insects
Article Molecular Identification and Immunity Functional Characterization of Lmserpin1 in Locusta migratoria manilensis
Beibei Li 1,2, Hongmei Li 3, Ye Tian 1,4, Nazir Ahmed Abro 5, Xiangqun Nong 1,2, Zehua Zhang 1,2 and Guangjun Wang 1,2,*
1 State Key Laboratory of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Science, Beijing 100081, China; [email protected] (B.L.); [email protected] (Y.T.); [email protected] (X.N.); [email protected] (Z.Z.) 2 Scientific Observation and Experimental Station of Pests in Xilingol Rangeland, Ministry of Agriculture and Rural Affairs, Xilinhot 026000, China 3 MARA-CABI Joint Laboratory for Bio-safety, Institute of Plant Protection, Chinese Academy of Agricultural Science, Beijing 100193, China; [email protected] 4 College of Plant Protection, Hebei Agricultural University, Baoding 071001, China 5 Department of Entomology, Sindh Agriculture University, Tando Jam 70060, Pakistan; [email protected] * Correspondence: [email protected]
Simple Summary: Insect serpins play a vital role in the defense mechanism of insects, especially in the Toll pathway and PPO (prophenoloxidase) cascade. In this study, we provided an answer to the open question of whether serpin1 was involved in the humoral immune responses of Locusta migra- toria manilensis. We identified a new Lmserpin1 gene from L. migratoria manilensis and investigated its expression profiles in all examined stages and tissues. Meanwhile, by interfering with Lmserpin1 gene, we examined the mortality of L. migratoria manilensis under Metarhizium anisopliae infection, as well as the activities of protective enzymes and detoxifying enzymes and the expression level of three immune-related genes (PPAE (prophenoloxidase-activating enzyme), PPO, and defensin). The results Citation: Li, B.; Li, H.; Tian, Y.; Abro, indicated that Lmserpin1 gene up-regulated the immune responses of L. migratoria manilensis and N.A.; Nong, X.; Zhang, Z.; Wang, G. inhibited the infection of M. anisopliae. Our results are of great importance for better understanding Molecular Identification and of the mechanism characterization of Lmserpin1 in L. migratoria manilensis. Immunity Functional Characterization of Lmserpin1 in Abstract: Serine protease inhibitors (Serpins) are a broadly distributed superfamily of proteins that Locusta migratoria manilensis. Insects exist in organisms with the role of immune responses. Lmserpin1 gene was cloned firstly from 2021, 12, 178. https://doi.org/ Locusta migratoria manilensis and then was detected in all tested stages from eggs to adults and 10.3390/insects12020178 six different tissues through qRT-PCR analysis. The expression was significantly higher in the 3rd
Received: 4 January 2021 instars and within integument. After RNAi treatment, the expression of Lmserpin1 was significantly Accepted: 12 February 2021 down-regulated at four different time points. Moreover, it dropped significantly in the fat body and Published: 18 February 2021 hemolymph at 24 h after treatment. The bioassay results indicated that the mortality of L. migratoria manilensis treated with dsSerpin1 + Metarhizium was significantly higher than the other three Publisher’s Note: MDPI stays neutral treatments. Furthermore, the immune-related genes (PPAE, PPO, and defensin) treated by dsSerpin1 with regard to jurisdictional claims in + Metarhizium were significantly down-regulated compared with the Metarhizium treatment, but published maps and institutional affil- the activities of phenoloxidase (PO), peroxidase (POD), superoxide dismutase (SOD), glutathione iations. S-transferase (GST), and multifunctional oxidase (MFO) were fluctuating. Our results suggest that Lmserpin1 plays a crucial role in the innate immunity of L. migratoria manilensis. Lmserpin1 probably took part in regulation of melanization and promoted the synthesis of antimicrobial peptides (AMPs).
Copyright: © 2021 by the authors. Keywords: locust; metarhizium anisopliae; lmserpin1; immune related gene Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons 1. Introduction Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ Host and pathogens are an interactive relationship locked in a perpetual evolutionary 4.0/). marathon due to the evolving microorganisms and adaptable host immune system [1,2].
Insects 2021, 12, 178. https://doi.org/10.3390/insects12020178 https://www.mdpi.com/journal/insects Insects 2021, 12, 178 2 of 16
Innate immunity is a fundamental self-protection system that evolved in all animals to protect against exogenous pathogenic signal. Unlike mammals, insects rely solely on innate immune mediators to prevent infection [3,4]. Pathogen-associated molecular patterns (PAMPs) activate host cell-surface receptors (pathogen-recognition receptors or PRRs) when infection occurs. These signal cascades activate both cellular and humoral innate immune mechanisms [5–7]. Innate humoral immune responses are initiated through Toll and IMD(immune defi- ciency) signaling pathways during the early invasion period leading to the synthesis and secretion of antimicrobial peptides (AMPs) [8]. Once insects are invaded by external mi- croorganisms, prophenoloxidase-activating enzyme (PPAE) activate the prophenoloxidase cascade reaction (PPO cascade), and specific serine protease activate the phenoloxidase (PO) which, together, with tyrosine hydroxylase then catalyze blood coagulation and melanin formation, participating in the immune defense response of the body [9]. Extracellular parts of both the Toll signaling pathway and PPO activation system employ cascades of serine proteinases to amplify the initial invading signal, ultimately resulting in rapid and efficient responses to threats. However, to avoid excessive inflammation and immunopathology, this signaling cascade must be well-regulated. Serine protease inhibitors (serpins), as serine or cysteine protease inhibitors, can regulate serine protease cascades to maintain homeostasis in the organisms [10]. Serpins are the largest and most widely distributed superfamily of protease inhibitors, presenting in animals, plants, and microorganisms [11–13]. To date, at least 23 different families of serpins have been described and at least 12 studied in insects, such as Drosophila melanogaster [14], Maduca sexta [15], Bombyx mori [16], and Choristoneura fumiferna [17]. Serpins are 40–50 kDa plasma proteins with approximately 400 amino acid residues in length. The majority of arthropod serpins regulate many innate immune responses, in- cluding the hemolymph serine protease cascade [18–21]. Their main function is to prevent excessive inflammation and immunopathology through irreversibly regulating the activity of serine proteases or inactivating proteases by forming covalent complexes [22]. For example in M. sexta, Msserpin4, and Msserpin5, PPO activation is inhibited by inhibiting the upstream hemolymph phase, and Msserpin6 inhibits PPO activation via the regulation of prophenoloxidase-activation protease 3 (PAP3) and hemolymph protease 8 (HP8) [23,24]. In D. melanogaster, Dmserpin43Ac regulates Toll and PPO pathways in response to fungal and bacterial infections [25]. It has been described that 13 serpins (1–7, 11–13, 21, 28, and 32) in B. mori, as protease inhibitors, can regulate extracellular serine proteases involved in innate immune responses such as PPO activation, spätzle processing, and embryonic development by Toll pathway activation [26–28]. The migratory locust, L. migratoria manilensis is an economically important insect pest that causes serious crop losses and pasture damage in China, South-East Asia, and the Pacific region [29]. A previous study found that the M. anisopliae strains had a strong virulence to L. migratoria manilensis [30]. To better understand the immune mechanisms of L. migratoria manilensis and examine their response to a variety of pathogen challenges, transcriptome sequencing and analysis were performed on migratory locusts. A total amino acid sequences of seven serpin genes (serpin1 to serpin7) were obtained [31]. Phylogenetic tree analysis showed that Lmserpin1 was similar to serpinB9, which was involved in the immune response [32]. It is speculated that Lmserpin1 may be involved in the immunity of the migratory locust through structural prediction. The expression pattern of Lmserpin1 and its function in L. migratoria manilensis were analyzed. This study will promote further exploration of the immune mechanism of the Lmserpin1 gene in L. migratoria manilensis.
2. Materials and Methods 2.1. Insect Rearing Eggs of L. migratoria manilensis were collected from Cangzhou in Hebei Province, China. Eggs mixed with soil were incubated under 27 ± 0.5 ◦C, 60 ± 5% RH in growth cabinets (PRX-350B-30) until hatching. Freshly emerged locust hoppers were transferred Insects 2021, 12, 178 3 of 16
into wooden boxes (60 cm × 50 cm × 60 cm, 27 ± 0.5 ◦C, 14:10 L:D photoperiod), and fed on wheat seedlings.
2.2. Expression Analysis of Lmserpin1 Gene in Different Tissues and Developmental Stages Total RNA was extracted from different tissues (midgut, testis, integument, metapedes (the leaping feet), fat body, and hemolymph) and developmental stages (egg, 1st, 2nd, 3rd, 4th, 5th, and adult) using the Trizol reagent (Invitrogen Corp., Carlsbad, CA, USA) according to the manufacturer’s instructions. The concentration and integrity of RNA were measured at an absorbance ratio of A260/280 and A260/230 using a NanoDrop 2000 spectrophotometer (Thermo Scientific TM, Waltham, MA, USA), and by 1.0% agarose gel electrophoresis, respectively. The first-strand cDNA was synthesized using PrimeScript™ One Step RT-PCR Kit Ver. 2 (Takara, Dalian, China) according to the manufacturer’s instructions. cDNA preparations from different samples were used as templates for qRT- PCR analysis of the Lmserpin1 gene expression level using a specific primer pair, qPCR- serpin1-F and qPCR-serpin1-R (Table1). qRT-PCR reactions were performed with the SYBR Premix ExTaq™ (TaKaRa, Dalian, China) in 20 µL of reaction volume with 1µL of cDNA, 10 µL of SsoFast SYBR-Green Mix, 1 µL of each primer (20 µM), and 7 µL of double distilled water (ddH2O), on the ABI 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). qRT-PCR conditions were as follows: Denaturation at 95 ◦C 60 s, followed by 40 cycles of amplification (95 ◦C 15 s, 60 ◦C 50 s). Actin was used as an external reference control. Each plate was repeated three times in independent runs for all reference and selected genes. Gene expression was evaluated by the 2−∆∆CT method [33]. The relative expression of developmental stages was calculated and normalized to the expression at the egg stage, of which different tissues were calculated and normalized to the expression at the hemolymph [34].
Table 1. The information of nucleotide sequences of the primers used in this study, and the purpose of corresponding genes. Prophenoloxidase-activating enzyme (PPAE); prophenoloxidase (PPO).
Gene Primers Purpose Sequence (50–30) serpin1-F Expression CGCGGATCC GATGCCAGTCCGCGCCTTCTC serpin1-R Expression CCC AAGCTT TTGCGGAGGC CTTTGTGG qPCR-serpin1-F Real-Time PCR TACGCAGGCAAAGGAAAG serpin1 qPCR-serpin1-R Real-Time PCR ATGGGTTTACGGTGCTC dsSerpin1-F RNAi TAATACGACTCACTATAGGATCAGCACAGCCAGGAAAC dsSerpin1-R RNAi TAATACGACTCACTATAGGCGGCATCGGAGAAGTATTG actin-F Real-Time PCR GTTACAAACTGGGACGACAT Actin actin-R Real-Time PCR AGAAAGCACAGCCTGAATAG PPAE-F Real-Time PCR CACCAGCACAAATGAATGAC PPAE PPAE-R Real-Time PCR CAACGACAATGAGGCACAG PPO-F Real-Time PCR AAAGACCGCAGAGGAGAA PPO PPO-R Real-Time PCR CCAACGATAGAACACAGGA defensin-F Real-Time PCR CCAGAAAGCGATGATGCCACTA defensin defensin-R Real-Time PCR CACCACAAATCAACGCCAAAGT
2.3. Cloning of the Lmserpin1 Gene and RNA Interference Using cDNA of 3rd instars as the templates and serpin1-R and serpin1-F as gene- specific primers (Table1), the open reading frame (ORF) of Lmserpin1 was amplified by PCR under the following protocol: 95 ◦C for 5 min; 35 cycles of 95 ◦C for 30 s; 56 ◦C for 30 s; 72 ◦C for 90 s; and 72 ◦C for 10 min. The PCR products were recovered on 1% agarose gel and purified using a DNA purification Kit (Tiangen Biotech, Beijing, China). Purified PCR products were cloned into the pMD19-T vector and sequenced by the Shanghai Sangon Biological Co. LTD to verify the cloned fragments. Insects 2021, 12, 178 4 of 16
RiboMAXTM System-T7 (Promega, Madison, WI, USA) was used to generate double- stranded serpin1 (dsSerpin1) RNA by in vitro transcription following the manufacturer’s instructions with dsSerpin1-F and dsSerpin1-R (Table1) as primers and plasmid DNA containing the Lmserpin1 gene as the template. The PCR reaction conditions were as follows: 94 ◦C for 10 min; 35 cycles of 94 ◦C for 30 s; 58 ◦C for 30 s; 72 ◦C for 90 s; and 72 ◦C for 10 min. dsSerpin1 RNA was then diluted to appropriate concentration using ddH2O and stored at −80 ◦C for later use. 3rd instars were starved for 12 h in advance, dsSerpin1 RNA (5 µg) was then injected into the ventral area between the second and third abdominal segments [35], and ddH2O was used as the control. There were three replicates and 20 individuals for each replicate. Lmserpin1 transcript levels in the whole body were tested at 6 h, 24 h, 48 h, and 72 h after injection and in different tissues (fat body, midgut, testis, and hemolymph) at 24 h through qRT-PCR with the specific primer pair, qPCR-serpin1-F, and qPCR-serpin1-R (Table1).
2.4. Expression Analysis of Lmserpin1 after Metarhizium Anisopliae Infection To determine the expression of Lmserpin1 after Metarhizium anisopliae infection, the total RNA was extracted and cDNA was prepared as described above at 6, 12, 24, 48, and 72 h after infection. The mRNA level of Lmserpin1 was analyzed by qRT-PCR. The transcriptional level of Lmserpin1 was normalized to L. migratoria manilensis actin. The experiment was conducted in triplicate.
2.5. Bioassay Conidia of M. anisopliae was from the Institute of Plant Protection, Chinese Academy of Agricultural Sciences. The concentration of conidia was adjusted to 2.5 × 108 spores/g using control bait which was prepared with sterile wheat bran containing 5% vegetable oil, and then used as the treatment bait [36]. dsSerpin1 RNA (l µg/µL) was prepared as for as step 2.3. The four different treatments were (1) inject 5 µL of ddH2O with the treatment bait, (2) inject 5 µL of dsSerpin1 RNA with the control baits, (3) inject 5 µL of dsSerpin1RNA with the treatment baits, and (4) inject 5µL of ddH2O with the control baits (Table2). All of the 3rd instars were starved for approximately 12 h before treatments. For each treatment, there were five replicates and 30 individuals for each replicate. All baits were replaced by fresh wheat seedlings after 24 h, and dead instars were recorded daily for 12 days.
Table 2. The components and concentration of baits from different treatments.
The Concentration of No. Treatments Dosage of ds Serpin1 RNA (mL) M. anisonliae (Spore/g Bran) (1) Metarhizium 2.50 × 108 0 (2) dsSerpin1 0 5 (3) Metarhizium + dsSerpin1 2.50 × 108 5 (4) Control 0 0
2.6. Enzyme Activity Assay 3rd instars L. migratoria manilensis were treated using the method described above, and samples were taken for 5 days continuously after treatments. The samples of the L. migratoria manilensis body were homogenized with 2 mL of 0.1 moL/L phosphate buffer solution (PBS), and then centrifuged at 11,000 rpm for 10 min at 4 ◦C. Resulting supernatants were transferred to a clean eppendorf tube and centrifuged again at 11,000 rpm for 15 min at 4 ◦C. The final supernatants were used for proteins and enzyme detection. The activities of phenoloxidase (PO), multifunctional oxidase (MFO), and glutathione transferase (GSTs) were measured according to previously described protocol using Soft- max Pro 6.1 software [37–39]. Superoxide dismutase (SOD) and peroxidase (POD) activities were measured by the manufacturer’s instruction (Nanjing Jiancheng Biochemical Institute, Nanjing, China). Moreover, protein content was measured using the Bradford method [40], with bovine serum albumin (BSA) as the standard. Insects 2021, 12, 178 5 of 16
2.7. Quantitative Analysis of Immune Related Gene Expression To determine the expression of the immune-related gene (PPAE, PPO, and defensin), fat body was collected from 3rd instars of L. migratoria manilensis at 24 h after the treat- ments. Total RNA was extracted and cDNA was prepared as described above. The mRNA level of PPAE, PPO, and defensin was analyzed by qRT-PCR using a specific primer pair (Table1). Each sample was analyzed by the threshold cycle (CT). The data were shown as means ± standard deviations. Actin was used as an external reference control. The experiment was conducted in triplicate.
2.8. Statistical Analysis Statistical analysis was done using the independent samples t-test and one-way ANOVA followed by post hoc test (Duncan’s new multiple range test). p < 0.05 was considered statistically significant, and the abc and asterisks on the bars in the figures represent significant differences among the treatments and control. All the studied traits and data were analyzed using SPSS, version 19.0 (SPSS Inc., Chicago, IL, USA) and PRISM, version 6.01 (GraphPad Software Inc., San Diego, CA, USA).
3. Result 3.1. Expression of Lmserpin1 in Different Tissues and Developmental Stages of L. migratoria manilensis A full-length cDNA representing a putative L. migratoria manilensis serpin was identi- fied and named Lmserpin1. The full-length cDNA of Lmserpin1 consists of 1228 bp contain- ing 1040 bp open reading frame (ORF) and translates into a 347 amino acids protein with a single serpin domain (spanning from residues 21–343). The calculated molecular mass of the Lmserpin1 protein is 35.6 kDa with an estimated pI of 6.19. The tissue distribution and developmental stages expression of Lmserpin1 in L. migra- toria manilensis were analyzed by qRT-PCR (Figure1). The results indicated that Lmserpin1 was consistently expressed in all life stages (Figure1A), and its expression level increased with the development of L. migratoria manilensis, reaching peak at 3rd instars. The Lmserpin1 expression levels at the 1st, 2nd, and 3rd instar were 1.224, 1.607, and 1.841 times of that in egg respectively. Moreover, Lmserpin1 expression at 3rd instars was significantly higher than the other stages (p < 0.05). While Lmserpin1 expression at 4th instars and adults was significantly lower than other stages (p < 0.05), and their expression levels was only 0.175 and 0.597 times that in the egg, respectively. Lmserpin1 expression at 5th instars was 1.122 times that in the egg respectively, which was no significantly different with egg. Therefore, we selected 3rd instars as the target stage to show the response to pathogenic bacteria. Furthermore, the tissues distribution of Lmserpin1 was also observed in midgut, testis, integument, metapedes, fat body, and hemolymph, respectively (Figure1B). The results indicated that the transcriptional level of Lmserpin1 in integument was the highest, with 28.825 times that of the hemolymph, meanwhile in metapedes and fat body it was 11.996 and 21.256 times that of the hemolymph (p < 0.05), respectively. While the expression level of Lmserpin1 in testis and midgut had no difference with the hemolymph (p > 0.05). Insects 2021, 12, x FOR PEER REVIEW 6 of 16
Insects 2021, 12, x FOR PEER REVIEW 6 of 16
11.996 and 21.256 times that of the hemolymph (p < 0.05), respectively. While the expres- 11.996sion level and of21.256 Lmserpin1 times inthat testis of the and hemolymph midgut had (p no < 0.05), difference respectively. with the While hemolymph the expres- (p > Insects 2021, 12, 178 sion0.05). level of Lmserpin1 in testis and midgut had no difference with the hemolymph 6(p of > 16 0.05).
B 40 B 40 a a 30 b 30 b 20 c
mRNA relative level relative mRNA 20 c
mRNA relative level relative mRNA 10 10 d d d 0 d d Lmserpin1 d t s t y 0 u n es d Lmserpin1 g sti d o mph d t te met e b y mi u s n t y l g gu tap es a d o sti e e d f o mph d te t me e b y mi In m t heml gu tap fa o te e n I differentm tissue hem different tissue
FigureFigure 1. 1. ExpressionExpression of of Lmserpin1Lmserpin1 inin the the different different tissue tissue and and developmental developmental stages stages of ofL. L.migratoria migratoria Figuremanilensis 1. Expression. (A) Relative of Lmserpin1mRNA level in the of thedifferent Lmserpin1 tissuegene and in developmental the development stages stages of L.of migratoriaL. migrato- manilensis.(A) Relative mRNA level of the Lmserpin1gene in the development stages of L. migratoria manilensisria manilensis. (A), Lmserpin1Relative mRNA mRNA level level of in the the Lmserpin1 egg was geneattributed in the adevelopment value of 1. (B stages) Relative of L. mRNA migrato- manilensis, Lmserpin1 mRNA level in the egg was attributed a value of 1. (B) Relative mRNA level rialevel manilensis of the Lmserpin1, Lmserpin1 gene mRNA in the level different in the tissueegg was of L.attributed migratoria a valuemanilensis of 1., (Lmserpin1B) Relative mRNA mRNA level Lmserpin1 L. migratoria manilensis Lmserpin1 levelinof the the of hemolymph the Lmserpin1gene was gene attributed in thein the different different a value tissue oftissue 1. ofBars of L. represent migratoria mean manilensis ± S.E., ,(n Lmserpin1 = 3). BarsmRNA mRNA labeled levellevel with in indifferentthe the hemolymph hemolymph letters are waswas significantly attributedattributed different aa valuevalue ofof(one-way 1.1. Bars represent ANOVA meanfollowed ±± S.E.S.E. by (n Duncan’s (n = =3). 3). Bars Bars test, labeled labeled p < 0.05). with with differentdifferent letters letters are are significantly significantly different different (one-way (one-way ANOVA ANOVA followed followed by by Duncan’s Duncan’s test, test, pp << 0.05). 0.05). 3.2. The Expression of Lmserpin1 of L. migratoria manilensis in 3rd Instars after RNAi 3.2. The Expression of Lmserpin1 of L. migratoria manilensis in 3rd Instars after RNAi 3.2. TheAnalysis Expression of variance of Lmserpin1 revealed of L. migratoria significant manilensis differences in 3rd for Instars the relative after RNAi expression of Analysis of variance revealed significant differences for the relative expression of Analysis of variance revealed significant differences for the relative expression of Lmserpin1Lmserpin1 inin L.L. migratoria migratoria manilensis. manilensis. TheThe expression expression of of Lmserpin1Lmserpin1 waswas significantly significantly lower lower Lmserpin1in treated insamples L. migratoria compared manilensis. to that Theof the expression control (inject of Lmserpin1 ddH2O) wasat 6 h,significantly 24 h, 48 h, andlower 72 in treated samples compared to that of the control (inject ddH2O) at 6 h, 24 h, 48 h, and in treated samples compared to that of the control (inject ddH2O) at 6 h, 24 h, 48 h, and 72 h72 after h after treatment, treatment, and andit was it wasonly only 0.160 0.160 times times of that of thatof the of control the control at 24 ath 24(Figure h (Figure 2A, 2pA < , h after treatment, and it was only 0.160 times of that of the control at 24 h (Figure 2A, p < 0.05).p < 0.05 Therefore,). Therefore, we selected we selected 24 h after 24 htreatment after treatment as the point as the in time point to in show time the to response show the 0.05). Therefore, we selected 24 h after treatment as the point in time to show the response ofresponse different of tissue different to Lmserpin1 tissue to Lmserpin1RNAi. RNAi. of differentMoreover,Moreover, tissue the to expressionLmserpin1expression RNAi. of ofLmserpin1 Lmserpin1 in differentin different tissue, tissue, after itafter was it silenced was silenced through throughRNAi,Moreover,was RNAi, significantly wasthe expressionsignificantly down-regulated of down-regulated Lmserpin1 at24 in h different afterat 24 treatment,h after tissue, treatment, inafter particular it in was particularin silenced fat body in throughfatand body hemolymph, RNAi, and hemolymph, was itsignificantly was onlyit was 0.0101 onlydown-regulated 0.0101 and 0.0171 and 0.0171 timesat 24 htimes that after of that treatment, the of control the control in ( pparticular< 0.05).(p < 0.05). Thein fatTheresult body result showed and showed hemolymph, that that the Lmserpin1the it wasLmserpin1 onlygene 0.0101 gene was interferedandwas 0.0171interfered efficiently times efficiently that in of fat the in body. control fat body. Therefore, (p < There- 0.05). we Thefore,selected result we selected fatshowed body fat asthat body the the target as Lmserpin1 the tissues target genetissues to show was to the showinterfered response the response efficiently to pathogenic to pathogenicin fat bacteria. body. bacteria. There- fore, we selected fat body as the target tissues to show the response to pathogenic bacteria.
Figure 2. Relative quantitative expression of Lmserpin1 mRNA in different time and different tissue Figureof L. migratoria 2. Relative manilensis quantitative after expression RNAi. (A) Relativeof Lmserpin1 mRNA mRNA level in of different the Lmserpin1 time geneand different in the bodies tis- of Figuresue3rd of instars L.2. RelativemigratoriaL. migratoria quantitative manilensis manilensis after expression RNAi.under ( ofA treatment) Lmserpin1 Relative for mRNA mRNA 6 h, 24 level in h, different 48 of h, the and Lmserpin time 72 h. and (B1gene) different Relative in the mRNAtis- bod- sueieslevel of 3rdL. of migratoria the instarsLmserpin1 L. manilensis migratoriagene inafter manilensis the RNAi. body, under( midgut,A) Relative treatment fat body,mRNA for testis, 6level h, 24 and of h, thehemolymph 48 Lmserpinh, and 721gene afterh. (B treatment)in Relative the bod- by iesmRNA of 3rd level instars of the L. migratoriaLmserpin1 manilensis gene in the under body, treatment midgut, fatfor body,6 h, 24 testis, h, 48 andh, and hemolymph 72 h. (B) Relative after 24 h. Error probability of p < 0.05 by Student’s t-test, ** indicates a significant difference between mRNA level of the Lmserpin1 gene in the body, midgut, fat body, testis, and hemolymph after the two groups; * indicates no significant difference between the two groups (Duncan’s method for multiple comparisons).
Insects 2021, 12, x FOR PEER REVIEW 7 of 16
Insects 2021, 12, x FOR PEER REVIEW 7 of 16
treatment by 24 h. Error probability of p < 0.05 by Student’s t-test, ** indicates a significant differ- ence between the two groups; * indicates no significant difference between the two groups (Dun- treatmentcan’s method by 24 for h. multiple Error probability comparisons). of p < 0.05 by Student’s t-test, ** indicates a significant differ- Insects 2021, 12, 178 ence between the two groups; * indicates no significant difference between the two groups (Dun-7 of 16 can’s3.3. The method Expression for multiple of Lmserpin1 comparisons). with Application of M. anisopliae After infection with M. anisopliae spores, the expression of Lmserpin1 of L. migratoria 3.3. The Expression of Lmserpin1 with Application of M. anisopliae manilensis3.3. The Expression was significantly of Lmserpin1 higher with than Application the contro ofl M. group anisopliae in the early stage (Figure 3). It After infection with M. anisopliae spores, the expression of Lmserpin1 of L. migratoria was 6.285,After 5.483, infection and with1.558 M.times anisopliae that ofspores, the control the expression at 6 h, 12 h, of andLmserpin1 24 h afterof L. treatment, migratoria manilensis was significantly higher than the control group in the early stage (Figure 3). It respectively.manilensis was While significantly there was higherno significant than the difference control group between in the the early control stage and (Figure treatment3). It was 6.285, 5.483, and 1.558 times that of the control at 6 h, 12 h, and 24 h after treatment, atwas 48 h 6.285, and 72 5.483, h. and 1.558 times that of the control at 6 h, 12 h, and 24 h after treatment, respectively. While there was no significant difference between the control and treatment respectively. While there was no significant difference between the control and treatment at 48 h and 72 h. at 48 h and 72 h.
Figure 3. Relative quantitative expression of Lmserpin1 mRNA of L. migratoria manilensis after beingFigure treated 3. Relative by M. quantitativeanisopliae. Error expression probability of Lmserpin1 of p < 0.05mRNA by Student’s of L. migratoria t-test, **manilensis indicates a after signifi- being Figurecanttreated difference 3. byRelativeM. between anisopliae quantitative the. Error two expression groups; probability * ofindi Lmserpin1 ofcatesp < 0.05no significantmRNA by Student’s of L.difference migratoria t-test, **between manilensis indicates the a twoafter significant beinggroupsdifference treated (Duncan’s between by M. method anisopliae the two for. groups;multipleError probability *comparisons). indicates of nop < significant 0.05 by Student’s difference t-test, between ** indicates thetwo a signifi- groups cant(Duncan’s difference method between for multiplethe two groups; comparisons). * indicates no significant difference between the two groups3.4. Mortality (Duncan’s Comparison method for under multiple Different comparisons). Bioassay Treatments 3.4. Mortality Comparison under Different Bioassay Treatments With the application of M. anisopliae, the mortality of L. migratoria manilensis increased 3.4. Mortality Comparison under Different Bioassay Treatments to 67.78%With at the the application 12th day after of M. infection, anisopliae ,and the mortalityfrom the 5th of L. to migratoria 12th day, manilensis all of themincreased were significantlyto 67.78%With the at higher application the 12th than day ofthat afterM. ofanisopliae infection,the control, the and mortality(p from< 0.05) the of (Figure L. 5th migratoria to 4). 12th Injection day,manilensis all of of dsSerpin1increased them were toRNAsignificantly 67.78% killed at only the higher 12th18.32%than day of thatafter the ofL. infection, themigratoria control and manilensis (p Figure 4. The mortality of L. migratoria manilensis days across 12 days after treatment, each treatments were 150 individuals. Bars represent mean ± S.E. (n = 3). Bars labeled with different letters are significantly different (one-way ANOVA followed by Duncan’s test, p < 0.05). Insects 2021, 12, x FOR PEER REVIEW 8 of 16 Figure 4. The mortality of L. migratoria manilensis days across 12 days after treatment, each treat- ments were 150 individuals. Bars represent mean ± S.E. (n = 3). Bars labeled with different letters Insects 2021, 12, 178 are significantly different (one-way ANOVA followed by Duncan’s test, p < 0.05). 8 of 16 3.5. The Enzyme Activity of L. migratoria manilensis among Different Treatment Groups 3.5.1.3.5. Effects The Enzyme of Different Activity ofTreatment L. migratoria Groups manilensis on PO among Activity Different of L. Treatment migratoria Groups manilensis 3.5.1.The Effects activity of Different of PO treated Treatment by Metarhiziu Groups on POm showed Activity ofa trendL. migratoria of increasing manilensis then de- creasingThe with activity days, of while PO treated that treated by Metarhizium by the dsSerpin1 showed + Metarhizium a trend of increasing showed thena trend de- of decreasingcreasing with then days, increasing while that with treated days by(Figure the dsSerpin1 5). Treated + Metarhizium by Metarhizium, showed the a activity trend of of POdecreasing was significantly then increasing lower than with daysthat of (Figure the co5).ntrol, Treated with by the Metarhizium, exception of the the activity 3rd day of of samplingPO was significantly(p < 0.05), and lower was thannot significantly that of the control, differen witht from the the exception control of on the the 3rd 3rd day day of of sampling.sampling Treated (p < 0.05), by anddsSerpin1 was not + significantlyMetarhizium, different the activity from of the PO control was significantly on the 3rd day higher of thansampling. that of Treatedthe control by dsSerpin1 on the 4th + Metarhizium, day while lower the activity than that of PO of was the significantlycontrol on the higher other daysthan of that sampling of the control (p < 0.05). on the Moreover, 4th day while it significantly lower than thathigher of the than control the Metarhizium on the other days treat- mentof sampling group on (p the< 0.05). 4th day, Moreover, and was it significantly significantly higher lower than than the the Metarhizium Metarhizium treatment treatment groupgroup on on the the 4th2nd day, and and 3rd was days significantly (p < 0.05), lower which than is thenot Metarhizium significantly treatment different group from on the Metarhiziumthe 2nd and treatment 3rd days (p group< 0.05), on which other is days. not significantly different from the Metarhizium treatment group on other days. PO 2.5 a Control 2.0 IMI330189 dsSerpin1+IMI330189 1.5 a a a a b a 1.0 b b b 0.5 b b c c b 0.0 1d 2d 3d 4d 5d Figure 5. The phenoloxidase (PO) activity of L. migratoria manilensis on the 3rd instars after the Figureapplication 5. The ofphenoloxidase different treatments. (PO) activity Bars represent of L. migratoria mean ± manilensisS.E. (n = 3). on The the letters 3rd instars a, b, and after c denote the applicationthe differences of different between treatments. treatments, Bars bars represent labeled withmean different ± S.E. (n letters= 3). The are letters significantly a, b, and different c denote the(one-way differences ANOVA between followed treatments by Duncan’s, bars labeled test, p < with 0.05). different letters are significantly different (one-way ANOVA followed by Duncan’s test, p < 0.05). 3.5.2. Effects of Different Treatment Groups on POD Activity of L. migratoria manilensis 3.5.2. EffectsThe activity of Different of POD Treatment treated by Groups Metarhizium on POD or Activity by the dsSerpin1of L. migratoria + Metarhizium manilensis showedThe activity a trend ofof decreasing POD treated then increasingby Metarhizium and then or decreasing by the dsSerpin1 with the days + Metarhizium(Figure6 ). showedTreated a by trend Metarhizium, of decreasing the activity then increasing of POD was and significantly then decreasing higher than with that the of days the control (Figureon the 6). 1st Treated day, but by significantly Metarhizium, lower the than activity that of of POD the control was significantly on the 2ndand higher 5th than day ofthat ofsampling the control (p Insects 2021, 12, x FOR PEER REVIEW 9 of 16 Insects 2021, 12, x FOR PEER REVIEW 9 of 16 Insects 2021, 12, 178 9 of 16 Figure 6. The peroxidase (POD) activity of L. migratoria manilensis from different treatments. Bars represent mean ± S.E. (n = 3). The letters a, b, and c denote the differences between treatments, barsFigure labeled 6. The with peroxidase different (POD) letters activity are significantly of L. migratoria different manilensis (one-wayfrom different ANOVA treatments. followed Bars by Dun- can’sFigurerepresent test, 6. Thep mean < 0.05). peroxidase± S.E. (n = (POD) 3). The lettersactivity a, b,of andL. migratoria c denote the manilensis differences from between different treatments, treatments. bars Bars representlabeled with mean different ± S.E. letters (n = 3). are Th significantlye letters a, different b, and (one-wayc denote ANOVAthe differences followed between by Duncan’s treatments, test, 3.5.3.barsp < labeled 0.05). Effects with of Different different lettersTreatment are significantly Groups on different SOD Activity (one-way of L. ANOVA migratoria followed manilensis by Dun- can’s test, p < 0.05). 3.5.3.The Effects activity of Different of SOD Treatmenttreated by Groups Metarhiziu on SODm Activityor by the of L.dsSerpin1 migratoria + manilensis Metarhizium de- creased with days (Figure 7). Treated by Metarhizium, the activity of SOD was signifi- 3.5.3. EffectsThe activity of Different of SOD treated Treatment by Metarhizium Groups on or SOD by the Activity dsSerpin1 of +L. Metarhiziummigratoria manilensis de- cantlycreased higher with daysthan (Figure that of7). the Treated control by Metarhizium,on the 1st day, the activitybut significantly of SOD was lower significantly than that of The activity of SOD treated by Metarhizium or by the dsSerpin1 + Metarhizium de- thehigher control than on that the of 5th the day control (p < on 0.05), the 1st and day, it butwas significantly not significantly lower than different that of from the control the control oncreasedon other the 5th withdays. day days Treated (p < 0.05),(Figure by and dsSerpin1 7). it wasTreated not + significantlyMetarhiz by Metarhizium,ium, different the activity the from activity the of controlSOD of onSOD on the other was first signifi- two dayscantlydays. were higher Treated significantly than by dsSerpin1 that higherof +the Metarhizium, thancontrol that on of the the the activity 1stcontrol day, of SODand but the onsignificantlythe Metarhizium, first two lower days but were than was that sig- of nificantlythesignificantly control lower on higher the than 5th than that day that of (p the < of 0.05), thetwo control groupand it and wason the not Metarhizium,4th significantly day (p < 0.05). but different was There significantly fromwas no the signif- control icantlyonlower other difference than days. that Treated of found the two byamong groupdsSerpin1 them on the on+ 4thMetarhiz the day 3rd ( pandium,< 0.05). 5th the day There activity (p > was 0.05). of no SOD significantly on the first two daysdifference were significantly found among themhigher on than the 3rd that and of 5th the day control (p > 0.05). and the Metarhizium, but was sig- nificantly lower than that of the two group on the 4th day (p < 0.05). There was no signif- icantly difference found among them on the 3rd and 5th day (p > 0.05). Figure 7. Superoxide dismutase (SOD) activity of L. migratoria manilensis from different treatments. FigureBars represent 7. Superoxide mean ± dismutaseS.E. (n = 3). (SOD) The letters activity a, b, of and L. cmigratoria denote the manilensis differences from between different treatments, treatments. Barsbars represent labeled with mean different ± S.E. letters (n = 3). are The significantly letters a, different b, and c (one-way denote the ANOVA differences followed between by Duncan’s treat- ments, bars labeled with different letters are significantly different (one-way ANOVA followed by test, p < 0.05). Duncan’s test, p < 0.05). Figure3.5.4. 7. Effects Superoxide of Different dismutase Treatment (SOD) Groups activity on of MFO L. migratoria Activity ofmanilensisL. migratoria from manilensis different treatments. Bars represent mean ± S.E. (n = 3). The letters a, b, and c denote the differences between treat- 3.5.4. EffectsThe MFO of activityDifferent of the Treatment group treated Groups with on the MFO Metarhizium Activity showed of L. migratoria a trend of increas- manilensis ments,ing then bars decreasing labeled with with different days, while letters the are activity significantly of MFO different in the dsSerpin1 (one-way + MetarhiziumANOVA followed by Duncan’sThe MFOtest, p activity< 0.05). of the group treated with the Metarhizium showed a trend of in- creasingtreatment then group decreasing showed a with trend days, of decreasing while th thene activity increasing of MFO with daysin the (Figure dsSerpin18). Treated + Metarhi- by Metarhizium, the activity of MFO was significantly higher than that of the control on the zium3.5.4. treatmentEffects of Differentgroup showed Treatment a trend Groups of decreasing on MFO then Activity increasing of L. withmigratoria days (Figuremanilensis 8). Treated by Metarhizium, the activity of MFO was significantly higher than that of the The MFO activity of the group treated with the Metarhizium showed a trend of in- creasing then decreasing with days, while the activity of MFO in the dsSerpin1 + Metarhi- zium treatment group showed a trend of decreasing then increasing with days (Figure 8). Treated by Metarhizium, the activity of MFO was significantly higher than that of the Insects 2021, 12, x FOR PEER REVIEW 10 of 16 Insects 2021, 12, 178 10 of 16 control on the 2nd and 3rd days of sampling, but significantly lower than that of the con- trol on the 4th and 5th days of sampling (p < 0.05), and was not significantly different from the2nd control and 3rd he days1st day of sampling, (p > 0.05). but Treated significantly by dsSerpin1 lower than + Me thattarhizium, of the control the activity on the 4th ofand MFO was5th significantly days of sampling lower (p than< 0.05), that and of the was control not significantly on the 4th different and 5th from days, the and control was henot 1st sig- nificantlyday (p > different 0.05). Treated from by the dsSerpin1 control on + Metarhizium,other days (p the< 0.05). activity Moreover, of MFO it was was significantly significantly lowerlower than than the that Metarhizium of the control treatment on the 4th group and 5th on days,the on and the was 2nd, not 3rd, significantly and 4th days different of sam- pling,from and the was control not onsignificantly other days different (p < 0.05). from Moreover, the Metarhizium it was significantly treatment lower group than on theother daysMetarhizium (p > 0.05). treatment group on the on the 2nd, 3rd, and 4th days of sampling, and was not significantly different from the Metarhizium treatment group on other days (p > 0.05). Figure 8. Multifunctional oxidase (MFO) activity of L. migratoria manilensis from different treatments. FigureBars represent8. Multifunctional mean ± S.E. oxidase (n = 3). (MFO) The letters activity a, b, of and L. migratoria c denote the manilensis differences from between different treatments, treat- ments.bars labeledBars represent with different mean letters± S.E. are(n = significantly 3). The letters different a, b, and (one-way c denote ANOVA the differences followed by between Duncan’s treatments,test, p < 0.05). bars labeled with different letters are significantly different (one-way ANOVA fol- lowed by Duncan’s test, p < 0.05). 3.5.5. Effects of Different Treatment Groups on GSTs Activity of L. migratoria manilensis 3.5.5. EffectsThe activity of Different of GSTs Treatment in the Metarhizium Groups treatmenton GSTs Activity group showed of L. migratoria a trend of decreasingmanilensis then increasing with days, while that in the dsSerpin1 + Metarhizium treatment group The activity of GSTs in the Metarhizium treatment group showed a trend of decreas- showed a trend of decreasing then increasing, then decreasing with days (Figure9). Treated ing then increasing with days, while that in the dsSerpin1 + Metarhizium treatment group by Metarhizium, the activity of GSTs was significantly lower than that of the control on showedthe 3rd a and trend 5th daysof decreasing of sampling then (p InsectsInsects2021 2021,, 1212, x 178 FOR PEER REVIEW 11 of 16 11 of 16 3 GSTs Control a Metarhizium a 2 dsSerpin1+Metarhizium b b a b a a b a 1 a b b b c Theratio of enzyme activity 0 1d 2d 3d 4d 5d day after treatment Figure 9. Glutathione S-transferase (GST) activity of L. migratoria manilensis from different treatments. Bars Figure 9. Glutathione S-transferase (GST) activity of L. migratoria manilensis from different treat- ments.represent Bars represent mean ± S.E. mean (n ± = S.E. 3). The(n = letters3). The a, letters b, and a, c b, denote and c thedenote differences the differences between between treatments, bars labeled treatments,with different bars labeled letters arewith significantly different letters different are significantly (one-way ANOVA different followed(one-way byANOVA Duncan’s fol- test, p < 0.05). lowed by Duncan’s test, p < 0.05). 3.6. Effect of RNAi on mRNA Levels of Immune Related Pathway Gene 3.6. EffectAnalysis of RNAi ofon mRNA variance leve revealedls of Immune that Related therelative Pathway expressionGene levels of PPAE, PPO, and defensinAnalysismRNA of variance in L. migratoriarevealed that manilensis the relativetreated expression by dsSerpin1 levels of PPAE + Metarhizium, PPO, and showed a defensindecreased mRNA trend in L. compared migratoria tomanilensis that treated treated by by Metarhizium dsSerpin1 + aloneMetarhizium (Figure showed 10). The a expression decreasedlevel of trendPPAE comparedtreated by to thethat Metarhizium treated by Metarhizium was significantly alone (Figure higher 10) than. The thatexpres- of other three siontreatments, level of PPAE while treated that by treated the Metarhizium by dsSerpin1 was +signif Metarhiziumicantly higher was than significantly that of other lower than Insects 2021, 12, x FOR PEER REVIEWthree treatments, while that treated by dsSerpin1 + Metarhizium was significantly lower12 of 16 the dsSerpin1 treatment and there was no significantly difference found comparing with than the dsSerpin1 treatment and there was no significantly difference found comparing the control (Figure 10A, p < 0.05). with the control (Figure 10A, p < 0.05). The expression level of PPO treated by the Metarhizium was significantly higher than that of other three groups, while treated by dsSerpin1 + Metarhizium, L. migratoria ma- nilensis sharply suppressed the expression of PPO, so that there were no significant differ- ences observed between the dsSerpin1 + Metarhizium treatment and the dsSerpin1 treat- meat as well as the control treatment respectively(Figure 10B, p < 0.05). For the expression level of defensin, when treated by the Metarhizium group, it was significantly higher than that of the control, while treated by dsSerpin1 + Metarhizium, it was significantly lower than that of the independent treatment of Metarhizium, while no such significant differences were observed with the control treatment (Figure 10C, p < 0.05). FigureFigure 10. 10. TheThe relative relative quantitative quantitative expressi expressionon of immune of immune related related genes of genes L. migratoria of L. migratoria manilensis. manilensis. (A(A) )The The expression expression of of PPAE PPAE in indifferent different treatments. treatments. (B) (TheB) The expression expression of PPO of PPO in different in different treat- treatments. ments.(C) The (C expression) The expression of defensin of defensinin different in different treatments. treatments. The letters The letters a, b, and a, cb, denote and c denote the differences the dif- between ferencestreatments, between values treatments, are expressed values asare means expressed± standard as means error ± standard (SE) of error the number(SE) of the of number treatments. of Bars treatments. Bars marked by different lowercase letters are significantly different based on least- marked by different lowercase letters are significantly different based on least-significant difference (LSD) significant difference (LSD) analysis at p < 0.05. analysis at p < 0.05. 4. Discussion When infected by M. anisopliae, we found that Lmserpin1 was expressed with a higher level at 6 h, 12 h, and 24 h after treatment, which means that Lmserpin1 gene was involved in the immune response of migratory locusts (Figure 3). To gain a better understanding of the expression profile of Lmserpin1 in different instars of L. migratoria manilensis, we cloned the Lmserpin1 gene from L. migratoria manilensis and investigated its transcription by qRT- PCR. The results showed that the Lmserpin1 gene was expressed in all stages with the highest expression level in 3rd instars (Figure 1A). Serpins had been found to be associ- ated with the innate immune system [11], thus we inferred that the nymph of L. migratoria manilensis in the 3rd instars had the highest resistance to pathogens, and we selected the 3rd instars as the optimal stage to show the response to pathogenic bacteria. Furthermore, we found that Lmserpin1 was expressed with a higher level in integument and fat body (Figure 1B). The higher expression level of Lmserpin1 in the integument might be due to direct contact between the tissue and M. anisopliae, which was helpful for successfully pre- venting the infection of fungi. Meanwhile, a higher expression level in the fat body may be due to the main tissue of innate immune in L. migratoria manilensis. When the Lmserpin1 gene was interfered with, the expression level was the lowest at 24 h after treatment, with a relative level no more than 20% compared to the control, which indicated that Lmserpin1 was successfully interfered (Figure 2A). In addition, the interference efficiency was the highest in fat body and hemolymph (Figure 2B). Previous studies have shown that the fat body and hemolymph were mediators of cellular immunity in arthropods and contrib- uted to the humoral branch by expressing a large number of secreted immune factors [41]. Insects 2021, 12, 178 12 of 16 The expression level of PPO treated by the Metarhizium was significantly higher than that of other three groups, while treated by dsSerpin1 + Metarhizium, L. migratoria manilensis sharply suppressed the expression of PPO, so that there were no significant differences observed between the dsSerpin1 + Metarhizium treatment and the dsSerpin1 treatmeat as well as the control treatment respectively (Figure 10B, p < 0.05). For the expression level of defensin, when treated by the Metarhizium group, it was significantly higher than that of the control, while treated by dsSerpin1 + Metarhizium, it was significantly lower than that of the independent treatment of Metarhizium, while no such significant differences were observed with the control treatment (Figure 10C, p < 0.05). 4. Discussion When infected by M. anisopliae, we found that Lmserpin1 was expressed with a higher level at 6 h, 12 h, and 24 h after treatment, which means that Lmserpin1 gene was involved in the immune response of migratory locusts (Figure3). To gain a better understanding of the expression profile of Lmserpin1 in different instars of L. migratoria manilensis, we cloned the Lmserpin1 gene from L. migratoria manilensis and investigated its transcription by qRT-PCR. The results showed that the Lmserpin1 gene was expressed in all stages with the highest expression level in 3rd instars (Figure1A). Serpins had been found to be associated with the innate immune system [11], thus we inferred that the nymph of L. migratoria manilensis in the 3rd instars had the highest resistance to pathogens, and we selected the 3rd instars as the optimal stage to show the response to pathogenic bacteria. Furthermore, we found that Lmserpin1 was expressed with a higher level in integument and fat body (Figure1B). The higher expression level of Lmserpin1 in the integument might be due to direct contact between the tissue and M. anisopliae, which was helpful for successfully preventing the infection of fungi. Meanwhile, a higher expression level in the fat body may be due to the main tissue of innate immune in L. migratoria manilensis. When the Lmserpin1 gene was interfered with, the expression level was the lowest at 24 h after treatment, with a relative level no more than 20% compared to the control, which indicated that Lmserpin1 was successfully interfered (Figure2A). In addition, the interference efficiency was the highest in fat body and hemolymph (Figure2B). Previous studies have shown that the fat body and hemolymph were mediators of cellular immunity in arthropods and contributed to the humoral branch by expressing a large number of secreted immune factors [41]. Thus we chose the fat body as the optimal tissue to detect the effect of Lmserpin1 interferrence in the immune response. M. anisopliae is the most important entomopathogenic fungus with potential use against many insect pests, including locusts and grasshoppers [42]. Previous studies have shown that the Metarhizium adhesion-like protein 1(Mad1) with Metarhizium can cause a higher mortality in migratory locusts than Metarhizium alone [43]. In our study, the mortality of L. migratoria manilensis treated with dsSerpin1 + Metarhizium was 94.31%, while being treated with Metarhizium alone was 67.78% (Figure4). This result indicated that interfering with Lmserpin1 could effectively enhance the infection of Metarhizium and increase the mortality of L. migratoria manilensis, however, it means that Lmserpin1 can inhibit the infection of M. anisopliae. For all we know, extracellular proteinase, which is a kind of main virulence factor, plays a vital role during the infection of M. anisopliae. We inferred that Lmserpin1, as a serine protease inhibitor, may have inhibited the activity of extracellular proteinase from M. anisopliae, decreased its virulence, ultimately reducing the insecticidal efficiency of locusts caused by M. anisopliae infection. When pathogens invade, humoral immunity will stimulate the synthesis of melanin to remove foreign pathogens [44]. PO is an important factor in catalyzing melanization [45]. Serpins acting as regulators of melanization response have been reported in various in- sects [21]. Such as in M. sexta, Mxserpin3, Mxserpin4, Mxserpin5, and Mxserpin6 has been found to be involved in the regulation of PPO cascade [23,24,46]. This study showed that PPAE and PPO genes were significantly enhanced following M. anisopliae infection (Figure 10A,B), while interference with the Lmserpin1 gene significantly reduced this two gene expression in the immune-related pathway when a locust is infected. Additionally, Insects 2021, 12, 178 13 of 16 the activity of PO in the dsSerpin1 + Metarhizium combined treatment group was signif- icantly reduced than the Metarhizium group in the early stage (Figure5). Those results showed that interference of the Lmserpin1 gene could effectively inhibit the expression of melanization-related pathway genes and the activity of PO, ultimately decreasing the ability of locust to resist pathogenic bacteria infection, which means Lmserpin1 could en- hance the melanization reaction of L. migratoria manilensis. It has been described that the Dmserpin27A of D. melanogaster can inhibit the activities of PPAE and PO at the site of injury or infection to prevent the insect from excessive melanization [14], and Dmserpin8 can inhibit the PO activity in the hemolymph of Penaeus Monodon and participates in its own melanization [47]. The function of Lmserpin1 was different from that of Dmserpin27A and Dmserpin8 to a certain extent, further research is needed. The invasion of M. anisopliae leads to changes of different enzyme activities in migra- tory locusts, which destroys the balance of the enzyme system. When the destruction of homeostasis reaches a certain degree, the migratory locust begins to die [48]. SOD and 2− POD can scavenge superoxide anion free radicals (O ) and hydrogen peroxide (H2O2), which plays an important role in insect resistance to pathogenic bacteria. It has been reported that the invasion of Metarhizium can induce the increasing of O2− concentration from locusts, enhancing the activity of SOD and POD to clear massive O2− and excess H2O2 [49,50]. In our experiment, the activity of SOD and POD in the prior period was significantly increased when locusts were treated with M. anisopliae, and after interference of the Lmserpin1 gene, the SOD enzyme activity was significantly higher than that without interference in the early stage of infection (Figures6 and7), which indicated that the balance of the protective enzyme system of L. migratoria manilensis was damaged after Lmserpin1 interference, it induced that the activity of the protective enzyme was over-increased, and ultimately mortality increased. It indicated that Lmserpin1 could regulate the protective enzyme system of the insect body and regulate the resistance of L. migratoria manilensis to pathogenic bacteria. MFO and GSTs are two important families of enzymes in insects that participate in the detoxification of various xenobiotics and insecticides and play important roles in the resistance of insects to various insecticides [51]. Compared with Metarhizium, the dsSerpin1 + Metarhizium combined treatment could effectively reduce the activity of MFO and weaken the detoxification ability of L. migratoria manilensis (Figure8). It indicated that the Lmserpin1 gene could reduce the infection of M. anisoplia. By enhancing the detoxifying enzyme system and immunity response in migratory locusts. GSTs play a pivotal role in cellular antioxidant defenses against oxidative stress [52–54]. However, after the dsSerpin1 + Metarhizium combined treatment, the activity of GSTs is irregular, and further study is needed (Figure9). The effector AMPs produced from fat body constitute the humoral immune system in the fat body. It has been described that Bmserpin15 protein in B. mori can reduce the transcript levels of the AMPs cecropin D, gloverin2, and moricin significantly [55]. The Bmserpin28 in fat body of B. mori can inhibit significantly the transcription of AMPs [34]. While our qRT-PCR analysis result showed that after L. migratoria manilensis was infected by M. anisopliae, the expression of the defensin gene significantly decreased when the Lmserpin1 gene was interfered with (Figure 10C). This result suggested that interference of the Lmserpin1 gene could effectively inhibit the production of AMPs, which indicates that Lmserpin1 could enhance the expression of AMPs genes to improve host humoral immune defensing. In summary, after the Lmserpin1 gene was interfered with, the activities of protective enzymes (SOD and POD), detoxification enzymes (GSTS and MFO), and PO in L. migratoria manilensis were fluctuating, and the expression levels of immune response related genes (PPAE, PPO, and defensin) decreased. These results show that Lmserpin1 could increase immune responses in L. migratoria manilensis to resist the infection of M. anisopliae. However, there are many questions that remain to be answered. The mechanisms of Lmserpin1’s interaction with its target protease remain to be discovered. Future studies should focus on Insects 2021, 12, 178 14 of 16 evaluating these signaling mechanisms to provide a clearer understanding of its possible functions in L. migratoria manilensis. 5. Conclusions In this study, we monitored the activities of SOD, POD, PO, GSTs, and MFO, and evaluated the expression levels of immune-related genes of L. migratoria manilensis treated with dsSerpin1, Metarhizium, and dsSerpin1 + Metarhizium respectively to identify the immunity mechanism of Lmserpin1. Our results showed that the interference of Lmser- pin1 caused the activity of the protective enzyme over-increased and the detoxification enzyme suppressed and effectively reduced the expression of immune-related genes in L. migratoria manilensis which ultimately promoted the infection of Metarhizium, resulting in the L. migratoria manilensis to die acceleratively. These results indicated that Lmserpin1 could increase the immune responses of L. migratoria manilensis to resist the infection of M. anisopliae. Author Contributions: B.L. contributed to planning the experimental design, sampling populations, conducting laboratory tests, data analysis, and writing of the manuscript. Y.T. assisted with data analysis. N.A.A., G.W., X.N., H.L., and Z.Z. contributed to editing the manuscript, provided sugges- tions and comments for manuscript improvement, and approved the final manuscript. All authors have read and agreed to the published version of the manuscript. Funding: This work was funded by the National Key Research and Development Project (No. 2017YFD0200402), Modern Agricultural Industry Technology System (No. CARS-34-07B), and Central Public-interest Scientific Institution Basal Research Fund (No. S2020XM17; Y2020XC18). Institutional Review Board Statement: Not applicable. Acknowledgments: We are grateful to Xiongbing Tu for his guidance on the molecular experiments. We are deeply indebted to Shuang Li for their guidance and suggestions on the experimental design and who helped to check the text. We also would like to express our appreciation to the anonymous reviewers for their valuable suggestions and comments on our manuscript. Conflicts of Interest: The authors declare no conflict of interest. References 1. Celli, J.; Finlay, B.B. Bacterial avoidance of phagocytosis. Trends. Microbiol. 2002, 10, 232–237. [CrossRef] 2. Nielsen-LeRoux, C.; Gaudriault, S.; Ramarao, N.; Lereclus, D.; Givau-dan, A. How the insect pathogen bacteria Bacillus thuringiensis and Xenorhabdus/Photorhabdus occupy their hosts. Curr. Opin. Microbiol. 2012, 15, 220–231. [CrossRef][PubMed] 3. Hultmark, D.; Engström, A.; Andersson, K.; Steiner, H.; Bennich, H.; Boman, H.G. Insect immunity. attacins, a family of antibacterial proteins from hyalophora cecropia. Embo. J. 1983, 2, 571–576. [CrossRef] 4. Iwona, W.; Małgorzata, C.; Agnieszka, Z.B.; Jakub, K. Insect Defense Proteins and Peptides. Subcell. Biochem. 2020, 94, 81–121. 5. Cerenius, L.; Söderhäll, K. The prophenoloxidase-activating system in invertebrates. Immunol. Rev. 2004, 198, 116–126. [CrossRef] 6. Jiravanichpaisal, P.; Lee, B.L.; Söderhäll, K. Cell-mediated immunity in arthropods: Hematopoiesis, coagulation, melanization and opsonization. Immunobiology 2006, 211, 213–236. [CrossRef][PubMed] 7. Olson, S.T.; Richard, B.; Izaguirre, G.; Schedin-Weiss, S.; Gettins, P.G. Molecular mechanisms of antithrombin-heparin regulation of blood clotting proteinases. A paradigm for understanding proteinase regulation by serpin family proteinproteinase inhibitors. Biochimie 2010, 92, 1587–1596. [CrossRef][PubMed] 8. Lemaitre, B.; Hoffmann, J. The host defense of Drosophila melanogaster. Annu. Rev. Immunol. 2007, 25, 697–743. [CrossRef] 9. Satoh, D.; Horii, A.; Ochiai, M.; Ashida, M. Prophenoloxidase-activating enzyme of the silkworm, Bombyx mori. Purification, characterization, and cDNA cloning. J. Biol. Chem. 1999, 274, 7441–7453. [CrossRef] 10. Kanost, M.R. Serine proteinase inhibitors in arthropod immunity. Dev. Comp. Immunol. 1999, 23, 291–301. [CrossRef] 11. Silverman, G.A.; Bird, P.L.; Carrell, R.W.; Church, F.C.; Coughlin, P.B.; Gettins, P.G. The serpins are an expanding uperfamily of structurally similar but functionally diverse proteins. Evolution mechanism of inhibition, novel functions, and a revised nomenclature. J. Biol. Chem. 2001, 276, 33293–33296. [CrossRef][PubMed] 12. Law, R.H.; Zhang, Q.; Mcgowan, S.; Buckle, A.M.; Silverman, G.A.; Wong, W.; Rosado, C.J.; Langendorf, C.G.; Pike, R.N.; Bird, P.I.; et al. An overview of the serpin superfamily. Genome Biol. 2006, 7, 216. [CrossRef] 13. Laskowski, M.; Kato, I. Protein inhibitors of proteinases. Annu. Rev. Biochem. 1980, 49, 593–626. [CrossRef][PubMed] 14. Gregorio, E.D.; Han, S.J.; Lee, W.J.; Baek, M.J.; Osaki, T.; Kawabata, S.I.; Lee, B.L.; Iwanaga, S.; Lemaitre, B.; Brey, P.T. An immune- responsive serpin regulates the melanization cascade in drosophila. Dev. Cell. 2002, 3, 581–592. [CrossRef] Insects 2021, 12, 178 15 of 16 15. Jiang, H.; Kanost, M.R. Characterization and functional analysis of 12 naturally occurring reactive site variants of serpin-1 from Manduca sexta. J. Biol. Chem. 1997, 272, 1082–1087. [CrossRef][PubMed] 16. Zhao, P.; Dong, Z.; Duan, J.; Wang, G.; Wang, L.; Li, Y.; Xiang, Z.; Xia, Q. Genome-wide identification and immune response analysis of serine protease inhibitor genes in the silkworm, Bombyx mori. PLoS ONE 2012, 7, e31168. [CrossRef] 17. Zheng, Y.P.; He, W.Y.; Béliveau, C.; Nisole, A.; Stewart, D.; Zheng, S.C.; Douceta, D.; Cusson, M.; Fengb, Q.L. Cloning, expression and characterization of four serpin-1 cDNA variants from the spruce budworm, Choristoneura fumiferana. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2009, 154, 165–173. [CrossRef] 18. Iwanaga, S.; Kawabata, S.; Muta, T. New types of clotting factors and defense molecules found in horseshoe crab hemolymph: Their structures and functions. J. Biochem. 1998, 123, 1–15. [CrossRef][PubMed] 19. Yang, L.Z.; Keyhani, N.O.; Tang, G.; Tian, C.; Fan, Y.H. Expression of a toll signaling regulator serpin in a mycoinsecticide for increased virulence. Appl. Environ. Microb. 2014, 80, 4531–4539. [CrossRef][PubMed] 20. Tong, Y.; Kanost, M.R. Manduca sexta serpin-4 and serpin-5 inhibit the prophenoloxidase activation pathway: cDNA cloning, protein expression, and characterization. J. Biol. Chem. 2005, 280, 14923–14931. [CrossRef][PubMed] 21. An, C.; Jiang, H.; Kanost, M.R. Proteolytic activation and function of the cytokine Spätzle in the innate immune response of a lepidopteran insect, Manduca sexta. FEBS J. 2010, 277, 148–162. [CrossRef] 22. Chen, H.; Davids, J.A.; Zheng, D.; Bryant, M.; Bot, I.; Theo, J.C.V.B.; Biessen, E.; Pepine, C.; Ryman, K.; Progulski-Fox, A.; et al. The serpin solution; targeting thrombotic and thrombolytic serine proteases in inflammation. Cardiovasc. Hematol. Disord. Drug Targets 2013, 13, 99–110. [CrossRef] 23. Zhu, Y.; Wang, Y.; Gorman, M.J. Manduca sexta serpin-3 regulates prophenoloxidase activation in response to infection by inhibiting prophenoloxidase-activating proteinases. J. Biol. Chem. 2003, 278, 46556–46564. [CrossRef][PubMed] 24. Tong, Y.; Kanost, H.J.; Identiiang, M. Identification of plasma proteases inhibited by Manduca sexta serpin-4 and serpin-5 and their association with components of the prophenoloxidase activation pathway. J. Biol. Chem. 2005, 280, 14932–14942. [CrossRef] [PubMed] 25. Nappi, A.J.; Frey, F.; Carton, Y. Drosophila serpin 27A is a likely target for immune suppression of the blood cell-mediated melanotic encapsulation response. J. Insect Physiol. 2005, 51, 197–205. [CrossRef] 26. Zou, Z.; Picheng, Z.; Weng, H.; Mita, K.; Jiang, H. A comparative analysis of serpin genes in the silkworm genome. Genomics 2009, 93, 367–375. [CrossRef] 27. Kim, C.H.; Kim, S.J.; Kan, H.; Kwon, H.M.; Roh, K.B.; Jiang, R.; Park, J.W.; Lee, H.H.; Ha, N.C.; Kang, H.J.; et al. A three-step proteolytic cascade mediates the activation of the peptidoglycan-induced toll pathway in an insect. J. Biol. Chem. 2008, 283, 7599–7607. [CrossRef] 28. Zhong, X.; Xu, X.X.; Yi, H.Y.; Lin, C.; Yu, X.Q. A toll-spatzle pathway in the tobacco hornworm, Manduca sexta. Insect Biochem. Mol. Biol. 2012, 42, 514–524. [CrossRef] 29. COPR (Centre of Overseas Pest Research). The Locust and Grasshopper Agricultural Manual; ACIAR: Canberra, Australia, 1982; pp. 449–467. 30. Cao, G.; Jia, M.; Zhao, X.; Wang, L.; Zhang, Z. Different effects of metarhizium anisopliae strains IMI330189 and IBC200614 on enzymes activities and hemocytes of Locusta migratoria L. PLoS ONE 2016, 11, e0155257. [CrossRef] 31. Chen, J.; Cui, D.; Ullah, H.; Hao, K.; Tu, X.; Zhang, Z. Serpin7 controls egg diapause of migratory locust (locusta migratoria) by regulating polyphenol oxidase. FEBS Open Bio 2020, 10, 707–717. [CrossRef][PubMed] 32. Rowshani, A.T.; Strik, M.C.M.; Rosalie, M.; Si-La, Y.; Wolbink, A.M.; Bemelman, F.J. The granzyme b inhibitor serpinb9 (protease inhibitor 9) circulates in blood and increases on primary cytomegalovirus infection after renal transplantation. J. Infect. Dis. 2006, 192, 1908–1911. [CrossRef] 33. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 −∆∆CT method. Methods 2001, 25, 402–408. [CrossRef] 34. Gao, Q.; Yang, L.; Dai, J.; Yuan, G.; Wang, L.; Qian, C.; Zhu, B.; Liu, C.; Wei, G. Characterization and functional analysis of serpin-28 gene from silkworm, bombyx mori. J. Inverteb. Pathol. 2018, 159, 18–27. [CrossRef] 35. Hao, K.; Ullah, H.; Jarwar, A.R.; Nong, X.; Tu, X.; Zhang, Z. Molecular identification and diapause-related functional characteriza- tion of a novel dual-specificity kinase gene, MPKL, in Locusta migratoria. FEBS Lett. 2019, 593, 3064–3074. [CrossRef] 36. Mullen, L.M.; Goldsworthy, G.J. Immune responses of locusts to challenge with the pathogenic fungus Metarhizium or high doses of laminarin. J. Insect Physiol. 2006, 52, 389–398. [CrossRef][PubMed] 37. Xue, C.B.; Luo, W.C.; Jiang, L.; Xie, X.Y.; Xiao, T.; Yan, L. Inhibition kinetics of cabbage butterfly (Pieris rapae L.) larvae phenoloxidase activity by 3-hydroxy-4-methoxybenzaldehyde thiosemicarbazone. Appl. Biochem. Biotechnol. 2007, 143, 101–114. [CrossRef][PubMed] 38. Han, Z.; Moores, G.D.; Denholm, I.; Devonshire, A.L. Association between biochemical markers and insecticide resistance in the cotton aphid, aphis gossypiiglover. Pestic. Biochem. Phys. 1998, 62, 164–171. [CrossRef] 39. Oppenoorth, F.J.; Welling, W. Biochemistry and physiology of resistance. In Wilkinson CF. Insecticide Biochemistry and Physiology; Springer: New York, NY, USA, 1976; pp. 507–551. 40. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Nature 1976, 72, 248–254. [CrossRef] 41. Shia, A.K.H.; Glittenberg, M.; Thompson, G.; Weber, A.N.; Reichhart, J.; Ligoxygakis, P. Toll-dependent antimicrobial responses in Drosophila larval fat body require Spätzle secreted by haemocytes. J. Cell Sci. 2009, 122, 4505–4515. [CrossRef][PubMed] Insects 2021, 12, 178 16 of 16 42. De Faria, M.R.; Wraight, S.P. Mycoinsecticides and mycoacaricides: A comprehensive list with worldwide coverage and international classification of formulation types. Biol. Control. 2007, 43, 237–256. [CrossRef] 43. Abro, N.A.; Wang, G.; Ullah, H.; Long, G.L.; Hao, K.; Nong, X.; Cai, N.; Tu, X.; Zhang, Z. Influence of Metarhizium anisopliae (IMI330189) and Mad1 protein on enzymatic activities and Toll-related genes of migratory locust. Environ. Sci. Pollut. R. 2019, 26, 17797–17808. [CrossRef][PubMed] 44. Dan, S.; Akio, H.; Masanori, O.; Masaaki, A. Prophenoloxidase-activating enzyme of the silkworm, Bombyx mori Purification, characterization and cDNA cloning. J. Biol. Inorg. Chem. 2007, 274, 7441–7453. 45. Duan, L.; Otvosi, S. Influence of larval age and virus concentration on mortality and sublethal effects of a nucleopolyhedrovirus on the west spruce budworm (Lepidoptera: Tortricidae). Environ. Entomol. 2001, 30, 136–146. [CrossRef] 46. Zou, Z.; Jiang, H. Manduca sexta serpin-6 regulates immune serine proteinases PAP-3 and HP8. cDNA cloning, protein expression, inhibition kinetics, and function elucidation. J. Biol. Chem. 2005, 280, 14341–14348. [CrossRef] 47. Somnuk, S.; Tassanakajon, A.; Rimphanitchayakit, V. Gene expression and characterization of a serine proteinase inhibitor pmserpin8 from the black tiger shrimp penaeus monodon. Fish Shellfish Immunol. 2012, 33, 332–341. [CrossRef] 48. Wang, Z.H. Virulence of Metarhizium anisopliae extracellular proteinases in midgut of Locusta migratoria manilensis Meyen. Master’s Thesis, Gansu Agricultural University, Lanzhou, Gansu, 2016. (In Chinese). 49. Chen, E.H.; Wei, D.; Wei, D.D.; Yuan, G.R.; Wang, J.J. The effect of dietary restriction on longevity, fecundity, and antioxidant responses in the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae). J. Insect Physiol. 2013, 59, 1008–1016. [CrossRef] 50. Felton, G.W.; Summers, C.B. Antioxidant systems in insects. Arch. Insect Biochem. Physiol. 1995, 29, 187–197. [CrossRef][PubMed] 51. Li, X.; Schuler, M.A.; Berenbaum, M.R. Molecular mechanisms of metabolic resistance to synthetic and natural xenobiotics. Annu. Rev. Entomol. 2007, 52, 231–253. [CrossRef] 52. Feyereisen, R. Insect cytochrome P450. In Comprehensive Molecular Insect Science; Gilbert, L.I., Latrou, K., Gill, S.S., Eds.; Elsevier: Oxford, UK; pp. 1–77. 53. Enayati, A.A.; Ranson, H.; Hemingway, J. Insect glutathione transferases and insecticide resistance. Insect Mol. Biol. 2005, 14, 3–8. [CrossRef] 54. Lumjuan, N.; McCarroll, L.; Prapanthadara, L.; Hemingway, J.; Ranson, H. Elevated activity of an epsilon class glutathione transferase confers DDT resistance in the dengue vector, Aedes aegypti. Insect Biochem. Mol. Biol. 2005, 35, 861–871. [CrossRef] 55. Liu, D.; Wang, L.; Yang, L.; Qian, C.; Wei, G.; Dai, L.; Li, J.; Zhu, B.; Liu, C. Serpin-15 from Bombyx mori inhibits prophenoloxidase activation and expression of antimicrobial peptides. Dev. Comp. Immunol. 2015, 51, 22–28. [CrossRef][PubMed]