DOCSLIB.ORG

Discovering Novel Mechanisms of Human Cortical Development & Disease Using in Vivo Mouse Model and in Vitro Human-Derived Cerebral Organoids

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Discovering Novel Mechanisms of Human Cortical Development & Disease Using in Vivo Mouse Model and in Vitro Human-Derived Cerebral Organoids DISCOVERING NOVEL MECHANISMS OF HUMAN CORTICAL DEVELOPMENT & DISEASE USING IN VIVO MOUSE MODEL AND IN VITRO HUMAN-DERIVED CEREBRAL ORGANOIDS Isabel Yasmin Buchsbaum Dissertation at the Graduate School of Systemic Neurosciences Ludwig‐Maximilians‐Universität München April 2019 Supervisor and first Reviewer: Dr. Silvia Cappello Developmental Neurobiology Max Planck Institute of Psychiatry Second Reviewer: Prof. Dr. Elisabeth Binder External Reviewer: Dr. Felipe Ortega de la O Date of Submission: 10th April 2019 Date of Defense: 22nd July 2019 ABSTRACT ABSTRACT This thesis combines three research studies with the common interest of identifying novel mechanisms underlying human cortical development. This aim is pursued from different angles, always basing the investigations on human induced pluripotent stem cell-derived 2D and 3D in vitro model systems that are partly combined with in vivo studies in the developing mouse cortex. Namely, in the pieces of work combined here, we 1) bring to light a neurodevelopmental role of a gene already implicated in adult nervous system function, 2) discover a novel mechanism that fine-tunes human neurogenesis, and 3) identify a novel gene whose mutations lead to a malformation of cortical development. The entirety of this work thus adds several aspects to the existing knowledge. In the first study, we identified a neurodevelopmental function of a gene mutated in patients with the progressive gait disorder hereditary spastic paraplegia (HSP). In this group of inherited neurodegenerative diseases, mutations in lipid, mitochondrial, cytoskeletal or transport proteins lead to degeneration of primary motor neurons, which, due to the length of their axons, are particularly sensitive to disruption of these processes. Here, were generated cerebral organoids (COs) derived from HSP patients with mutations in SPG11 coding for spatacsin. Previous work had shown impaired proliferation of SPG11 patient-derived neural progenitor cells (NPCs). We found a proliferation defect also in CO NPCs, leading to a thinner progenitor zone and premature neurogenesis due to increased asymmetric progenitor divisions, along with smaller size of patient-derived COs. Molecularly, we found a decrease in deactivated GSK3β and increase in P-βcatenin at the basis of the observed proliferation/neurogenesis imbalance. We thus confirmed the neurodevelopmental role of SPG11 that had previously been suggested from 2D human in vitro findings. Both the observed reduction in proliferating progenitors and in organoid size were rescued through inhibition of GSK3β, with the Food and Drug Administration (FDA) approved compound tideglusib only affecting patient COs. These rescue experiments thus stressed the opportunity that COs represent for drug testing and translation of findings to precision medicine. In the second study, we investigated the role of a novel posttranslational modification (PTM) termed AMPylation in neurogenesis. Using a novel probe for the detection of AMPylated proteins and a combination of mass spectrometry-based proteomics, immunohistochemistry, and acute interference with the expression of the AMPylating enzyme, we made several interesting findings: AMPylation takes place on a cell type- specific set of proteins, is responsive to the predominant environmental condition, and both AMPylator and targets localize to cell type-specific intracellular localizations. During the process of neuronal differentiation, the set of AMPylated proteins is completely remodeled, with a very high number of unique targets in neurons. These include metabolic enzymes as in all analyzed cell types and, additionally and specifically, cytoskeletal and motor proteins. Cytoskeletal and motor proteins in neural progenitors and neurons are known to be differentially modified by several PTMs whose correct establishment is highly important during neurodevelopment; AMPylation may thus be an additional one. To assess the role of AMPylation in neurodevelopment, we manipulated the expression of the AMPylating enzyme FICD in COs. Downregulation kept cells in a proliferating progenitor state, whereas overexpression increased neurogenesis. We thus suggest AMPylation as a novel PTM fine-tuning neurogenesis. i ABSTRACT The third study focused on the identification of new mechanisms underlying cortical malformations, aiming at a better understanding of how the human brain develops. In patients with periventricular heterotopia (PH), a neuronal migration disorder in which a subset of neurons fail to migrate to the developing cortical plate and instead form nodules of grey matter lining the lateral ventricles as their site of production, biallelic mutations in endothelin converting enzyme 2 (ECE2) were identified as candidate causative. Combining in vitro and in vivo models, we found a role for ECE2 in neuronal migration and cortical development. In the absence of ECE2, several processes of general importance to proper neuronal migration were disrupted. Namely, changes in progenitor cell polarity and morphology and in apical adherens junctions led to their delamination, restricting their use as a scaffold for neuronal migration. This resulted in ectopic neurons reminiscent of nodules in PH. Besides a deregulation of cytoskeletal, polarity, and apical adhesion proteins, extracellular matrix (ECM) proteins were reduced in absence of ECE2, suggesting its role in ECM production and underlining the necessity of ECM components for proper neuronal migration during cortical development. Moreover, we detected differential phosphorylation of several cytoskeletal, motor and adhesion proteins in the absence of ECE2, which is functionally in line with the former findings and suggests an additional involvement of ECE2 in the regulation of PTMs. Altogether, the studies presented here underline the heterogeneity and complexity of pathways and mechanisms that contribute to human cortical development and its disorders, converging on the regulation of cytoskeleton and transport within the involved cells and of the ECM on their outside. ii ACKNOWLEDGEMENTS ACKNOWLEDGEMENTS Before starting this PhD, I never considered alternative routes and not do a PhD. Not for the sake of the title: I took it for the natural way to go if you want to do science, which is what I have wanted since my childhood. But then, facing the reality of failures and ups and downs of the PhD life, I more than once thought about quitting it. It was thanks to many people that I overcame these hurdles and now hopefully finish this big chapter of my life with success. I would like to express my heartfelt gratitude… to Silvia, for being the most enthusiastic and positive supervisor I could have imagined, for supporting my New Zealand experience and attendance of numerous conferences, for enabling me to work on several different projects and sharing my fascination of diversity, for your scientific advice and encouragement, and for believing in me and my work. Thank you for your always open door and ear and for readily sharing your own experiences – also outside the sciences. to Stephen and Adam, for guiding me into the PhD and enriching me with an invaluable experience on the other side of the world. to my TAC members Elisabeth, Magdalena and Jürgen, for supporting and steering my work with fruitful discussions and to Felipe for reviewing this thesis – thanks for your time and support. to the GSN and the GSN team, for selecting me for the Fast-track PhD program, for their friendly support both with advice and financially, which enabled me to make my New Zealand experience and to visit international conferences, and for this scientific and cultural inspiration and supportive network that the GSN represents. to my collaborators in all projects, especially to Pavel and Stephan, for the great teamwork and constructive discussions and for broadening my angle of view. to Magdalena and her group at the Helmholtz, for housing us while our lab at the MPI was being renovated. to Ane, for many hours and meters of height with precious talking, a huge backpack and a camera in our Alps and the Taiwanese mountains, and for proofreading my discussion. ¡Muchas gracias mi amiga! to Johannes, for being great company in the beginning of my PhD, for teaching me the in vitro methods and for proofreading my discussion – danke; to Grazia, for your support in the hardest phase of the ECE2 project – mille grazie; to Christina, for sharing your in vivo expertise and always knowing advice – ευχαριστώ; to Timo and Barbara for your technical support. And thanks to all yet unmentioned members of the C-lab, the A-, Z- and Binder-labs, and Marisa and her group for sharing and enriching this section of my life. to Antonietta – without your coffee and smile, life at the MPI would not have been the same! to Sara, for introducing me to Lindy Hop, which became a great source of positive energy for me; to my roomies Ines, Patrick, and Grandma Hilde, and to my Munich iii ACKNOWLEDGEMENTS family of friends, for believing in me and being there for me with uplifting chats, good coffees and food, handicraft sessions, game nights, and innumerable hugs. to Babaganouch, for teaching me not to let the failures close to me and that “time will graduate everyone”. to my parents and my sisters, for your steadfast support and love over this far too far distance, for enduring my fluctuations and complaints, and for believing in me and my dreams not only during these last years but throughout my whole life. an Andrej, mein Lieblingsmensch. Danke, dass Du an meiner
Load more

Recommended publications
  • 1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia
    1 Evidence for gliadin antibodies as causative agents in schizophrenia. C.J.Carter PolygenicPathways, 20 Upper Maze Hill, Saint-Leonard’s on Sea, East Sussex, TN37 0LG [email protected] Tel: 0044 (0)1424 422201 I have no fax Abstract Antibodies to gliadin, a component of gluten, have frequently been reported in schizophrenia patients, and in some cases remission has been noted following the instigation of a gluten free diet. Gliadin is a highly immunogenic protein, and B cell epitopes along its entire immunogenic length are homologous to the products of numerous proteins relevant to schizophrenia (p = 0.012 to 3e-25). These include members of the DISC1 interactome, of glutamate, dopamine and neuregulin signalling networks, and of pathways involved in plasticity, dendritic growth or myelination. Antibodies to gliadin are likely to cross react with these key proteins, as has already been observed with synapsin 1 and calreticulin. Gliadin may thus be a causative agent in schizophrenia, under certain genetic and immunological conditions, producing its effects via antibody mediated knockdown of multiple proteins relevant to the disease process. Because of such homology, an autoimmune response may be sustained by the human antigens that resemble gliadin itself, a scenario supported by many reports of immune activation both in the brain and in lymphocytes in schizophrenia. Gluten free diets and removal of such antibodies may be of therapeutic benefit in certain cases of schizophrenia. 2 Introduction A number of studies from China, Norway, and the USA have reported the presence of gliadin antibodies in schizophrenia 1-5. Gliadin is a component of gluten, intolerance to which is implicated in coeliac disease 6.
    [Show full text]
  • Regulation of Cdc42 and Its Effectors in Epithelial Morphogenesis Franck Pichaud1,2,*, Rhian F
    © 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs217869. doi:10.1242/jcs.217869 REVIEW SUBJECT COLLECTION: ADHESION Regulation of Cdc42 and its effectors in epithelial morphogenesis Franck Pichaud1,2,*, Rhian F. Walther1 and Francisca Nunes de Almeida1 ABSTRACT An overview of Cdc42 Cdc42 – a member of the small Rho GTPase family – regulates cell Cdc42 was discovered in yeast and belongs to a large family of small – polarity across organisms from yeast to humans. It is an essential (20 30 kDa) GTP-binding proteins (Adams et al., 1990; Johnson regulator of polarized morphogenesis in epithelial cells, through and Pringle, 1990). It is part of the Ras-homologous Rho subfamily coordination of apical membrane morphogenesis, lumen formation and of GTPases, of which there are 20 members in humans, including junction maturation. In parallel, work in yeast and Caenorhabditis elegans the RhoA and Rac GTPases, (Hall, 2012). Rho, Rac and Cdc42 has provided important clues as to how this molecular switch can homologues are found in all eukaryotes, except for plants, which do generate and regulate polarity through localized activation or inhibition, not have a clear homologue for Cdc42. Together, the function of and cytoskeleton regulation. Recent studies have revealed how Rho GTPases influences most, if not all, cellular processes. important and complex these regulations can be during epithelial In the early 1990s, seminal work from Alan Hall and his morphogenesis. This complexity is mirrored by the fact that Cdc42 can collaborators identified Rho, Rac and Cdc42 as main regulators of exert its function through many effector proteins.
    [Show full text]
  • Differences Between Human and Chimpanzee Genomes and Their Implications in Gene Expression, Protein Functions and Biochemical Properties of the Two Species Maria V
    Suntsova and Buzdin BMC Genomics 2020, 21(Suppl 7):535 https://doi.org/10.1186/s12864-020-06962-8 REVIEW Open Access Differences between human and chimpanzee genomes and their implications in gene expression, protein functions and biochemical properties of the two species Maria V. Suntsova1 and Anton A. Buzdin1,2,3,4* From 11th International Young Scientists School “Systems Biology and Bioinformatics”–SBB-2019 Novosibirsk, Russia. 24-28 June 2019 Abstract Chimpanzees are the closest living relatives of humans. The divergence between human and chimpanzee ancestors dates to approximately 6,5–7,5 million years ago. Genetic features distinguishing us from chimpanzees and making us humans are still of a great interest. After divergence of their ancestor lineages, human and chimpanzee genomes underwent multiple changes including single nucleotide substitutions, deletions and duplications of DNA fragments of different size, insertion of transposable elements and chromosomal rearrangements. Human-specific single nucleotide alterations constituted 1.23% of human DNA, whereas more extended deletions and insertions cover ~ 3% of our genome. Moreover, much higher proportion is made by differential chromosomal inversions and translocations comprising several megabase-long regions or even whole chromosomes. However, despite of extensive knowledge of structural genomic changes accompanying human evolution we still cannot identify with certainty the causative genes of human identity. Most structural gene-influential changes happened at the level of expression regulation, which in turn provoked larger alterations of interactome gene regulation networks. In this review, we summarized the available information about genetic differences between humans and chimpanzees and their potential functional impacts on differential molecular, anatomical, physiological and cognitive peculiarities of these species.
    [Show full text]
  • Regulation of Cardiovascular Homeostasis by Autophagy
    Georgia State University ScholarWorks @ Georgia State University Chemistry Dissertations Department of Chemistry 12-16-2020 Regulation Of Cardiovascular Homeostasis By Autophagy Jing Mu Georgia State University Follow this and additional works at: https://scholarworks.gsu.edu/chemistry_diss Recommended Citation Mu, Jing, "Regulation Of Cardiovascular Homeostasis By Autophagy." Dissertation, Georgia State University, 2020. https://scholarworks.gsu.edu/chemistry_diss/190 This Dissertation is brought to you for free and open access by the Department of Chemistry at ScholarWorks @ Georgia State University. It has been accepted for inclusion in Chemistry Dissertations by an authorized administrator of ScholarWorks @ Georgia State University. For more information, please contact [email protected]. REGULATION OF CARDIOVASCULAR HOMEOSTASIS BY AUTOPHAGY by JING MU Under the Direction of Ming-hui Zou, MD/PhD ABSTRACT Macroautophagy (hereafter autophagy) is a fundamental cellular process that removes unnecessary or dysfunctional components. It allows the orderly degradation and recycling of cellular components. Mitophagy refers to the selective removal of damaged mitochondria via autophagy pathway. In addition to utilizing core autophagic machinery components, mitophagy exploits a variety of molecules, such as PTEN-induced putative kinase protein 1 (PINK1) and Parkin, to identify and eliminate damaged or superfluous mitochondria. Dysregulation of autophagy and mitophagy contributes to a variety of human disorders, including cardiovascular diseases, such as atherosclerosis and diabetic cardiomyopathy. Vascular smooth muscle cells (VSMCs) are a major component of the vascular media, and are vital for maintaining vessel homeostasis. Migration of VSMCs from the media to intima occurs during the development of atherosclerosis. Although alterations in autophagy activity have been reported in atherosclerosis, further investigation is required to delineate the mechanism by which autophagy regulates microtubule stability and cell migration.
    [Show full text]
  • Nucleocytoplasmic Shuttling of Soluble Tubulin in Mammalian Cells
    Research Article 1111 Nucleocytoplasmic shuttling of soluble tubulin in mammalian cells Tonia Akoumianaki1, Dimitris Kardassis1,2, Hara Polioudaki1, Spyros D. Georgatos3,4 and Panayiotis A. Theodoropoulos1,* 1Department of Biochemistry, University of Crete, School of Medicine, 71 003 Heraklion, Greece 2Institute of Molecular Biology and Biotechnology, Foundation for Research and Technology-Hellas, 71 110 Heraklion, Greece 3Stem Cell and Chromatin Group, The Laboratory of Biology, University of Ioannina School of Medicine, 45 110 Ioannina, Greece 4The Biomedical Institute of Ioannina, IBE/ITE, 45 110 Ioannina, Greece *Author for correspondence (e-mail: [email protected]) Accepted 17 December 2008 Journal of Cell Science 122, 1111-1118 Published by The Company of Biologists 2009 doi:10.1242/jcs.043034 Summary We have investigated the subcellular distribution and dynamics to recombinant, normally modified and hyper- of soluble tubulin in unperturbed and transfected HeLa cells. phosphorylated/acetylated histone H3. Tubulin-bound H3 no Under normal culture conditions, endogenous α/β tubulin is longer interacts with heterochromatin protein 1 and lamin B confined to the cytoplasm. However, when the soluble pool of receptor, which are known to form a ternary complex under in subunits is elevated by combined cold-nocodazole treatment and vitro conditions. Based on these observations, we suggest that when constitutive nuclear export is inhibited by leptomycin B, nuclear accumulation of soluble tubulin is part of an intrinsic tubulin accumulates in the cell nucleus. Transfection assays and defense mechanism, which tends to limit cell proliferation FRAP experiments reveal that GFP-tagged β-tubulin shuttles under pathological conditions. This readily explains why nuclear between the cytoplasm and the cell nucleus.
    [Show full text]
  • Dissertation Kokes M
    Mechanisms of Chlamydia Manipulation of Host Cell Biology Revealed Through Genetic Approaches by Marcela Kokes Department of Molecular Genetics and Microbiology Program in Cell and Molecular Biology Duke University Date:_______________________ Approved: ___________________________ Raphael H. Valdivia, Supervisor ___________________________ Daniel J. Lew ___________________________ Jörn Coers ___________________________ Patrick C. Seed Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Molecular Genetics and Microbiology in the Graduate School of Duke University 2015 i v ABSTRACT Mechanisms of Chlamydia Manipulation of Host Cell Biology Revealed Through Genetic Approaches by Marcela Kokes Department of Molecular Genetics and Microbiology Program in Cell and Molecular Biology Duke University Date:_______________________ Approved: ___________________________ Raphael H. Valdivia, Supervisor ___________________________ Daniel J. Lew ___________________________ Jörn Coers ___________________________ Patrick C. Seed An abstract of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Molecular Genetics and Microbiology in the Graduate School of Duke University 2015 Copyright by Marcela Kokes 2015 i v Abstract Chlamydia trachomatis is the most common sexually transmitted bacterial pathogen and is the leading cause of preventable blindness worldwide. Chlamydia is particularly intriguing from the perspective of cell biology because it is an obligate intracellular pathogen that manipulates host cellular pathways to ensure its proliferation and survival. This is achieved through a significant remodeling of the host cell’s internal architecture from within a membrane-bound vacuole, termed the inclusion. However, given a previous lack of tools to perform genetic analysis, the mechanisms by which Chlamydia induces host cellular changes remained unclear.
    [Show full text]
  • Differentially Expressed on Collagen Networks 1, 2, 10 © 2000-2009 Ingenuity Systems, Inc. All Rights Reserved. Symbol Entrez
    Differentially expressed on collagen Networks 1, 2, 10 © 2000-2009 Ingenuity Systems, Inc. All rights reserved. Symbol Entrez Gene Name Affymetrix Fold Change Location Family ALDH1A3 aldehyde dehydrogenase 1 family, member A3 203180_at -5.43125168 Cytoplasm enzyme 209772_s_ Plasma CD24 CD24 molecule at -4.32890229 Membrane other HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 204130_at -4.1099197 Cytoplasm enzyme Plasma AMOTL2 angiomotin like 2 203002_at -2.82872773 Membrane other transcription DLX2 distal-less homeobox 2 207147_at -2.74996362 Nucleus regulator 221215_s_ RIPK4 receptor-interacting serine-threonine kinase 4 at -2.56556472 Nucleus kinase PLK2 polo-like kinase 2 (Drosophila) 201939_at -2.47054478 Nucleus kinase ALDH3A1 aldehyde dehydrogenase 3 family, memberA1 205623_at -2.30532989 Cytoplasm enzyme TXNRD1 thioredoxin reductase 1 201266_at -2.27936909 Cytoplasm enzyme Extracellular CYR61 cysteine-rich, angiogenic inducer, 61 201289_at -2.09052668 Space other 214212_x_ FERMT2 fermitin family homolog 2 (Drosophila) at -1.87478183 Cytoplasm other Plasma RIT1 Ras-like without CAAX 1 209882_at -1.77586775 Membrane enzyme 210297_s_ Extracellular MSMB microseminoprotein, beta- at -1.72177723 Space other Extracellular PI3 peptidase inhibitor 3, skin-derived 203691_at -1.68135697 Space other ALDH3B1 aldehyde dehydrogenase 3 family, member B1 205640_at -1.67376791 Cytoplasm enzyme 202124_s_ Plasma TRAK2 trafficking protein, kinesin binding 2 at -1.6367793 Membrane transporter BMP and activin membrane-bound inhibitor Plasma BAMBI
    [Show full text]
  • The Borg Family of Cdc42 Effector Proteins Cdc42ep1–5
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Institute of Cancer Research Repository Biochemical Society Transactions (2016) 0 1–8 DOI: 10.1042/BST20160219 1 2 The Borg family of Cdc42 effector proteins 3 4 Cdc42EP1–5 5 6 Aaron J. Farrugia and Fernando Calvo 7 8 Tumour Microenvironment Team, Division of Cancer Biology, Institute of Cancer Research, 237 Fulham Road, London SW2 6JB, U.K. 9 Correspondence: Fernando Calvo ([email protected]) 10 11 12 13 Despite being discovered more than 15 years ago, the Borg (binder of Rho GTPases) 14 – family of Cdc42 effector proteins (Cdc42EP1 5) remains largely uncharacterised and rela- 15 tively little is known about their structure, regulation and role in development and disease. 16 Recent studies are starting to unravel some of the key functional and mechanistic 17 aspects of the Borg proteins, including their role in cytoskeletal remodelling and signal- 18 ling. In addition, the participation of Borg proteins in important cellular processes such as 19 cell shape, directed migration and differentiation is slowly emerging, directly linking Borgs 20 with important physiological and pathological processes such as angiogenesis, neuro- 21 fi transmission and cancer-associated desmoplasia. Here, we review some of these nd- 22 ings and discuss future prospects. 23 24 25 26 27 28 29 Introduction 30 The Rho GTPase family member Cdc42 regulates a diverse range of cellular functions including cyto- 31 kinesis, cytoskeletal remodelling and cell polarity [1,2]. Like other Rho family members, Cdc42 cycles 32 between two tightly regulated conformational states, a GTP-bound active state and a GDP-bound 33 inactive state [3].
    [Show full text]
  • Chromatography Including Electrophoresis and Other Separation Methods
    15SIO 06£ i 36 j 6 VOL. 610 NO.2 JUNE 12, 1992 THIS ISSUE COMPLETES VOL. 610 Bibliography Section JOURNAL OF CHROMATOGRAPHY INCLUDING ELECTROPHORESIS AND OTHER SEPARATION METHODS EDITORS U. A. Th. Brinkman (Amsterdam) R. W. Giese (Boston, MA) J. K. Haken (Kensington, N.S.W.) K. Macek (Prague) L. R. Snyder (Orinda, CA) EDITORS. SYMPOSIUM VOLUMES. E. Heftmann (Orinda. CAl. Z. Deyl (Prague) EDITORIAL BOARD D. W. Armstrong (Rollo. MO) W. A. Aue (Holifo,) P. Botek (8.00) A. A. Boulton (Saskatoon) P. W. Cmr (Minneopolis. MN) N. H. C. Cooke (San Ramon. CAl V. A. Davankov (Moscow) Z. Deyl (Progue) S. Dilli (Kl~nsington. N.S.W.) F. Ern! (Basle) M. B. Evans (Hatfield) J. L. Glojcl, (N. Billerico. MA) G. A. Guiochon (Knoxville, TN) P. R. Haddod (Kensington. N.S.W.) I. M. Hais (Hradec Kralove) W. S. Hancock (San FranCISCo. CAl S. Hjerten (Uppsalo) Cs. Horvinh (New Haven. CT) J. F. K. Huber (Vienna) K.·P. Hupe (Woldbronn) T. W. Hutchens (Houston. IX) J. Jonak (B.oo) P. Jandera (Pardubice) B. L. Kmger (B05<on. MA) J. J. Kirkland (Wilmington. DE) E. sz. Kovats (Lausanne) A. J. P. Mortin (Cambridge) L. W. McLoughlin (Chestnut Hill. MA) E. D. Morgan (Keele) J. O. Pearson (KrJlamazoo, MI) H. Poppe (Amsterdam) F. E. Regnier (West Lafayette. IN) P. G. Righetti (Milan) P. Sclloenmakers (Eindhoven) R. Schwarzenbach (Dubendor!) R. E. Shoup (West Lafayette. IN) A. M. Siouf!i (Mo,seille) D. J. Strydom (Boston. MA) N. Tonaka (Kyoto) S. Terabe (Hyogo) K. K. Unger (Mainz) R. Verpoorle (Leiden) Gy.
    [Show full text]
  • Molecular Evolutionary Routes That Lead to Innovations
    International Journal of Evolutionary Biology Molecular Evolutionary Routes That Lead to Innovations Guest Editors: Frédéric Brunet, Hideki Innan, Ben-Yang Liao, and Wen Wang Molecular Evolutionary Routes That Lead to Innovations International Journal of Evolutionary Biology Molecular Evolutionary Routes That Lead to Innovations Guest Editors: Fred´ eric´ Brunet, Hideki Innan, Ben-YangLiao, and Wen Wang Copyright © 2012 Hindawi Publishing Corporation. All rights reserved. This is a special issue published in “International Journal of Evolutionary Biology.” All articles are open access articles distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Editorial Board Giacomo Bernardi, USA Kazuho Ikeo, Japan Jeffrey R. Powell, USA Terr y Burke, UK Yoh Iwasa, Japan Hudson Kern Reeve, USA Ignacio Doadrio, Spain Henrik J. Jensen, UK Y. Satta, Japan Simon Easteal, Australia Amitabh Joshi, India Koji Tamura, Japan Santiago F. Elena, Spain Hirohisa Kishino, Japan Yoshio Tateno, Japan Renato Fani, Italy A. Moya, Spain E. N. Trifonov, Israel Dmitry A. Filatov, UK G. Pesole, Italy Eske Willerslev, Denmark F. Gonzalez-Candelas,´ Spain I. Popescu, USA Shozo Yokoyama, Japan D. Graur, USA David Posada, Spain Contents Molecular Evolutionary Routes That Lead to Innovations,Fred´ eric´ Brunet, Hideki Innan, Ben-Yang Liao, and Wen Wang Volume 2012, Article ID 483176, 2 pages Purifying Selection Bias against Microsatellites in Gene
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name microtubule-associated protein 6 Gene Symbol MAP6 Organism Human Gene Summary This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. Gene Aliases FLJ41346, KIAA1878, MTAP6, N-STOP, STOP RefSeq Accession No. NC_000011.9, NT_167190.1 UniGene ID Hs.585540 Ensembl Gene ID ENSG00000171533 Entrez Gene ID 4135 Assay Information Unique Assay ID qHsaCID0006783 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000304771, ENST00000526740, ENST00000434603, ENST00000545476 Amplicon Context Sequence GGCCTGACACCGCCTGCTTGTCTTTGGCCTTCCTCGTGGGCTTATGGCTCGCTG AGGTCTTTTTTGGTTTGGAACTCTGAACACTAGGTTTTTCCACCTTTGGGGGTTC CTTGAAGGGTTCGCTGTAGAGGCTGCGTATTCTTCTGCGATCAATGACCTTATTG TCAGCTGTTGTTGGCT Amplicon Length (bp) 150 Chromosome Location 11:75316953-75319236 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 99 R2 0.9995 cDNA Cq 26 cDNA Tm (Celsius) 85 gDNA Cq 31.54 Page 1/5 PrimePCR™Assay Validation Report Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report MAP6, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 3/5 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Human Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online.
    [Show full text]