Structural Studies of a Fungal Polyphenol Oxidase with Application to Bioremediation of Contaminated Water †
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Characterization of Polyphenol Oxidase and Antioxidants from Pawpaw (Asimina Tribola) Fruit
University of Kentucky UKnowledge University of Kentucky Master's Theses Graduate School 2007 CHARACTERIZATION OF POLYPHENOL OXIDASE AND ANTIOXIDANTS FROM PAWPAW (ASIMINA TRIBOLA) FRUIT Caodi Fang University of Kentucky, [email protected] Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Fang, Caodi, "CHARACTERIZATION OF POLYPHENOL OXIDASE AND ANTIOXIDANTS FROM PAWPAW (ASIMINA TRIBOLA) FRUIT" (2007). University of Kentucky Master's Theses. 477. https://uknowledge.uky.edu/gradschool_theses/477 This Thesis is brought to you for free and open access by the Graduate School at UKnowledge. It has been accepted for inclusion in University of Kentucky Master's Theses by an authorized administrator of UKnowledge. For more information, please contact [email protected]. ABSTRACT OF THESIS CHARACTERIZATION OF POLYPHENOL OXIDASE AND ANTIOXIDANTS FROM PAWPAW (ASIMINA TRIBOLA) FRUIT Crude polyphenol oxidase (PPO) was extracted from pawpaw (Asimina triloba) fruit. The enzyme exhibited a maximum activity at pH 6.5–7.0 and 5–20 °C, and had -1 a maximum catalysis rate (Vmax) of 0.1363 s and a reaction constant (Km) of 0.3266 M. It was almost completely inactivated when incubated at 80 °C for 10 min. Two isoforms of PPO (MW 28.2 and 38.3 kDa) were identified by Sephadex gel filtration chromatography and polyacrylamide gel electrophoresis. Both the concentration and the total activity of the two isoforms differed (P < 0.05) between seven genotypes of pawpaw tested. Thermal stability (92 °C, 1–5 min) and colorimetry (L* a* b*) analyses showed significant variations between genotypes. -
3. Methodology
3. METHODOLOGY The present study focused on the responses evoked by B. monnieri under conditions of oxidative stress. The plan of work and the methodology adopted are presented in this chapter. The work was carried out in four phases. In Phase I, different parts of B. monnieri , namely leaves, stolon and roots, were assessed for their antioxidant potential and free radical scavenging activity. The biomolecular protective effects and the apoptosis- modulating effects of the leaf extract in cell free and in vitro systems were studied in Phase II. Phase III involved assessing the antioxidant status in precision-cut liver slices exposed to oxidative stress and confirming the results in experimental animals. In the final phase of the study, phytochemical analysis of the active component in B. monnieri leaves was carried out. The layout of the study is presented below. PHASE I In this phase, the antioxidant status in different parts of B. monnieri was assessed. The leaves, stolon and roots of the plantlets were collected from the plants grown in pots in the University campus. They were washed thoroughly in running tap water in order to remove any dirt or soil particles adhered and blotted gently between folds of tissue paper to remove any water droplets. Both enzymic and non-enzymic antioxidants were analysed in all the three parts of the plant. ENZYMIC ANTIOXIDANTS The enzymic antioxidants analyzed in the parts of B. monnieri w ere superoxide dismutase, catalase, peroxidase, glutathione S-transferase and polyphenol oxidase. ASSAY OF SUPEROXIDE DISMUTASE (SOD) SOD was assayed according to the method of Kakkar et al. -
Polyphenol Oxidases in Plants and Fungi: Going Places? a Review
PHYTOCHEMISTRY Phytochemistry 67 (2006) 2318–2331 www.elsevier.com/locate/phytochem Review Polyphenol oxidases in plants and fungi: Going places? A review Alfred M. Mayer Department of Plant and Environmental Sciences, The Hebrew University of Jerusalem, Jerusalem 91904, Israel Received 3 June 2006; received in revised form 22 July 2006 Available online 14 September 2006 Abstract The more recent reports on polyphenol oxidase in plants and fungi are reviewed. The main aspects considered are the structure, dis- tribution, location and properties of polyphenol oxidase (PPO) as well as newly discovered inhibitors of the enzyme. Particular stress is given to the possible function of the enzyme. The cloning and characterization of a large number of PPOs is surveyed. Although the active site of the enzyme is conserved, the amino acid sequence shows very considerable variability among species. Most plants and fungi PPO have multiple forms of PPO. Expression of the genes coding for the enzyme is tissue specific and also developmentally controlled. Many inhibitors of PPO have been described, which belong to very diverse chemical structures; however, their usefulness for controlling PPO activity remains in doubt. The function of PPO still remains enigmatic. In plants the positive correlation between levels of PPO and the resistance to pathogens and herbivores is frequently observed, but convincing proof of a causal relationship, in most cases, still has not been published. Evidence for the induction of PPO in plants, particularly under conditions of stress and pathogen attack is consid- ered, including the role of jasmonate in the induction process. A clear role of PPO in a least two biosynthetic processes has been clearly demonstrated. -
Conformational Selection in Trypsin-Like Proteases
Available online at www.sciencedirect.com Conformational selection in trypsin-like proteases Nicola Pozzi, Austin D Vogt, David W Gohara and Enrico Di Cera For over four decades, two competing mechanisms of ligand recognition and regulation in trypsin-like proteases is recognition — conformational selection and induced-fit — relevant to many other biological systems. We therefore have dominated our interpretation of protein allostery. Defining start our discussion with the fundamental properties of the the mechanism broadens our understanding of the system and simplest allosteric models of ligand recognition — confor- impacts our ability to design effective drugs and new mational selection and induced-fit — and present an effec- therapeutics. Recent kinetics studies demonstrate that trypsin- tive experimental strategy to distinguish between them. like proteases exist in equilibrium between two forms: one fully accessible to substrate (E) and the other with the active site Conformational selection or induced-fit? occluded (E*). Analysis of the structural database confirms In its simplest incarnation, binding of ligand L to its existence of the E* and E forms and vouches for the allosteric biological target E can be cast in terms of the reaction nature of the trypsin fold. Allostery in terms of conformational (Scheme 1). selection establishes an important paradigm in the protease À1 À1 field and enables protein engineers to expand the repertoire of In Scheme 1 kon (M s ) is the second-order rate constant À1 proteases as therapeutics. for ligand binding and koff (s ) is the first-order rate of dissociation of the E:L complex into the parent species E Address and L. -
Characterization and Expression Analysis of the Prophenoloxidase Activating Factor from the Mud Crab Scylla Paramamosain
Characterization and expression analysis of the prophenoloxidase activating factor from the mud crab Scylla paramamosain J. Wang1,2, K.J. Jiang1, F.Y. Zhang1, W. Song1, M. Zhao1,2, H.Q. Wei1,2, Y.Y. Meng1,2 and L.B. Ma1 1East China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Shanghai, China 2College of Fisheries and Life Science, Shanghai Ocean University, Shanghai, China Corresponding author: L.B. Ma E-mail address: [email protected] Genet. Mol. Res. 14 (3): 8847-8860 (2015) Received November 25, 2014 Accepted April 27, 2015 Published August 3, 2015 DOI http://dx.doi.org/10.4238/2015.August.3.8 ABSTRACT. Prophenoloxidase activating factors (PPAFs) are a group of clip domain serine proteinases that can convert prophenoloxidase (pro-PO) to the active form of phenoloxidase (PO), causing melanization of pathogens. Here, two full-length PPAF cDNAs from Scylla paramamosain (SpPPAF1 and SpPPAF2) were cloned and characterized. The full-length SpPPAF1 cDNA was 1677 bp in length, including a 5'-untranslated region (UTR) of 52 bp, an open reading frame (ORF) of 1131 bp coding for a polypeptide of 376 amino acids, and a 3'-UTR of 494 bp. The full-length SpPPAF2 cDNA was 1808 bp in length, including a 5'-UTR of 88 bp, an ORF of 1125 bp coding for a polypeptide of 374 amino acids, and a 3'-UTR of 595 bp. The estimated molecular weight of SpPPAF1 and SpPPAF2 was 38.43 and 38.56 kDa with an isoelectric point of 7.54 and 7.14, respectively. Both SpPPAF1 and SpPPAF2 proteins consisted of a signal peptide, a characteristic structure of clip domain, and a carboxyl-terminal trypsin- Genetics and Molecular Research 14 (3): 8847-8860 (2015) ©FUNPEC-RP www.funpecrp.com.br J. -
Discovery of Oxidative Enzymes for Food Engineering. Tyrosinase and Sulfhydryl Oxi- Dase
Dissertation VTT PUBLICATIONS 763 1,0 0,5 Activity 0,0 2 4 6 8 10 pH Greta Faccio Discovery of oxidative enzymes for food engineering Tyrosinase and sulfhydryl oxidase VTT PUBLICATIONS 763 Discovery of oxidative enzymes for food engineering Tyrosinase and sulfhydryl oxidase Greta Faccio Faculty of Biological and Environmental Sciences Department of Biosciences – Division of Genetics ACADEMIC DISSERTATION University of Helsinki Helsinki, Finland To be presented for public examination with the permission of the Faculty of Biological and Environmental Sciences of the University of Helsinki in Auditorium XII at the University of Helsinki, Main Building, Fabianinkatu 33, on the 31st of May 2011 at 12 o’clock noon. ISBN 978-951-38-7736-1 (soft back ed.) ISSN 1235-0621 (soft back ed.) ISBN 978-951-38-7737-8 (URL: http://www.vtt.fi/publications/index.jsp) ISSN 1455-0849 (URL: http://www.vtt.fi/publications/index.jsp) Copyright © VTT 2011 JULKAISIJA – UTGIVARE – PUBLISHER VTT, Vuorimiehentie 5, PL 1000, 02044 VTT puh. vaihde 020 722 111, faksi 020 722 4374 VTT, Bergsmansvägen 5, PB 1000, 02044 VTT tel. växel 020 722 111, fax 020 722 4374 VTT Technical Research Centre of Finland, Vuorimiehentie 5, P.O. Box 1000, FI-02044 VTT, Finland phone internat. +358 20 722 111, fax + 358 20 722 4374 Edita Prima Oy, Helsinki 2011 2 Greta Faccio. Discovery of oxidative enzymes for food engineering. Tyrosinase and sulfhydryl oxi- dase. Espoo 2011. VTT Publications 763. 101 p. + app. 67 p. Keywords genome mining, heterologous expression, Trichoderma reesei, Aspergillus oryzae, sulfhydryl oxidase, tyrosinase, catechol oxidase, wheat dough, ascorbic acid Abstract Enzymes offer many advantages in industrial processes, such as high specificity, mild treatment conditions and low energy requirements. -
Nelumbo Nucifera)
Transcriptome Proling for Pericarp Browning During Long-term Storage of Intact Lotus Root (Nelumbo Nucifera) Kanjana Worarad ( [email protected] ) Ibaraki University Tomohiro Suzuki Utsunomiya University Haruka Norii Ibaraki University Yuya Muchizuki Ibaraki University Takashi Ishii Ibaraki Agriculture Center Keiko Shinohara Tokushima Horticulture Takao Miyamoto Renkon3kyodai Tsutomu Kuboyama Ibaraki University Eiichi Inoue Ibaraki University Library Mito Main Library: Ibaraki Daigaku Toshokan Honkan Mito Campus Research Article Keywords: Browning disorder, RNA sequencing, Transcriptomics, Postharvest physiology Posted Date: May 25th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-539513/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published at Plant Growth Regulation on August 11th, 2021. See the published version at https://doi.org/10.1007/s10725-021-00736-2. 1 1 Transcriptome profiling for pericarp browning during long-term storage of intact lotus root (Nelumbo 2 nucifera) 3 Kanjana Worarad1, Tomohiro Suzuki2, Haruka Norii1, Yuya Muchizuki1, Takashi Ishii3, Keiko Shinohara4, Takao 4 Miyamoto5, Tsutomu Kuboyama1, Eiichi Inoue1* 5 6 1College of Agriculture, Ibaraki University, Ami, Ibaraki 300-0393, Japan. 7 2Center for Bioscience Research and Education, Utsunomiya University, Utsunomiya, Tochigi 321-8505, 8 Japan. 9 3Ibaraki Agricultural Center, Horticultural Research Institute, Mito, Ibaraki 310-8555, Japan. 10 -
Springer Handbook of Enzymes
Dietmar Schomburg and Ida Schomburg (Eds.) Springer Handbook of Enzymes Volume 25 Class 1 • Oxidoreductases X EC 1.9-1.13 co edited by Antje Chang Second Edition 4y Springer Index of Recommended Enzyme Names EC-No. Recommended Name Page 1.13.11.50 acetylacetone-cleaving enzyme 673 1.10.3.4 o-aminophenol oxidase 149 1.13.12.12 apo-/?-carotenoid-14',13'-dioxygenase 732 1.13.11.34 arachidonate 5-lipoxygenase 591 1.13.11.40 arachidonate 8-lipoxygenase 627 1.13.11.31 arachidonate 12-lipoxygenase 568 1.13.11.33 arachidonate 15-lipoxygenase 585 1.13.12.1 arginine 2-monooxygenase 675 1.13.11.13 ascorbate 2,3-dioxygenase 491 1.10.2.1 L-ascorbate-cytochrome-b5 reductase 79 1.10.3.3 L-ascorbate oxidase 134 1.11.1.11 L-ascorbate peroxidase 257 1.13.99.2 benzoate 1,2-dioxygenase (transferred to EC 1.14.12.10) 740 1.13.11.39 biphenyl-2,3-diol 1,2-dioxygenase 618 1.13.11.22 caffeate 3,4-dioxygenase 531 1.13.11.16 3-carboxyethylcatechol 2,3-dioxygenase 505 1.13.11.21 p-carotene 15,15'-dioxygenase (transferred to EC 1.14.99.36) 530 1.11.1.6 catalase 194 1.13.11.1 catechol 1,2-dioxygenase 382 1.13.11.2 catechol 2,3-dioxygenase 395 1.10.3.1 catechol oxidase 105 1.13.11.36 chloridazon-catechol dioxygenase 607 1.11.1.10 chloride peroxidase 245 1.13.11.49 chlorite O2-lyase 670 1.13.99.4 4-chlorophenylacetate 3,4-dioxygenase (transferred to EC 1.14.12.9) . -
Polyphenol Oxidases in Crops: Biochemical, Physiological and Genetic Aspects
International Journal of Molecular Sciences Review Polyphenol Oxidases in Crops: Biochemical, Physiological and Genetic Aspects Francesca Taranto 1,*, Antonella Pasqualone 2, Giacomo Mangini 2, Pasquale Tripodi 3, Monica Marilena Miazzi 2, Stefano Pavan 2 and Cinzia Montemurro 1,2 1 SINAGRI S.r.l.-Spin off dell’Università degli Studi di Bari “Aldo Moro”, 70126 Bari, Italy; [email protected] 2 Dipartimento di Scienze del Suolo, della Pianta e degli Alimenti, Università degli Studi di Bari “Aldo Moro”, 70126 Bari, Italy; [email protected] (A.P.); [email protected] (G.M.); [email protected] (M.M.M.); [email protected] (S.P.) 3 Consiglio per la ricerca in agricoltura e l’analisi dell’economia agraria, Centro di ricerca per l’orticoltura, 84098 Pontecagnano Faiano, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-80-5443003 Academic Editor: Gopinadhan Paliyath Received: 15 November 2016; Accepted: 4 February 2017; Published: 10 February 2017 Abstract: Enzymatic browning is a colour reaction occurring in plants, including cereals, fruit and horticultural crops, due to oxidation during postharvest processing and storage. This has a negative impact on the colour, flavour, nutritional properties and shelf life of food products. Browning is usually caused by polyphenol oxidases (PPOs), following cell damage caused by senescence, wounding and the attack of pests and pathogens. Several studies indicated that PPOs play a role in plant immunity, and emerging evidence suggested that PPOs might also be involved in other physiological processes. Genomic investigations ultimately led to the isolation of PPO homologs in several crops, which will be possibly characterized at the functional level in the near future. -
Inhibition of Tyrosinase-Induced Enzymatic Browning by Sulfite and Natural Alternatives
Inhibition of tyrosinase-induced enzymatic browning by sulfite and natural alternatives Tomas F.M. Kuijpers Thesis committee Promotor Prof. Dr H. Gruppen Professor of Food Chemistry Wageningen University Co-promotor Dr J-P. Vincken Assistant professor, Laboratory of Food Chemistry Wageningen University Other members Prof. Dr M.A.J.S van Boekel, Wageningen University Dr H.T.W.M. van der Hijden, Unilever R&D, Vlaardingen, The Netherlands Dr C.M.G.C. Renard, INRA, Avignon, France Prof. Dr H. Hilz, Hochschule Bremerhaven, Germany This research was conducted under the auspices of the Graduate School VLAG (Advanced studies in Food Technology, Agrobiotechnology, Nutrition and Health Sciences). Inhibition of tyrosinase-induced enzymatic browning by sulfite and natural alternatives Tomas F.M. Kuijpers Thesis submitted in fulfilment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof. Dr M.J. Kropff, in the presence of the Thesis Committee appointed by the Academic Board to be defended in public on Friday 25 October 2013 at 4 p.m. in the Aula. Tomas F.M. Kuijpers Inhibition of tyrosinase-mediated enzymatic browning by sulfite and natural alternatives 136 pages PhD thesis, Wageningen University, Wageningen, NL (2013) With references, with summaries in English and Dutch ISBN: 978-94-6173-668-0 ABSTRACT Although sulfite is widely used to counteract enzymatic browning, its mechanism has remained largely unknown. We describe a double inhibitory mechanism of sulfite on enzymatic browning, affecting both the enzymatic oxidation of phenols into o-quinones, as well as the non-enzymatic reactions of these o-quinones into brown pigments. -
Plays a Central Role in Insect Immunity a Serine Proteinase Homologue, SPH-3
A Serine Proteinase Homologue, SPH-3, Plays a Central Role in Insect Immunity Gabriella Felföldi, Ioannis Eleftherianos, Richard H. ffrench-Constant and István Venekei This information is current as of September 29, 2021. J Immunol 2011; 186:4828-4834; Prepublished online 11 March 2011; doi: 10.4049/jimmunol.1003246 http://www.jimmunol.org/content/186/8/4828 Downloaded from References This article cites 44 articles, 14 of which you can access for free at: http://www.jimmunol.org/content/186/8/4828.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 29, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2011 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology A Serine Proteinase Homologue, SPH-3, Plays a Central Role in Insect Immunity Gabriella Felfo¨ldi,* Ioannis Eleftherianos,†,1 Richard H. ffrench-Constant,‡ and Istva´n Venekei* Numerous vertebrate and invertebrate genes encode serine proteinase homologues (SPHs) similar to members of the serine pro- teinase family, but lacking one or more residues of the catalytic triad. -
Gene ID Log2 Ratio FDR Annotation
Table S1. Primer sequences used for real-time quantitative PCR Gene ID Primer name Primer sequence (5’-3’) Experimental Use MD04G1003300 CHS-F CTAGTGACACCCACCTTGAYAG RT-PCR CHS-R AGAAGAGYGAGTTCCAGTCYGA MD01G1118100 CHI-F GGTCCGTTTGAGAAATTCATTC RT-PCR CHI-R KGTTTTCTATCACCRYGTTTGC MD15G1353800 F3H-F TCAACCAGTGGAAGGAGCTT RT-PCR F3H-R GTCCTGCAGTTGCTGTTCCT MD15G1024100 DFR-F AGTCCGAATCCGTTTGTGTC RT-PCR DFR-R TTGTGGGCTTGATCACTTCA MD03G1001100 ANS -F CACCTTCATCCTCCACAACAT RT-PCR ANS - R ATGTGCTCAGCAAAAGTTCGT MD15G1215500 MYB114-F GAAGACCTTGTTAGAAGACGACGATATA RT-PCR MYB114-R TATGATCTTGCCGACTGTTGCATAT MD03G1266300 bHLHA-like-F AACTAAGGGCCAAGGTGAAGG RT-PCR bHLHA-like-R CTGCTTATCCTAAATCGTCCTGC MD07G1137500 bHLH33-F ATGTTTTTGCGACGGAGAGAGCA RT-PCR bHLH33-R TAGGCGAGTGAACACCATACATTAAAGG MD09G1193500 MSI4-1F CCAGGCGTGATGTCTCCTTT RT-PCR MSI4-1R GCTGTCTTAGCGGACTGGTT JX162681 MYB10-F ACGCCACCACAAACGTCGTCG RT-PCR MYB10-R GGCGCATGATCTTGGCGACAGT DQ341382 18SR-F GAGCCTGAGAAACGGCTACC RT-PCR 18SR-R GTCACTACCTCCCCGTGTCA Table S2. Transcription factors identified among the differentially regulated genes log2 Ratio Gene ID FDR Annotation (RIT/UIT) MD00G1000500 2.12 0.032445 MYB family transcription factor PHL11 [Pyrus x bretschneideri] MD01G1054800 1.26 0.013987 MYB-related protein MYB4-like [Malus domestica] MD01G1084400 4.51 2.98E-06 MYB-related protein 308-like [Malus domestica] MD01G1144700 1.64 0.001018 transcription factor MYB86-like [Malus domestica] MD01G1155100 2.98 0.006279 transcriptional activator MYB-like [Malus domestica] MD02G1076300 -1.87 1.01E-05