out to determine the role of IL-9, Muc5ac production and epithelial turnover in driving worm expulsion in a low dose C57BL/6 vaccination model.

Finally, vaccination with ES collected from both larval and adult stages stimulates protective immunity, and there is significant overlap between the protein content of these two sources of ES. The rationale for this experiment was that during acute infection, worms are expelled before they reach patency and therefore the host is not ordinarily exposed to adult ES (31). Instead, expulsion in resistant mouse strains must be triggered by larval components. The experiments carried out prior to this involved vaccination with adult ES as practically, much larger quantities of ES can be collected from adult worms compared to larval stages. However, the present experiments do confirm that adult T. muris ES is a biologically relevant source of antigens that can induce protection.

170 Additionally, data presented in Figure A3.2 showed that vaccination with 3 μg of ES protected mice against a subsequent T. muris infection. The main reason for carrying out this titration experiment was to compare the protection conferred by vaccination with 3 μg of ELV material and 3 μg of ES (Figures 5.3 and A3.2). Clearly, the ES vaccination was more potent, however this vaccination was formulated with aluminum hydroxide, whereas the ELV vaccine was formulated without adjuvant. Adjuvant usage often enables lower quantities of antigens to be used (a phenomena known as ‘dose sparing’) (135), and therefore, the ES titration experiment should be repeated both with and without adjuvant to compare the quantity of material required to stimulate protection in the presence and absence of adjuvant. ELV vaccinations formulated with and without aluminum hydroxide should be carried out alongside this experiment, in order to determine the optimum conditions for vaccination with ES and ELV material. The ES titration experiment was carried out at the end of the project, which is why all the experiments described in Chapters 3 and 4 involved vaccinations with 30 μg of ES products. Based on initial experiments performed with native ES products in Chapter 3, 30 μg of protein was also used for the recombinant protein vaccines described in Chapter 4, although the amount of each protein within 30 μg of ES is likely to be much lower.

6.2 Identification of immunogenic candidates within T. muris ELVs

Chapter 5 investigated the potential of T. muris ELVs as a source of immunogenic candidates. ELVs have been isolated previously from T. suis and T. muris ES, however this is the first report to include TEM images of the vesicles, and to isolate ELVs from adult ES using differential ultracentrifugation. Mass spectrometry was carried out on three ELV samples, and the list of identified proteins was more comprehensive than the list published by Tritten and colleagues earlier this year (180). Comparison of the protein content of T. muris ELVs and ES samples showed that there was significant overlap. Importantly, the present work also showed that ELV vaccinations (formulated

171 without adjuvant) induced protective immunity in male C57BL/6 mice. This is the first example of a successful helminth ELV vaccination formulated without adjuvant.

In future, work should be carried out in order to explore how an ELV vaccine might work in the host and to determine how antigen presentation might be affected. Encapsulating antigens in lipid spheres may increase their antigenicity, much like how lipid-based adjuvants increase the antigenicity of vaccines (135). Alternatively, ELV size could play a major role, promoting uptake of antigens by DCs (238). QuilA, a commonly used adjuvant for vaccines against ruminant gastrointestinal nematodes (209), encapsulates antigens in 40 nm cage-like structures, and the size of these particles is thought to increase immunostimulation (135). In addition, studies comparing the adjuvanticity of 112 nm and 9.3 μm aluminum hydroxide particles showed that antibody production and antigenicity was higher in response to the nano-particles (254). The authors suggest that this may be due to the larger surface area available for absorption of antigen (254). These studies emphasise the importance of particle size on adjuvanticity.

An antibody-based screening approach was used to identify potential immunogenic candidates within ELVs in Chapter 5. Despite the discussions throughout this project regarding the suitability of such approaches for identifying host protective antigens for T. muris, limitations in the amount of ELV material available would have made identifying immunogenic candidates using chromatography methods similar to those employed in Chapter 4 impractical, if not impossible. Antibody-based screening methods at least give an indication of which components are targeted by the immune response following vaccination and subsequent infection. The two immunogenic candidates that stood out were VWD and Vitellogenin N and DUF1943-domain containing protein and TSP-1 domain containing protein. Both Vitegellin and TSP-1 proteins have been identified as vaccine candidates for other helminth and ectoparasites (23, 27, 239-244), and therefore warrant further investigation.

172 6.3 Other considerations for Trichuris vaccine design

If effective vaccine candidates were identified, it would be necessary to consider the ‘target product profile’ of the vaccine. This would involve identifying the target patient group and summarising the safety and efficacy of the vaccine. Population studies show that the majority of low-level infections are asymptomatic, while clinical symptoms are generally associated with heavy worm burdens (8, 9). This suggests that a successful vaccine against T. trichiura would need to reduce the worm burden such that clinical symptoms are reduced, however, this may be possible without achieving complete worm expulsion. In endemic areas, close to 90% of children are infected with T. trichiura within the first twelve months (9), so ideally a successful vaccine against this parasite should be administered in the first year of life, along with other childhood vaccines. It would also be necessary to determine whether vaccination can protect against a pre-existing infection. If this was the case, older children and adults could be vaccinated along with infants. Bancroft and colleagues showed that mice are susceptible to a high dose T. muris infection if a low dose is administered first, however the authors also demonstrated that worm expulsion occurs when mice are given multiple low dose infections (trickle regime) (45). These data suggest that it might be possible to vaccinate people with an ongoing chronic T. trichiura infection, however it may be necessary to administer multiple vaccinations over time to achieve an appropriate level of protection.

This could be investigated using the T. muris mouse model by allowing a low dose infection to develop to chronicity in male C57BL/6 mice. These mice could then be given three or more ES vaccinations and worm burdens should be assessed a number of weeks post-vaccination. Similar experiments were performed as part of this project, however when the mice were sacrificed at day 76 p.i., the negative control group (which was infected and then vaccinated with aluminum hydroxide only) had very low worm burdens (around 5 worms per mouse, data not shown), which meant that it was difficult to compare the mean worm burden of sham versus ES vaccinated mice. This is likely due to the

173 viability of worms decreasing with age. In future, this experiment should be repeated, sacrificing mice at an earlier time point to ensure that the worms are still viable.

Gomez-Samblas and colleagues claim to have identified a vaccine candidate (a serine/threonine phosphatase 2A from A. costaricensis) that can trigger expulsion of a chronic T. muris infection in AKR mice (30). However, the worms were 90 days old at the point of necroscopy, and therefore, based on the observations described above, the viability of the worms is likely to be reduced at this time point. Although the authors do report a statistically significant reduction in worm burden following vaccinations with the serine/threonine phosphatase compared to the sham vaccination group 12 days post vaccination, the worm burden of the sham vaccine group was reduced by 50% compared to the worm burden at 7 days post vaccination (30). This suggests that the viability of the worms is reduced at this time point. This study should be modified in order to assess worm burden at an earlier time point, when the worms are less aged, in order to confirm that the serine/threonine phosphatase is a potent vaccine candidate.

Another complicating factor for vaccinating humans, or indeed veterinary species, against Trichuris parasites, is that individuals are exposed to multiple pathogens from a young age. These may be other STH species, for example A. lumbricoides and hookworms, however people are also likely to be exposed to a range of bacterial, viral and protozoan pathogens (2, 255-257). This may affect the type of immunity that is mounted in response to vaccination with Trichuris components, and is something that needs to be taken into consideration if a vaccine was to reach clinical trials (256, 257).

In addition, care should be taken to ensure that vaccine candidates are not allergenic, as this may cause problems if the vaccine population has previously been exposed to the parasite. This issue was brought to the attention of researchers after the Phase II clinical trial for the N. americanus vaccine candidate, Na-ASP-2, was terminated early, as three out of the seven

174 volunteers experienced allergic reactions, which are thought to have been triggered by high levels of pre-existing anti-parasite IgE (103).

6.4 Conclusions and future perspectives

In summary, the work presented in this thesis represents significant progress towards identifying vaccine candidates for Trichuris parasites and important observations were made in relation to the immunity induced by vaccination with ES products and ELVs in mice. Specifically, the work described in Chapter 3 showed that vaccination with T. muris ES proteins (collected from the larval and adult stages) stimulates long-lasting protection against a subsequent low dose infection in C57BL/6 mice. The data presented in Chapter 4 provided a framework by which to identify vaccine candidates within T. muris ES. This approach could be used in future to identify immunogenic candidates within other groups of ES proteins (for example pool 4). Future work should also include investigation of alternative expression systems, in order to find one that will enable the expression of the five immunogenic candidates that HEK293 cells were unable to express. As discussed in Chapter 4, there is no clear way to determine the most appropriate expression system for synthesis of recombinant helminth proteins, since expression systems that are effective for one protein may not enable expression of other proteins from the same species (206). Recent work describing the ability to engineer yeast to add complex mammalian glycans during recombinant protein expression could be applied to helminth protein expression, providing that more information regarding the glycosylation patterns of these species was available (223, 224).

Chapter 5 highlighted the potential of Trichuris ELVs as a source of immunogenic material, and this is the first report, to our knowledge, to identify novel immunogenic candidates within nematode ELVs. These studies demonstrate that ELVs are an undervalued source of protective antigens that warrant further exploration, and suggest that packaging of native or

175 recombinant antigens within ELVs may boost protection. Future work should investigate the potential for recombinant forms of the ELV antigenic candidates to stimulate protective immunity when administered as a vaccine formulated with aluminum hydroxide, and also the potential to boost immunity through encapsulating these proteins in synthetic ELV-sized lipid spheres.

176 References

1. Grencis RK. Cytokine regulation of resistance and susceptibility to intestinal nematode infection - from host to parasite. Veterinary Parasitology. 2001;100(1-2):45-50.

2. Bethony J, Brooker S, Albonico M, Geiger SM, Loukas A, Diemert D, Hotez PJ. Soil-transmitted helminth infections: ascariasis, trichuriasis, and hookworm. Lancet. 2006;367(9521):1521-32.

3. Hotez PJ, Strych U, Lustigman S, Bottazzi ME. Human anthelminthic vaccines: Rationale and challenges. Vaccine. 2016;34(30):3549-55.

4. Ojha SC, Jaide C, Jinawath N, Rotjanapan P, Baral P. Geohelminths: public health significance. Journal of Infection in Developing Countries. 2014;8(1):5-16.

5. Utzinger J, Keiser J. Schistosomiasis and soil-transmitted helminthiasis: common drugs for treatment and control. Expert Opinion on Pharmacotherapy. 2004;5(2):263-85.

6. Hotez PJ, Molyneux DH, Fenwick A, Kumaresan J, Sachs SE, Sachs JD, Savioli L. Current concepts - Control of neglected tropical diseases. New England Journal of Medicine. 2007;357(10):1018-27.

7. Keiser J, Utzinger J. Efficacy of current drugs against soil-transmitted helminth infections - Systematic review and meta-analysis. Jama-Journal of the American Medical Association. 2008;299(16):1937-48.

8. Stephenson LS, Holland CV, Cooper ES. The public health significance of Trichuris trichiura. Parasitology. 2000;121:S73-S95.

9. Bundy DAP. Population ecology of intestinal helminth infections in human communities. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences. 1988;321(1207):405-20.

10. Bundy DAP, Cooper ES, Thompson DE, Didier JM, Anderson RM, Simmons I. Predisposition to Trichuris trichiura infection in humans. Epidemiology and Infection. 1987;98(1):65-71.

11. Stoltzfus RJ, Dreyfuss ML, Chwaya HM, Albonico M. Hookworm control as a strategy to prevent iron deficiency. Nutrition Reviews. 1997;55(6):223-32.

12. Stephenson LS, Latham MC, Kurz KM, Kinoti SN, Brigham H. Treatment with a single dose of albendazole improves growth of Kenyan school children with hookworm, Trichuris trichiura, and Ascaris lumbricoides infections. American Journal of Tropical Medicine and Hygiene. 1989;41(1):78-87.

13. Stephenson LS, Latham MC, Adams EJ, Kinoti SN, Pertet A. Physical fitness, growth and appetite of Kenyan school boys with hookworm, Trichuris

177 trichiura and Ascaris lumbricoides infections are improved 4 months after a single dose of albendazole. Journal of Nutrition. 1993;123(6):1036-46.

14. Smith JL, Brooker S. Impact of hookworm infection and deworming on anaemia in non-pregnant populations: a systematic review. Tropical Medicine & International Health. 2010;15(7):776-95.

15. Partridge FA, Murphy EA, Willis NJ, Bataille CJR, Forman R, Heyer- Chauhan N, Marinič B, Sowood DJC, Wynne GM, Else KJ, Russell AJ, Sattelle DB. Dihydrobenz[e][1,4]oxazepin-2(3H)-ones, a new antihelmintic chemotype immobilising whipworm and reducing infectivity in vivo. PLOS Neglected Tropical Diseases. 2017.

16. Albonico M1, Smith PG, Ercole E, Hall A, Chwaya HM, Alawi KS, Savioli L. Rate of reinfection with intestinal nematodes after treatment of children with mebendazole or albendazole in a highly endemic area. Transactions of the Royal Society of Tropical Medicine and Hygiene. 1995;89(5):538-41.

17. Chan L, Bundy DAP, Kan SP. Aggregation and predisposition to Ascaris lumbricoides and Trichuris trichiura at the familial level. Transactions of the Royal Society of Tropical Medicine and Hygiene. 1994;88(1):46-8.

18. Elkins DB, Haswellelkins M, Anderson RM. The importance of host age and sex to patterns of reinfection with Ascaris lumbricoides following mass anthelminthic treatment in a South Indian fishing community. Parasitology. 1988;96:171-84.

19. Dixon H, Johnston CE, Else KJ. Antigen selection for future anti-Trichuris vaccines: a comparison of cytokine and antibody responses to larval and adult antigen in a primary infection. Parasite Immunology. 2008;30(9):454-61.

20. Albonico M, Bickle Q, Ramsan M, Montresor A, Savioli L, Taylor M. Efficacy of mebendazole and levamisole alone or in combination against intestinal nematode infections after repeated targeted mebendazole treatment in Zanzibar. Bulletin of the World Health Organization. 2003;81(5):343-52.

21. Flohr C, Tuyen LN, Lewis S, Minh TT, Campbell J, Britton J, Williams H, Hien TT, Farrar J, Quinnell RJ. Low efficacy of mebendazole against hookworm in Vietnam: Two randomized controlled trials. American Journal of Tropical Medicine and Hygiene. 2007;76(4):732-6.

22. Z Zhan B, Beaumier CM, Briggs N, Jones KM, Keegan BP, Bottazzi ME, Hotez PJ. Advancing a multivalent 'Pan-anthelmintic' vaccine against soil- transmitted nematode infections. Expert Review of Vaccines. 2014;13(3):321- 31.

23. Riveau G, Deplanque D, Remoue F, Schacht AM, Vodougnon H, Capron M, Thiry M, Martial J, Libersa C, Capron A. Safety and Immunogenicity of rSh28GST Antigen in Humans: Phase 1 Randomized Clinical Study of a

178 Vaccine Candidate against Urinary Schistosomiasis. Plos Neglected Tropical Diseases. 2012;6(7).

24. Zhang WD, Ahmad G, Le L, Rojo JU, Karmakar S, Tillery KA, Torben W, Damian RT, Wolf RF, White GL, Carey DW, Carter D, Reed SG, Siddiqui AA. Longevity of Sm-p80-specific antibody responses following vaccination with Sm-p80 vaccine in mice and baboons and transplacental transfer of Sm-p80- specific antibodies in a baboon. Parasitology Research. 2014;113(6):2239-50.

25. Le L, Zhang WD, Karmakar S, Ahmad G, Torben W, Siddiqui AA. Simultaneous priming with DNA encoding Sm-p80 and boosting with Sm-p80 protein confers protection against challenge infection with Schistosoma mansoni in mice. Parasitology Research. 2014;113(3):1195-200.

26. Karmakar S, Zhang WD, Ahmad G, Torben W, Alam MU, Le L, Damian RT, Wolf RF, White GL, Carey DW, Carter D, Reed SG, Siddiqui AA. Use of an Sm-p80-Based Therapeutic Vaccine to Kill Established Adult Schistosome Parasites in Chronically Infected Baboons. Journal of Infectious Diseases. 2014;209(12):1929-40.

27. Pearson MS, Becker L, Driguez P, Young ND, Gaze S, Mendes T, Li XH, Doolan DL, Midzi N, Mduluza T, McManus DP, Wilson RA, Bethony JM, Nausch N, Mutapi F, Felgner PL, Loukas A. Of monkeys and men: immunomic profiling of sera from humans and non-human primates resistant to schistosomiasis reveals novel potential vaccine candidates. Frontiers in Immunology. 2015;6.

28. Jenkins SN, Wakelin D. Functional antigens of Trichuris muris released during in vitro maintenace - their immunogenicity and partial purification. Parasitology. 1983;86(FEB):73-82.

29. Dixon H, Little MC, Else KJ. Characterisation of the protective immune response following subcutaneous vaccination of susceptible mice against Trichuris muris. International Journal for Parasitology. 2010;40(6):683-93.

30. Gomez-Samblas M, Garcia JJ, Rodriguez M, Trelis M, Bernal D, Lopez- Jaramillo FJ, Santoyo-Gonzalez F, Vilchez S, Espino AM, Bolas-Fernandez F. Self-adjuvating C18 lipid vinil sulphone-PP2a vaccine: study of the induced immunomodulation against Trichuris muris infection. Open Biology. 2017;7.

31. Klementowicz JE, Travis MA, Grencis RK. Trichuris muris: a model of gastrointestinal parasite infection. Seminars in Immunopathology. 2012;34(6):815-28.

32. Hurst RJM, Else KJ. Trichuris muris research revisited: a journey through time. Parasitology. 2013;140(11):1325-39.

33. F Foth BJ, Tsai IJ, Reid AJ, Bancroft AJ, Nichol S, Tracey A, Holryd N, Cotton JA, Stanley EJ, Zarowiecki M, Liu JZ, Huckvale T, Cooper PJ, Grencis RK, Berriman M. Whipworm genome and dual-species transcriptome analyses provide molecular insights into an intimate host-parasite interaction. Nature genetics. 2014;46(7):693-700.

179 34. Hayes KS, Bancroft AJ, Goldrick M, Portsmouth C, Roberts IS, Grencis RK. Exploitation of the Intestinal Microflora by the Parasitic Nematode Trichuris muris. Science. 2010;328(5984):1391-4.

35. Tilney LG, Connelly PS, Guild GM, Vranich KA, Artis D. Adaptation of a nematode parasite to living within the mammalian epithelium. Journal of Experimental Zoology Part a-Comparative Experimental Biology. 2005;303A(11):927-45.

36. Grencis RK, Humphreys NE, Bancroft AJ. Immunity to gastrointestinal nematodes: mechanisms and myths. Immunological Reviews. 2014;260(1):183- 205.

37. Wakelin D, Selby GR. Thymus-dependency of the immune response of mice to a primary infection with the nematode Trichuris muris. International journal for parasitology. 1974;4:657-61.

38. Lee TDG, Wakelin D, Grencis RK. Cellular mechanisms of immunity to the nematode Trichuris muris. International Journal for Parasitology. 1983;13(4):349-53.

39. Ito Y. The absence of resistance in congenitally athymic nude mice toward infection with the intestina nematode, Trichuris muris - resistance restored by lymphoid cell transfer. International Journal for Parasitology. 1991;21(1):65-9.

40. Koyama K, Tamauchi H, Ito Y. The role of CD4+ and CD8+ T cells in protective immunity to the murine nematode parasite Trichuris muris. Parasite Immunology. 1995;17(3):161-5.

41. Koyama K. NK1.1(+) cell depletion in vivo fails to prevent protection against infection with the murine nematode parasite Trichuris muris. Parasite Immunology. 2002;24(11-12):527-33.

42. Betts CJ, deSchoolmeester ML, Else KJ. Trichuris muris: CD4(+) T cell- mediated protection in reconstituted SCID mice. Parasitology. 2000;121:631-7.

43. Else KJ, Finkelman FD, Maliszewski CR, Grencis RK. Cytokine mediated regulation of chronic intestinal helminth infection. Journal of Experimental Medicine. 1994;179(1):347-51.

44. Bancroft AJ, McKenzie ANJ, Grencis RK. A critical role for IL-13 in resistance to intestinal nematode infection. Journal of Immunology. 1998;160(7):3453-61.

45. Hayes KS, Bancroft AJ, Grencis RK. The role of TNF-alpha in Trichuris muris infection I: influence of TNF-alpha receptor usage, gender and IL-13. Parasite Immunology. 2007;29(11):575-82.

180 46. Hepworth MR, Hardman MJ, Grencis RK. The role of sex hormones in the development of Th2 immunity in a gender-biased model of Trichuris muris infection. European Journal of Immunology. 2010;40(2):406-16.

47. Helmby H, Takeda K, Akira S, Grencis RK. Interleukin (IL)-18 promotes the development of chronic gastrointestinal helminth infection by downregulating IL-13. Journal of Experimental Medicine. 2001;194(3):355-64.

48. Bancroft AJ, Else KJ, Humphreys NE, Grencis RK. The effect of challenge and trickle Trichuris muris infections on the polarisation of the immune response. International Journal for Parasitology. 2001;31(14):1627-37.

49. Else KJ, Hultner L, Grencis RK. Modulation of cytokine production and response phenotypes in murine Trichuriasis. Parasite Immunology. 1992;14(4):441-9.

50. Else KJ, Grencis RK. Antibody-independent effector mechanisms in resistance to the intestinal nematode parasite Trichuris muris. Infection and Immunity. 1996;64(8):2950-4.

51. Behnke JM, Wakelin D. The survival of Trichuris muris in wild populations of its natural hosts. Parasitology. 1973;67:157-64.

52. Faulkner H, Turner J, Kamgno J, Pion SD, Boussinesq M, Bradley JE. Age- and infection intensity-dependent cytokine and antibody production in human trichuriasis: The importance of IgE. Journal of Infectious Diseases. 2002;185(5):665-72.

53. Koyama K, Ito Y. Comparative studies on immune responses to infection in susceptible B10.BR mice infected with different strains of the murine nematode parasite Trichuris muris. Parasite Immunology. 1996;18(5):257-63.

54. Bellaby T, Robinson K, Wakelin D. Induction of differential T-helper-cell responses in mice infected with variants of the parasitic nematode Trichuris muris. Infection and Immunity. 1996;64(3):791-5.

55. D'Elia R, Behnke JM, Bradley JE, Else KJ. Regulatory T Cells: A Role in the Control of Helminth-Driven Intestinal Pathology and Worm Survival. Journal of Immunology. 2009;182(4):2340-8.

56. Hasnain SZ, Evans CM, Roy M, Gallagher AL, Kindrachuk KN, Barron L, Dickey BF, Wilson MS, Wynn TA, Grencis RK, Thornton DJ. Muc5ac: a critical component mediating the rejection of enteric nematodes. Journal of Experimental Medicine. 2011;208(5):893-900.

57. Cliffe LJ, Humphreys NE, Lane TE, Potten CS, Booth C, Grencis RK. Accelerated intestinal epithelial cell turnover: A new mechanism of parasite expulsion. Science. 2005;308(5727):1463-5.

181 58. Khan WI, Richard M, Akiho H, Blennerhasset PA, Humphreys NE, Grencis RK, Van Snick J, Collins SM. Modulation of intestinal muscle contraction by interleukin-9 (IL-9) or IL-9 neutralization: Correlation with worm expulsion in murine nematode infections. Infection and Immunity. 2003;71(5):2430-8.

59. Betts CJ, Else KJ. Mast cells, eosinophils and antibody-mediated cellular cytotoxicity are not critical in resistance to Trichuris muris. Parasite Immunology. 1999;21(1):45-52.

60. Svensson M, Bell L, Little MC, deSchoolmeester M, Locksley RM, Else KJ. Accumulation of eosinophils in intestine-draining mesenteric lymph nodes occurs after Trichuris muris infection. Parasite Immunology. 2011;33(1):1-11.

61. Dixon H, Blanchard C, deSchoolmeester ML, Yuill NC, Christie JW, Rothenberg ME, Else KJ. The role of Th2 cytokines, chemokines and parasite products in eosinophil recruitment to the gastrointestinal mucosa during helminth infection. European Journal of Immunology. 2006;36(7):1753-63.

62. Faulkner H, Renauld JC, Van Snick J, Grencis RK. Interleukin-9 enhances resistance to the intestinal nematode Trichuris muris. Infection and Immunity. 1998;66(8):3832-40.

63. Artis D, Mei LW, Keilbaugh SA, He WM, Brenes M, Swain GP, Knight PA, Donaldson DD, Lazar MA, Miller HR, Schad GA, Scott P, Wu GD. RELM beta/FIZZ2 is a goblet cell-specific immune-effector molecule in the gastrointestinal tract. Proceedings of the National Academy of Sciences of the United States of America. 2004;101(37):13596-600.

64. Wakelin D. Immunity to intestinal parasites. Nature. 1978;273(5664):617-20.

65. Miller HRP. Gastrointestinal mucus, a medium for survival and for elimination or parasitic nematodes and protozoa. Parasitology. 1987;94:S77- S100.

66. Wahid FN, Behnke JM, Grencis RK, Else KJ, Bensmith AW. Immunological relationships during primary infection with Heligosomoides polygyrus - TH2 cytokines and primary response phenotypes. Parasitology. 1994;108:461-71.

67. Hasnain SZ, Wang H, Ghia J-E, Haq N, Deng Y, Velcich A, Grencis RK, Thornton DJ, Khan WI. Mucin Gene Deficiency in Mice Impairs Host Resistance to an Enteric Parasitic Infection. Gastroenterology. 2010;138(5):1763-U45.

68. Hasnain SZ, Thornton DJ, Grencis RK. Changes in the mucosal barrier during acute and chronic Trichuris muris infection. Parasite Immunology. 2011;33(1):45-55.

69. Hasnain SZ, Dawson PA, Lourie R, Hutson P, Tong H, Grencis RK, McGuckin MA, Thornton DJ. Immune-driven alterations in mucin sulphation is

182 an important mediator of Trichuris muris helminth expulsion. Plos Pathogens. 2017;13(2).

70. Nair MG, Guild KJ, Du Y, Zaph C, Yancopoulos GD, Valenzuela DM, Murphy A, Stevens S, Karow M, Artis D. Goblet cell-derived resistin-like molecule beta augments CD4(+) T cell production of IFN-gamma and infection- induced intestinal inflammation. Journal of Immunology. 2008;181(7):4709-15.

71. Herbert DR, Yang JQ, Hogan SP, Groschwitz K, Khodoun M, Munitz A, Orekov T, Perkins C, Wang Q, Brombacher F, Urban JF, Rothenberg ME, Finkelman FD. Intestinal epithelial cell secretion of RELM-beta protects against gastrointestinal worm infection. Journal of Experimental Medicine. 2009;206(13):2947-57.

72. Oudhoff MJ, Antignano F, Chenery AL, Burrows K, Redpath SA, Braam MJ, Perona-Wright G, Zaph C. Intestinal Epithelial Cell-Intrinsic Deletion of Setd7 Identifies Role for Developmental Pathways in Immunity to Helminth Infection. Plos Pathogens. 2016;12(9).

73. Lee TDG, Wakelin D. The use of host strain variation to assess the significance of mucosal mast cells in the spontaneous cure response of mice to the nematode Trichuris muris. International Archives of Allergy and Applied Immunology. 1982;67(4):302-5.

74. Koyama K, Ito Y. Mucosal mast cell responses are not required for protection against infection with the murine nematode parasite Trichuris muris. Parasite Immunology. 2000;22(1):13-20.

75. Blackwell NM, Else KJ. A comparison of local and peripheral parasite- specific antibody production in different strains of mice infected with Trichuris muris. Parasite Immunology. 2002;24(4):203-11.

76. Else KJ, Wakelin D, Wassom DL, Hauda KM. MHC-restricted antibody responses to Trichuris muris excretory secretory (E/S) antigen. Parasite Immunology. 1990;12(5):509-27.

77. Selby GR, Wakelin D. Transfer of immunity against Trichuris muris in the serum and cells. International Journal for Parasitology. 1973;3(6):717-22.

78. Blackwell NM, Else KJ. B cells and antibodies are required for resistance to the parasitic gastrointestinal nematode Trichuris muris. Infection and Immunity. 2001;69(6):3860-8.

79. Spits H, Cupedo T. Innate Lymphoid Cells: Emerging Insights in Development, Lineage Relationships, and Function. Annual Review of Immunology, Vol 30. 2012;30:647-75.

80. Perrigoue JG, Saenz SA, Siracusa MC, Allenspach EJ, Taylor BC, Giacomin PR, Nair MG, Du Y, Zaph C, van Rooijen N, Comeau MR, Pearce EJ, Laufer TM, Artis D. MHC class II-dependent basophil-CD4(+) T cell interactions

183 promote T(H)2 cytokine-dependent immunity. Nature Immunology. 2009;10(7):697-U45.

81. Sokol CL, Chu N-Q, Yu S, Nish SA, Laufer TM, Medzhitov R. Basophils function as antigen-presenting cells for an allergen-induced T helper type 2 response. Nature Immunology. 2009;10(7):713-U63.

82. Sokol CL, Barton GM, Farr AG, Medzhitov R. A mechanism for the initiation of allergen-induced T helper type 2 responses. Nature Immunology. 2008;9(3):310-8.

83. Hepworth MR, Grencis RK. Disruption of Th2 Immunity Results in a Gender-Specific Expansion of IL-13 Producing Accessory NK Cells during Helminth Infection. Journal of Immunology. 2009;183(6):3906-14.

84. Humphreys NE, Xu D, Hepworth MR, Liew FY, Grencis RK. IL-33, a potent inducer of adaptive immunity to intestinal nematodes. Journal of Immunology. 2008;180(4):2443-9.

85. Hung L-Y, Lewkowich IP, Dawson LA, Downey J, Yang Y, Smith DE, Herbert DR. IL-33 drives biphasic IL-13 production for noncanonical Type 2 immunity against hookworms. Proceedings of the National Academy of Sciences of the United States of America. 2013;110(1):282.

86. Yasuda K, Muto T, Kawagoe T, Matsumoto M, Sasaki Y, Matsushita K, Taki Y, Futatsugi-Yumikara S, Tsutsui H, Ishii KJ, Yoshimoto T, Akira S, Nakanishi K. Contribution of IL-33-activated type II innate lymphoid cells to pulmonary eosinophilia in intestinal nematode-infected mice. Proceedings of the National Academy of Sciences of the United States of America. 2012;109(9):3451-6.

87. Owyang AM, Zaph C, Wilson EH, Guild KJ, McClanahan T, Miller HRP, Cua DJ, Goldschimdt M, Hunter CA, Kastelein RA, Artis D. Interleukin 25 regulates type 2 cytokine-dependent immunity and limits chronic inflammation in the gastrointestinal tract. Journal of Experimental Medicine. 2006;203(4):843-9.

88. Price AE, Liang H-E, Sullivan BM, Reinhardt RL, Eisley CJ, Erle DJ, Locksley RM. Systemically dispersed innate IL-13-expressing cells in type 2 immunity. Proceedings of the National Academy of Sciences of the United States of America. 2010;107(25):11489-94.

89. Fallon PG, Ballantyne SJ, Mangan NE, Barlow JL, Dasvarma A, Hewett DR, McIlgorm A, Jolin HE, McKenzie AN. Identification of an interleukin (IL)-25- dependent cell population that provides IL-4, IL-5, and IL-13 at the onset of helminth expulsion. Journal of Experimental Medicine. 2006;203(4):1105-16.

90. Saenz SA, Siracusa MC, Perrigoue JG, Spencer SP, Urban JF, Tocker JE, Budelsky AL, Kleinschek MA, Kastelein RA, Kambayashi T, Bhandoola A, Artis D. IL25 elicits a multipotent progenitor cell population that promotes T(H)2 cytokine responses. Nature. 2010;464(7293):1362-U8.

184 91. Taylor BC, Zaph C, Troy AE, Du Y, Guild KJ, Comeau MR, Artis D. TSLP regulates intestinal immunity and inflammation in mouse models of helminth infection and colitis. Journal of Experimental Medicine. 2009;206(3):655-67.

92. Levison SE, McLaughlin JT, Zeef LAH, Fisher P, Grencis RK, Pennock JL. Colonic Transcriptional Profiling in Resistance and Susceptibility to Trichuriasis: Phenotyping a Chronic Colitis and Lessons for latrogenic Helminthosis. Inflammatory Bowel Diseases. 2010;16(12):2065-79.

93. Schopf LR, Hoffmann KF, Cheever AW, Urban JF, Wynn TA. IL-10 is critical for host resistance and survival during gastrointestinal helminth infection. Journal of Immunology. 2002;168(5):2383-92.

94. Collison LW, Chaturvedi V, Henderson AL, Giacomin PR, Guy C, Bankoti J, Finkelstein D, Forbes K, Workman CJ, Brown SA, Rehg JE, Jones ML, Ni HT, Artis D, Turk MJ, Vignali DA. IL-35-mediated induction of a potent regulatory T cell population. Nature Immunology. 2010;11(12):1093-U97.

95. Veldhoen M, Uyttenhove C, van Snick J, Helmby H, Westendorf A, Buer J, Martin B, Wilhelm C, Stockinger B. Transforming growth factor-beta 'reprograms' the differentiation of T helper 2 cells and promotes an interleukin 9- producing subset. Nature Immunology. 2008;9(12):1341-6.

96. Worthington JJ, Klementowicz JE, Rahman S, Czajkowska BI, Smedley C, Waldmann H, Sparwasser T, Grencis RK, Travis MA. Loss of the TGF beta- Activating Integrin alpha v beta 8 on Dendritic Cells Protects Mice from Chronic Intestinal Parasitic Infection via Control of Type 2 Immunity. Plos Pathogens. 2013;9(10).

97. Lightowlers MW. Control of Taenia solium taeniasis/cysticercosis: past practices and new possibilities. Parasitology. 2013;140(13):1566-77.

98. Lightowlers MW, Colebrook AL, Gauci CG, Gauci SM, Kyngdon CT, Monkhouse JL, Vallejo Rodriguez C, Read AJ, Rolfe RA, Sato C. Vaccination against cestode parasites: anti-helminth vaccines that work and why. Veterinary Parasitology. 2003;115(2):83-123.

99. Bottazzi ME. The human hookworm vaccine: recent updates and prospects for success. Journal of Helminthology. 2015;89(5):540-4.

100. Hotez PJ, Diemert D, Bacon KM, Beaumier C, Bethony JM, Bottazzi ME, Brooker S, Couto AR, Freire Mda S, Homma A, Lee BY, Loukas A, Loblack M, Morel CM, Oliveira RC, Russell PK. The Human Hookworm Vaccine. Vaccine. 2013;31:B227-B32.

101. Bethony J, Loukas A, Smout M, Brooker S, Mendez S, Plieskatt J, Goud G, Bottazzi ME, Zhan B, Wang Y, Williamson A, Lustigman S, Correa-Oliveira R, Xiao S, Hotez PJ. Antibodies against a secreted protein from hookworm larvae reduce the intensity of hookworm infection in humans and vaccinated laboratory animals. Faseb Journal. 2005;19(9):1743-+.

185 102. Goud GN, Zhan B, Ghosh K, Loukas A, Hawdon J, Dobardzic A, Deumic V, Liu S, Dobardzic R, Zook BC, Jin Q, Liu Y, Hoffman L, Chung-Debose S, Patel R, Mendez S, Hotez PJ. Cloning, yeast expression, isolation, and vaccine testing of recombinant Ancylostoma-secreted protein (ASP)-1 and ASP-2 from Ancylostoma ceylanicum. Journal of Infectious Diseases. 2004;189(5):919-29.

103. Diemert DJ, Pinto AG, Freire J, Jariwala A, Santiago H, Hamilton RG, Periago MV, Loukas A, Tribolet L, Mulvenna J, Correa-Oliveira R, Hotez PJ, Bethony. Generalized urticaria induced by the Na-ASP-2 hookworm vaccine: Implications for the development of vaccines against helminths. Journal of Allergy and Clinical Immunology. 2012;130(1):169-+.

104. Goud GN, Deumic V, Gupta R, Brelsford J, Zhan B, Gillespie P,Plieskatt JL, Tsao EI, Hotez PJ, Bottazzi ME. Expression, purification, and molecular analysis of the Necator americanus glutathione S-transferase 1 (Na-GST-1): A production process developed for a lead candidate recombinant hookworm vaccine antigen. Protein Expression and Purification. 2012;83(2):145-51.

105. Seid CA, Curti E, Jones RM, Hudspeth E, Rezende W, Pollet J, Center L, Versteeg L, Pritchard S, Musiychuk, Yusibov V, Hotez PJ, Bottazzi ME. Expression, purification, and characterization of the Necator americanus aspartic protease-1 (Na-APR-1 (M74)) antigen, a component of the bivalent human hookworm vaccine. Human Vaccines & Immunotherapeutics. 2015;11(6):1474-88.

106. Pearson MS, Jariwala AR, Abbenante G, Plieskatt J, Wilson D, Bottazzi ME, Hotez PJ, Keegan B, Bethony JM, Loukas A. New tools for NTD vaccines: A case study of quality control assays for product development of the human hookworm vaccine Na-APR-1M74. Human Vaccines & Immunotherapeutics. 2015;11(5):1251-7.

107. Hotez PJ, Beaumier CM, Gillespie PM, Strych U, Hayward T, Bottazzi ME. Advancing a vaccine to prevent hookworm disease and anemia. Vaccine. 2016;34(26):3001-5.

108. Tsuji N, Suzuki K, Kasuga-Aoki H, Matsumoto Y, Arakawa T, Ishiwata K, Isobe T. Intranasal immunization with recombinant Ascaris suum 14-kilodalton antigen coupled with cholera toxin B subunit induces protective immunity to A. suum infection in mice. Infection and Immunity. 2001;69(12):7285-92.

109. Tsuji N, Suzuki K, Kasuga-Aoki H, Isobe T, Arakawa T, Matsumoto Y. Mice intranasally immunized with a recombinant 16-kilodalton antigen from roundworm Ascaris parasites are protected against larval migration of Ascaris suum. Infection and Immunity. 2003;71(9):5314-23.

110. Islam MK, Miyoshi T, Tsuji N. Vaccination with recombinant Ascaris suum 24-kilodalton antigen induces a Th1/Th2-mixed type immune response and confers high levels of protection against challenged Ascaris suum lung- stage infection in BALB/c mice. International Journal for Parasitology. 2005;35(9):1023-30.

186 111. Islam MK, Miyoshi T, Yokomizo Y, Tsuji N. Molecular cloning and partial characterization of a nematode-specific 24 kDa protein from Ascaris suum. Parasitology. 2005;130:131-9.

112. Tsuji N, Kasuga-Aoki H, Isobe T, Arakawa T, Matsumoto Y. Cloning and characterisation of a highly immunoreactive 37 kDa antigen with multi- immunoglobulin domains from the swine roundworm Ascaris suum. International Journal for Parasitology. 2002;32(14):1739-46.

113. Chen N, Yuan Z-G, Xu MJ, Zhou D-H, Zhang XX, Zhang YZ, Wang XW, Yan C, Lin RQ, Zhu XQ. Ascaris suum enolase is a potential vaccine candidate against ascariasis. Vaccine. 2012;30(23):3478-82.

114. Chen N, Xu MJ, Nisbet AJ, Huang CQ, Lin RQ, Yuan ZG, Song HQ, Zhu XQ. Ascaris suum: RNAi mediated silencing of enolase gene expression in infective larvae. Experimental Parasitology. 2011;127(1):142-6.

115. Jenkins SA, Wakelin D. The source and nature of some functional antigens of Trichuris muris. Parasitology. 1977.

116. Robinson K, Bellaby T, Wakelin D. Efficacy of oral vaccination against the murine intestinal parasite Trichuris muris is dependent upon host genetics. Infection and Immunity. 1995;63(5):1762-6.

117. Hasnain SZ, McGuckin MA, Grencis RK, Thornton DJ. Serine Protease(s) Secreted by the Nematode Trichuris muris Degrade the Mucus Barrier. Plos Neglected Tropical Diseases. 2012;6(10).

118. Hewitson JP, Grainger JR, Maizels RM. Helminth immunoregulation: The role of parasite secreted proteins in modulating host immunity. Molecular and Biochemical Parasitology. 2009;167(1):1-11.

119. Fawzi EM, Bustos TC, Samblas MG, Gonzalez-Gonzalez G, Solano J, Gonzalez-Sanchez ME, De Pablos LM, Corral-Caridad MJ, Cuquerella M, Osuna A, Alunda JM. Intranasal Immunization of Lambs with Serine/Threonine Phosphatase 2A against Gastrointestinal Nematodes. Clinical and Vaccine Immunology. 2013;20(9):1352-9.

120. Tendler M, Almeida M, Simpson A. Development of the Brazilian anti Schistosomiasis vaccine based on the recombinant fatty acid binding protein Sm14 plus GLA-SE adjuvant. Frontiers in Immunology. 2015;6.

121. Rodriguezperez J, Rodriguezmedina JR, Garciablanco MA, Hillyer GV. Fasciola hepatica - molecular cloning, nucleotide sequence, and expression of a gene encoding a polypeptide homologous to a Schistosoma mansoni fatty acid binding protein. Experimental Parasitology. 1992;74(4):400-7.

122. Tendler M, Brito CA, Vilar MM, SerraFreire N, Diogo CM, Almeida MS, Delbem AC, Da Silva JF, Savino W, Garratt RC, Katz N, Simpson AS. A Schistosoma mansoni fatty acid-binding protein, Sm14, is the potential basis of

187 a dual-purpose anti-helminth vaccine. Proceedings of the National Academy of Sciences of the United States of America. 1996;93(1):269-73.

123. Lee JS, Kim IS, Sohn WM, Lee J, Yong TS. A DNA vaccine encoding a fatty acid-binding protein of Clonorchis sinensis induces protective immune response in Sprague-Dawley rats. Scandinavian Journal of Immunology. 2006;63(3):169-76.

124. Chabalgoity JA, Harrison JA, Esteves A, deHormaeche RD, Ehrlich R, Khan CMA, Hormaeche CE. Expression and immunogenicity of an Echinococcus granulosus fatty acid-binding protein in live attenuated Salmonella vaccine strains. Infection and Immunity. 1997;65(6):2402-12.

125. Miller HM. Acquired immunity against a metazoan parasite by use of non-specific worm material. Proc, Soc Exp Biol and Med. 1932;29(1125-1126).

126. Khan K. Immunological studies of Cysticercus fasciolaris. Keio Igaka. 1935;14:663–87.

127. Campbell. The specific protective property of serum from rats infected with Cysticercus crassicollis. Journal of Immunology. 1938;35:195–204.

128. Harrison GB, Heath DD, Dempster RP, Gauci C, Newton SE, Cameron WG, Robinson CM, Lawrence SB, Lightowlers MW, Rickard MD. Identification and cDNA cloning of two novel low molecular weight host-protective antigens from Taenia ovis oncospheres. International Journal of Parasitology. 1996;26:195-204.

129. Harrison GB, Heath DD, Dempster RP, Lawrence SB, Lightowlers MW, Rickard MD. Identification of host-protective antigens of Taenia ovis oncospheres. International Journal of Parasitology. 1993;23:41-50.

130. Assana E, Kyngdon CT, Gauci CG, Geerts S, Dorny P, De Deken R, Anderson GA, Zoli AP, Lightowlers MW. Elimination of Taenia solium transmission to pigs in a field trial of the TSOL18 vaccine in Cameroon. International Journal for Parasitology. 2010;40(5):515-9.

131. Lightowlers MW. Eradication of Taenia solium cysticercosis: A role for vaccination of pigs. International Journal for Parasitology. 2010;40(10):1183-92.

132. Lightowlers MW, Rolfe R, Gauci CG. Taenia saginata: Vaccination against cysticercosis in cattle with recombinant oncosphere antigens. Experimental Parasitology. 1996;84(3):330-8.

133. Lightowlers MW, Lawrence SB, Gauci CG, Young J, Ralston MJ, Maas D, Heath DD. Vaccination against hydatidosis using a defined recombinant antigen. Parasite Immunology. 1996;18(9):457-62.

134. Lightowlers MW, Jensen O, Fernandez E, Iriarte JA, Woollard DJ, Cauci CG, Jenkins DJ, Heath DD. Vaccination trials in Australia and Argentina confirm

188 the effectiveness of the EG95 hydatid vaccine in sheep. International Journal for Parasitology. 1999;29(4):531-4.

135. Lebre F, Hearnden CH, Lavelle EC. Modulation of Immune Responses by Particulate Materials. Advanced Materials. 2016;28(27):5525-41.

136. Elliott SL, Suhrbier A, Miles JJ, Lawrence G, Pye SJ, Le TT, Rosenstengel A, Nguyen T, Allworth A, Burrows SR, Cox J, Pye D, Moss DJ, Bharadwaj M. Phase I trial of a CD8(+) T-Cell peptide epitope-based vaccine for infectious mononucleosis. Journal of Virology. 2008;82(3):1448-57.

137. Sabet LP, Taheri T, Memarnejadian A, Azad TM, Asgari F, Rahimnia R, Alavian SM, Rafati S, Samimi Rad K. Immunogenicity of Multi-Epitope DNA and Peptide Vaccine Candidates Based on Core, E2, NS3 and NS5B HCV Epitopes in BALB/c Mice. Hepatitis Monthly. 2014;14(10).

138. Koopman G, Beenhakker N, Nieuwenhuis I, Doxiadis G, Mooij P, Drijfhout JW, Koestler J, Hanke T, Fagrouch Z, Verschoor EJ, Bontrop RE, Wagner R, Bogers WM, Melief CJ. DNA/long peptide vaccination against conserved regions of SIV induces partial protection against SIVmac251 challenge. Aids. 2013;27(18):2841-51.

139. Hermsen CC, Verhage DF, Telgt DS, Teelen K, Bousema JT, Roestenberg M, Bolad A, Berzins K, Corradin G, Leroy O, Theisen M, Sauerwein RW.Glutamate-rich protein (GLURP) induces antibodies that inhibit in vitro growth of Plasmodium falciparum in a phase 1 malaria vaccine trial. Vaccine. 2007;25(15):2930-40.

140. Pierce MA, Ellis RD, Martin LB, Malkin E, Tierney E, Miura K, Fay MP, Marjason J, Elliott SL, Mullen GE, Rausch K, Zhu D, Long CA, Miller LH. Phase 1 safety and immunogenicity trial of the Plasmodium falciparum blood- stage malaria vaccine AMA1-C1/ISA 720 in Australian adults. Vaccine. 2010;28(10):2236-42.

141. Audran R, Cachat M, Lurati F, Soe S, Leroy O, Corradin G, Druilhe P, Spertini F. Phase I malaria vaccine trial with a long synthetic peptide derived from the merozoite surface protein 3 antigen. Infection and Immunity. 2005;73(12):8017-26.

142. Ricciardi A, Visitsunthorn K, Dalton JP, Ndao M. A vaccine consisting of Schistosoma mansoni cathepsin B formulated in Montanide ISA 720 VG induces high level protection against murine schistosomiasis. Bmc Infectious Diseases. 2016;16.

143. Marrack P, McKee AS, Munks MW. Towards an understanding of the adjuvant action of aluminium. Nature Reviews Immunology. 2009;9(4):287-93.

144. Hutchison S, Benson R, Gibson V, Pollock A, Garside P, Brewer J. Antigen depot is not required for alum adjuvanticity. FASEB Journal. 2012;26(3):1272-9.

189 145. Marichal T1, Ohata K, Bedoret D, Mesnil C, Sabatel C, Kobiyama K, Lekeux P, Coban C, Akira S, Ishii KJ, Bureau F, Desmet CJ. DNA released from dying host cells mediates aluminum adjuvant activity. Nature Medicine. 2011;17(8):996-U118.

146. Sharp FA1, Ruane D, Claass B, Creagh E, Harris J, Malyala P, Singh M, O'Hagan DT, Pétrilli V, Tschopp J, O'Neill LA, Lavelle EC. Uptake of particulate vaccine adjuvants by dendritic cells activates the NALP3 inflammasome. Proceedings of the National Academy of Sciences of the United States of America. 2009;106(3):870-5.

147. Li HF, Willingham SB, Ting JPY, Re F. Cutting edge: Inflammasome activation by alum and alum's adjuvant effect are mediated by NLRP3. Journal of Immunology. 2008;181(1):17-21.

148. Eisenbarth SC, Colegio OR, O'Connor W, Sutterwala FS, Flavell RA. Crucial role for the Nalp3 inflammasome in the immunostimulatory properties of aluminium adjuvants. Nature. 2008;453(7198):1122-U13.

149. Duewell P1, Kisser U, Heckelsmiller K, Hoves S, Stoitzner P, Koernig S, Morelli AB, Clausen BE, Dauer M, Eigler A, Anz D, Bourquin C, Maraskovsky E, Endres S, Schnurr M. ISCOMATRIX Adjuvant Combines Immune Activation with Antigen Delivery to Dendritic Cells In Vivo Leading to Effective Cross- Priming of CD8(+) T Cells. Journal of Immunology. 2011;187(1):55-63.

150. Wilson NS1, Yang B, Morelli AB, Koernig S, Yang A, Loeser S, Airey D, Provan L, Hass P, Braley H, Couto S, Drane D, Boyle J, Belz GT, Ashkenazi A, Maraskovsky E. ISCOMATRIX vaccines mediate CD8(+) T-cell cross-priming by a MyD88-dependent signaling pathway. Immunology and Cell Biology. 2012;90(5):540-52.

151. Frazer IH1, Quinn M, Nicklin JL, Tan J, Perrin LC, Ng P, O'Connor VM, White O, Wendt N, Martin J, Crowley JM, Edwards SJ, McKenzie AW, Mitchell SV, Maher DW, Pearse MJ, Basser RL. Phase 1 study of HPV16- specific immunotherapy with E6E7 fusion protein and ISCOMATRIX (TM) adjuvant in women with cervical intraepithelial neoplasia. Vaccine. 2004;23(2):172-81.

152. Marcilla A, Trelis M, Cortes A, Sotillo J, Cantalapiedra F, Teresa Minguez M, Valero ML, Sanchez del Pino MM, Munoz-Antoli C, Toledo R, Bernal D. Extracellular Vesicles from Parasitic Helminths Contain Specific Excretory/Secretory Proteins and Are Internalized in Intestinal Host Cells. Plos One. 2012;7(9).

153. Coakley G, Maizels RM, Buck AH. Exosomes and Other Extracellular Vesicles: The New Communicators in Parasite Infections. Trends in Parasitology. 2015;31(10):477-89.

190 154. Hansen EP, Kringel H, Williams AR, Nejsum P. Secretion of RNA containing extracellular vesicles by the porcine whipworm, Trichuris suis. Journal of Parasitology. 2015;101(3):336-40.

155. Coakley G, McCaskill JL, Borger JG, Simbari F, Robertson E, Millar M, Harcus Y, McSorley HJ, Maizels RM, Buck AH. Extracellular Vesicles from a Helminth Parasite Suppress Macrophage Activation and Constitute an Effective Vaccine for Protective Immunity. Cell Reports. 2017;19:1545-57.

156. Trelis M, Galiano A, Bolado A, Toledo R, Marcilla A, Bernal D. Subcutaneous injection of exosomes reduces symptom severity and mortality induced by Echinostoma caproni infection in BALB/c mice. International Journal for Parasitology. 2016;46(12):799-808.

157. Mathivanan S, Ji H, Simpson RJ. Exosomes: Extracellular organelles important in intercellular communication. Journal of Proteomics. 2010;73(10):1907-20.

158. Pan BT, Johnstone RM. Fate of the transferrin receptor during maturation of sheep reticulocytes in vitro - selective externalization of the receptor. Cell. 1983;33(3):967-77.

159. Harding C, Heuser J, Stahl P. Receptor mediated endocytosis of transferrin and recycling of the transferrin receptor in rat reticulocytes. Journal of Cell Biology. 1983;97(2):329-39.

160. Raposo G, Nijman HW, Stoorvogel W, Leijendekker R, Harding CV, Melief CJM, Geuze HJ. B lymphocytes secrete antigen-presenting vesicles. Journal of Experimental Medicine. 1996;183(3):1161-72.

161. Valadi H, Ekstrom K, Bossios A, Sjostrand M, Lee JJ, Lotvall JO. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nature Cell Biology. 2007;9(6):654-U72.

162. Silverman JM, Reiner NE. Leishmania exosomes deliver preemptive strikes to create an environment permissive for early infection. Frontiers in Cellular and Infection Microbiology. 2012;1:1-8.

163. Silverman JM, Clos J, Horakova E, Wang AY, Wiesgigl M, Kelly I, Lynn MA, McMaster WR, Foster LJ, Levings MK, Reiner NE. Leishmania Exosomes Modulate Innate and Adaptive Immune Responses through Effects on Monocytes and Dendritic Cells. Journal of Immunology. 2010;185(9):5011-22.

164. Trocoli Torrecilhas AC, Tonelli RR, Pavanelli WR, da Silva JS, Schumacher RI, de Souza W, E Silva NC, de Almeida Abrahamsohn I, Colli W, Manso Alves MJ. Trypanosoma cruzi: parasite shed vesicles increase heart parasitism and generate an intense inflammatory response. Microbes and Infection. 2009;11(1):29-39.

165. Buck AH, Coakley G, Simbari F, McSorley HJ, Quintana JF, Le Bihan T, Kumar S, Abreu-Goodger C, Lear M, Harcus Y, Ceroni A, Babayan SA, Blaxter

191 M, Ivens A, Maizels RM. Exosomes secreted by nematode parasites transfer small RNAs to mammalian cells and modulate innate immunity. Nature Communications. 2014;5.

166. Cvjetkovic A, Lotvall J, Lasser C. The influence of rotor type and centrifugation time on the yield and purity of extracellular vesicles. Journal of Extracellular Vesicles. 2013.

167. Hanson PI, Cashikar A. Multivesicular Body Morphogenesis. Annual Review of Cell and Developmental Biology, Vol 28. 2012;28:337-62.

168. Coakley G, Buck AH, Maizels RM. Host parasite communications- Messages from helminths for the immune system Parasite communication and cell-cell interactions. Molecular and Biochemical Parasitology. 2016;208(1):33- 40.

169. Wang L, Li Z, Shen J, Liu Z, Liang J, Wu X, Sun X, Wu Z. Exosome-like vesicles derived by Schistosoma japonicum adult worms mediates M1 type immune- activity of macrophage. Parasitology Research. 2015;114(5):1865-73.

170. Virginio VG, Monteiro KM, Drumond F, de Carvalho MO, Vargas DM, Zaha A, Ferreira HB. Excretory/secretory products from in vitro-cultured Echinococcus granulosus protoscoleces. Molecular and Biochemical Parasitology. 2012;183(1):15-22.

171. dos Santos GB, Monteiro KM, da Silva ED, Battistella ME, Ferreira HB, Zaha A. Excretory/secretory products in the Echinococcus granulosus metacestode: is the intermediate host complacent with infection caused by the larval form of the parasite? International Journal for Parasitology. 2016;46(13- 14):843-56.

172. Bernal D, Trelis M, Montaner S, Cantalapiedra F, Galiano A, Hackenberg M, Marcilla A. Surface analysis of Dicrocoelium dendriticum. The molecular characterization of exosomes reveals the presence of miRNAs. Journal of Proteomics. 2014;105:232-41.

173. Sotillo J, Pearson M, Potriquet J, Becker L, Pickering D, Mulvenna J, Loukas A. Extracellular vesicles secreted by Schistosoma mansoni contain protein vaccine candidates. International Journal for Parasitology. 2016;46(1):1- 5.

174. Espino AM, Hillyer GV. Molecular cloning of a member of the Fasciola hepatica saposin-like protein family. Journal of Parasitology. 2003;89(3):545-52.

175. Tran MH, Pearson MS, Jeffrey MB, Smyth DJ, Jones MK, Duke M, Don TA, McManus DP, Correa-Oliveira R, Loukas A. Tetraspanins on the surface of Schistosoma mansoni are protective antigens against schistosomiasis. Nature Medicine. 2006;12(7):835-40.

176. Cardoso FC, Pacifico RNA, Mortara RA, Oliveira SC. Human antibody responses of patients living in endemic areas for schistosomiasis to the

192 tegumental protein Sm29 identified through genomic studies. Clinical and Experimental Immunology. 2006;144(3):382-91.

177. Rezende CMF, Silva MR, Santos IGD, Silva GAB, Gomes DA, Goes AM. Immunization with rP22 induces protective immunity against Schistosoma mansoni: Effects on granuloma down-modulation and cytokine production. Immunology Letters. 2011;141(1):123-33.

178. Nowacki FC, Swain MT, Klychnikov OI, Niazi U, Ivens A, Quintana JF, Hensbergen PJ, Hokke CH, Buck AH, Hoffmann KF. Protein and small non- coding RNA-enriched extracellular vesicles are released by the pathogenic blood fluke Schistosoma mansoni. Journal of Extracellular Vesicles. 2015;4.

179. Zamanian M, Fraser LM, Agbedanu PN, Harischandra H, Moorhead AR, Day TA, Bartholomay LC, Kimber MJ. Release of Small RNA-containing Exosome-like Vesicles from the Human Filarial Parasite Brugia malayi. Plos Neglected Tropical Diseases. 2015;9(9).

180. Tritten L, Tam M, Vargas M, Jardim A, Stevenson MM, Keiser J, Geary TG. Excretory/secretory products from the gastrointestinal nematode Trichuris muris. Experimental Parasitology. 2017;178:30-36.

181. Tzelos T, Matthews JB, Buck AH, Simbari F, Frew D, Inglis NF, McLean K, Nisbet AJ, Whitelaw CB, Knox DP, McNeilly TN. A preliminary proteomic characterisation of extracellular vesicles released by the ovine parasitic nematode, Teladorsagia circumcincta. Veterinary Parasitology. 2016;221:84-92.

182. Tritten L, Clarke D, Timmins S, McTier T, Geary TG. Dirofilaria immitis exhibits sex- and stage-specific differences in excretory/secretory miRNA and protein profiles. Veterinary Parasitology. 2016;232:1-7.

183. Eichenberger RM, Talukder MH, Field MA, Wangchuk P, Giacomin P, Loukas A, Sotillo J. Characterisation of Trichuris muris secreted proteins and extracellular vesicles provides new insights into host-parasite communication. BioRxiv. 2017. 184. McKenzie GJ, Bancroft A, Grencis RK, McKenzie ANJ. A distinct role for interleukin-13 in Th2-cell-mediated immune responses. Current Biology. 1998;8(6):339-42.

185. Hayes KS, Cliffe LJ, Bancroft AJ, Forman SP, Thompson S, Booth C, Grencis RK. Chronic Trichuris muris infection causes neoplastic change in the intestine and exacerbates tumour formation in APC min/+ mice. PLoS Neglected Tropical Diseases. 2017.

186. Malvern. Dynamic light scattering common terms defined. 2011.

187. Hollander MaW, D.A. Nonparametric Statistical Methods: John Wiley & Sons.; 1973.

193 188. Keiser J, Utzinger J. The Drugs We Have and the Drugs We Need Against Major Helminth Infections. Advances in Parasitology, Vol 73: Important Helminth Infections in Southeast Asia: Diversity and Potential for Control and Elimination, Pt B. 2010;73:197-230.

189. Khan WI, Motomura Y, Blennerhassett PA, Kanbayashi H, Varghese AK, El-Sharkawy RT, Gauldie J, Collins SM. Disruption of CD40-CD40 ligand pathway inhibits the development of intestinal muscle hypercontractility and protective immunity in nematode infection. American Journal of Physiology- Gastrointestinal and Liver Physiology. 2005;288(1):G15-G22.

190. Amanna IJ, Slifka MK, Crotty S. Immunity and immunological memory following smallpox vaccination. Immunological Reviews. 2006;211:320-37.

191. Zhang X, Wang Q, Bi Y, Kou Z, Zhou J, Cui Y, Yan Y, Zhou L, Tan Y, Yang H, Du Z, Han Y, Song Y, Zhang P, Zhou D, Yang R, Wang X. Kinetics of Memory B Cell and Plasma Cell Responses in the Mice Immunized with Plague Vaccines. Scandinavian Journal of Immunology. 2014;79(3):157-62.

192. Pepper M, Linehan JL, Pagan AJ, Zell T, Dileepan T, Cleary PP, Jenkins MK. Different routes of bacterial infection induce long-lived T(H)1 memory cells and short-lived T(H)17 cells. Nature Immunology. 2010;11(1):83-U2.

193. Brady RC, Treanor JJ, Atmar RL, Keitel WA, Edelman R, Chen WH, Winokur P, Belshe R, Graham IL, Noah DL, Guo K, Hill H. Safety and immunogenicity of a subvirion inactivated influenza A/H5N1 vaccine with or without aluminum hydroxide among healthy elderly adults. Vaccine. 2009;27(37):5091-5.

194. Keitel WA1, Campbell JD, Treanor JJ, Walter EB, Patel SM, He F, Noah DL, Hill H. Safety and immunogenicity of an inactivated influenza A/H5N1 vaccine given with or without aluminum hydroxide to healthy adults: Results of a phase I-II randomized clinical trial. Journal of Infectious Diseases. 2008;198(9):1309-16.

195. Verdijk P, Rots NY, van Oijen MG, Weldon WC, Oberste MS, Okayasu H, Sutter RW, Bakker WA. Safety and immunogenicity of a primary series of Sabin-IPV with and without aluminum hydroxide in infants. Vaccine. 2014;32(39):4938-44.

196. Schmidt CS, White CJ, Ibrahim AS, Filler SG, Fu Y, Yeaman MR, Edwards JE, Hennessey JP. NDV-3, a recombinant alum-adjuvanted vaccine for Candida and Staphylococcus aureus, is safe and immunogenic in healthy adults. Vaccine. 2012;30(52):7594-600.

197. Bancroft AJ, Else KJ, Grencis RK. Low level infection with Trichuris muris significantly affects the polarization of the CD4 response. European Journal of Immunology. 1994;24(12):3113-8.

194 198. Else KJ, Hultner L, Grencis RK. Cellular immune responses to the murine nematode parasite Trichuris muris. 2. Differential induction of the TH cell subsets in resistant versus susceptible mice. Immunology. 1992;75(2):232-7.

199. Smith NMS, Wasserman GA, Coleman FT, Hilliard KL, Yamamoto K, Lipsitz E, Malley R, Dooms H, Jones MR, Quinton LJ, Mizgerd JP. Regionally compartmentalized resident memory T cells mediate naturally acquired protection against pneumococcal pneumonia. Mucosal Immunology. 2017.

200. Hewitson JP, Ivens AC, Harcus Y, Filbey KJ, McSorley HJ, Murray J, Bridgett S, Ashford D, Dowle AA, Maizels RM. Secretion of Protective Antigens by Tissue-Stage Nematode Larvae Revealed by Proteomic Analysis and Vaccination-Induced Sterile Immunity. Plos Pathogens. 2013;9(8).

201. Neilson KA, Ali NA, Muralidharan S, Mirzaei M, Mariani M, Assadourian G, Lee A, van Sluyter SC, Haynes PA. Less label, more free: Approaches in label-free quantitative mass spectrometry. Proteomics. 2011;11(4):535-53.

202. Healthcare G. Superose 12 Overview [Available from: http://www.gelifesciences.com/webapp/wcs/stores/servlet/productById/en/GELif eSciences-uk/17517301.

203. Healthcare G. Superdex 75 10/300 GL and 5/150 G [Available from: http://www.gelifesciences.com/webapp/wcs/stores/servlet/productById/en/GELif eSciences-uk/17517401.

204. Santos LN, Gallo MBC, Silva ES, Figueiredo CAV, Cooper PJ, Barreto ML, Loureiro S, Pontes-de-Carvalho LC, Alcantara-Neves NM. A proteomic approach to identify proteins from Trichuris trichiura extract with immunomodulatory effects. Parasite Immunology. 2013;35(5-6):188-93.

205. Redmond DL, Smith SK, Halliday A, Smith WD, Jackson F, Knox DP, Matthews JB. An immunogenic cathepsin F secreted by the parasitic stages of Teladorsagia circumcincta. International Journal for Parasitology. 2006;36(3):277-86.

206. Nisbet AJ, McNeilly TN, Wildblood LA, Morrison AA, Bartley DJ, Bartley Y, Longhi C, McKendrick IJ, Palarea-Albaladejo J, Matthews JB. Successful immunization against a parasitic nematode by vaccination with recombinant proteins. Vaccine. 2013;31(37):4017-23.

207. Lee BH, Hwang DM, Palaniyar N, Grinstein S, Philpott DJ, Hu J. Activation of P2X(7) receptor by ATP plays an important role in regulating inflammatory responses during acute viral infection. PloS one. 2012;7(4):e35812-e.

208. Goncalves AM, Pedro AQ, Maia C, Sousa F, Queiroz JA, Passarinha LA. Pichia pastoris: A Recombinant Microfactory for Antibodies and Human Membrane Proteins. Journal of Microbiology and Biotechnology. 2013;23(5):587-601.

195 209. Matthews JB, Geldhof P, Tzelos T, Claerebout E. Progress in the development of subunit vaccines for gastrointestinal nematodes of ruminants. Parasite Immunology. 2016;38(12):744-53.

210. Wilson IBH, Paschinger K. Sweet secrets of a therapeutic worm: mass- spectrometric N-glycomic analysis of Trichuris suis. Analytical and Bioanalytical Chemistry. 2016;408(2):461-71.

211. Hokke C, van Diepen A. Helminth glycomics – glycan repertoires and host-parasite interactions. Molecular & Biochemical Parasitology. 2017;215:47-57.

212. Urquhart GM, Jarrett WFH, Jennings FW, McIntyre WI, Mulligan W. Immunity to Haemonchus contortus infection - relationship between age and successful vaccination with irradiated larvae. American Journal of Veterinary Research. 1966;27(121):1645-.

213. Smith WD. Protection in lambs immunized with Haemonchus contortus gut membrane proteins. Research in Veterinary Science. 1993;54(1):94-101.

214. Smith SK, Pettit D, Newlands GF, Redmond DL, Skuce PJ, Knox DP, Smith WD. Further immunization and biochemical studies with a protective antigen complex from the microvillar membrane of the intestine of Haemonchus contortus. Parasite Immunology. 1999;21(4):187-99.

215. Smith TS, Munn EA, Graham M, Tavernor AS, Greenwood CA. Purification and evaluation of the integral membrane protein H11 as a protective antigen against Haemonchus contortus. International Journal for Parasitology. 1993;23(2):271-80.

216. Smith SK, Smith WD. Immunisation of sheep with an integral membrane glycoprotein complex of Haemonchus contortus and with its major polypeptide components. Research in Veterinary Science. 1996;60(1):1-6.

217. Smith WD, Smith SK, Murray JM. Protection studies with integral membrane fractions of Haemonchus contortus. Parasite Immunology. 1994;16(5):231-41.

218. Knox DP, Redmond DL, Skuce PJ, Newlands GFJ. The contribution of molecular biology to the development of vaccines against nematode and trematode parasites of domestic ruminants. Veterinary Parasitology. 2001;101(3-4):311-35.

219. Newton SE, Meeusen ENT. Progress and new technologies for developing vaccines against gastrointestinal nematode parasites of sheep. Parasite Immunology. 2003;25(5):283-96.

220. Reszka N, Rijsewijk FAM, Zelnik V, Moskwa B, Bienkowska-Szewczyk K. Haemonchus contortus: Characterization of the baculovirus expressed form of aminopeptidase H11. Experimental Parasitology. 2007;117(2):208-13.

196 221. Geldhof P, Claerebout E, Knox D, Vercauteren I, Looszova A, Vercruysse J. Vaccination of calves against Ostertagia ostertagi with cysteine proteinase enriched protein fractions. Parasite Immunology. 2002;24(5):263-70.

222. Geldhof P, Vercauteren I, Gevaert K, Staes A, Knox DP, Vandekerckhove J, Vercruysse J, Claerebout E. Activation-associated secreted proteins are the most abundant antigens in a host protective fraction from Ostertagia ostertagi. Molecular and Biochemical Parasitology. 2003;128(1):111-4.

223. Jacobs PP, Geysens S, Vervecken W, Contreras R, Callewaert N. Engineering complex-type N-glycosylation in Pichia pastoris using GlycoSwitch technology. Nature Protocols. 2009;4(1):58-70.

224. Meuris L, Santens F, Elson G, Festjens N, Boone M, Dos Santos A, Devos S, Rousseau F, Plets E, Houthuys E, Malinge P, Magistrelli G, Cons L, Chatel L, Devreese B, Callewaert N. GlycoDelete engineering of mammalian cells simplifies N-glycosylation of recombinant proteins. Nature Biotechnology. 2014;32(5):485-U210.

225. Roberts B, Antonopoulos A, Haslam SM, Dicker AJ, McNeilly TN, Johnston SL, Dell A, Knox DP, Britton C. Novel expression of Haemonchus contortus vaccine candidate aminopeptidase H11 using the free-living nematode Caenorhabditis elegans. Veterinary Research. 2013;44.

226. Chitnis CE, Mukherjee P, Mehta S, Yazdani SS, Dhawan S, Shakri AR, Bhardwaj R, Gupta PK, Hans D, Mazumdar S, Singh B, Kumar S, Pandey G, Parulekar V, Imbault N, Shivyogi P, Godbole G, Mohan K, Leroy O, Singh K, Chauhan VS. Phase I Clinical Trial of a Recombinant Blood Stage Vaccine Candidate for Plasmodium falciparum Malaria Based on MSP1 and EBA175. Plos One. 2015;10(9).

227. Xu J, Bai X, Wang L, Shi HN, van der Giessen JWB, Boireau P, Liu MY, Liu XL. Influence of adjuvant formulation on inducing immune response in mice immunized with a recombinant serpin from Trichinella spiralis. Parasite Immunology. 2017.

228. Hu JH, Chen ZH, Gu J, Wan MB, Shen Q, Kieny MP, He J, Li Z, Zhang Q, Reed ZH, Zhu Y, Li W, Cao Y, Qu L, Cao Z, Wang Q, Liu H, Pan X, Huang X, Zhang Dm Xue X, Pan W. Safety and Immunogenicity of a Malaria Vaccine, Plasmodium falciparum AMA-1/MSP-1 Chimeric Protein Formulated in Montanide ISA 720 in Healthy Adults. Plos One. 2008;3(4).

229. Murphy K. Janeway's Immunobiology. 8th ed. London: Garland Science; 2012.

230. Loukas A, Bethony JM, Williamson AL, Goud GN, Mendez S, Zhan B, Hawdon JM, Bottazzi ME, Brindley PJ Hotez PJ. Vaccination of dogs with a recombinant cysteine protease from the intestine of canine hookworms

197 diminishes the fecundity and growth of worms. Journal of Infectious Diseases. 2004;189(10):1952-61.

231. Vermeire JJ, Lantz LD, Caffrey CR. Cure of Hookworm Infection with a Cysteine Protease Inhibitor. Plos Neglected Tropical Diseases. 2012;6(7).

232. Singh PK, Kushwaha S, Rana AK, Misra-Bhattacharya S. Cofactor Independent Phosphoglycerate Mutase of Brugia malayi Induces a Mixed Th1/Th2 Type Immune Response and Inhibits Larval Development in the Host. Biomed Research International. 2014.

233. Singh PK, Kushwaha S, Mohd S, Pathak M, Misra-Bhattacharya S. In vitro gene silencing of independent phosphoglycerate mutase (iPGM) in the filarial parasite Brugia malayi. Infectious Diseases of Poverty. 2013;2.

234. Feng D, Zhao WL, Ye YY, Bai XC, Liu RQ, Chang LF, Zhou Q, Sui SF. Cellular Internalization of Exosomes Occurs Through Phagocytosis. Traffic. 2010;11(5):675-87.

235. Guy B. The perfect mix: recent progress in adjuvant research. Nature Reviews Microbiology. 2007;5(7):505-17.

236. Chadwick S, Kriegel C, Amiji M. Nanotechnology solutions for mucosal immunization. Advanced Drug Delivery Reviews. 2010;62(4-5):394-407.

237. Gregoriadis G. Liposomes as Immunoadjuvants and Vaccine Carriers: Antigen Entrapment. ImmunoMethods. 1994;4(3):210-6.

238. Fifis T, Gamvrellis A, Crimeen-Irwin B, Pietersz GA, Li J, Mottram PL, McKenzie IF, Plebanski M. Size-dependent immunogenicity: Therapeutic and protective properties of nano-vaccines against tumors. Journal of Immunology. 2004;173(5):3148-54.

239. Armstrong SD, Babayan SA, Lhermitte-Vallarino N, Gray N, Xia D, Martin C, Kumar S, Taylor DW, Blaxter ML, Wastling JM, Makepeace BL. Comparative Analysis of the Secretome from a Model Filarial Nematode (Litomosoides sigmodontis) Reveals Maximal Diversity in Gravid Female Parasites. Molecular & Cellular Proteomics. 2014;13(10):2527-44.

240. Vercauteren I, Geldhof P, Peelaers I, Claerebout E, Berx G, Vercruysse J. Identification of excretory-secretory products of larval and adult Ostertagia ostertagi by immunoscreening of cDNA libraries. Molecular and Biochemical Parasitology. 2003;126(2):201-8.

241. Rodriguez PBR, Cruz RR, Garcia DID, Gutierrez RH, Quintanilla REL, Sahagun DO, Gonzalez Castillo C, Gutierrez Ortega A, Herrera Rodriguez SE, Vallejo Cardona A, Martinez Velazquez M. Identification of immunogenic proteins from ovarian tissue and recognized in larval extracts of Rhipicephalus (Boophilus) microplus, through an immunoproteomic approach. Experimental Parasitology. 2016;170:227-35.

198 242. Taheri M, Nabian S, Ranjbar M, Fard RMN, Sadeghian AG, Sazmand A. Study of vitellogenin in Boophilus annulatus tick larvae and its immunological aspects. Tropical Biomedicine. 2014;31(3):398-405.

243. Bartley K, Wright HW, Huntley JF, Manson EDT, Inglis NF, McLean K, Nath M, Bartley Y, Nisbet AJ. Identification and evaluation of vaccine candidate antigens from the poultry red mite (Dermanyssus gallinae). International Journal for Parasitology. 2015;45(13):819-30.

244. Zhang TT, Cui XJ, Zhang JC, Wang H, Wu M, Zeng H, Cao Y, Liu J, Hu J. Screening and Identification of Antigenic Proteins from the Hard Tick Dermacentor silvarum (Acari: Ixodidae). Korean Journal of Parasitology. 2015;53(6):789-93.

245. Pearson MS, Bethony JM, Pickering DA, de Oliveira LM, Jariwala A, Santiago H, Miles AP, Zhan B, Jiang D, Ranjit N, Mulvenna J, Tribolet L, Plieskatt J, Smith T, Bottazzi ME, Jones K, Keegan B, Hotez PJ, Loukas A. An enzymatically inactivated hemoglobinase from Necator americanus induces neutralizing antibodies against multiple hookworm species and protects dogs against heterologous hookworm infection. Faseb Journal. 2009;23(9):3007-19.

246. Beauvillain C, Juste MO, Dion S, Pierre J, Dimier-Poisson I. Exosomes are an effective vaccine against congenital toxoplasmosis in mice. Vaccine. 2009;27(11):1750-7.

247. del Cacho E, Gallego M, Lee SH, Lillehoj HS, Quilez J, Lillehoj EP, Quilez J, Lillehoj EP, Sanchez-Acedo C. Induction of Protective Immunity against Eimeria tenella, Eimeria maxima, and Eimeria acervulina Infections Using Dendritic Cell-Derived Exosomes. Infection and Immunity. 2012;80(5):1909-16.

248. McSorley HJ, Hewitson JP, Maizels RM. Immunomodulation by helminth parasites: Defining mechanisms and mediators. International Journal for Parasitology. 2013;43(3-4):301-10.

249. Boulanger D, Reid GDF, Sturrock RF, Wolowczuk I, Balloul JM, Grezel D, Pierce RJ, Otieno MF, Guerret MF, Grimaud A, Butterworth AE, Capron A. Immunization of mice and baboons with the recombinant SM28GST affects both worm viability and fecundity after experimental infection with Schistosome mansoni. Parasite Immunology. 1991;13(5):473-90.

250. Boulanger D, Warter A, Trottein F, Mauny F, Bremond P, Audibert F, Couret D, Kadri S, Codin C, Sellin E, Pierce RJ, Lecocq JP, Sellin B, Capron A. Vaccination of patas monkeys experimentally with Schistosoma haematobium using a recombinant glutathione-S-transferase cloned from Schistosoma mansoni. Parasite Immunology. 1995;17(7):361-9.

251. Grzych JM, Grezel D, Xu CB, Neyrinck JL, Capron M, Ouma JH, Butterworth AE, Capron A. IgA antibodies to a protective antigen in human Schistosomiasis mansoni. Journal of Immunology. 1993;150(2):527-35.

199 252. Remoue F, Rogerie F, Gallissot MC, Guyatt HL, Neyrinck JL, Diakkhate MM, Niang M, Butterworth AE, Auriault C, Capron A, Riveau G. Sex-dependent neutralizing humoral response to Schistosoma mansoni 28GST antigen in infected human populations. Journal of Infectious Diseases. 2000;181(5):1855-9.

253. Habtezion A, Nguyen LP, Hadeiba H, Butcher EC. Leukocyte Trafficking to the Small Intestine and Colon. Gastroenterology. 2016;150(2):340-54.

254. Li XR, Aldayel AM, Cui ZR. Aluminum hydroxide nanoparticles show a stronger vaccine adjuvant activity than traditional aluminum hydroxide microparticles. Journal of Controlled Release. 2014;173:148-57.

255. Salim N, Knopp S, Lweno O, Abdul U, Mohamed A, Schindler T, Rothen J, Masimba J, Kwaba D, Mohammed AS, Althaus F, Abdulla S, Tanner M, Daubenberger C, Genton B. Distribution and Risk Factors for Plasmodium and Helminth Co-infections: A Cross-Sectional Survey among Children in Bagamoyo District, Coastal Region of Tanzania. Plos Neglected Tropical Diseases. 2015;9(4):3660-.

256. Goncalves RM, Lima NF, Ferreira MU. Parasite virulence, co-infections and cytokine balance in malaria. Pathogens and Global Health. 2014;108(4):173-8.

257. George PJ, Anuradha R, Kumar NP, Sridhar R, Banurekha VV, Nutman TB, Babu S. Helminth Infections Coincident with Active Pulmonary Tuberculosis Inhibit Mono- and Multifunctional CD4(+) and CD8(+) T Cell Responses in a Process Dependent on IL-10. Plos Pathogens. 2014;10(9).

200 Appendix 1

GTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCAT ATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACC CCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAAAGGGACTTTCCATTGA CGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGC CAAGTCCGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACAT GACCTTACGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGA TGCGGTTTTGGCAGTACACCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCT CCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGT CGTAATAACCCCGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATA AGCAGAGCTCGTTTAGTGAACCGTCAGATCTCTAGAAGCTGGGTACCAGCTGCTAGCAAGCTTC TTCCTGCCGCCAGCCTGCCTGCCACTGAGGGTTCCCAGCACCATGAGGGCCTGGATCTTCTTT CTCCTTTGCCTGGCCGGGAGGGCTCTGGCAGCCCCGCTAGCGCATCACCATCACCATCACGAT CTGTACGACGATGACGATAAGCTCGAGGCCGGCAAGGCCGGATCCAGACATGATAAGATACAT TGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTG ATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTC ATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAA TGTGGTATGGCTGATTATGATCCGGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTG ACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGC CCGTCAGGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGAGGTCGACTCTAGAGG ATCGATGCCCCGCCCCGGACGAACTAAACCTGACTACGACATCTCTGCCCCTTCTTCGCGGGG CAGTGCATGTAATCCCTTCAGTTGGTTGGTACAACTTGCCAACTGGGCCCTGTTCCACATGTGA CACGGGGGGGGACCAAACACAAAGGGGTTCTCTGACTGTAGTTGACATCCTTATAAATGGATGT GCACATTTGCCAACACTGAGTGGCTTTCATCCTGGAGCAGACTTTGCAGTCTGTGGACTGCAAC ACAACATTGCCTTTATGTGTAACTCTTGGCTGAAGCTCTTACACCAATGCTGGGGGACATGTACC TCCCAGGGGCCCAGGAAGACTACGGGAGGCTACACCAACGTCAATCAGAGGGGCCTGTGTAG CTACCGATAAGCGGACCCTCAAGAGGGCATTAGCAATAGTGTTTATAAGGCCCCCTTGTTAACC CTAAACGGGTAGCATATGCTTCCCGGGTAGTAGTATATACTATCCAGACTAACCCTAATTCAATA GCATATGTTACCCAACGGGAAGCATATGCTATCGAATTAGGGTTAGTAAAAGGGTCCTAAGGAA CAGCGATATCTCCCACCCCATGAGCTGTCACGGTTTTATTTACATGGGGTCAGGATTCCACGAG GGTAGTGAACCATTTTAGTCACAAGGGCAGTGGCTGAAGATCAAGGAGCGGGCAGTGAACTCT CCTGAATCTTCGCCTGCTTCTTCATTCTCCTTCGTTTAGCTAATAGAATAACTGCTGAGTTGTGAA CAGTAAGGTGTATGTGAGGTGCTCGAAAACAAGGTTTCAGGTGACGCCCCCAGAATAAAATTTG GACGGGGGGTTCAGTGGTGGCATTGTGCTATGACACCAATATAACCCTCACAAACCCCTTGGG CAATAAATACTAGTGTAGGAATGAAACATTCTGAATATCTTTAACAATAGAAATCCATGGGGTGG GGACAAGCCGTAAAGACTGGATGTCCATCTCACACGAATTTATGGCTATGGGCAACACATAATC CTAGTGCAATATGATACTGGGGTTATTAAGATGTGTCCCAGGCAGGGACCAAGACAGGTGAACC ATGTTGTTACACTCTATTTGTAACAAGGGGAAAGAGAGTGGACGCCGACAGCAGCGGACTCCAC TGGTTGTCTCTAACACCCCCGAAAATTAAACGGGGCTCCACGCCAATGGGGCCCATAAACAAAG ACAAGTGGCCACTCTTTTTTTTGAAATTGTGGAGTGGGGGCACGCGTCAGCCCCCACACGCCG CCCTGCGGTTTTGGACTGTAAAATAAGGGTGTAATAACTTGGCTGATTGTAACCCCGCTAACCA CTGCGGTCAAACCACTTGCCCACAAAACCACTAATGGCACCCCGGGGAATACCTGCATAAGTAG GTGGGCGGGCCAAGATAGGGGCGCGATTGCTGCGATCTGGAGGACAAATTACACACACTTGCG CCTGAGCGCCAAGCACAGGGTTGTTGGTCCTCATATTCACGAGGTCGCTGAGAGCACGGTGGG CTAATGTTGCCATGGGTAGCATATACTACCCAAATATCTGGATAGCATATGCTATCCTAATCTATA TCTGGGTAGCATAGGCTATCCTAATCTATATCTGGGTAGCATATGCTATCCTAATCTATATCTGG GTAGTATATGCTATCCTAATTTATATCTGGGTAGCATAGGCTATCCTAATCTATATCTGGGTAGCA TATGCTATCCTAATCTATATCTGGGTAGTATATGCTATCCTAATCTGTATCCGGGTAGCATATGCT ATCCTAATAGAGATTAGGGTAGTATATGCTATCCTAATTTATATCTGGGTAGCATATACTACCCAA ATATCTGGATAGCATATGCTATCCTAATCTATATCTGGGTAGCATATGCTATCCTAATCTATATCT GGGTAGCATAGGCTATCCTAATCTATATCTGGGTAGCATATGCTATCCTAATCTATATCTGGGTA GTATATGCTATCCTAATTTATATCTGGGTAGCATAGGCTATCCTAATCTATATCTGGGTAGCATAT GCTATCCTAATCTATATCTGGGTAGTATATGCTATCCTAATCTGTATCCGGGTAGCATATGCTAT CCTCATGCATATACAGTCAGCATATGATACCCAGTAGTAGAGTGGGAGTGCTATCCTTTGCATAT GCCGCCACCTCCCAAGGGGGCGTGAATTTTCGCTGCTTGTCCTTTTCCTGCTGGTTGCTCCCAT TCTTAGGTGAATTTAAGGAGGCCAGGCTAAAGCCGTCGCATGTCTGATTGCTCACCAGGTAAAT GTCGCTAATGTTTTCCAACGCGAGAAGGTGTTGAGCGCGGAGCTGAGTGACGTGACAACATGG GTATGCCCAATTGCCCCATGTTGGGAGGACGAAAATGGTGACAAGACAGATGGCCAGAAATAC ACCAACAGCACGCATGATGTCTACTGGGGATTTATTCTTTAGTGCGGGGGAATACACGGCTTTT

201 AATACGATTGAGGGCGTCTCCTAACAAGTTACATCACTCCTGCCCTTCCTCACCCTCATCTCCAT CACCTCCTTCATCTCCGTCATCTCCGTCATCACCCTCCGCGGCAGCCCCTTCCACCATAGGTGG AAACCAGGGAGGCAAATCTACTCCATCGTCAAAGCTGCACACAGTCACCCTGATATTGCAGGTA GGAGCGGGCTTTGTCATAACAAGGTCCTTAATCGCATCCTTCAAAACCTCAGCAAATATATGAGT TTGTAAAAAGACCATGAAATAACAGACAATGGACTCCCTTAGCGGGCCAGGTTGTGGGCCGGG TCCAGGGGCCATTCCAAAGGGGAGACGACTCAATGGTGTAAGACGACATTGTGGAATAGCAAG GGCAGTTCCTCGCCTTAGGTTGTAAAGGGAGGTCTTACTACCTCCATATACGAACACACCGGCG ACCCAAGTTCCTTCGTCGGTAGTCCTTTCTACGTGACTCCTAGCCAGGAGAGCTCTTAAACCTT CTGCAATGTTCTCAAATTTCGGGTTGGAACCTCCTTGACCACGATGCTTTCCAAACCACCCTCCT TTTTTGCGCCTGCCTCCATCACCCTGACCCCGGGGTCCAGTGCTTGGGCCTTCTCCTGGGTCAT CTGCGGGGCCCTGCTCTATCGCTCCCGGGGGCACGTCAGGCTCACCATCTGGGCCACCTTCTT GGTGGTATTCAAAATAATCGGCTTCCCCTACAGGGTGGAAAAATGGCCTTCTACCTGGAGGGG GCCTGCGCGGTGGAGACCCGGATGATGATGACTGACTACTGGGACTCCTGGGCCTCTTTTCTC CACGTCCACGACCTCTCCCCCTGGCTCTTTCACGACTTCCCCCCCTGGCTCTTTCACGTCCTCT ACCCCGGCGGCCTCCACTACCTCCTCGACCCCGGCCTCCACTACCTCCTCGACCCCGGCCTCC ACTGCCTCCTCGACCCCGGCCTCCACCTCCTGCTCCTGCCCCTCCTGCTCCTGCCCCTCCTCC TGCTCCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCTCC TGCCCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTCCT GCTCCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCTCCTGCCCCTCCT GCCCCTCCTGCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCTCCTGCC CCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCTCCTGCCCCTCCTGCCCCT CCTGCCCCTCCTGCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTGCCCCTCCT CCTGCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCT GCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCT CCTGCTCCTGCCCCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTCCTGCTCCT GCCCCTCCTGCCCCTCCTGCCCCTCCTGCCCCTCCTCCTGCTCCTGCCCCTCCTCCTGCTCCT GCCCCTCCTGCTCCTGCCCCTCCCGCTCCTGCTCCTGCTCCTGTTCCACCGTGGGTCCCTTTG CAGCCAATGCAACTTGGACGTTTTTGGGGTCTCCGGACACCATCTCTATGTCTTGGCCCTGATC CTGAGCCGCCCGGGGCTCCTGGTCTTCCGCCTCCTCGTCCTCGTCCTCTTCCCCGTCCTCGTC CATGGTTATCACCCCCTCTTCTTTGAGGTCCACTGCCGCCGGAGCCTTCTGGTCCAGATGTGTC TCCCTTCTCTCCTAGGCCATTTCCAGGTCCTGTACCTGGCCCCTCGTCAGACATGATTCACACT AAAAGAGATCAATAGACATCTTTATTAGACGACGCTCAGTGAATACAGGGAGTGCAGACTCCTG CCCCCTCCAACAGCCCCCCCACCCTCATCCCCTTCATGGTCGCTGTCAGACAGATCCAGGTCT GAAAATTCCCCATCCTCCGAACCATCCTCGTCCTCATCACCAATTACTCGCAGCCCGGAAAACT CCCGCTGAACATCCTCAAGATTTGCGTCCTGAGCCTCAAGCCAGGCCTCAAATTCCTCGTCCCC CTTTTTGCTGGACGGTAGGGATGGGGATTCTCGGGACCCCTCCTCTTCCTCTTCAAGGTCACCA GACAGAGATGCTACTGGGGCAACGGAAGAAAAGCTGGGTGCGGCCTGTGAGGATCAGCTTATC GATGATAAGCTGTCAAACATGAGAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTA TAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCG CGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACC CTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCC TTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTA AAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTA AGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTA TGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTAT TCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAG TAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACA ACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGC CTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATG CCTGCAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCC GGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCC TTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCAT TGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCA GGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGG TAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAA GGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTC CACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGT AATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAG CTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCT AGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTG CTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAA GACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCC

202 AGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCC ACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGA GCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCA CCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGC CAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTGAAGCTGTCCCTGATGGTCG TCATCTACCTGCCTGGACAGCATGGCCTGCAACGCGGGCATCCCGATGCCGCCGGAAGCGAG AAGAATCATAATGGGGAAGGCCATCCAGCCTCGCGTCGCGAACGCCAGCAAGACGTAGCCCAG CGCGTCGGCCCCGAGATGCGCCGCGTGCGGCTGCTGGAGATGGCGGACGCGATGGATATGTT CTGCCAAGGGTTGGTTTGCGCATTCACAGTTCTCCGCAAGAATTGATTGGCTCCAATTCTTGGA GTGGTGAATCCGTTAGCGAGGTGCCGCCCTGCTTCATCCCCGTGGCCCGTTGCTCGCGTTTGC TGGCGGTGTCCCCGGAAGAAATATATTTGCATGTCTTTAGTTCTATGATGACACAAACCCCGCC CAGCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCGAGGT CCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGCGACCCGC TTAACAGCGTCAACAGCGTGCCGCAGATCCCGGGGGGCAATGAGATATGAAAAAGCCTGAACT CACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGTTCGACAGCGTCTCCGACCTGATGCA GCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGATATGTCCT GCGGGTAAATAGCTGCGCCGATGGTTTCTACAAAGATCGTTATGTTTATCGGCACTTTGCATCG GCCGCGCTCCCGATTCCGGAAGTGCTTGACATTGGGGAATTCAGCGAGAGCCTGACCTATTGC ATCTCCCGCCGTGCACAGGGTGTCACGTTGCAAGACCTGCCTGAAACCGAACTGCCCGCTGTT CTGCAGCCGGTCGCGGAGGCCATGGATGCGATCGCTGCGGCCGATCTTAGCCAGACGAGCGG GTTCGGCCCATTCGGACCGCAAGGAATCGGTCAATACACTACATGGCGTGATTTCATATGCGCG ATTGCTGATCCCCATGTGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCG CGCAGGCTCTCGATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTG CACGCGGATTTCGGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGTCATTGAC TGGAGCGAGGCGATGTTCGGGGATTCCCAATACGAGGTCGCCAACATCTTCTTCTGGAGGCCG TGGTTGGCTTGTATGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGCAGGA TCGCCGCGGCTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTATCAGAGCTTGGTTG ACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGATCCGGAG CCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCGATGGCTGT GTAGAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGGATCGGGAGATGGG GGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAA AAAGACAGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCATAAACGCGGGGTTCGGTCCCAG GGCTGGCACTCTGTCGATACCCCACCGAGACCCCATTGGGGCCAATACGCCCGCGTTTCTTCC TTTTCCCCACCCCACCCCCCAAGTTCGGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGC GGCAGGCCCTGCCATAGCCACTGGCCCCGTGGGTTAGGGACGGGGTCCCCCATGGGGAATGG TTTATGGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCACGACTGGACTGAG CAGACAGACCCATGGTTTTTGGATGGCCTGGGCATGGACCGCATGTACTGGCGCGACACGAAC ACCGGGCGTCTGTGGCTGCCAAACACCCCCGACCCCCAAAAACCACCGCGCGGATTTCTGGC GTGCCAAGCTAGTCGACCAATTCTCATGTTTGACAGCTTATCATCGCAGATCCGGGCAACGTTG TTGCCATTGCTGCAGGCGCAGAACTGGTAGGTATGGAAGATCTATACATTGAATCAATATTGGC AATTAGCCATATTAGTCATTGGTTATATAGCATAAATCAATATTGGCTATTGGCCATTGCATACGT TGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCCAATATGACCGCCAT

Figure A1.1. Sequence for pCep-His vector used for expression of recombinant T. muris proteins.

203

The following Tables can be found on the CD provided with this thesis.

Table A1.1. List of proteins identified within adult T. muris ES. List was compiled by collating the mass spectrometry data for fractions 16 to 32. The total spectral count is displayed for each protein in each fraction (criteria set to 95% protein threshold, 50% peptide threshold, minimum 2 peptides identified). Mw= molecular weight in kDa. Frac = fraction.

Table A1.2. List of proteins identified within pool 1. List was compiled by collating the mass spectrometry data for fractions 16 to 18. The total spectral count is displayed for each protein in each fraction (criteria set to 95% protein threshold, 50% peptide threshold, minimum 2 peptides identified). Mw= molecular weight in kDa. Frac = fraction.

Table A1.3. List of proteins identified within pool 2. List was compiled by collating the mass spectrometry data for fractions 20 to 22. The total spectral count is displayed for each protein in each fraction (criteria set to 95% protein threshold, 50% peptide threshold, minimum 2 peptides identified). Mw= molecular weight in kDa. Frac = fraction.

Table A1.4. List of proteins identified within pool 3. List was compiled by collating the mass spectrometry data for fractions 24 to 27. The total spectral count is displayed for each protein in each fraction (criteria set to 95% protein threshold, 50% peptide threshold, minimum 2 peptides identified). Mw= molecular weight in kDa. Frac = fraction.

Table A1.5. List of proteins identified within pool 4. List was compiled by collating the mass spectrometry data for fractions 29 to 32. The total spectral count is displayed for each protein in each fraction (criteria set to 95% protein threshold, 50% peptide threshold, minimum 2 peptides identified). Mw= molecular weight in kDa. Frac = fraction.

Table A1.6. List of L2 larval ES protein. List was compiled based on proteins identified in unfractionated L2 larval ES. The total spectral count is displayed for each protein in each sample (criteria set to 95% protein threshold, 50% peptide threshold, minimum 2 peptides identified). Mw= molecular weight in kDa. Frac = fraction.

204 Appendix 2

Accession number Protein No. unique peptides TMUE_s0016004100 Serpin 20

Table A2.1. Mass spectrometry analysis of recombinant Serpin. Once the recombinant Serpin protein had been expressed and purified, its identity was confirmed by tandem mass spectrometry of tryptic peptides.

No. unique peptides

45 kDa 30 kDa 25 kDa Accession number Protein band band band TMUE_s0428000200 Lactoylglutathione lyase 21 18 20 TMUE_s0029005700 Actin 2 3 3

Table A2.2. Mass spectrometry analysis of recombinant Lactoglutathione lyase. Once the recombinant Lactoglutathione lyase protein had been expressed and purified, its identity was confirmed by tandem mass spectrometry of tryptic peptides from gel digests. The proteins identified in the 45, 30 and 25 kDa bands are shown.

No. unique Accession number Protein peptides TMUE_s0009001300 Translationally controlled tumour protein 13

Table A2.3. Mass spectrometry analysis of recombinant Translationally controlled tumour protein. Once the recombinant Translationally controlled tumour protein had been expressed and purified, its identity was confirmed by tandem mass spectrometry of tryptic peptides.

No. unique peptides 30 kDa 20 kDa Accession number Protein band band TMUE_s0071003300 TPD52 domain containing protein 12 12

Table A2.4. Mass spectrometry analysis of recombinant TPD52 domain containing protein. Once the recombinant TPD52 domain containing protein had been expressed and purified, its identity was confirmed by tandem mass spectrometry of tryptic peptides from gel digests. The proteins identified in the 30 and 20 kDa bands are shown.

205 No. unique Accession number Protein peptides TMUE_s0016007700 Hypothetical protein 5

Table A2.5. Mass spectrometry analysis of recombinant Hypothetical protein. Once the recombinant Hypothetical protein had been expressed and purified, its identity was confirmed by tandem mass spectrometry of tryptic peptides.

Comparison to T. trichiura homologue Query Identity Accession number Protein coverage (%) (%) TMUE_s0016004100 Serpin protein 98 44 TMUE_s0009001300 Translationally controlled tumour protein 95 91 Ion trans 2 and Pfam-B 17708-domain TMUE_s0066001200 35 90 containing protein TMUE_s0016007600 Hypothetical protein 98 40 TMUE_s0072003400 Independent phosphoglycerate mutase 93 88 TMUE_s0071003300 TPD52 domain containing protein 84 89 TMUE_s0132001200 Gut specific cysteine proteinase 85 71 TMUE_s0428000200 Lactoylglutathione lyase 97 86 TMUE_s0003017400 Rab GDP dissociation inhibitor alpha 99 92 TMUE_s0013010700 NADH dependent fumarate reductase 85 79

Table A2.6. Comparison of protein sequences for T. muris immunogenic candidates with T. trichiura homologues. A BLAST search was performed whereby the protein sequence for each of the immunogenic candidates was searched against all organisms. The top T. trichiura protein hit was identified and the query coverage (%) and identity (%) was recorded.

206

Amino acid position

i g

Figure A2.1. BLAST search results for Ion trans 2 and Pfam-B 17708-domain containing protein (TMUE_s0066001200). The protein sequence for Ion trans 2 and Pfam-B 17708- domain containing protein (TMUE_s0066001200) was searched against all organisms using the BLAST protein search tool. Protein sequences (from other organisms) with shared homology are aligned against the protein sequence for TMUE_s0066001200. The results suggest that the predicted protein sequence may have arisen by incorrectly pairing together two proteins (protein 1: approximately amino acids 1-620, protein 2: approximately amino acids 780-1200).

Query Identity Protein Organism coverage (%) (%) Hypothetical protein T. suis 35 90 Ion trans 2 domain containing protein T. trichiura 35 90 Potassium channel subfamily K member 18 T. zimbabwensis 35 71 Potassium channel subfamily K member 18 T. pseudospiralis 35 71 Potassium channel subfamily K member 18 T. papuae 35 71 Potassium channel subfamily K member 18 T. murelli 35 71 Potassium channel subfamily K member 18 T. spiralis 35 63

Table A2.7. BLAST search results for T. muris Ion trans 2 and Pfam-B 17708-domain containing protein (TMUE_s0066001200). The protein sequence of T. muris Ion trans 2 and Pfam-B 17708-domain containing protein (TMUE_s0066001200) was searched against all organisms using the BLAST protein search tool. The results revealed that there are homologues within other tricephalid parasites, including Trichuris and Trichinella species.

207 A) Serum dose response curve B) Serum dose response curve for for sham vaccination group recombinants vaccination group 2.5 2.5

2.0 2.0

. 1.5 . 1.5

O O 1.0 1.0

0.5 0.5

C) Serum dose response curve D) Mean O.D. (1:320 serum dilution) for ES vaccination group

2.5 2.5 **** **** 2.0 2.0

. 1.5

D .

O O 1.0 1.5 0.5

1.0 0.0 0 0 0 0 0 0 0 0 2 4 8 6 2 4 8 6 m ts e m n n n 1 3 6 2 5 a n id u i i i n n n 1 2 h a n l 1 1 1 i i i n n n a a 1 1 1 i i S i t + 1 1 b n m o S o M E c Dilution e + R S E Vaccination group

Figure A2.2. Anti-parasite IgG1 serum antibody levels for mice vaccinated with recombinant T. muris proteins formulated with Montanide ISA 720. Mice, n=5 per group, were subcutaneously vaccinated with recombinant T. muris proteins administered together as a single vaccination (30 μg of each protein, 150 μg protein in total). Mice were vaccinated a second and third time with 15 μg of each protein (75 μg protein in total). All vaccinations were formulated with Montanide ISA 720, and 30 days after the third vaccination, mice were infected with 25 T. muris eggs. Mice were sacrificed at day 32 p.i. Anti-parasite IgG1 serum antibody levels were measured for each individual by ELISA (reading at 405 nm) and these are displayed for each vaccine group (A-C). The symbols on each graph represent individual mice within the same vaccination group. (D) Shows mean anti-parasite IgG1 serum antibody levels for each vaccine group at 1:320 serum dilution. Sham= mice vaccinated with aluminum hydroxide only, ES vaccinated mice were used as positive control. Error bars show SEM, **** P <0.0001.

208 A) Serum dose response curve for B) Serum dose response curve for sham vaccination group recombinants vaccination group

2.0 2.0

1.5 1.5

. . 1.0 1.0

O O 0.5 0.5 0.0 0.0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 4 8 6 2 4 8 6 2 4 8 6 2 4 8 6 1 3 6 2 5 n n n 1 3 6 2 5 n n n 1 2 i i i n n n 1 2 i i i n n n 1 1 1 i i i n n 1 1 1 i i i n n 1 1 1 i i 1 1 1 i i 1 1 1 1 Dilution Dilution

C) Serum dose response curve for D) Mean O.D. (1:40 serum dilution) ES vaccination group NS 2.0 2.0 **** **** 1.5 1.5

. . 1.0 1.0

O O 0.5 0.5

0.0 0.0 0 0 0 0 0 0 0 0 m ts e m 2 4 8 6 2 4 8 6 a n id u 1 3 6 2 5 h a n l in in in 1 2 S n a a in in in i t + 1 1 1 in in b n 1 1 1 m o S 1 1 o M E c e + Dilution R S E Vaccination group

Figure A2.3. Anti-parasite IgG2a serum antibody levels for mice vaccinated with recombinant T. muris proteins formulated with Montanide ISA 720. Mice, n=5 per group, were subcutaneously vaccinated with recombinant T. muris proteins administered together as a single vaccination (30 μg of each protein, 150 μg protein in total). Mice were vaccinated a second and third time with 15 μg of each protein (75 μg protein in total). All vaccinations were formulated with Montanide ISA 720, and 30 days after the third vaccination, mice were infected with 25 T. muris eggs. Mice were sacrificed at day 32 p.i. Anti-parasite IgG2a serum antibody levels were measured for each individual by ELISA (reading at 405 nm) and these are displayed for each vaccine group (A-C). The symbols on each graph represent individual mice within the same vaccination group. (D) Shows mean anti-parasite IgG2a serum antibody levels for each vaccine group at 1:40 serum dilution. Sham= mice vaccinated with aluminum hydroxide only, ES vaccinated mice were used as positive control. Error bars show SEM, **** P <0.0001, NS= non-significant.

209 A) Serum dose response curve for B) Serum dose response curve for sham vaccination group recombinants vaccination group

2.0 2.0

1.5 1.5

. . 1.0 1.0

0.5 0.5

0.0 0.0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 4 8 6 2 4 8 6 2 4 8 6 2 4 8 6 1 3 6 2 5 n n n 1 3 6 2 5 in in in 1 2 i i i n n n 1 2 in in in 1 1 1 i i i n n 1 1 1 in in 1 1 1 i i 1 1 1 1 1 1 1 Dilution Dilution

C) Serum dose response curve for D) Mean O.D. (1:320 serum dilution) ES vaccination group 3.0 NS 2.5 **** 2.5

2.0 2.0

D . 1.5

. 1.5

1.0 O 1.0 0.5 0.5 0.0 0 0 0 0 0 0 0 0 2 4 8 6 2 4 8 6 0.0 n n n 1 3 6 2 5 i i i n n n 1 2 s 1 1 1 i i i n n m t S 1 1 1 i i a n E 1 1 h a S in b Dilution m o c e R Vaccination group

Figure A2.4. Anti-parasite IgG1 serum antibody levels for mice vaccinated with recombinant T. muris proteins formulated with aluminum hydroxide. Mice, n=5 per group, were subcutaneously vaccinated with recombinant T. muris proteins administered together as a single vaccination (30 μg of each protein, 150 μg of protein in total) formulated with aluminum hydroxide. Two weeks following the second vaccination, mice were infected with 25 T. muris eggs and were sacrificed at day 32 p.i. The anti-parasite IgG1 serum antibody response was measured for each individual by ELISA (reading at 405 nm) and these are displayed for each vaccination group (A-C). The symbols on each graph represent individual mice within the same vaccination group. (D) Shows mean anti-parasite IgG1 serum antibody levels for each vaccine group at 1:320 serum dilution. Sham vaccination group= mice vaccinated with aluminum hydroxide only. ES vaccination group= mice vaccinated with ES formulated with aluminum hydroxide. Error bars show SEM **** P < 0.0001, NS= non-significant.

210 A) Serum dose response curve for B) Serum dose response curve for sham vaccination group recombinants vaccination group 2.0 2.0

1.5 1.5

. 1.0 . 1.0

0.5 0.5

C) Serum dose response curve for D) Mean O.D. (1:40 serum dilution)

ES vaccination group NS 2.5 1.5 NS

2.0 1.0

. 1.5

O O 1.0 0.5

0.5 0.0 0.0 0 0 0 0 0 0 0 0 m ts S 2 4 8 6 2 4 8 6 a n E 1 3 6 2 5 h a in in in 1 2 S n in in in i 1 1 1 in in b 1 1 1 m 1 1 o c e Dilution R Vaccination group

Figure A2.5. Anti-parasite IgG2a serum antibody levels for mice vaccinated with recombinant T. muris proteins formulated with aluminum hydroxide. Mice, n=5 per group, were subcutaneously vaccinated with recombinant T. muris proteins administered together as a single vaccination (30 μg of each protein, 150 μg of protein in total) formulated with aluminum hydroxide. Two weeks following the second vaccination, mice were infected with 25 T. muris eggs and were sacrificed at day 32 p.i. The anti-parasite IgG2a serum antibody response was measured for each individual by ELISA (reading at 405 nm) and these are displayed for each vaccination group (A-C). The symbols on each graph represent individual mice within the same vaccination group. (D) Shows mean anti-parasite IgG2a serum antibody levels for each vaccine group at 1:40 serum dilution. Sham vaccination group= mice vaccinated with aluminum hydroxide only. ES vaccination group= mice vaccinated with ES formulated with aluminum hydroxide. Error bars show SEM, NS= non-significant.

211 A) Serum dose response curve for B) Serum dose response curve for sham vaccination group recombinants vaccination group Freund's negative control IgG1 Freund's recombinants IgG1 4.0 4.0 A A 3.5 3.5 B B 3.0 3.0 C 2.5 C

2.5 .

. D 2.0 D . 2.0 D

O 1.5 E 1.5 E 1.0 1.0 0.5 0.5 0.0 0.0

1 in 20 1 in 40 1 in 80 1 in 20 1 in 40 1 in 80 1 in 160 1 in 320 1 in 640 1 in 160 1 in 320 1 in 640 1 in 1280 1 in 2560 1 in 1280 1 in 2560 Dilution Dilution

C) Serum dose response curve for D) Mean O.D. (1:320 serum dilution) ES vaccination group 4.0 3.0 **** 3.5 * 3.0 2.5 2.5

. 2.0

. . 2.0

O . 1.5 1.5 O 1.0 1.0

0.5 0.5 0.0 0 0 0 0 0 0 0 0 0.0 2 4 8 6 2 4 8 6 n n n 1 3 6 2 5 s S i i i n n n 1 2 m t 1 1 1 i i i n n a n E 1 1 1 i i h a 1 1 S in b m o Dilution c e R Vaccine group

Figure A2.6. Anti-parasite IgG1 serum antibody levels for mice vaccinated with recombinant T. muris proteins formulated with Freund’s adjuvants. Mice, n=5 per group, were subcutaneously vaccinated with recombinant T. muris proteins administered together as a single vaccination (30 μg of each protein, 150 μg of protein in total, formulated in CFA). Mice were vaccinated a second and third time with 15 μg of each protein (75 μg protein in total, formulated in IFA). 30 days after the third vaccination, mice were infected with 25 T. muris eggs. Mice were sacrificed at day 32 p.i. Anti-parasite IgG1 serum antibody levels were measured for each individual by ELISA (reading at 405 nm) and these are displayed for each vaccine group (A-C). The symbols on each graph represent individual mice within the same vaccination group. (D) Shows mean anti-parasite IgG1 serum antibody levels for each vaccine group at 1:320 serum dilution. Sham= mice vaccinated with Freund’s adjuvants only (CFA for the first vaccination, IFA for the second and third). ES= mice vaccinated with ES formulated with Freund’s adjuvants. Error bars show SEM, * P <0.05, **** P <0.0001.

212 A) Serum dose response curve for B) Serum dose response curve for sham vaccination group recombinants vaccination group

4.0 4.0 3.5 3.5 3.0 3.0 2.5

2.5 .

. D 2.0 . 2.0

O 1.5 1.5 1.0 1.0 0.5 0.5 0.0 0.0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 4 8 6 2 4 8 6 2 4 8 6 2 4 8 6 1 3 6 2 5 n n n 1 3 6 2 5 in in in 1 2 i i i n n n 1 2 in in in 1 1 1 i i i n n 1 1 1 in in 1 1 1 i i 1 1 1 1 1 1 1 Dilution Dilution

C) Serum dose response curve for D) Mean O.D. (1:40 serum dilution)

ES vaccination group

4.0 2.5 * 3.5

3.0 2.0 2.5

. 1.5 . 2.0

1.5 O 1.0 1.0 NS 0.5 0.5 0.0 0 0 0 0 0 0 0 0 0.0 2 4 8 6 2 4 8 6 n n n 1 3 6 2 5 s S i i i n n n 1 2 m t E 1 1 1 i i i n n a n 1 1 1 i i h a 1 1 S in b m o Dilution c e R Vaccine group

Figure A2.7. Anti-parasite IgG2a serum antibody levels for mice vaccinated with recombinant T. muris proteins formulated with Freund’s adjuvants. Mice, n=5 per group, were subcutaneously vaccinated with recombinant T. muris proteins administered together as a single vaccination (30 μg of each protein, 150 μg of protein in total, formulated in CFA). Mice were vaccinated a second and third time with 15 μg of each protein (75 μg protein in total, formulated in IFA). 30 days after the third vaccination, mice were infected with 25 T. muris eggs. Mice were sacrificed at day 32 p.i. Anti-parasite IgG2a serum antibody levels were measured for each individual by ELISA (reading at 405 nm) and these are displayed for each vaccine group (A-C). The symbols on each graph represent individual mice within the same vaccination group. (D) Shows mean anti-parasite IgG2a serum antibody levels for each vaccine group at 1:40 serum dilution. Sham= mice vaccinated with Freund’s adjuvants only (CFA for the first vaccination, IFA for the second and third). ES= mice vaccinated with ES formulated with Freund’s adjuvants. Error bars show SEM, * P <0.05, NS= non-significant.

213 A) IgG2a antibody response to B) IgG2a antibody response to TPD52 TranslSerumationa responselly contr oagainstlled tu Lactomour protein domain containing protein 1:40 dilution 1:40 dilution 1.5 0.10 0.05 * NS 0.08 **** 0.04 1.0

. 0.06 . 0.03 D

O O 0.50.04 0.02

0.02 0.01 0.00.00 0.00 n d d o n te d te d n d d ti o a a o c ti n te n te ti te te fe c i a i a c a a n c in c in in in i fe c c fe e n a c a c n c c s i v c v c i c c o e 3 a a e a a d s l v to v s v v o o 3 c s o 3 2 h d l a n d l 5 ig Po o L a o H h r h PD ig Po T ig Po T H Source of serum H Source of serum Source of serum

C) IgG2a antibody response to D) IgG2a antibody response to Serpin Lactoylglutathione lyase Summary 1:40 IgG2a

1.5 0.3 ** * 1.0

0.2 .

. O O 0.5 0.1

0.0 0.0 n d d o n d d ti te te o e e c a a ti t t in in c a a fe c c e in in in c c f c c a a n c c e v v i a a s e v v o 3 in s d l p o 3 to h o r d l c o a ig Po Se h o H ig P L H Vaccination group Source of serum

Figure A2.8. Vaccination with T. muris recombinant proteins induced production of IgG2a antibodies specific for these proteins. IgG2a antibodies specific for Translationally controlled tumour protein (A), TPD52 domain containing protein (B), Lactoylglutathione lyase (C) and Serpin (D) were measured in sera from infected (high dose) mice, pool 3 vaccinated mice, or mice vaccinated with each of the recombinant proteins (single protein vaccinations formulated with aluminum hydroxide). IgG2a serum antibody levels were measured for each individual by ELISA (reading at 405 nm) and graphs show mean antibody titres at 1:40 serum dilution. Error bars show SEM, * P < 0.05, ** P < 0.01, **** P < 0.0001. Trans= Translationally controlled tumour protein, TDP= TPD52 domain containing protein, Lacto= Lactyoglutathione lyase.

214 Appendix 3

The following table can be found on the CD provided.

Table A3.1. List of T. muris ELV proteins. Mass spectrometry analysis was carried out on three biological replicates (samples 1 to 3). The total spectral count is displayed for each protein in replicate (criteria set to 95% protein threshold, 50% peptide threshold, minimum 2 peptides identified). Mw= molecular weight in kDa. The table indicates whether each protein is identified in T. muris ES and whether there is a signal peptide present (Y/N= yes and no respectively).

Figure A3.1. BLAST search results for T. muris TSP-1 domain containing protein (TMUE_s0070003500). The protein sequence of T. muris TSP-1 domain containing protein (TMUE_s0070003500) was searched against all organisms using the BLAST protein search tool. The results revealed that this protein contains severaltetraspanin (TSP) domains.

Overlapping Identity Species Genomic Location E-val Gene(s) (%) S. mansoni Smp.Chr_1:27143252-27143419 Smp_060030 0.0034 28.6 S. mansoni Smp.Chr_1:53413414-53413488 Smp_158550 0.045 56 S. mansoni Smp.SC_0142:339943-340005 Smp_158620 1.30E-06 52.4 S. mansoni Smp.SC_0142:339829-339930 Smp_158620 1.30E-06 47.1

Table A3.2. BLAST search results show that there is significant homology between the T. muris TSP-1 domain containing protein (TMUE_s0070003500) and S. mansoni proteins. The WormBase ParaSite BLAST tool was used to compare the protein sequence of TMUE_s0070003500 to all Schistosoma sequences. The low E values (<0.05) suggest that there is significant homology between the sequences.

215 A) Worm burden

**** **** **** 20

n 15

d r

b 10

o W 5

0 m g g g a u u u h 3 0 0 S 1 3 Vaccination group

B) Anti-parasite IgG1 antibody C) Anti-parasite IgG2a antibody response for ES titration groups response for ES titration groups (1:320 serum dilution) (1:40 serum dilution) **** **** **** **** 2.0 0.6 **** ****

1.5 0.4

. .

1.0 .

O 0.2 0.5

0.0 0.0 m g g g m g g g a u u u a u u u h 3 0 0 h 3 0 0 S 1 3 S 1 3 Vaccination group Vaccination group

Figure A3.2. Worm burden and anti-parasite IgG1/IgG2a serum antibody response for ES titration experiment. (A) Worm burdens for mice vaccinated with 3, 10 or 30 μg ES, followed by a second vaccination with half the amount of material 2 weeks later. Mice were infected with 25 T. muris eggs and sacrificed at day 32 p.i.. (B) Shows mean anti-parasite IgG1 serum antibody levels for each vaccine group at 1:320 serum dilution. (C) Shows mean anti-parasite IgG2a serum antibody levels for each vaccine group at 1:40 serum dilution. Sham= mice vaccinated with aluminum hydroxide only. Error bars show SEM, **** P < 0.0001.

216 Query Identity Protein Organism coverage (%) (%) Vacuolar sorting associated protein 52 T. trichiura 26 80 Vacuolar sorting associated protein 52-like 26 58 protein T. pseudospiralis Vacuolar sorting associated protein 52-like 26 59 protein T. patagoniensis Vacuolar sorting associated protein 52-like 26 59 protein T. papuae Vacuolar sorting associated protein 52-like 26 59 protein T. zimbabwensis Vacuolar sorting associated protein 52-like 26 58 protein T. nelsoni

Table A3.3. BLAST search results for T. muris Vacuolar protein sorting associated protein (TMUE_s0093001800). The protein sequence of T. muris Vacuolar protein sorting associated protein (TMUE_s0093001800) was searched against all organisms using the BLAST protein search tool. The results revealed that there are homologues within other tricephalid parasites, including Trichuris and Trichinella species.

217