Development of a Full-Length Infectious Clone of Grapevine Rupestris Stem Pitting-Associated Virus Strain Syrah and GFP-Tagged and VIGS Vectors for Vitis Vinifera

Development of a Full-Length Infectious Clone of Grapevine rupestris stem pitting-associated virus strain Syrah and GFP-Tagged and VIGS Vectors for Vitis vinifera.

by Olivia M. A. Roscow

A thesis presented to The University of Guelph

In partial fulﬁlment of requirements for the degree of Master of Science in Molecular and Cellular Biology

Guelph, Ontario, Canada c Olivia M. A. Roscow, December, 2019 ABSTRACT Development of a Full-Length Infectious Clone of Grapevine rupestris stem pitting-associated virus strain Syrah and Production of GFP-Tagged and VIGS Vectors for Vitis vinifera.

Olivia Marion Alice Roscow Advisor: University of Guelph, 2019 Dr. Baozhong Meng Advisory Committee: Dr. Annette Nassuth Dr. Ian Tetlow

Grapevines are an important Canadian crop, yet quality, health, and yield are threatened by viral infections and coinfections with multiple viruses complicate disease associations. Grapevine rupestris stem pitting-associated virus (GRSPaV) is a single-stranded, positive-sense RNA virus that is widely distributed worldwide and is associated with Rupestris Stem Pitting, Syrah Decline, and Grapevine Vein Necrosis. Speciﬁcally the SY strain is associated with unhealthy vines, possibly being more pathogenic. An infectious clone can help clarify disease associations and viral biology by reproducing singular infections in virus-free plants. MGT, a clone related to SY, was constructed and a GFP-tagged version produced GFP faster and to a greater degree than the asymptomatic GG strain in Nicotiana benthamiana, as determined by Western blotting and epiﬂuorescence microscopy. A Virus-Induced Gene Silencing (VIGS) clone was also constructed for future study of grapevine genomics. These N. benthamiana experiments provide a foundation for continued work with this clone with grapevines. ACKNOWLEDGEMENTS

Thanks to Dr. Baozhong Meng for instilling in me a passion for research and for challenging me to overcome seemingly insurmountable obstacles. He has not only nurtured my interest in all things molecular and inspired me to further pursue research, but also taught me great life lessons on how to be stoic and that no challenge is unconquerable.

Thanks to Sunny Li for being a great friend and colleague. She provided me with new ideas in times of need and was a great companion in the lab. I hope to always remain in contact.

Thanks to everyone who has passed through and is currently working in the Meng lab. Special thanks to Clayton Moore for helping me adjust to Ontario, Huogen Xiao for helping me adjust to the lab, and Mehdi Shabanian for his patience and guidance.

Thanks to my advisory committee, Annette Nassuth and Ian Tetlow, for their enthusi- asm and suggestions. They both were tremendously helpful and indispensable in my studies.

Thanks to Rosemarie Ganassin, Mark Polinski, Kyler Garver, and Caroline Josefsson for putting me on the right track. Without their help, I would not have progressed this far.

Thanks to my immediate family (Greg, Alison, Frazer, and Edward), my partner War- wick, and my close friends for supporting me through the highs and lows of research. No path is linear and they accompanied me through the winding turns.

Last, but not least, thanks to NSERC, for their funding and ﬁnancial support, without which I could not have pursued my passion. Special thanks to the University of Guelph for awarding me the Graduate Excellence Entrance Scholarship and to the Province of Ontario for awarding me the Queen Elizabeth II Graduate Scholarship in Science & Technology.

iii TABLE OF CONTENTS

ABSTRACT ...... ii TABLE OF CONTENTS ...... vii LIST OF TABLES ...... viii LIST OF FIGURES ...... x LIST OF ABBREVIATIONS ...... xi 1 INTRODUCTION ...... 1 1.1 Grapevines ...... 1 1.1.1 History ...... 1 1.1.2 Viruses ...... 2 1.1.3 Defence & Immunity Against Viruses ...... 3 1.2 Grapevine rupestris stem pitting-associated virus ...... 4 1.2.1 Distribution & Transmission ...... 5 1.2.2 Taxonomy & Phylogeny ...... 5 1.2.3 Genome ...... 6 1.2.4 Replication & Life Cycle ...... 10 1.2.5 Disease Associations ...... 12 1.3 Viral Vectors ...... 13 1.3.1 Wildtype Clones ...... 15 1.3.2 Protein Expression Vectors ...... 16 1.3.3 Virus-Induced Gene Silencing (VIGS) Vectors ...... 17 1.3.4 GRSPaV-GG Clone ...... 18 1.4 Justiﬁcation & Goals ...... 19 1.5 Hypotheses ...... 20 1.6 Objectives ...... 20 2 MATERIALS & METHODS ...... 20 2.1 Full Length Clone ...... 20

iv 2.1.1 Previous Work ...... 22 2.1.2 Viral Source & Cloning Genome Fragments ...... 22 2.1.3 Subcloning Fragments D and A into the Intermediate Vector . 23 2.1.4 Subcloning the Terminator into the Intermediate Vector . . . 24 2.1.5 Removing Restriction Sites ...... 24 2.1.6 Subcloning Fragments B1, B2 & C into the Intermediate Vector 24 2.2 Wildtype Clone ...... 26 2.3 VIGS Clone ...... 27 2.3.1 Inserting Restriction Sites into Fragment D ...... 27 2.3.2 PDS Cloning ...... 29 2.3.3 Subcloning PDS into Fragment D ...... 29 2.3.4 Cloning SGP into Fragment D ...... 29 2.3.5 Reinserting Missing Viral Sequence ...... 30 2.3.6 Subcloning recombinant PDS Fragment into Full Length Clone and Binary Vector ...... 30 2.3.7 Subcloning PDS into GRSPaV-GG ...... 30 2.4 GFP Expression Vector ...... 31 2.4.1 GFP Cloning ...... 31 2.4.2 Reinserting Missing Viral Sequence ...... 31 2.4.3 Subcloning recombinant GFP Fragment into Full Length Clone and Binary Vector ...... 32 2.4.4 Subcloning GFP into GRSPaV-GG ...... 32 2.5 Infectivity Assays in N. benthamiana ...... 32 2.6 Infectivity Assays in V. vinifera ...... 32 2.7 Analyses ...... 33 2.7.1 Genome Sequencing ...... 33 2.7.2 Symptom observation ...... 33 2.7.3 Western Blotting ...... 33 2.7.4 Fluorescence Microscopy ...... 35

v 2.7.5 Bioinformatic & Statistical Analyses ...... 35 3 RESULTS ...... 36 3.1 Construction of wildtype and GFP-tagged full-length clones for GRSPaV isolate VD-102 ...... 36 3.2 Infectivity of wildtype and GFP-tagged MGT clones in N. benthamiana ...... 38 3.3 RNA & Protein Structure Predictions ...... 39

3.4 Effectiveness of pRSPMGT-PDSf and pRSPGG-PDSf as VIGS vectors in N. benthamiana ...... 40 4 DISCUSSION ...... 55 5 CONCLUSION ...... 60 REFERENCES ...... 61 A APPENDIX ...... 78 A.1 Standard Procedures and Procedures ...... 78 A.1.1 Agarose Gel Puriﬁcation of DNA ...... 78 A.1.2 Agrobacterium Transformation ...... 78 A.1.3 Agroinﬁltration of N. benthamiana and V. vinifera ...... 78 A.1.4 Broth Culture and Plasmid Miniprep ...... 79 A.1.5 Competent A. tumefaciens Preparation ...... 79 A.1.6 Competent E. coli Preparation ...... 79 A.1.7 Dephosphorylation ...... 80 A.1.8 Digestion ...... 80 A.1.9 E. coli Transformation ...... 80 A.1.10 KOD Polymerase Chain Reaction (PCR) ...... 81 A.1.11 Ligation ...... 81 A.1.12 Overlap-Extension PCR (OE-PCR) ...... 81 A.1.13 PaCeR PCR ...... 82 A.1.14 RNA Extraction ...... 82 A.1.15 Reverse Transcription (RT) ...... 82

vi A.1.16 Site-Directed Mutagenesis (SDM) ...... 82 A.1.17 TA cloning ...... 83 A.1.18 Taq PCR/Colony PCR ...... 83 A.2 MGT Consensus Sequence ...... 83 A.3 Supplementary Figures and Tables ...... 84

vii LIST OF TABLES

1: Percent nucleotide identity between TA cloned fragments and the GRSPaV-SY and VD-102 genomes. 37 A1: Percent similarity (bottom left) and hamming distance (top right) for genomes/proteins of prominent GRSPaV strains. 90 A2: Primers used for cloning and diagnostic assays. 93

viii LIST OF FIGURES

1: Representative diagram of the GRSPaV genome. 6 2: Syrah Decline (SD) symptoms. 13 3: Rugose Wood Complex (RWC) symptoms. 14 4: Grapevine vein Necrosis (GVN) symptoms in the indicator rootstock 110R. 15 5: Cloning plan based on VD-102 (MF979534.1) isolate. 21 6: Vector map for pCB-301.3. 26 7: Plan for creating GFP-tagged and VIGS vectors from the wildtype GRSPaV- SY clone. 28 8: Coverage Diagram of plan to sequence entire wildtype GRSPaV-SY clone (pBS-SY) genome. 34 9: Multiple sequence alignment of the pRSPMGT and 13 prominent GRSPaV strains shows a gap in VD-102 sequencing. 38 10: Phylogenetic tree of all GRSPaV isolates for which complete or near complete genomes are available. 41 11: Western blot for detecting GRSPaV CP from N. benthamiana agroinfiltrated with pRSPMGT-GFP, pRSPGG-GFP, and pCB-301.3 (–) at 10 days post-infiltration (dpi). 42 12: N. benthamiana infiltrated with pRSPMGT-GFP from 2 to 10 days post-infiltration (dpi) at 100x magnification. 43 13: N. benthamiana infiltrated with pRSPGG-GFP from 2 to 10 days post-infiltration (dpi) at 100x magnification. 44 14: N. benthamiana infiltrated with pRSPGG-GFP (left) and pRSPMGT-GFP (right) in the same leaf from 2 to 10 days post-infiltration (dpi) at 100x magnification. 45 15: Western blot of pooled protein extracts (n=3) for detecting GFP from N. benthamiana agroinfiltrated with pRSPMGT-GFP, pRSPGG-GFP, and pCB-301.3 (–) at 2, 3, 5, 7, and 10 days post-infiltration (dpi). 46 16: Analysis of GFP bands from a Western blot for N. benthamiana agroinfiltrated with pRSPMGT-GFP and pRSPGG-GFP from 2 to 10 days post-infiltration (dpi). A: Normalized density values. B: Normalized percent differences in density values relative to 2 dpi. 47 17: Predicted 2◦ and 3◦ RNA structures of the (+)-sense strands of the 3’ UTRs of MGT and GG. 48 18: Predicted 3◦ protein structures of the replicase domains of MGT (red) and GG (grey). 49 19: Predicted 3◦ protein structures of the proteins of MGT (red) and GG (grey). 50 20: Hydrophobicity plots of proteins for MGT (black) and GG (red). 51 21: Predicted 2◦ and 3◦ RNA structures of the (–)-sense strands of the 97 nt CP SGP region of MGT and GG. 52 22: Predicted 2◦ and 3◦ RNA structures of the (–)-sense strands of the 70 nt CP SGP region minus the CP sgRNA 5’ UTR of MGT and GG. 53

ix 23: Predicted 2◦ and 3◦ RNA structures of the (+)-sense strands of the GFP sgRNA 5’ UTRs of MGT and GG. 54 A1: Western blot of non-pooled protein extracts from N. benthamiana agroinﬁl- trated with MGT, GG, and pCB-301.3 (–) at 7 and 10 days post-inﬁltration (dpi). 84 A2: Predicted 2◦ and 3◦ RNA structures of the (+)-sense strand of the 3’ UTR of PN. 84 A3: Predicted 3◦ protein structures of the replicase domains of PN (blue) and MGT (grey). 85 A4: Predicted 2◦ and 3◦ RNA structures of the (–)-sense strands of the 97 and 70 nt CP SGP of PN. 86 A5: Predicted 2◦ and 3◦ RNA structures of the (+)-sense strands of the GFP sgRNA 5’ UTRs of PN. 87 A6: Predicted 3◦ protein structures of MGT CP (orange) and the crystal structure of N. benthamiana rubisco large subunit (grey, PDB: 1EJ7). 88 A7: Predicted 3◦ protein structures of V. vinifera rubisco large subunit (green) and the crystal structure of N. benthamiana rubisco large subunit (grey, PDB: 1EJ7). 89

x LIST OF ABBREVIATIONS aa Amino Acid(s) nt Nucleotide(s) Ab Antibiotic OE-PCR Overlap-Extension PCR bp Base Pair(s) ORF Open Reading Frame BVY Blackberry virus Y PAMP Pathogen-Associated Molecular Pattern CaMV Cauliﬂower mosaic virus PNRSV Prunus necrotic ringspot virus cDNA Complementary DNA PCR Polymerase Chain Reaction CP Coat Protein PD Plasmodesmata CTV Citrus tristeza virus PDS Phytoene Desaturase DAMP Damage-Associated Molecular Pattern PRR Pattern Recognition Receptors ds Double-Stranded PTI PAMP-triggered immunity dpi Days Post-Inoculation PTGS Post-Transcriptional Gene Silencing DUB Deubiquitinase PVX Potato virus X ER Endoplasmic Reticulum RdRp RNA-Dependent RNA Polymerase ETI Effector-Triggered Immunity RISC RNA-Induced Silencing Complex FLC Full Length Clone RNP Ribonucleoprotein GAMaV Grapevine asteroid mosaic-associated RSP Rupestris Stem Pitting virus RSS RNAi Silencing Suppressors GFkV Grapevine ﬂeck virus RWC Rugose Wood Complex GFP Green Fluorescent Protein SA Salicylic Acid GLRaV-2 Grapevine leafroll-associated virus-2 SD Syrah Decline GPGV Grapevine pinot gris virus SDM Site-Directed Mutagenesis GRBV Grapevine red blotch virus SEL Size Exclusion Limit GRGV Grapevine redglobe virus SGP Subgenomic Promoter GRVFV Grapevine rupestris vein feathering virus sgRNA Subgenomic RNA GRSPaV Grapevine rupestris stem siRNA Short Interfering RNA pitting-associated virus SL Stem-Loop GSyV-1 Grapevine Syrah virus 1 ss Single-stranded GVA Grapevine virus A TGB Triple Gene Block GVN Grapevine Vein Necrosis TRV Tobacco rattle virus HDV Hepatitis D virus TYMV Turnip yellow mosaic virus HEL Helicase UTR Untranslated Region HR Hypersensitive Response VIGS Virus-Induced Gene Silencing HVR Highly Variable Region VRC Viral Replication Complex I:V Insert:Vector ratio (molar) VSR Viral Suppressors of RNA Silencing LB Lysogeny Broth 101-14 MGT Millardet et de Grasset 101-14 MTR Methyltransferase

xi 1 INTRODUCTION

1.1 Grapevines

1.1.1 History

Grapevines are an important agricultural crop in Canada and, through wine sales, increasingly inﬂuence the Canadian economy. In 2017, 2.1 million L of Canadian wine was exported, primarily to China and the US, worth $39.6 million CAD (Canadian Vintners Association, 2019). These values have increased by 12% and 14% from the previous year, respectively, indicating that not only is demand rising but so is value. Consequently, their cultivation and health are being given more and more attention.

Grapevines (genus Vitis) are perennial, woody plants. The predominant species of the modern grapevine is Vitis vinifera L. subsp. vinifera and the predominant wild species, also considered the wild ancestor of modern domesticated vines, is Vitis vinifera L. subsp. sylvestris (C.C.Gmelin) Berger (Hornsey, 2007). Wild grapevines initially only ﬂourished in temperate and humid areas of southern Europe and western Asia, along rivers such as the Rhine and Danube, but now can be found worldwide. Grapevines may have ﬁrst been domesticated in the early bronze age (2000 BC) in Transcaucasia (McGovern et al., 1996a; Zohary and Spiegel- Roy, 1975), however, evidence suggests more than one point of origin for domestication is possible (Arroyo-Garc´ıa et al., 2006; McGovern et al., 1996b; Gismondi et al., 2016).

V. vinifera was the primary species used in viniculture before the 1900s. In the 1860s, the Great French Wine Blight caused widespread devastation of vineyards in Europe due to the introduction of destructive grape phylloxera from North America (Bittner, 2015). The solution, which still prevails to this day, was to graft V. vinifera scions (i.e. young shoots or branches) onto phylloxera-resistant rootstocks (i.e. the roots and partial stem) of North Ameri- can grapevine species. North American species, such as V. rupestris, V. riparia, V. berlandieri, and various interspecies hybrids, are mostly used for their rootstocks, which are hardier and have improved resilience to pests, diseases, and abiotic conditions (McGovern et al., 1996a). As a result, most commercial vineyards today graft V. vinifera scions onto North American

1 rootstocks or use hybrids that have a north American parent.

Domesticated grapevines are hermaphroditic, possessing both male and female reproductive systems in the same flower, permitting self-fertilization, whereas wild grapevines possess either the male or female reproductive systems and reproduce via traditional cross-fertilization. This change is believed to be due to a single gene mutation that was retained via grafting (Mc- Govern et al., 1996a) and has been beneficial because it reduces genetic variation, which can cause quality inconsistency. As a result, grafting has become the most popular way of propagat- ing vines. Grafting contributes to artificial selection and speciation of grapevines, as hybridization can be strictly controlled, decreasing the likelihood of cross-fertilization (McGovern et al., 1996a). Grafting places a lot of stress on the plant to restore vascular connections and the injury can facilitate spread of infectious agents such as bacteria, fungi, and viruses, which negatively affect grapevine health, quality, and yield.

1.1.2 Viruses

Viruses are obligate intracellular parasites and predominantly have (+)-sense single-stranded (ss) RNA genomes when the hosts are plants, although DNA plant viruses have been identiﬁed (Varsani et al., 2017). Grapevines contain a complex virome of over 80 virus species and more are being identiﬁed through deep sequencing, such as Grapevine Syrah virus 1 (GSyV-1) and Grapevine Pinot gris virus (GPGV) (Al Rwahnih et al., 2009; Giampetruzzi et al., 2012).

Several major grapevine diseases are believed to be caused by viruses. Some diseases have definitive viral origins, such as Fleck, which is primarily caused by Grapevine fleck virus (GFkV) and secondarily by Grapevine asteroid mosaic-associated virus (GAMaV), Grapevine rupestris vein feathering virus (GRVFV), and Grapevine redglobe virus (GRGV), which are termed the “fleck complex” Martelli (2017), and Red Blotch Disease, which is caused by Grapevine red blotch virus (GRBV) (Yepes et al., 2018). Other diseases do not yet have definitive causes, such as Leafroll, which is correlated with Grapevine leafroll-associated virus 1, 2, 3, 4, and 7, Rugose Wood Complex (RWC), which has been attributed to many viruses, such as Grapevine rupestris stem pitting-associated virus and Grapevine virus A (GVA), GVB, GVD, GVE, and GVF, and leaf mottling, which has been associated with GPGV. However, the true

2 causes for these diseases are not known.

Grapevines are commonly infected multiple viruses at one time (Beuve et al., 2018; Coetzee et al., 2010), likely because unregulated grafting has permitted spread and concentration of viruses. Virus-disease relationships are difﬁcult to establish because of these ubiquitous coinfections and, as a result, virus-associated diseases are difﬁcult to manage.

1.1.3 Defence & Immunity Against Viruses

Viruses cannot physically penetrate plant bark or cell walls and take advantage of injuries due to grafting or insect vectors to enter the cell. Once the virus enters, the cell can respond in several ways.

RNA interference (RNAi) is a post-transcriptional gene silencing (PTGS) mechanism that can also be used to cleave viral RNA. DICER-like proteins cleave viral dsRNA, produced as a viral replication intermediate, and create small interfering/silencing RNAs (siR- NAs) that guide the argonaute (AGO) protein contained within RNA-induced silencing complexes (RISC). RISC uses siRNA to bind complementary viral RNA sequences and cleave them (Pattanayak et al., 2013). Viruses can evade RNAi using encoded RNA silencing suppressors (RSS, also called viral suppressors of RNA silencing or VSRs), which target proteins in the RNAi pathway to prevent processes like viral RNA recognition and cleavage, RISC assembly, and siRNA synthesis (Burgyan´ and Havelda, 2011).

Plants also have a two-stage innate immunity for non-speciﬁc defence. The ﬁrst stage is pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI), whereby pattern recognition receptors recognize PAMPs. Viruses have very few conserved PAMPs, so it has been proposed that hosts sense danger-associated molecular patterns (DAMPs), which are produced by the host upon viral infection, in order to trigger PTI (Zvereva and Pooggin, 2012). Signalling compounds like salicylic acid (SA), jasmonic acid, and ethylene are produced, eliciting reactive oxygen species accumulation, mitogen-activated kinase activation, production of pathogenesis-related proteins, and transcription of wound response genes like protease inhibitors, aldehydes, and oxoacids (Alazem and Lin, 2014; Halim et al., 2006; Srivastava, 2002; Zhao et al., 2016; Srivastava, 2002). These signal cascades occur throughout the entire plant

3 to conﬁne the virus and prevent spread (Durrant and Dong, 2004). Viruses can evade PTI by using effector proteins (these are often RSS that may or may not have multiple functions) that dampen these responses to infection (Leisner and Schoelz, 2018).

When a virus overcomes PTI, the plant experiences effector-triggered susceptibility and the virus can spread. The second stage of innate immunity, called effector-triggered immunity (ETI) is initiated, producing R proteins speciﬁc to viral proteins and often eliciting a hypersensitive response (HR), which causes necrosis and cell death (Cui et al., 2015). R proteins can interact directly with a viral gene (gene-for-gene model), a viral protein (guard and decoy models), or detect PAMPs, all of which result in induction of PTI-like immune responses through SA signalling (Głowacki et al., 2011; Martin et al., 2003). Some anti-viral R proteins are not dependent on SA signalling and do not elicit PT-/ETI-like responses; instead of interacting with the host, they interact with the virus directly, interfering with processed like formation of viral replication complexes (VRC) and viral polymerase function (Ishibashi et al., 2007; Yoshida et al., 2019).

Plants can cycle through stages of resistance breaking and ETI, known as the “zig-zag model”, as the pathogen evades the host and the host targets the virus (Zvereva and Pooggin, 2012). Plant viruses are often latent and persist for a long time. It is not known how these viruses tolerate the immune system or vice versa. The viruses may downregulate host immunity or the host immunity may maintain viral proteins below a threshold for developing symptoms without eliminating the virus entirely (Paudel and Sanfac¸on, 2018). 1.2 Grapevine rupestris stem pitting-associated virus

GRSPaV is a monopartite (+)-sense ssRNA virus with a flexuous filamentous virion. It was first identified in 1998 in grapevines that induced stem pitting symptoms when grafted onto the St George indicator cultivar (Meng et al., 1998). This isolate was designated as GRSPaV-1. Since then, a variety of strains have been discovered and implicated in several grapevine diseases, although a lot of fundamental characteristics about these viruses remain to be understood.

4 1.2.1 Distribution & Transmission

GRSPaV is the most ubiquitous of all grapevine viruses and is found in domesticated grapevines worldwide, including Canada, the US, China, Turkey, Spain, Italy, France, Russia, Africa, Chile, Australia, and Korea (Xiao et al., 2018; Lima et al., 2009; Hu et al., 2015; Buzkan et al., 2015; Fiore et al., 2016; Terlizzi et al., 2011; Beuve et al., 2018; Dmitrenko et al., 2016; Goszczynski, 2010; Fiore et al., 2008; Habili et al., 2006; Jo et al., 2017). It has even been detected in wild grapevines (Selmi et al., 2017).

No insect transmission vector has been identiﬁed and GRSPaV is transmitted via grafting. Transmission via pollen has not been thoroughly tested (Martelli, 2014). Despite being detected on the outside of pollen, GRSPaV has not been detected inside it (Morelli et al., 2009), making pollen unlikely to contribute to transmission. It has been detected in seeds of many cultivars (Lima et al., 2006b; Stewart and Nassuth, 2001) but seeds have still not been conﬁrmed to spread GRSPaV. Because grafting is the predominant cultivation method and cross-fertilization is uncommon, pollen and seeds remain unlikely transmission routes.

1.2.2 Taxonomy & Phylogeny

GRSPaV is a member of the genus Foveavirus in the family Betaflexiviridae. The family Betaflexiviridae is defined to contain viruses with flexuous filamentous virions, monopartite (+)-sense ssRNA genomes with a poly(A) tail, an alphavirus-like replication protein containing methyl transferase (MTR), helicase (HEL), RNA-dependent RNA polymerase (RdRp), RNA demethylase (AlkB), and tandem deubiquitinase/protease (OTU/PPro) domains, as well as one or more movement proteins, and a coat protein (CP) (Adams et al., 2004; Adams and Kreuze, 2007; Meng and Rowhani, 2017). A new subfamily, Quinvirinae, has been proposed to contain the Betaflexiviridae members possessing triple gene block (TGB) proteins (Adams and Kreuze, 2015), such as GRSPaV. Isolates are classified in the genus Foveavirus if the amino acid (aa) sequence of any gene differs by more than 10% from other genera (Adams et al., 2004).

Analyses of nucleotide sequences corresponding to the highly conserved HEL domain and the CP gene often reveal the phylogenetic groups (also called phylogroups) –1, SG1, BS, SY, ML, JF, PN, and LSL (Meng and Rowhani, 2017). Within the GRSPaV species, nucleotide

5 (nt) identity can differ up to 27% and aa ID up to 22%. LSL, PN, JF, and SY appear to be some of the most divergent variants based on sequence comparisons (Table A1). The high degree of variation between isolates means it is likely that more phylogroups/strains exist. Chimerism between different strains has been postulated (Meng and Rowhani, 2017), which may contribute to high variability, although this phenomenon has not been conﬁrmed.

1.2.3 Genome

The genome contains ﬁve open reading frames (ORF) and a putative sixth ORF (Figure 1).

Figure 1: Representative diagram of the GRSPaV genome. Sizes and positions are approximately to scale. Dashed red lines indicate putative self-cleavage sites (Udaskin, 2016).

The first ORF encodes the replicase polyprotein (accession: MF979534.1, 61–6546 nt, 2165 aa), which contains several conserved domains serving specific functions. Polyproteins allow viruses to have more condensed genomes (Yost and Marcotrigiano, 2013) and control the activity of domains via selective cleavage (Yost and Marcotrigiano, 2013). Preliminary results suggest that there are two putative cleavage sites in the replicase and a possible third site yet to be confirmed (Udaskin, 2016)(Figure 1).

The ﬁrst replicase domain is a methyltransferase (MTR) (accession: MF979534.1, ∼43–355 aa). Closely related viruses in the family Betaﬂexiviridae, such as Potato virus S (PVS), have 5’ capped RNA (Gutierrez´ et al., 2013), which is presumably capped by MTR so they can be translated by host ribosomes (Martelli et al., 2007). The 132–207 aa in this domain appear to localize the replicase to ER membranes (Prosser et al., 2015), possibly aiding VRC formation.

In between the ﬁrst and second domains is a highly variable region (HVR) (accession: MF979534.1, ∼473–750 aa). Isolates may vary by up to 53% here (Meng and Rowhani, 2017). All isolates have low aa ID and the length varies between different Foveavirus species, suggest-

6 ing that this region has little biochemical functionality. This region may be necessary for proper polyprotein conformation or permitting auto-cleavage to occur by providing ﬂexibility to the replicase, allowing the internal protease to access distant regions. This would explain why the HVR is retained in all known strains despite such low conservation. Additionally, this region’s C terminus contributes to AlkB function to some degree (Van den Born et al., 2008).

The second domain is AlkB (accession: MF979534.1, ∼751–874 aa), which is an RNA demethylase that is believed to reverse m6A methylation of RNA primarily (Ougland et al., 2004). This domain is unique to a small group of ssRNA viruses including Betaﬂexiviridae, excluding the Capillovirus genus, Closteroviridae, Alphaﬂexiviridae, and a single member each of the Potyviridae and Secoviridae families (Martelli et al., 2007). Plants possess many AlkB homologs, suggesting a possible source for viral inheritance, although the diverse AlkB sequences between viruses also suggests more recent AlkB integration after viral species diverged (Bratlie and Drabløs, 2005). RNA methylation is used to regulate gene expression by tagging mRNA for degradation, but AlkB, from either the host or the virus, likely circumvents this process (Mart´ınez-Perez´ et al., 2017), functioning similarly to Escherichia coli AlkB (Van den Born et al., 2008) by rescuing tagged RNA. The domain’s true length is unknown as extensions into the HVR can increase activity (Van den Born et al., 2008; Moore and Meng, 2019).

The third domain is a tandem ovarian tumour (OTU) deubiquitinase and papain-like cys- teine protease (PPro) (accession: MF979534.1, ∼1182–1268 aa). This domain has two functions: The ﬁrst is to deubiquitinate proteins via its deubiquitinase-like (DUB) activity (Lom- bardi et al., 2013). Plants recycle proteins using the ubiquitin-proteasome system, which can inhibit viral infection (Chenon et al., 2012). DUBs deubiquitinate ubiquitin-tagged substrates to prevent their degradation (Bailey-Elkin et al., 2014) and allow the virus to tightly control the timing of its life cycle (Camborde et al., 2010). The OTU and PPro activities are unre- lated and can be uncoupled (Jupin et al., 2017). The second function is to cleave the replicase polyprotein via PPro activity (Lombardi et al., 2013), which produces mature viral proteins (Jakubiec et al., 2007) and produces infectious virions, which presumably require cleavage for infectivity (Lawrence et al., 1995). Like Turnip yellow mosaic virus (TYMV) it is predicted that Betaﬂexiviridae viral proteases can act both in cis and in trans, acting on host proteins and

7 other viral proteins in addition to the replicase polyprotein (Rodamilans et al., 2018). Whether full or partial cleavage is necessary for full infectivity is not known.

The fourth domain is a superfamily 1 RNA helicase (HEL) (accession: MF979534.1, ∼1353–1474 aa), which is responsible for disrupting hydrogen bonds between dsRNA replication intermediates or intramolecular double stranded regions such as stem loops, allowing polymerases to access RNA, and to counteract unwanted binding between complementary RNA strands (Kadare´ and Haenni, 1997). This is performed using its NTPase activity (Rikkonen et al., 1994; Seybert et al., 2000). It is not known whether this domain possesses activity on its own or whether it needs to associate with other viral or cellular proteins.

The ﬁfth domain is an RNA-dependent RNA polymerase (RdRp) (accession: MF979534.1, ∼1773–2075 aa), which is necessary to replicate and transcribe RNA into its complementary component without incorporating a DNA stage. It is a nucleotidyltransferase that starts at the 3’ end of the template RNA strand to produce a complementary RNA strand in a 5’→3’ direc- tion. RdRps have no proofreading exonuclease activity and have a higher mutation rate than eukaryotic DNA-dependent RNA polymerases (Venkataraman et al., 2018). RdRps are also prone to template-switching, which can alter gene arrangement or cause gene acquisition from other viruses or hosts (Cheng and Nagy, 2003).

The second ORF encodes the first triple gene block protein (TGBp1) (accession: MF979534.1, 6577–7224 nt, 221 aa). TGBp1 is distributed throughout the cytosol and nucleus in early infection stages and ∼8 hours post-infection it self-aggregates in the cytoplasm (Rebelo et al., 2008). TGBp1 binds ssRNA non-specifically and likely aids ribonucleoprotein (RNP) formation (Lough et al., 2000). TGBp1 contains a superfamily 1 helicase domain (accession: MF979534.1, ∼25–224 aa) with ATPase activity (Rebelo et al., 2008) similar to the replicase HEL domain (Morozov and Solovyev, 2003). This RNA helicase has in vitro activity for Potato virus X (PVX) (Morozov and Solovyev, 2003) and is necessary for cell-to-cell movement (Howard et al., 2004). PVX and GRSPaV TGBp1 are unsubstitutable, as substitution significantly reduces movement efficiency, although does not altogether abolish it (Matousekˇ et al., 2009; Mann and Meng, 2013). This suggests that GRSPaV TGBp1 serves a similar function as PVX TGBp1 but cannot be interchanged likely due to adaptation to very different

8 hosts, as PVX movement is adapted to work in an annual herbaceous plant whereas GRSPaV is adapted to work in a woody perennial. Supporting this idea, swapping PVX TBG genes with those of PVS, a much more closely related virus to GRSPaV, restored some movement but not entirely (Matousekˇ et al., 2009; Mann and Meng, 2013). TGBp1 may have additional functions such as RSS activity (Senshu et al., 2009) and the ability to increase plasmodesmata (PD) size-exclusion limit (SEL) (Lough et al., 1998), but ultimately it is proposed to be the deﬁnitive movement protein, particularly since it can allow PVX to move intercellularly without the need of any other proteins (Okarpova et al., 2006).

The third ORF encodes the second triple gene block protein (TBGp2) (accession: MF979534.1, 7226–7579 nt, 117 aa). TGBp2 is believed to induce formation of ER vesicles (Ju et al., 2005, 2007). It is is an integral membrane protein with a conserved region flanked by two hydrophobic termini, each forming a transmembrane domain, and localizes to the ER/endomembrane structures, exposing the conserved region to the lumen and both termini to the cytosol (Re- belo et al., 2008; Morozov and Solovyev, 2003). The functions of these exposed domains are not known but the possibility that the ER-exposed region influences budding and the cytosol- exposed termini influence viral RNA trafficking via actin and the ER has been posited (Hsu et al., 2008). TGBp2-ER complexes in the cytosol contain ribosomes and binding immunoglob- ulin proteins that stabilize proteins (Ju et al., 2007), possibly aiding viral replication. TGBp2

increases PD SEL by interacting with β-1,3-glucanase (Haupt et al., 2005) and may affect PD gating via ER stress (Ju et al., 2005). TGBp2 is necessary for fully efﬁcient systemic viral infection (Lough et al., 1998). As with TGBp1, PVX and GRSPaV TGBp2 are unsubstitutable (Matousekˇ et al., 2009; Mann and Meng, 2013). TGBp2 is likely not the primary movement protein but aids TGBp1 signiﬁcantly.

The fourth ORF encodes the third and ﬁnal triple gene block protein (TGBp3) (accession: MF979534.1, 7500–7742 nt, 80 aa). The ﬁrst 80 nt at the 5’ terminus overlap with the 3’ terminus of the TGB2 ORF. TGBp3 is an integral membrane protein that localizes to the ER (Rebelo et al., 2008) but, unlike TGBp2, contains one hydrophobic region forming only one transmembrane domain positioned at the N terminus (Morozov and Solovyev, 2003). Po- texviral TGBp3 contains signals that interact with TGBp2-induced ER vesicles to direct them

9 to the cell membrane (Rebelo et al., 2008), aiding signiﬁcantly in viral movement. TGBp3 is necessary for systemic viral infection in addition to TGBp1/2 (Lough et al., 1998) and all three TGB proteins are necessary for optimal inter-cellular movement. As with TGBp1/2, PVX and GRSPaV TGBp3 are unsubstitutable (Matousekˇ et al., 2009; Mann and Meng, 2013). TGBp3 is not the primary movement protein but, like TGBp2, it aids TGBp1 signiﬁcantly.

The ﬁfth ORF encodes the CP (accession: MF979534.1, 7752–8531 nt, 259 aa). This is the major constituent of virions and RNPs and physically protects enclosed genomic (gRNA). It contains an active nuclear localization signal that targets CP to the nucleus, although the reason for this is unclear (Meng and Li, 2010). It may be to sequester excess CP to control cellular conditions to make them more favourable for viral replication. In PVX, CP can be phosphorylated by host protein kinases to translationally activate virions and RNPs Zayakina et al. (2008), allowing them to launch infections in new cells.

A putative sixth ORF may encode a 13-14 kDa protein (accession: MF979534.1, 8209– 8565 nt, 118 aa) with unknown function. Its existence has not been validated by any experiments.

1.2.4 Replication & Life Cycle

Upon cell entry, the virion is stripped of capsid proteins in the cytoplasm and releases (+)- sense gRNA, which can be translated directly as if it is host mRNA. The replicase polyprotein is the primary protein produced in early infection stages. The replicase binds to the 2◦ structure of the 3’ untranslated region (UTR), possibly a pseudoknot/stem loop structure formed by the 3’ UTR/poly(A) tail (Cheng et al., 2002) and produces full-length (–)-sense strands. (– )-sense strands can either be (a) a template for synthesis of multiple (+)-sense subgenomic RNA (sgRNA), (b) a template for gRNA synthesis, or (c) packaged in a virion, although it is vastly outnumbered by packaged (+)-sense RNA in this case (Tao and Ye, 2010). Genes are expressed via truncated 3’ coterminal (+)-sense sgRNAs, which are produced by several possible models (Sztuba-Solinska´ et al., 2011). For GRSPaV, the two most likely models are internal initiation, where the replicase binds to an internal subgenomic promoter (SGP) on the (–)-strand RNA and produces truncated (+)-sense RNA, and premature termination, where the

10 replicase stops transcribing (–)-sense RNA upon encountering a termination signal, possibly a 2◦ RNA structure, producing truncated (–)-sense gRNA, which then serves as the template for producing (+)-sense sgRNA (Bustamante and Hull, 1998). It is not known which mechanism is truly used. GRSPaV likely produces three kinds of sgRNA: One that is monocistronic for TGB1, one that is bicistronic for TGB2 and TGB3, where TGB3 is translated by leaky scanning through the TGB2 start codon (Morozov et al., 1991; Verchot et al., 1998), and one that is monocistronic for CP, although it is possible that more sgRNA species exist (Xiao and Meng, 2017). TGBp2 induces formation of ER vesicles that the replicase’s RdRp domain localizes to, forming VRCs (Venkataraman et al., 2018). VRCs are associations of necessary replication components that aid in viral replication (Carbonell et al., 2016) and form on the cytoplasmic side of membranes, possibly because these membranes act as a scaffold, provide protection for viral replication, and/or provide resources for replication (Linnik et al., 2013). VRCs may also produce RNPs for cell-to-cell spread. For PVX, VRCs contain sheets of TGBp1, which may need to be sequestered because of their ability to destabilize RNA and associated proteins, surrounded by non-encapsidated gRNA (Linnik et al., 2013). TGBp2 may induce formation of ER “hoops” that wrap around TGBp1 sheets and contain some TGBp3, which increase surface area for protein accumulation and RNA replication (Linnik et al., 2013). This assembly is surrounded by a “cage” of ﬁlamentous encapsidated virions (Linnik et al., 2013). Infectious virions and movement-capable RNPs are produced in VRCs. RNPs can be composed of gRNA, TGBp1, and CP or only CP with TGBp1 at the 5’ end of the CP-coated gRNA (Park et al., 2014). TGBp2 and TGBp3 are transported to PD by budding from VRCs/ER membranes and travelling along the ER/actin network (Morozov and Solovyev, 2003). Whether the TGBp2/3 proteins associate with PD by using a receptor or by membrane fusion is unknown. Initially, only TGBp2 increases the PD SEL, cooperating with TGBp1/3 to insert RNP into the PD to initiate passage (Heinlein, 2015). TGBp1 displaces complementary RNA and other proteins binding to gRNA and interacts with CP to translationally activate viral particles (Okarpova et al., 2006) and increase PD SEL (Lough et al., 1998). Translationally-activated RNPs are transported into an adjacent cell and the replication cycle repeats.

11 1.2.5 Disease Associations

Syrah decline (SD) was ﬁrst reported in V. vinifera cv. Syrah in the 1990s in Southern France (decline in French vineyards, 2002) and SD-like symptoms have been reported worldwide (Bat- tany et al., 2004; Habili et al., 2006; Goszczynski, 2007; Gramaje et al., 2009; Xiao et al., 2018). There are different names for similar complexes of symptoms, such Shiraz decline or Syrah disorder, but it is likely that these are all varied presentations of SD that arose due to regional differences. Symptoms progress from cracking/pitting of woody tissues to swelling of the graft union, stem necrosis, leaf reddening, failure of the fruit to ripen fully, and eventual death within 4–10 years (Battany et al., 2004). Crevasses/cracking are not always sufﬁcient to cause vine death, which usually occurs when vines develop red canopies (Beuve et al., 2013) (Figure 2). GRSPaV strain SY has been detected in declining vines (Lima et al., 2006a; Ha- bili et al., 2006), implicating its possible involvement. GRSPaV-PN has also been detected in declining Pinot Noir vines (Lima et al., 2009), implying the involvement of different GRSPaV strains. SD may even be a genetic disease (Puckett et al., 2018), although there is no conclusive evidence. SD symptoms can be accelerated by grafting (Renault-Spilmont et al., 2005) and it is likely a graft-transmissible disease.

RWC is a complex of diseases that affect all grapevine cultivars (Martelli, 2014; Nakaune et al., 2008). It was first reported in southern Italy in the 1960s and occurs worldwide (Martelli, 2014). The graft-transmissible diseases it includes are corky bark, Kober stem grooving, LN33 stem grooving, and rupestris stem pitting (RSP). These diseases are difficult to distinguish because of large similarities and few defining symptoms. Symptoms include swelling/pitting of the graft union, delayed bud break, and reduced vigour (Martelli, 2014)(Figure 3). GRSPaV is a suspected causative agent of RWC (specifically the RSP disease) (Lima et al., 2006a) but there is conflicting evidence regarding its involvement in symptom production (Rosa et al., 2011; Nakaune et al., 2008).

Grapevine Vein Necrosis (GVN) was ﬁrst reported in France in 1973 (Legin and Vuit- tenez, 1973) and occurs worldwide (Bouyahia et al., 2005). This disease is graft-transmissible (Krake et al., 1999) and is latent/asymptomatic in many European and American cultivars, with

12 Figure 2: Syrah Decline (SD) symptoms. Left: Swelling, pitting, and cracking of the graft union. Right: Uniformly red canopy. Retrieved from “Le Dep´ erissement´ de la Syrah” by Audrey Petit and Anne-Sophie Spilmont, published by the Institut Franc¸ais de la Vigne et du Vin at http: //www.vignevin-occitanie.com/fiches-pratiques/le-deperissement-de-la-syrah/.

the exception of the indicator rootstock 110 Richter (Bouyahia et al., 2006). Symptoms include necrosis in leaf veins and tendrils, reduced shoot growth, and eventual death (Bouyahia et al., 2006)(Figure 4). GRSPaV is the suspected, but unconﬁrmed, causative agent (Bouyahia et al., 2005). It is most highly correlated with GRSPaV strain –1 (Bouyahia et al., 2006), but SG1, SY, and BS are also present in diseased plants, singularly or as part of a coinfection (Alliaume et al., 2012). 1.3 Viral Vectors

RNA molecules are notoriously unstable and make RNA viruses difﬁcult to work with. This can be avoided by working with viral complementary DNA (cDNA) clones. In vitro transcription of viral cDNA has frequently been used, whereby the viral cDNA is preceded by an SP6/T7 promoter, mixed with the corresponding polymerase in vitro to produce viral RNA that is rub-inoculated into host plants, but this method is not always the most effective (Meng et al., 2013). Recently, Agrobacterium-mediated inoculation has become popular for launching infection with viral cDNA clones. This method necessitates the use of a viral cDNA clone that is preceded by a eukaryotic promoter and followed by a eukaryotic terminator. cDNA clones are

13 Figure 3: Rugose Wood Complex (RWC) symptoms. Left: Swelling/pitting in the scion above the graft union. Middle: Swelling/Pitting in the rootstock below the graft union. Right: Swelling/pitting in both the scion and rootstock surround the graft union. Retrieved from “Rugose Wood Complex” by Martelli, published by the Food and Agriculture Organization of the United Nations at http://www.fao.org/3/t0675e/T0675E09.htm. constructed by extracting viral RNA and reverse transcribing it to produce viral cDNA fragments, which can be assembled into a cDNA genome. In Agrobacterium-mediated inoculation, two plasmids are necessary:

1. The binary plasmid: Contains the cDNA viral genome ﬂanked by a eukaryotic promoter and a terminator on the 5’ and 3’ ends, respectively. These are contained within T-DNA borders, thereby becoming potential T-DNA for transfer.

2. The helper plasmid: Contains virulence genes necessary for T-DNA transfer.

Agrobacterium tumefaciens excises T-DNA from the binary plasmid in its own cell and produces ssT-DNA with the help of proteins encoded by the virulence genes in the helper plasmids. A. tumefaciens utilizes a type IV secretion system (T4SS) to transport ssT-DNA and bacterial- encoded proteins across the bacterial membrane and plant cell wall to the host’s nucleus. The promoter and terminator surrounding the cDNA allow the cDNA to be transcribed by host RNA polymerase II into RNA in planta. T-DNA can be inserted into the host genome but the mechanism by which this occurs is not clear. Evidence suggests that dsT-DNA is produced from ssT-DNA in the nucleus, which targets random double stranded breaks (DSB) in the genome and joins these breaks via non-homologous end joining (Saika et al., 2014). In initial infection

14 Figure 4: Grapevine vein Necrosis (GVN) symptoms in the indicator rootstock 110R. Necrosis is present in leaf veins, petioles, and pith. Retrieved from “Grapevine rupestris stem pitting-associated virus is linked with grapevine vein necrosis” by Bouyahia et. al, published in Vitis 44(3), 133–137 (2005). stages, RNA will be produced from cDNA, but as the infection progresses the cDNA will be degraded and the infection will be maintained by viral RNA molecules.

1.3.1 Wildtype Clones

Wildtype viral clones have been used extensively to investigate disease associations in perennial plants. To formally prove the causal relationship between a virus and a disease, a virus-modiﬁed version of Koch’s postulates (Yepes et al., 2018) must be fulﬁlled:

1. The virus must be present in most or all plants suffering from the disease(s).

2. The virus must be isolated from a diseased plant and grown in pure culture (in the case of plant viruses, a cDNA clone must be constructed).

3. The cultured virus should cause disease when introduced into healthy plants.

4. The virus must be re-isolated from the diseased host and identiﬁed as being identical to

15 the original culture/cDNA clone.

These have been satisfied recently for Grapevine red blotch virus (GRBV) and its role in Red Blotch Disease (RBD) (Yepes et al., 2018), demonstrating the use of wildtype clones in clarifying disease aetiology. Diseases origins are particularly difficult to determine in grapevines due to coinfections and the difficulty of finding ideal infections in naturally-infected vines. A wildtype clone can be used to produce desired infections and monitor specific infection outcomes.

Wildtype vectors can also be used to study molecular virus characteristics regarding virulence, pathogenesis, and replication (Cockrell et al., 2018; Matsumur et al., 2018; Nishi et al., 2016; Rebel et al., 2000), which may be difﬁcult to study in vines that are infected with multiple viruses. Wildtype vectors can be modiﬁed for practical uses, such as protein delivery, compartmentalizing reactions/pathways, and as nanocarriers in medical and biotechnological industries (Steele et al., 2017; Schoonen et al., 2015; Brasch et al., 2017) and have a broad range of additional uses.

1.3.2 Protein Expression Vectors

GFP fusions can be used to study many molecular characteristics of viruses, such as life cycle, movement, and protein localization, which are poorly understood for viruses like GRSPaV. Pro- teins can be studied individually or in tandem by tagging multiple proteins with ﬂuorophores that are excited in different wavelengths. It can also be coupled with viral promoters to determine the relative strength of these promoters.

Viral protein expression vectors can be used to over- or under-express host genes in transformed plants, thereby altering metabolic pathways (Kumagai et al., 1995; Bedoya et al., 2012). This can be exploited to study very specific aspects of grapevine metabolism, which is currently difficult. These vectors can also be used to express foreign genes and confer tempo- rary resistance in plants that are seriously threatened by disease. As Dawson and Folimonova (2013) mention, it can takes upwards of 30 years to optimize and approve transgenic plants for use, which can put plants and economies at risk in the meantime. A viral protein expression vector can bridge this gap by delivering foreign genes that alleviate symptoms. The benefits of this method are that it transforms plants transiently, i.e. without affecting germ cells, yet can

16 be maintained long-term by ensuring transformed plants continue to be grafted.

Plants can also be superficially improved by protein expression vectors by expressing proteins that influence flavour, colour, or texture. This would be of particular interest for grape growers because it can be difficult to improve upon grapevine varieties using traditional means, such as cross-fertilization or even grafting, without introducing undesirable changes.

Virus-based protein expression vectors are widely used but very few are optimized for use in woody plants. Parameters like long-term stability and speed of replication differ between viruses that infect herbaceous and woody plants and, since herbaceous plant viruses cannot infect woody plants, it is unlikely that current viral protein expression vectors can transition to woody plants. A Citrus tristeza virus-based (CTV) protein expression vector has been tested extensively but there are still unexplored areas, such as whether a single vector can express multiple proteins or whether a plant can be infected with multiple viral vectors each expressing different proteins. If CTV-based vectors end up being deﬁcient in these areas, other protein expression vectors for woody plants need to be examined. Moreover, there is no well-studied protein expression vector for use in grapevines that is equivalent to CTV-based vectors, which may not work in grapevines.

1.3.3 Virus-Induced Gene Silencing (VIGS) Vectors

Plant defences can be exploited for silencing host genes via virus-induced gene silencing (VIGS) vectors. A VIGS vector is a viral vector containing a small region of a host gene under the control of a viral subgenomic promoter (SGP). The SGP allows the gene region under its control to replicate as if it is viral RNA, thereby producing dsRNA as an intermediate. Host RNAi components recognize this dsRNA as pathogenic and viral, resulting in not only viral RNA being silenced but all other RNA transcripts similar to the dsRNA, including mRNA transcripts produced by the host. The result is mRNA PTGS for the insert in the VIGS vector. Genes like phytoene desaturase (PDS) or magnesium chelatase (ChlI) participate in chlorophyll biosynthesis are popular candidates for testing VIGS vectors because of the observable bleaching phenotype their silencing produces. VIGS inserts can be inserted in either the forward or reverse orientation, which each elicit varying degrees of silencing for unknown reasons. Re-

17 cent approaches have used hairpin constructs of the VIGS insert to increase silencing efﬁciency (Aguero¨ et al., 2014), which likely increase the amount of targets for RNAi by forming hairpin RNA containing ds regions. Ultimately, VIGS vectors can be used to silence genes to study functional genomics of host plants.

The host range for a majority of VIGS vectors is limited to herbaceous plants with much fewer focusing on woody plants, which are difﬁcult to inoculate and less well-studied. Some VIGS vectors have been tested, such as Prunus necrotic ringspot virus- (PNRSV), Tobacco rattle virus- (TRV), and Grapevine leafroll-associated virus 2 (GLRaV-2)-based vectors, which were reasonably effective in the woody plants Prunus persica, Paeonia ostii, and V. vinifera, respectively (Kurth et al., 2012; Xie et al., 2019; Cui and Wang, 2017). Currently, the only grapevine VIGS vectors are based on GLRaV-2, Grapevine virus A (GVA), and Grapevine Al- gerian latent virus (GALV) (Muruganantham et al., 2009; Park et al., 2016; Kurth et al., 2012). Hairpin RNAs have been inoculated on their own, lacking any sort of vector, into V. vinifera and were able to induce production of siRNA; however, no bleaching symptoms were noted and the amount of siRNA produced was relatively small (Dalakouras et al., 2018). The ability of a virus to move systemically and maintain a high titre infection over a long period of time would vastly improve upon this process, thus, the more pathogenic viruses may have the best VIGS capabilities. For this reason, multiple viruses must be examined in order to create an optimal VIGS system in grapevines. Although GALV was effective in Nicotiana benthamiana, it has not been tested in V. vinifera (Park et al., 2016). Muruganantham et al. (2009) demonstrated effective silencing in grapevines, as well as Kurth et al. (2012) who demonstrated it in grapevine with GLRaV-2 using a variety of PDS orientations (sense, anti-sense, and tandem sense/anti-sense). Both of vectors caused almost total bleaching of the leaf veins and bleaching of the inter-vein area to differing degrees. Unfortunately, both of these viruses are phloem- limited, which may restrict their potential uses in studying grapevine gene functions. Whether GRSPaV is also phloem-limited or not has not been deﬁnitively proven.

1.3.4 GRSPaV-GG Clone

Meng et al. (2013) developed the ﬁrst GRSPaV clone, GRSPaV-GG, which shared 98% nt ID with –1, 87% with SG1, 84.2% with BS, 77.1% with SY, and 76.4% with PN. In N. benthami-

18 ana, the clone was unable to move from cell-to-cell or systemically throughout the plant and produced GFP in inoculated leaves when the GFP ORF was inserted in between the CP SGP and CP ORF. To restore CP production, an approximate region corresponding to the CP SGP from GRSPaV-BS was inserted between GFP and CP. GFP production proved that the clone was able to carry out all stages of the viral life cycle with the exception of cell-to-cell movement, thereby conﬁrming its infectivity in N. benthamiana. Interestingly, the GFP-tagged GG clone produced fewer virions than the wildtype GG clone, possibly due to incompatibility between the BS SGP and the GG CP ORF (Meng et al., 2013), which would result in reduced CP production. The –1 strain of GRSPaV was chosen for cloning at the time because it produced mild symptoms (Meng et al., 2013), making it a suitable candidate for practical applications where symptoms would be undesirable, such as VIGS. 1.4 Justiﬁcation & Goals

Genetic variants of the SY phylogroup have been suggested to be more virulent than those from other phylogroups (Beuve et al., 2013; Meng et al., 2013; Lima et al., 2006a; Habili et al., 2006); however, due to coinfections, this has not been concluded with any certainty. Koch’s postulates can be proven for GRSPaV-SY by launching a singular infection with a viral clone and assessing viral replication and host symptoms. No cDNA clone has been made for SY or any closely-related variants.

Additionally, the differential pathogenicity between GRSPaV strains has not been char- acterized. By comparing the isolates MGT, a variant closely related to SY, and GG, more insight can be gained about the degree of variance between strains that cannot be determined by sequence comparison alone. This may provide insight on the relative virulence of different GRSPaV phylogroups as well.

The primary goal of this research was to produce an SY-like clone and test its virulence in the experimental host, N. benthamiana, as well as begin experiments with the natural host, V. vinifera. If virulence is proven in an experimental host, the long-term goal is to use the clone to investigate the relationship between GRSPaV-SY or SY-like and RWC, SD, and/or GVN in V. vinifera, which take much longer to grow and observe infections in. A GFP expression clone was produced to study GRSPaV-SY replication and a VIGS clone was produced to determine

19 the practical use of GRSPaV-SY for biotechnological applications. 1.5 Hypotheses

1. An infectious cDNA clone can be produced for a GRSPaV-SY variant.

2. SY variants replicate faster than GRSPaV-GG variants.

3. The SY variant clone can be used to develop GFP-tagged and VIGS vectors.

1.6 Objectives

The hypotheses were tested by completing four objectives:

1. Clone the isolate MGT, which is a representative variant in the SY phylogroup of GRSPaV.

2. Produce wildtype, GFP-tagged, and VIGS vectors based on isolate MGT.

3. Conduct infectivity assays in N. benthamiana.

4. Analyse viral protein production, GFP expression, and symptoms in infected plants.

2 MATERIALS & METHODS

Standard procedures and software used are described in detail in A.1. All primer information is provided in Table A2. 2.1 Full Length Clone

The initial cloning plan was designed based on a published GRSPaV-SY genome (accession: AY368590.1), utilizing restriction sites already present in the viral genome to clone the genome fragments in a step-wise fashion. After cloning the ﬁrst fragment, fragment D, sequencing revealed that the predominant variant present in the plant viral source was more similar to an isolate detected in Croatia (accession: MF979534.1) (Voncinaˇ and Almeida, 2018), referred to as VD-102. This became the new reference genome and the plan was adapted (Figure 5).

Restriction sites between the promoter and terminator that were used to facilitate cloning but were not part of the native viral sequence, the XbaI site between the CaMV35S promoter

20 Figure 5: Cloning plan based on VD-102 (MF979534.1) isolate. Diagram of cloning plan based on VD-102 (MF979534.1) isolate. Modiﬁed from initial plan based on GRSPaV-SY genome (AY368590.1).

21 (CaMV35S) and fragment A and the KpnI site between fragment D and the HDV ribozyme- linked nos terminator (HDVnos), were removed to ensure maximum identity to the source isolate. VD-102 had an unforeseen KpnI site in fragment C that also had to be removed. The site arose due to a synonymous substitution and the nucleotide was reverted to the same one as in the previous SY reference genome (accession: AY368590.1), removing the KpnI site without changing the aa encoded by the codon. Fragment B was difﬁcult to clone and was split into fragments B1 and B2 to overcome this issue. Fragments B2 and C were joined via overlap- extension PCR (OE-PR) to form fragment B2C, which was cloned into the vector. The VD-102 variant had another unforeseen restriction site, SpeI, in fragment B1 that had to be removed. As before, the site arose due to a synonymous substitution and the altered nucleotide was reverted to the same identity as in the previous reference genome (accession: AY368590.1), which did not have this site. This mutated fragment B1 was cloned into the vector to produce the ﬁnal full-length clone.

2.1.1 Previous Work

CaMV35S and HDVnos were cloned into pBluescript KS II(+) (Agilent) previously (Hooker,

2017). The resultant plasmid was denoted as pBS35SHDV.

2.1.2 Viral Source & Cloning Genome Fragments

A Millardet et de Grasset 101-14 (101-14 MGT) rootstock, which is a blue/black-berried hybrid of V. rupestris and V. riparia was used as a pure source of the desired viral strain. ssRNA was extracted from leaves and reverse transcribed using combinations of RSP-SY-FaR, SY2127R, SY2481R, SY4410R(Cla), SY6074R, SY7592R(Sal), and SY8725R(Kpn) primers to produce GRSPaV-SY genome cDNA fragments. cDNA was ampliﬁed using either KOD polymerase, for fragments A and D, or PaCeR polymerase, for fragments B1, B2, and C. PaCeR polymerase was preferentially used because it was more resistant to PCR inhibitors and ampli- ﬁed to a greater degree than KOD. Primers used were RSP-SY-FaF/RSP-SY-FaR for fragment A, SY7581F(Sal)/SY8725R(Kpn) for fragment D. Primers used were RSP-SY-FbF1/RSP-SY- FbR3012 for fragment B1, RSP-SY-FbF2831/RSP-SY-FbR2 for fragment B2, and RSP-SY- FcF2/RSP-SY-muSalR for fragment C. Fragments A, C, and D were TA cloned into pCR2.1

22 (Invitrogen) and fragments B1 and B2 into pMD20 (Takara Bio). TA clones were transformed into competent E. coli JM109 cells and plated on lysogeny broth (LB) supplemented with 100

μg/mL of ampicillin, 40 μg/mL of X-Gal, and 0.1 mM of IPTG for blue-white screening. White colonies were screened via colony PCR using the same primers used for initial ampliﬁcation

of the speciﬁc fragment. Cells were subcultured in LB broth supplemented with 100 μg/mL of ampicillin and plasmids were isolated and analysed via restriction digestion at sites within and surrounding the inserts to conﬁrm ligation. All plasmids were sent to the Genomics Facility at the University of Guelph for Sanger sequencing before proceeding.

2.1.3 Subcloning Fragments D and A into the Intermediate Vector

Fragment D was sequentially digested out of its TA vector with KpnI and SalI due to lack of compatible buffers for double digestion. Fragment D was first digested with KpnI and purified from an agarose gel. The purified DNA was then digested with SalI and purified again.

pBS35SHDV (see section 2.1.1), i.e. the intermediate vector, was simultaneously digested with KpnI and SalI and puriﬁed from an agarose gel. The KpnI/SalI-digested fragment D and

pBS35SHDV were ligated and transformed into competent E. coli JM109 cells. Eight colonies were were screened via colony PCR using the primers SY7581F(Sal)/SY8725R(Kpn), cultured

in LB broth supplemented with 100 μg/mL of ampicillin, and plasmids were isolated. Plasmids were digested with NotI and XbaI to conﬁrm ligation. This plasmid was denoted as pBS-D’.

Fragment A was simultaneously digested out of its TA vector with SpeI and XbaI and dephosphorylated and then puriﬁed from an agarose gel. Digested fragment A was ligated with digested/dephosphorylated pBS-D’ and the ligation transformed into competent E. coli JM109 cells. Eight colonies were screened via colony PCR using the primers RSP-SY-

FaF/SY8725R(Kpn), cultured in LB broth supplemented with 100 μg/mL of ampicillin, and plasmids were isolated. Plasmids were digested with SpeI and XbaI to conﬁrm ligation. This plasmid was denoted at pBS-A’D’.

pBS-A’D’ was simultaneously digested with KpnI and dephosphorylated and then pu- riﬁed from an agarose gel.

23 2.1.4 Subcloning the Terminator into the Intermediate Vector

pBS35SHDV (see 2.1.1) was digested with KpnI, then puriﬁed from an agarose gel. Digested HDVnos was ligated with digested/dephosphorylated pBS-A’D’ (see 2.1.3) and transformed into competent E. coli JM109 cells. Eight colonies were screened via colony PCR using the primers SY7581F(Sal)/M13R and SY7581F/KpnNos-R to conﬁrm the correct orientation of

HDVnos. Four colonies were cultured in LB broth supplemented with 100 μg/mL of ampicillin and plasmids were isolated. Plasmids were digested with KpnI to conﬁrm ligation. The new plasmid was denoted as pBS-A’D’HDV.

2.1.5 Removing Restriction Sites

The XbaI restriction site at the 5’ end of the cDNA of the viral genome was removed from

pBS-A’D’HDV (see 2.1.4) via SDM using the primers SYmuXbF/SYmuXbR. Mutated DNA was puriﬁed from an agarose gel and transformed into competent E. coli JM109 cells. Eight colonies were subcultured in LB broth containing 100 μg/mL of ampicillin and plasmids were isolated and digested with XbaI to conﬁrm XbaI removal. This plasmid was denoted as pBS-

AD’HDV.

The 3’ KpnI restriction site was removed from pBS-AD’HDV via SDM using the primers SYmuKpnF/SYmuKpnR. Mutated DNA was puriﬁed from an agarose gel transformed into competent E. coli JM109 cells. Eight colonies were subcultured in LB broth containing 100

μg/mL of ampicillin and plasmids were isolated and digested with KpnI to conﬁrm KpnI re-

moval. This plasmid was denoted as pBS-ADHDV. pBS-ADHDV was sent to the Genomics Facility at the University of Guelph for Sanger sequencing of CaMV35S and HDVnos.

pBS-ADHDV was sequentially digested with SpeI and SalI due to lack of compatible

buffers for double digestion. pBS-ADHDV was first digested with SpeI and purified from an agarose gel. This purified DNA was then digested with SalI and purified again.

2.1.6 Subcloning Fragments B1, B2 & C into the Intermediate Vector

An internal KpnI site was removed from fragment C via SDM using the primers RSP-SY- muKpnF/RSP-SY-muKpnR. Mutated DNA was puriﬁed from an agarose gel and transformed

24 into competent E. coli JM109 cells. Eight colonies were subcultured in LB broth containing

100 μg/mL of ampicillin and plasmids were isolated and digested with KpnI to conﬁrm KpnI removal.

Fragments B2 and C were amplified from their TA vectors for OE-PCR via ampli- fication with PaCeR PCR using the primers RSP-SY-FbF1/RSP-SY-FbR3012 and RSP-SY- FcF2/RSP-SYmuSalR, respectively, and purified from an agarose gel. The purified fragments were joined via OE-PCR using the primers RSP-SY-FbF2831/RSP-SYmuSalR. PCR products were purified from an agarose gel. This DNA was called fragment B2C.

Fragment B2C was sequentially digested with SpeI and SalI due to lack of compatible buffers for double digestion. Fragment B2C was first digested with SpeI and purified from an agarose gel. The purified DNA was then digested with SalI and purified again. Digested frag-

ment B2C was ligated with digested pBS-ADHDV (see 2.1.6) and transformed into competent E. coli JM109 cells. After multiple ligation/transformation attempts, possibly due to inefﬁciency of the SalI enzyme being used, only one colony was obtained. This colony was subcultured in

LB broth containing 100 μg/mL of ampicillin and the plasmid was isolated and digested with

SpeI and KpnI to conﬁrm ligation. The resultant plasmid was denoted as pBS-AB2CDHDV.

pBS-AB2CDHDV was sent to the Genomics Facility at the University of Guelph for sequencing of fragment B2C.

pBS-AB2CDHDV was simultaneously digested with SpeI and dephosphorylated and then puriﬁed from an agarose gel.

An internal SpeI site was removed from fragment B1 via SDM using the primers RSP-SY-muSpeF/RSP-SY-muSpeR. Mutated DNA was puriﬁed from an agarose gel and transformed into competent E. coli JM109 cells. Six colonies were subcultured in LB broth containing 100 μg/mL of ampicillin and plasmids were isolated and digested with SpeI to conﬁrm SpeI removal.

Fragment B1 was digested out of its TA vector with SpeI, puriﬁed from an agarose gel, ligated with digested/dephosphorylated pBS-AB2CDHDV, and transformed into competent E.

coli JM109 cells. Six colonies were subcultured in LB broth containing 100 μg/mL of ampicillin and plasmids were isolated and analysed via SacI and KpnI digests to conﬁrm ligation.

25 Plasmids were also screened via PCR using the primers RSP-SY-FbF1/RSP-SY-FbR3012 to conﬁrm the correct orientation of fragment B1. This plasmid was denoted as pBS-RSPMGT. 2.2 Wildtype Clone pBS-RSPMGT was subcloned into the binary vector pCB-301.3 (see Figure 6), which is a variant of the binary plasmid pCB-301 (AF139061) (Xiang et al., 1999) that no longer has a NotI site at position 98. pBS-RSPMGT and pCB-301.3 were digested with KpnI and NotI and puriﬁed from an agarose gel. Digested pBS-RSPMGT and digested pCB-301.3 were ligated and transformed into competent E. coli DH5α cells. Six colonies were subcultured in LB broth containing 50

μg/mL of kanamycin and plasmids were isolated and analysed via SacI and KpnI digests to conﬁrm ligation. This new plasmid was denoted as pRSPMGT.

To compare CP production, the GRSPaV-GG full length clone in pCAMBIA-1390 with established infectivity (Meng et al., 2013), herein denoted as pRSPGG-GFP, was used as a positive control.

Figure 6: Vector map for pCB-301.3. Restriction sites in red are not unique in the multiple cloning site (MCS).

26 2.3 VIGS Clone

VIGS and GFP-tagged clones were produced from pBS-RSPMGT. A DNA segment consisting of fragment D, containing the CP gene and promoter, and the HDVnos terminator was subcloned into a new plasmids to reduce plasmid size and facilitate manipulation 7). BamHI and PstI sites were inserted between the CP SGP and CP ORF. The CP SGP is considered the 97 bp of sequence immediately upstream from the CP start codon (Hooker and Meng, 2017). The PstI site was the site for insertion of SGP derived from the GRSPaV-GG clone (accession: JQ922417.1 (Meng et al., 2013)) because it is sufﬁciently different from the CP SGP in SY, reducing the likelihood of homologous recombination, yet closely-related enough to reduce incompatibility issues. The BamHI site was the site for insertion of either GFP (GFP-tagged clone) or PDS (VIGS clone). Once PDS was subcloned into the plasmid, the presence of an internal BamHI site in the plasmid resulted in the ﬁrst 198 bp of fragment D being removed. The solution was to mutate the 3’ BamHI site to NdeI and amplify GFP with a 3’ NdeI site so that it could be inserted between BamHI and NdeI, then the removed 198 bp of fragment D was re-inserted at the BamHI site in the proper orientation (Figure 7). The two fragment D/HDV recombinants, containing either GFP/SGP or PDS/SGP, were inserted back into the wildtype clone where fragment D/HDV was previously removed to reconstitute the full-length virus with GFP and PDS inserts.

2.3.1 Inserting Restriction Sites into Fragment D

pBS-RSPMGT and pBS35SHDV (see 2.1.2) were digested with SalI and KpnI and puriﬁed from

an agarose gel. pBS-RSPMGT digestion released a DNA segment consisting of fragment D, containing the CP gene and promoter, and the HDVnos terminator. This DNA segment and

digested pBS35SHDV were ligated and transformed into competent E. coli DH5αcells. Eight colonies were subcultured in LB broth containing 100 μg/mL of ampicillin and plasmids were isolated and analysed via BamHI, SalI, and KpnI digests to conﬁrm ligation. This plasmid was

denoted as pBS-FdHDV.

BamHI and PstI, restriction sites not present in fragment D or HDVnos, were added to

pBS-FdHDV immediately before the CP start codon via SDM using the primers RSP-SY-BaPs-

27 Figure 7: Plan for creating GFP-tagged and VIGS vectors from the wildtype GRSPaV-SY clone. The ﬁrst 198 bp of fragment D were unintentionally removed and it had to be re-inserted.

28 Fm/RSP-SY-BaPs-Rm. Mutated DNA was puriﬁed from an agarose gel and transformed into competent E. coli JM109 cells. Four colonies were subcultured in LB broth containing 100

μg/mL of ampicillin and plasmids were isolated from the cultures and analysed via BamHI and PstI digests to conﬁrm BamHI and PstI insertion. This plasmid was denoted as pBS-

FdbapsHDV.

pBS-FdbapsHDV was digested with BamHI and puriﬁed from an agarose gel.

2.3.2 PDS Cloning

The PDS gene was reverse transcribed from total RNA extracted from V. vinifera using only the PSD1352R primer. A PDS fragment containing BamHI restriction sites at both ends, denoted as PDSbam, was amplified via PaCeR PCR using the primers Vv-PDSbamF/Vv-PDSbamR. The PCR products were purified from an agarose gel, blunt-end ligated into pJET1.2, and transformed into competent E. coli JM109 cells. Four colonies were subcultured in LB broth containing 100 μg/mL of ampicillin and plasmids were isolated analysed via BamHI digests to confirm ligation. This plasmid was denoted as pJET-PDSbam.

pJET-PDSbam was digested with BamHI and puriﬁed from an agarose gel. This DNA was denoted again as PDSbam.

2.3.3 Subcloning PDS into Fragment D

Digested PDSbam (see 2.3.2) and digested pBS-FdbapsHDV (see 2.3.1) were ligated and transformed into competent E. coli JM109 cells. Six colonies were subcultured in LB broth containing 100 μg/mL of ampicillin and plasmids were isolated and analysed via Taq PCR using the primers M13F/Vv-PDSbamR to identify plasmids with PDS in the forward orientation. This plasmid was denoted as pBS-FdPsHDV-PDSf.

pBS-FdPsHDV-PDSf was digested with PstI and puriﬁed from an agarose gel.

2.3.4 Cloning SGP into Fragment D

The 97 bp corresponding to the putative CP promoter in GRSPaV-GG was ampliﬁed with PstI restriction sites at both ends, denoted as SGPpst, was ampliﬁed via PaCeR PCR using the primers RSP-GG-SGP97pstF/RSP-GG-SGP97pstR and digested with PstI. The digested PCR

29 products were puriﬁed from an agarose gel. Digested SGPpst and digested pBS-FdPsHDV- PDSf(see 2.3.3) were ligated and transformed into competent E. coli JM109 cells. Eight colonies were subcultured in LB broth containing 100 μg/mL of ampicillin and plasmids were isolated and analysed via PCR using the primers Vv-PDSbamF/RSP-GG-SGP97pstR to iden-

tify plasmids with SGP in the forward orientation. This plasmid was denoted as pBS-FdHDV- PDSf.

2.3.5 Reinserting Missing Viral Sequence

An oversight in examining the restriction sites present in pBS35SHDV resulted in BamHI digestion removing the ﬁrst 192 bp of fragment D. This was resolved by replacing the 3’ BamHI site

of PDS in pBS-FdHDV-PDSf with NdeI via SDM using the primers SGPfBamMU-F/PDSfBamMU- R. This plasmid was denoted as pBS-PDSfBamMu.

pBS-PDSfBamMu and pBS-FdbapsHDV were digested with BamHI and puriﬁed from an agarose gel. The puriﬁed pBS-FdbapsHDV band was denoted as Fd200. Fd200 and digested/dephosphorylated pBS-PDSfBamMu were ligated and transformed into competent E.

coli JM109 cells. Twelve colonies were subcultured in LB broth containing 100 μg/mL of ampicillin and plasmids were isolated and analysed via NdeI and SalI digests to conﬁrm ligation. This plasmid was denoted as pBS-PDSf*200.

2.3.6 Subcloning recombinant PDS Fragment into Full Length Clone and

Binary Vector

pBS-PDSf*200 and pRSPMGT were digested with SalI and KpnI, puriﬁed from an agarose gel, ligated, and transformed into competent E. coli JM109 cells. Six colonies were subcultured in LB broth containing 50 μg/mL of kanamycin and plasmids were isolated and analysed via

KpnI and SalI digests to conﬁrm ligation. This plasmid was denoted as pRSPMGT-PDSf.

2.3.7 Subcloning PDS into GRSPaV-GG

For a comparison of VIGS potential, the same PDS sequence was inserted into pRSPGG-GFP as well. GFP was removed via BamHI digestion and the linearised pRSP was dephosphorylated, puriﬁed from an agarose gel, ligated with BamHI-digested PDSbam (see 2.3.3), and

30 transformed into competent E. coli JM109 cells. Six isolated colonies were subcultured in LB

broth containing 50 μg/mL of kanamycin and plasmids were isolated and analysed via PCR

using the primers RSP6821F/Vv-PDSbamR. The new plasmid was denoted as pRSPGG-PDSf. 2.4 GFP Expression Vector

2.4.1 GFP Cloning

The GFP ORF was ampliﬁed with a BamHI site at the 5’ end and an NdeI site at the 3’ end,

denoted as GFPbamnde, from pRSPGG-GFP via PaCeR PCR using the primers eGFPbam- F/eGFPnde-R, puriﬁed from an agarose gel, blunt-end ligated into pJET1.2, and transformed into competent E. coli JM109 cells. Eight colonies were subcultured in LB broth containing

100 μg/mL of ampicillin and plasmids were isolated and analysed via BamHI and NdeI digests to conﬁrm ligation. This plasmid was denoted as pJET-GFPbamnde.

pJET-GFPbamnde was digested with BamHI and NdeI and puriﬁed from an agarose gel.

pBS-PDSfBamMu (see 2.3.5) was digested with BamHI and NdeI to remove PDS and puriﬁed from an agarose gel. Digested GFPbamnde (see 2.3.5) and digested PDSfBamMu were ligated and transformed into competent E. coli JM109 cells. Ten colonies were subcultured in

LB broth containing 100 μg/mL of ampicillin and plasmids were isolated and analysed via PCR using the primers eGFPbam-F/RSP-GG-SGP97pstR. This plasmid was denoted as pBS-GFP*.

pBS-GFP* was digested with BamHI, puriﬁed from an agarose gel, and dephosphorylated.

2.4.2 Reinserting Missing Viral Sequence

Fd200 (see 2.3.5) and digested/dephosphorylated pBS-GFP* (see ??) were ligated and transformed into competent E. coli JM109 cells. Eight colonies were subcultured in LB broth con-

taining 100 μg/mL of ampicillin and plasmids were isolated and analysed via Taq PCR using the primers SY7581F(Sal)/SY8725R(Kpn). This plasmid was denoted as pBS-GFP*200.

pBS-GFP*200 was digested with SalI and KpnI and puriﬁed from an agarose gel.

31 2.4.3 Subcloning recombinant GFP Fragment into Full Length Clone and

Binary Vector

Digested pBS-GFP*200 (see 2.4.2) and digested pRSPMGT (see 2.3.6) were ligated and transformed into competent E. coli JM109 cells. Four colonies were subcultured in LB broth con-

taining 50 μg/mL of kanamycin and plasmids were isolated and analysed via PCR using the

primers SY5938F/SY8725R(Kpn). This plasmid was denoted as pRSPMGT-GFP.

2.4.4 Subcloning GFP into GRSPaV-GG

pRSPGG-GFP that already contained the GFP ORF (Meng et al., 2013) in a similar location as

the pRSPMGT-GFP clone was used as a positive control and to compare GFP expression. 2.5 Infectivity Assays in N. benthamiana

All constructs (pRSPMGT, pRSPMGT-PDSf, pRSPMGT-GFP, pRSPGG-GFP, pRSPGG-PDSf, and pCB-301.3) were transformed into competent A. tumefaciens EHA105 cells. Successful transformation was conﬁrmed via colony PCR using the primers RSP21/RSP22, RSP-SY-FbF2/RSP- SY-FbR3012, RSP-SY-FcF1/Vv-PDSbamR, and SY5938F/

SY8725R(Kpn) for pRSPGG-GFP, pCB-SY, pCB-SY-PDsf, and pCB-SY-GFP, respectively. N. benthamiana plants at the five- or six-leaf stage with leaves not fully expanded were agroinfiltrated on the abaxial side of two 70-80% fully expanded leaves with one plant per time point and per viral construct. Plants were infiltrated with cells containing pCB-SY, pCB-SY-

GFP, pCB-SY-PDSf, pRSPGG-PDSf as the treatments, pRSPGG-GFP as the positive control (Meng et al., 2013), and pCB-301.3 containing no insert as the mock-infected negative control. >5 independent agroinﬁltration experiments were performed for observing GFP ﬂuorescence microscopically.

For VIGS assays, ﬁnal A. tumefaciens OD600 values of 0.2, 0.4, 0.7, and 0.9 were tested. 2.6 Infectivity Assays in V. vinifera

The same constructs as above, excluding pCB-301.3, were agroinfiltrated into ∼15–20 plants each. All plants were co-infiltrated with p24, a strong RSS encoded by GLRaV-2, to help establish infection. GFP clones of MGT, GG, and GLRaV-2 were combined and infiltrated into

32 the same plants, as were the VIGS clones of MGT, GG, and GLRaV-2. 2.7 Analyses

Three N. benthamiana plants were infected per construct for each time point. Only one plant for each time point was infected with the negative pCB-301.3 control. Leaves were collected at 2, 3, 5, 7, and 10 days post-inoculation (dpi), ground in liquid nitrogen until they were fine powders, and stored at –70◦C. Infiltrated areas, areas of the infiltrated leaves that had not been infiltrated, and non-infiltrated leaves were all examined.

2.7.1 Genome Sequencing

The sequencing plan and coverage is shown in Figure 8. All sequences were sent to the Ge- nomics Facility at the University of Guelph for Sanger sequencing.

2.7.2 Symptom observation

Macroscopic symptoms were assessed visually and compared with negative and positive agroin- ﬁltration controls.

2.7.3 Western Blotting

∼500 mg of sample was homogenized with a mortar and pestle in 1 volume (i.e. 500 μL) of a

modiﬁed tris-buffered saline buffer (2.5 mM tris (pH 8.2), 0.05 mM KCl, 5 mM MgCl2, 400 mM sucrose, 4% glycerol, 0.0007% of β-mercaptoethanol (β-MC), and 1 mM phenylmethyl- sulfonyl ﬂuoride (PMSF)). Homogenates were centrifuged at 8000 x g at 4◦C for 10 minutes and the supernatants containing the extracted proteins were harvested. Each extract was mixed with 6x loading buffer (0.375 M pH 6.8 Tris-Cl, 60% glycerol, 12%SDS, 0.6 M DTT, 0.06% bromophenol, and autoclaved MilliQ water), denatured in boiling water for 10 minutes, and immediately placed on ice. Proteins were separated on 5–12% discontinuous sodium dodecyl sulphate polyacrylamide gels (SDS-PAGE) and transferred to PVDF membranes (∼15 minutes). Membranes were blocked with a phosphate buffered saline (PBS) solution (1.4 mM

NaCl, 0.03 mM KCl, 0.1 mM Na2HPO4-7H2O, 0.02 mM KH2PO4, and autoclaved MilliQ water) containing 0.05% Tween-20 (PBS-T) and 3% skim milk for 30 minutes at room temperature with gentle shaking. PBS-T/skim milk solutions were decanted, diluted to 1% skim milk,

33 34

Figure 8: Coverage Diagram of plan to sequence entire wildtype GRSPaV-SY clone (pBS-SY) genome. Primers were all complementary to the VD-102 (accession: MF979534.1), the most similar GRSPaV-SY strain to this clone. and the 1◦ Ab was added at the indicated concentrations. Membranes were incubated in this solution overnight at 4◦C with gentle shaking. Membranes were washed five times with PBS-T for 5 minutes each time. Membranes were then incubated in PBS-T supplemented with the 2◦ antibody added at the indicated concentration and incubated for 2 hours at room temperature with gentle shaking. Membranes were washed five times with PBS-T for 5 minutes each time, drained of excess liquid, and incubated in Pierce ECL Western Blotting Substrate (Thermo Sci- entific) at room temperature for 5 minutes. Membranes were drained of excess liquid, sealed in plastic wrap, and viewed with a ChemiDoc Imaging System (Bio-Rad) and/or developed onto X-ray film with exposures ranging from 5 seconds–15 minutes.

To detect CP, the 1◦ antibody (Ab) was polyclonal anti-GRSPaV CP from rabbit (produced from insect cell culture) diluted to 1:5000. The 2◦ Ab was anti-rabbit IgG horseradish peroxidase-linked Ab from donkey (GE Healthcare) diluted to 1:7000. Protein extracts from the three plant replicates at 10 dpi for each construct were analysed.

To detect GFP, the 1◦ Ab was anti-GFP N-terminus from rabbit (Millipore Sigma) diluted to 1:5000. The 2◦ Ab was anti-rabbit IgG horseradish peroxidase-linked Ab from donkey diluted to 1:7000. Protein extracts for the three replicates of each construct at each time point

were pooled (15 μL each; for pCB-301.3, 10 μL of protein extracts from all time points were pooled).

All protein samples were ∼0.8–1.0 mg/mL and 40–60 μL for each sample was loaded.

2.7.4 Fluorescence Microscopy

Sections of agro-inﬁltrated leaves were placed up-side down on a glass slide and observed using a Leica DM4500B epiﬂuorescence microscope (Leica Microsystems). Emissions from the GFP and RFP excitation wavelengths were observed for all samples.

2.7.5 Bioinformatic & Statistical Analyses

Multiple alignments were performed using ClustalO with ﬁve combined iterations (Madeira et al., 2019).

Western blots were analysed using Fiji (Schindelin et al., 2012) and graphed in R version 3.6.1 (R Core Team, 2013). A two-sample Student’s t-test was performed for values ob-

35 tained from a Western blot of triplicate 7 and 10 dpi samples of SY and GG (Figure A1).

Phylogenetic trees were constructed using MEGA X (Kumar et al., 2018). The Maxi- mum Likelihood method and Tamura-Nei model (Tamura and Nei, 1993) were used to create bootstrap consensus trees with the highest log likelihood. Initial trees for the heuristic search were obtained by applying Neighbour-Join and BioNJ algorithms to a matrix of pairwise dis- tances estimated using the Maximum Composite Likelihood (MCL) approach, and then select-

ing the topology with best log likelihood value. The pBS-RSPMGT consensus sequence (A.2) obtained from sequencing (see 2.7.1) was including as well as a modiﬁed VD-102 sequence,

based on the pBS-RSPMGT consensus sequence, to ﬁll the 18 bp gap. 109 nucleotide sequences of complete GRSPaV genomes and a total of 8779 nucleotide positions were used. SGP and 3’ UTR regions 2◦ RNA structures were predicted and multiple sequence alignments between prominent strains were performed.

2◦ RNA structures were produced using Mfold (Zuker, 2003) and edited using RNA2Drawer (Johnson et al., 2019). 3◦ RNA structures were produced using RNAComposer (Antczak et al., 2016) and visualized using PyMol (Schrodinger,¨ LLC, 2015). All possible structures were examined and the most likely (i.e. energetically favourable) ones were presented.

Hydrophobicity scores were calculated using ProtScale (Gasteiger et al., 2005) and the Kyte & Doolittle scale (J and Doolittle, 1982). The raw outputs were graphed in R version 3.6.1.

Ab initio protein modelling was performed using DMPfold (Greener et al., 2019) and visualized using PyMol.

3 RESULTS

3.1 Construction of wildtype and GFP-tagged full-length clones

for GRSPaV isolate VD-102

Sequencing results obtained during cloning are detailed in Table 1. All fragments were most closely related to VD-102 with the exception of fragment D, which was most closely related

to the original SY reference strain. The HDVnos terminator in pBS-A’D’HDV shared >99% nt

36 with the terminators in other plant viral vectors and the ﬁrst 85 bp shared 98.85% nt with many

HDV isolates, likely in a ribozyme-encoding region. The 97 bp CP SGP region from pRSPGG that was used to create pRSPMGT-GFP and pRSPMGT-PDSf shared ∼84% nt with the 97 bp CP SGP from SY/VD-102.

Table 1: Percent nucleotide identity between TA cloned fragments and the GRSPaV-SY and VD-102 genomes. The 3’ end of fragment D was not sequenced because of the viral poly(A) tail interfered with results. . Percent nt ID GRSPaV-SY Isolate VD-102 Fragment Plasmid Terminus (accession: AY368590.1) (accession: MF979534.1) 95.2 98.6 A pCR2.1-Fa N/A 95.2 98.6 5’ 91.4 97.3 B1 pMD-Fb1 3’ 91.3 97.4 5’ 90.8 98.8 B2 pMD-Fb2 3’ 94.4 98.6 5’ 95.3 98.6 C pCR2.1-Fc 3’ 93.0 95.3 5’ 95.3 91.7 D pCR2.1-Fd 3’ N/A N/A

The consensus sequence of the pBS-RSPMGT is provided in A.2. A multiple sequence alignment of VD-102 with other prominent strains revealed an 18 nt gap from 7131–7148 bp. pBS-RSPMGT, which is most closely related to VD-102 (Table A1), did not have this 18 nt gap, implying that VD-102 sequencing was incomplete and that this gap is an artefact (Figure 9).

37 Figure 9: Multiple sequence alignment of the pRSPMGT and 13 prominent GRSPaV strains shows a gap in VD-102 sequencing. The VD-102 genome (MF979534.1) contains an 18 bp gap from 7131–7148 bp, which was conﬁrmed to be an error due to incomplete sequencing based on the sequence of the MGT clone, which shares 97% nucleotide with VD-102. Sequences for 1, CA, GG, SG1, BS, PN, PG, MG, WA, JF, LSL, and SY correspond to accessions NC 001948.1, AF026278.1, JQ922417.1, AY881626.1, AY881627.1, AY368172.2, HE591388.1, FR691076.1, KC427107.1,KR054734.1, KR054735.1, and AY368590.1, respectively. pBS-RSPMGT represents the consensus sequence of the GRSPaV-SY wildtype clone constructed here.

Phylogenetic analysis showed that the MGT isolate is most closely related to VD- 102, which can be considered a variant of SY (Figure 10). Three distinct clusters containing GG/SG1/–1/WA/BS/PN, PN/LSL/JF/VF1, and SY were produced. 3.2 Infectivity of wildtype and GFP-tagged MGT clones in

N. benthamiana

Agroinfiltration with either the pRSPMGT (wildtype) or pRSPMGT-GFP (GFP-tagged) MGT clones in N. benthamiana did not produce visible symptoms when compared to the mock- infiltrated negative control. Eventual collapse of infiltrated leaves occurred for all plants beyond ∼15 dpi due to the stress of agroinfiltration. Infectivity of the wildtype clone had to be inferred from GFP production by the GFP-tagged clone because the anti-GRSPaV CP Ab was unreliable in N. benthamiana, as there was a lot of background signal, especially with the large subunit of

38 rubisco at ∼55 kDa (Figure 11). Consequently, the wildtype clone’s infectivity was unable to be conﬁrmed through Western blotting of viral CP. The rootstock MGT 101-14 positive control strongly detected the ∼28 kDa CP protein (Figure 11, see arrow), indicating that there was no issue with Ab binding. Comparison of the positive control with all other lanes shows the lack of Ab binding to V. vinifera rubisco compared to N. benthamiana rubisco.

pRSPMGT-GFP replicated significantly faster than pRSPGG-GFP based on the rate of fluorescence accumulation (Figure 12, Figure 13). This was observed in over five independent agroinfiltration experiments. Globular structures appeared to increase in size and number over

the course of infection, more prominently for pRSPMGT-GFP than for pRSPGG-GFP. These structures were not observed in any negative controls (Figure 12, inset) and are possibly VRCs. Side-by-side agroinfiltrations in different halves of the same leaf were less efficient than infil- trations in separate leaves as fluorescence did not accumulate as quickly and leaf health was

affected to a much greater degree. Despite this, pRSPMGT-GFP still produced more GFP more

quickly than pRSPGG-GFP (Figure 14) (n > 5). No fluorescence in non-infiltrated parts of leaves was observed for either pRSPMGT-GFP or pRSPGG-GFP and neither strain was detected in upper uninfiltrated leaves.

Faster GFP production by pRSPMGT-GFP was also conﬁrmed through Western blotting

(Figure 15). GFP production was similar between pRSPMGT-GFP and pRSPGG-GFP until 5-7 dpi, at which point GFP accumulated more signiﬁcantly in MGT-inﬁltrated leaves (Figure 16).

The amount of GFP present in pRSPGG-GFP-inﬁltrated plants was fairly constant at all time

points, where-as in pRSPMGT-GFP-inﬁltrated plants GFP production increased over 80% from 2 to 10 dpi. The difference in GFP accumulation, based on normalized band density, was not

significant at the α= 0.05 significance level for 7 dpi (one-tailed p=0.11), possibly due to small sample size, but GFP accumulation was significant at 10 dpi (one-tailed p=0.02). 3.3 RNA & Protein Structure Predictions

Ab initio modelling was used to model the structures of the 3’ UTR, CP SGP, and 5’ CP sgRNA UTR RNA as well as protein structures for all replicase domains and proteins of MGT and GG.

39 3.4 Effectiveness of pRSPMGT-PDSf and pRSPGG-PDSf as VIGS

vectors in N. benthamiana

Inﬁltrated leaves were unable to survive longer than ∼15–18 days, which may have been too short to observe potential symptoms. This was likely due to the stress of agroinﬁltration. This occurred for every dilution (OD600 0.2, 0.4, 0.7, and 0.9) of A. tumefaciens tested.

40 Figure 10: Phylogenetic tree of all GRSPaV isolates for which complete or near complete genomes are available. The percentage of trees (500 replicates) in which the associated taxa clustered together are shown next to the branches. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. Prominent isolate sequences are indicated in parentheses and phylogroups are indicated with brackets. Large branches were condensed, represented by triangles, and the number of sequences is proportionate to the triangle size. pBS-RSPMGT represents the consensus sequence of the wildtype MGT clone. 41 Figure 11: Western blot for detecting GRSPaV CP from N. benthamiana agroinfiltrated with pRSPMGT-GFP, pRSPGG-GFP, and pCB-301.3 (–) at 10 days post-infiltration (dpi). Proteins extracted from the original 101-14 rootstock that was used for clone construction were used as a positive control (+) and produced the desired ∼28 kDa band (arrow; ∼27 mg of protein). Faint bands at ∼28 kDa were inconsistent over multiple blots and showed no definitive pattern. This demonstrated the strong cross-reactivity and inconsistent CP detection of the anti-GRSPaV CP antibody in N. benthamiana.

42 Figure 12: N. benthamiana infiltrated with pRSPMGT-GFP from 2 to 10 days post-infiltration (dpi) at 100x magnification. (A) 2 dpi. (B) 3 dpi. (C) 5 dpi. (D) 7 dpi. (E) 10 dpi. Green images were taken using the GFP excitation spectrum and red images were taken using the RFP excitation spectrum. The lack of RFP fluorescence demonstrates that fluorescence in the GFP excitation spectrum is likely due to GFP expression and not plant autofluorescence. The same pattern was observed for over five independent infiltration experiments. Inset: 10 dpi images of a pCB-301.3 mock-infiltrated negative control.

43 Figure 13: N. benthamiana infiltrated with pRSPGG-GFP from 2 to 10 days post-infiltration (dpi) at 100x magnification. (A) 2 dpi. (B) 3 dpi. (C) 5 dpi. (D) 7 dpi. (E) 10 dpi. Green images were taken using the GFP excitation spectrum and red images were taken using the RFP excitation spectrum. The lack of RFP fluorescence demonstrates that fluorescence in the GFP excitation spectrum is likely due to GFP expression and not plant autofluorescence. The same pattern was observed for over five independent infiltration experiments.

44 Figure 14: N. benthamiana infiltrated with pRSPGG-GFP (left) and pRSPMGT-GFP (right) in the same leaf from 2 to 10 days post-infiltration (dpi) at 100x magnification. (A) 2 dpi. (B) 3 dpi. (C) 5 dpi. (D) 7 dpi. (E) 10 dpi. Green images were taken using the GFP excitation spectrum and red images were taken using the RFP excitation spectrum. The lack of RFP fluorescence demonstrates that fluorescence in the GFP excitation spectrum is likely due to GFP expression and not plant autofluorescence. The same pattern was observed for three independent infiltration experiments.

45 Figure 15: Western blot of pooled protein extracts (n=3) for detecting GFP from N. benthamiana agroinﬁltrated with pRSPMGT-GFP, pRSPGG-GFP, and pCB-301.3 (–) at 2, 3, 5, 7, and 10 days post-inﬁltration (dpi).

pRSPMGT-GFP produced more GFP (∼26 kDa) over time than pRSPGG-GFP, which was fairly consistent throughout the time course.

46 Figure 16: Analysis of GFP bands from a Western blot for N. benthamiana agroinfiltrated with pRSPMGT-GFP and pRSPGG-GFP from 2 to 10 days post-infiltration (dpi). A: Normalized density values. B: Normalized percent differences in density values relative to 2 dpi. Bands corresponding to GFP were normalized to the ∼35 kDa protein bands, present at a consistent density throughout all blots and lanes, in their respective wells. By 10 dpi, pRSPMGT-GFP accumulated significantly more GFP (* p<0.05).

47 Figure 17: Predicted 2◦ and 3◦ RNA structures of the (+)-sense strands of the 3’ UTRs of MGT and GG. The two most energetically favourable structures are presented, with 1 being the most favourable. Coloured bases form stem loops and black bases are unpaired. Green and red circles surround the 5’- and 3’-most nucleotides, respectively. Inset: An example of a pseudoknot structure.

48 Figure 18: Predicted 3◦ protein structures of the replicase domains of MGT (red) and GG (grey).

49 Figure 19: Predicted 3◦ protein structures of the proteins of MGT (red) and GG (grey). Inset: Top view of TGBp2.

50 51

Figure 20: Hydrophobicity plots of proteins for MGT (black) and GG (red). High scores represent more hydrophilic residues and low scores represent more hydrophobic residues. Figure 21: Predicted 2◦ and 3◦ RNA structures of the (–)-sense strands of the 97 nt CP SGP region of MGT and GG. The three most energetically favourable structures are presented, with 1 being the most favourable. Coloured bases form stem loops and black bases are unpaired. Green and red circles surround the 5’- and 3’-most nucleotides, respectively.

52 Figure 22: Predicted 2◦ and 3◦ RNA structures of the (–)-sense strands of the 70 nt CP SGP region minus the CP sgRNA 5’ UTR of MGT and GG. All energetically favourable structures are presented, with 1 being the most favourable. Coloured bases form stem loops and black bases are unpaired. Green and red circles surround the 5’- and 3’-most nucleotides, respectively.

53 Figure 23: Predicted 2◦ and 3◦ RNA structures of the (+)-sense strands of the GFP sgRNA 5’ UTRs of MGT and GG. The three most energetically favourable structures are presented, with 1 being the most favourable. Coloured bases form stem loops and black bases are unpaired. Green and red circles surround the 5’- and 3’-most nucleotides, respectively.

54 4 DISCUSSION GRSPaV is considered to be the most ubiquitous of all grapevine viruses and is associated with harmful diseases such as RSP, GVN, and SD, all of which are detrimental to plant health. GRSPaV is highly variable and the contributions of different variants to diseases/symptoms has not been studied extensively. Isolates from different phylogroups may differ in genome replication, transcription, or other pathological attributes, which could result in different degrees of virulence or distinct diseases. The purpose of this research was to create a full-length infectious clone of an isolate representing the SY phylogroup, which has often been associated with harmful symptoms, and its GFP-tagged variant. These clones may be useful for studying molecular, cellular, and pathogenic aspects of the SY phylogroup. It may also be developed into a VIGS vector for studying gene-function relationships in grapevines and for comparison with other grapevine VIGS vectors.

An SY-like clone was successfully constructed for the first time, as confirmed by full- length sequencing. This clone was not identical to SY, despite belonging in the same phylogroup, and was most similar to the Croatian isolate VD-102. Nonetheless, this clone is suf- ficiently similar to SY and dissimilar to any other GRSPaV strain to make it useful for study of the SY phylogroup. The efficacy of the wildtype MGT clone could not be assessed in N. benthamiana due to strong background signals of the anti-GRSPaV CP Ab, so its efficacy is inferred from the GFP-tagged MGT clone. Inability to detect CP using the polyclonal Ab is not due the lack of reactivity with the CP of isolate MGT as CP was clearly detected in Western blotting when using extract from the source material of MGT 101-14. However, the detection remains unreliable in N. benthamiana and CP detection for the wildtype clone will be most reliable in the native host, V. vinifera. For this reason, all experiments were performed with the GFP-tagged clone. To assess the clone’s replication, CP and GFP production over time were observed.

There is a clear and consistent difference in the rate of GFP production by pRSPMGT-

GFP and pRSPGG-GFP (Figure 16). By 10 dpi, the amount of GFP produced by pRSPMGT-

GFP was signiﬁcantly higher than pRSPGG-GFP as determined by both Western blotting and

55 ﬂuorescence microscopy. The difference in GFP amount between pRSPMGT-GFP and pRSPGG- GFP was not signiﬁcant at 7 dpi, although this is likely due to small sample size since, while Student t-tests can be used for small sample sizes (de Winter, 2013), they are optimized for larger ones. Additionally, the GFP produced by pRSPGG-GFP was relatively constant over the course of infection while for pRSPMGT-GFP it steadily increased after 3 dpi.

There are several possible reasons for increased GFP production by MGT relative to GG:

1. MGT is more efﬁcient at transcribing/replicating gRNA, resulting in higher levels of all sgRNA species, due to either more efﬁcient 3’ UTR structure or replication proteins.

2. MGT is more efﬁcient at transcribing GFP sgRNA GFP due to the RNA structure/sequence of the CP SGP in MGT.

3. MGT sgRNA for GFP is translated more efﬁciently due to the RNA structure of the sgRNA 5’ UTR.

A phylogenetic tree was made for all GRSPaV isolates for which complete or near complete genomes are available, which revealed three broad clusters of viral variants: SY (referred to as the SY phylogroup; contains MGT), GG/SG1/–1/WA/BS/PG (referred to as the GG phylogroup), and PN/LSL/JF/VF1 (referred to as the PN phylogroup) (Figure 10). A strain from each of these phylogroups, MGT, GG, and PN, will be compared in each of the aspects listed above.

Stem-loops (SLs) are commonly found in SGPs and 3’ UTRs and are associated with RdRp binding and the synthesis of the full-length negative strand RNA that serves as the template for genome replication and sgRNA transcription. Two or more SLs or a single SL and a complementary section of ssRNA can form a pseudoknot structure that is highly correlated with increased RNA stability and translation efficiency (Gallie and Walbot, 1990; Newburn and White, 2015). Pseudoknots are also believed to bind RdRp more efficiently, thus potentially increasing (–)-sense strand and sgRNA transcription efficiency (Cheng et al., 2002; Osman et al., 2000). The 3’ UTR of MGT appears to form significantly different 2◦ and 3◦ structures

56 compared to GG (Figure 17). The 3’ UTR structures of MGT more closely resemble pseudoknots and are more condensed relative to their counterparts in GG, perhaps contributing to the difference in GFP production between the two strains. This also might represent one of the fundamental differences between the SY and GG phylogroups. Interestingly, the 3’ UTR structure from PN is very different from both MGT’s and GG’s; it is more chaotic, sometimes forming upwards of three SLs and producing large 3◦ structures (Figure A2). The signiﬁcance of this warrants further investigation.

The relative shapes of proteins and protein domains were compared using ab initio modelling to get a rough approximation of the relative structural differences between strains (Figure 18, Figure 19). All of the replicase domains appear nearly identical between strains, with the exception of the RdRp. In MGT, the helices are shorter and less numerous than in GG. Conformation differences can also be observed in the other proteins. For example, TGBp1 has

relatively few structural motifs but there appear to be more α helices in MGT’s TGBp1 than GG’s. TGBp1 contains a helicase domain that spans most of the protein and this is the region where the extra α helices in MGT are located. These helices make the TGBp1 protein more

structurally similar to the HEL domain in the replicase, which has several α helices, possibly making the MGT version of this protein more efﬁcient at separating dsRNA and complementing the activity of the HEL domain during replication. The other proteins do not have functions relating to transcription/replication so it is unlikely that structural differences in these play a large role, although it is interesting to note that MGT’s TGBp2 is mirrored compared to GG’s, with the β sheets and α helices on opposite sides of the protein relative to the ﬁrst α helix (Figure 19, inset).

A similar situation was observed for TGBp3 as well; however, these observations could be an artefact from incorrect modelling and need to be confirmed experimentally, such as by X-ray crystallography. Lastly, the CP proteins are difficult to compare and most areas seem suf- ficiently similar between strains, suggesting there are no significant differences between them. Similar patterns can be seen when comparing protein structures of PN and MGT, although it seems like the differences between MGT and PN are more pronounced than the differences between MGT and GG (Figure A3). The significance of these structural differences is not known

57 and should all be confirmed experimentally before drawing firm conclusions about their contribution to the differences in GFP production. Hydrophobicity plots of the aa sequences from MGT and GG show similar patterns and don’t diverge in small areas (Figure 20). In the replicase and TGBp1 there are minor differences; for example, TGBp1 seems more hydrophobic overall in MGT than in GG. These changes possibly affect protein stability but seem unlikely to significantly alter replication efficiency. Hydrophobicity scores were not calculated for the proteins from strain PN.

There are two ways to look at the CP SGP: The first is to look at the entire exogenous 97 nt region preceding the GFP ORF (Figure 21). While in MGT the SGP is likely to form more SLs compared to GG, it is unlikely that the quantity of SLs has an effect on transcription efficiency/ribosome binding. It is more likely that the nature and structure of SLs alter efficiency. Nonetheless, this may represent another fundamental difference between the SY and GG phylogroups. In contrast to the other strains, PN tends to have larger SLs that are more numerous (Figure A4). It is unclear whether any of these differences would impact sgRNA synthesis. The second way to look at the CP SGP is to remove the 27 nt 5’ UTR present in the CP sgRNA (Xiao and Meng, 2017) and look at the remaining 70 nt (Figure 22). In this case, the MGT SGP forms more condensed structures than in GG, which has a more disorganized structure, both showing similar trends as predicted for the 3’ UTR (Figure 17). The effects these packed RNA structures may have on transcription are unclear, but if these structures bear enough similarity to pseudoknots they may be beneficial to transcription, which would explain the faster GFP production by MGT. PN is also predicted to form these folded-looking structures and bear more similarity to MGT than GG (Figure A4).

Additionally, in both GFP-tagged clones, the expression of GFP was under the control of isolate’s native CP SGPs, which implies that the CP SGP from MGT may be stronger than that from GG since more GFP was produced by MGT. The exogenous SGP used to restore CP expression in the GFP-tagged GG clone came from strain BS, which has a CP SGP that shares more nt ID with MGT’s than GG’s, despite belonging to the same phylogroup as GG. Similarity to the stronger MGT SGP could suggest that the BS SGP is stronger than GG’s, but the strength of these promoters can only be determined by further experimentation and

58 measuring differences in CP expression.

The hypothetical GFP sgRNA, based on CP sgRNA, should have a 27 nt 5’ UTR (Xiao and Meng, 2017). As with the 3’ UTR, pseudoknot-like structures in this 27 nt 5’ UTR region appear more common in MGT than GG, whereas GG forms more helical and less condensed structures (Figure 23). As mentioned previously, this structure can increase sgRNA translation efﬁciency. A similar trend can be seen in PN (Figure A5), which also seems to have pseudoknot structures, although they seems less condensed and prominent than those predicted in MGT. Validation of the RNA structures modelled here could greatly improve knowledge on not only differential replication efﬁciency between viruses but also knowledge about RNA structures and the contribution of pseudoknots to replication.

Overall, the differential GFP production between pRSPMGT-GFP and pRSPGG-GFP makes an interesting case for the increased replication of the MGT isolate compared to GG. Further studies in grapevines and proper analysis of CP expression will conﬁrm or refute this. The models presented here are not conclusive, but suggest potential areas for studying species differences in depth.

The anti-GRSPaV CP Ab binding the large subunit of rubisco so strongly in N. benthamiana and not in V. vinifera is puzzling. Presumably, the overwhelming quantity of rubisco present in plant cells and the undesired binding by the Ab left very little remaining to interact with viral CP The aa sequences of the two proteins are 94% identical and there is little similarity in aa sequence between MGT CP and N. benthamiana rubisco. Alignment of the ab initio

CP model with N. benthamiana rubisco shows similar general characteristics, like many α helices (Figure A6); however, these are also observed in the ab initio model of V. vinifera rubisco, which aligned very well with the crystal structure of rubisco from N. benthamiana, and appear conserved between the two species’ rubisco (Figure A7). If the rabbit source for the Ab had N. benthamiana or a sufﬁciently similar plant, in its diet, it may have developed Ab against the plant’s rubisco, which would be contained in the serum along with the desired anti-GRSPaV CP antibody. This could perhaps explain the speciﬁcity for N. benthamiana rubisco and not V. vinifera’s. It remains unclear what structural differences between the two rubisco proteins are responsible for the stark difference in binding.

59 The efficacy of the VIGS vectors could not be assessed in N. benthamiana, which is unsurprising since it is a herbaceous plant in which GRSPaV does not move cell to cell or systemically. Issues arose from the short life span of infiltrated leaves, ∼15 days, as a result of the stress of agroinfiltration. It was possible that VIGS could have been observed if the leaves lasted longer, so the concentration of A. tumefaciens cells was decreased to see if leaf longevity could be increased. Unfortunately, no changes in leaf health were observed at low cell concentrations and the leaves collapsed at the same time as before. Because the GRSPaV viruses cannot move between cells in N. benthamiana, lowering the cell concentration also lowered the chances of successfully infiltrating cells and reduced the likelihood of PDS expression. Consequently, no conclusion can be made about the usefulness of these vectors. Since N. benthamiana was an unsuitable host, these vectors are being tested in the natural host, V. vinifera.

5 CONCLUSION The MGT clone successfully replicated and produced an exogenous protein in N. benthamiana, which is promising for future infectivity assays in V. vinifera, which are under way. MGT also replicated faster and produced more proteins over time than the GG clone, suggesting the possibility of this strain having increased pathogenicity relative to GG, which may mean that it also plays a larger role in disease. The true reason for the increased replication speed is unknown, although the most likely reason seems to be the possible formation of pseudoknot-like structures in regions like the gRNA 3’ UTR, CP SGP, and CP sgRNA 5’ UTR. It is possible that differences in the 3◦ of other RNA or protein structures contribute as well, but no notable structural differences for these were found. All of the proposed structural differences are theo- retical and must be veriﬁed experimentally. The MGT clone provides a foundation for further studying differences among GRSPaV strains and clarifying disease associations. This clone will be tested in V. vinifera to further explore these areas as well as the use of GRSPaV clones for biotechnological applications, such as VIGS.

60 REFERENCES

Adams, M., Antoniw, J., Bar-Joseph, M., Brunt, A., Candresse, T., Foster, G., Martelli, G., Milne, R., and Fauquet, C. (2004). The new plant virus family Flexiviridae and assessment of molecular criteria for species demarcation. Arch. Virol. 149, 1045–1060.

Adams, M. and Kreuze, J. (2007). Creation of new family Betaﬂexiviridae. Technical report, International Committee on Taxonomy of Viruses.

Adams, M. and Kreuze, J. (2015). Revision of family betaﬂexiviridae,order tymovirales. Tech- nical report, International Committee on Taxonomy of Viruses.

Aguero,¨ J., del Carmen Vives, M., Velazquez,´ K., Pina, J., Navarro, L., Moreno, P., and Guerri, J. (2014). Effectiveness of gene silencing induced by viral vectors based on Citrus leaf blotch virus is different in Nicotiana benthamiana and citrus plants. Virology. 460–461, 154–164.

Al Rwahnih, M., Daubert, S., Golino, D., and Rowhani, A. (2009). Deep sequencing analysis of RNAs from a grapevine showing Syrah decline symptoms reveals a multiple virus infection that includes a novel virus. Virology. 387, 395–401.

Alazem, M. and Lin, N. (2014). Roles of plant hormones in the regulation of host-virus inter- actions. Mol. Plant. Pathol. 16(5), 529–540.

Alliaume, A., Spilmont, A., Beuve, M., and Lemaire, O. (2012). Grapevine vein necrosis is not exclusively associated to GRSPaV group 2 molecular variants. In: Proceedings of the 17th Congress of ICVG, Davis, California, USA, pages 84–85.

Antczak, M., Popenda, M., Zok, T., Sarzynska, J., Ratajczak, T., Tomczyk, K., Adamiak, R., and M, S. (2016). New functionality of RNAComposer: an application to shape the axis of miR160 precursor structure. Acta Biochim. Pol. pages 737–744.

Arroyo-Garc´ıa, R., Ruiz-Garc´ıa, L., Bolling, L., Ocete, R., Lopez,´ M., Arnold, C., Ergul, A., Soylemezo¨ glu,˘ G., Uzun, H., Cabello, F., Iba´nez,˜ J., Aradhya, M., Atanassov, A., Atanassov,

61 I., Balint, S., Cenis, J., Costantini, L., Goris-Lavets, S., Grando, M., Klein, B., McGovern, P., Merdinoglu, D., Pejic, I., Pelsy, F., Primikirios, N., Risovannaya, V., Roubelakis-Angelakis, K., Snoussi, H., Sotiri, P., Tamhankar, S., This, P., Troshin, L., Malpica, J., Lefort, F., and Martinez-Zapater, J. (2006). Multiple origins of cultivated grapevine (Vitis vinifera L. ssp. sativa) based on chloroplast DNA polymorphisms. Mol. Ecol. 15(12), 3707–3714.

Bailey-Elkin, B., Van Kasteren, P., Snijder, E., Kikkert, M., and Mark, B. (2014). Viral otu deubiquitinases: A structural and functional comparison. PLoS Pathog. 10(3), 1–6.

Battany, M., Rowhani, A., and Golino, D. (2004). Syrah in california: Decline or disorder? In: Grapegrowing. Practical WInery and Vineyard.

Bedoya, L., Mart´ınez, F., Orzaez,´ D., and Daros,` J. (2012). Visual tracking of plant virus infection and movement using a reporter MYB transcription factor that activates anthocyanin biosynthesis. Plant Physiol. 158, 1130–1138.

Beuve, M., Hily, J., Alliaume, A., Reinbold, C., Le Maguet, J., Candresse, T., Herrbach, E., and Lemaire, O. (2018). A complex virome unveiled by deep sequencing analysis of RNAs from a French Pinot Noir grapevine exhibiting strong leafroll symptoms. Arch. Virol. 163, 2937–2946.

Beuve, M., Moury, B., Spilmont, A., Sempe-Ignatovic,´ L., Hemmer, C., and Lemaire, O. (2013). Viral sanitary status of declining grapevine Syrah clones and genetic diversity of Grapevine rupestris stem pitting-associated virus. Eur. J. Plant Pathol. 135, 439–452.

Bittner, S. (2015). American roots, french varietals, russian science: A transnational history of the great wine blight in late-tsarist bessarabia. Past and Present. 227(1), 151–177.

Bouyahia, H., Boscia, D., Savino, V., La Notte, P., Pirolo, C., Castellano, M., Minafra, A., and Martelli, G. (2005). Grapevine rupestris stem pitting-associated virus is linked with grapevine vein necrosis. Vitis 44, 133–137.

Bouyahia, H., Materazzi, A., and Triolo, E. (2006). Grapevine vein necrosis: Further data on etiology and diagnosis. In: 2006 First International Symposium on Environment Identities and Mediterranean Area, pages 629–631.

62 Brasch, M., Putri, R., de Ruiter, M., Luque, D., Koay, M., Caston, J., and Cornelissen, J. (2017). Assembling enzymatic cascade pathways inside virus-based nanocages using dual- tasking nucleic acid tags. J. Am. Chem. Soc. 139, 1512–1519.

Bratlie, M. and Drabløs, F. (2005). Bioinformatic mapping of AlkB homology domains in viruses. BMS Genomics. 6(1), 1–15.

Burgyan,´ J. and Havelda, Z. (2011). Viral suppressors of RNA silencing. Cell. 16(5), 265–272.

Bustamante, P. and Hull, R. (1998). Plant virus gene expression strategies. EJB. 1(2), 65–82.

Buzkan, N., La Notte, P., Karadag, S., Aktan, A., Saldarelli, P., and Minafra, A. (2015). De- tection of Grapevine rupestris stem pitting-associated virus in autochthonous grapevine cultivars in Turkey. J. Plant. Pathol. 97(2), 387–389.

Camborde, L., Planchais, S., Tournier, V., Jakubiec, A., Drugeon, G., Lacassagne, E., Pﬂieger, S., Chenon, M., and Isabelle, J. I. (2010). The ubiquitin-proteasome system regulates the accumulation of Turnip yellow mosaic virus RNA-dependent RNA polymerase during viral infection. The Plant Cell. 22, 3142–3152.

Canadian Vintners Association (2019). Industry statistics.

Carbonell, A., Garc´ıa, J., Simon-Mateo,´ C., and Hernandez,´ C. (2016). Plant virus RNA replication. eLS. pages 1–13.

Cheng, C. and Nagy, P. (2003). Mechanism of RNA recombination in carmo- and tombusviruses: Evidence for template switching by the RNA-dependent RNA polymerase in vitro. J. Virol. 77(22), 12033–12047.

Cheng, J., Peng, C., Hsu, Y., , and Tsai, C. (2002). The synthesis of minus-strand RNA of Bamboo Mosaic Potexvirus initiates from multiple sites within the poly(A) tail. J. Virol. 76(12), 6114–6120.

Chenon, M., Camborde, L., Cheminant, S., and Jupin, I. (2012). A viral deubiquitylating enzyme targets viral RNA-dependent RNA polymerase and affects viral infectivity. EMBO J. 31, 741–753.

63 Cockrell, A., Johnson, J., Moore, I., Liu, D., Bock, K., Douglas, M., Graham, R., Solomon, J., Torzewski, L., Bartos, C., Hart, R., Baric, R., and Johnson, R. (2018). A spike-modiﬁed Middle East respiratory syndrome coronavirus (MERS-CoV) infectious clone elicits mild respiratory disease in infected rhesus macaques. Nat. 8, 1–9.

Coetzee, B., Freeborough, M., Maree, H., Celton, J., Rees, D., and Burger, J. (2010). Deep sequencing analysis of viruses infecting grapevines: Virome of a vineyard. Virology 400, 157–163.

Cui, H., Tsuda, K., and Parker, J. (2015). Effector-triggered immunity: From pathogen percep- tion to robust defense. Annu. Rev. Plant Biol. 66, 487–511.

Cui, H. and Wang, A. (2017). An efﬁcient viral vector for functional genomic studies of prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene. Plant Biotechnol. J. 15, 344–356.

Dalakouras, A., Jarausch, W., Buchholz, G., Bassler, A., Braun, M., Manthey, T., Krczal, G., and Wassenegger, M. (2018). Delivery of hairpin RNAs and small RNAs into woody and herbaceous plants by trunk injection and petiole absorption. Front. Plant Sci. 9, 1–11.

Dawson, W. and Folimonova, S. (2013). Virus-based transient expression vectors for woody crops: A new frontier for vector design and use. Annu. Rev. Phytopathol. 51, 321–327. de Winter, O. (2013). Using the Student’s t-test with extremely small sample sizes. PARE. 18(10), 1–12. decline in French vineyards, S. (2002). Renault-spilmont, as and boursiquot, j. In: FMPS Grape Program Newsletter. Foundation Plant Materials Service, University of California.

Dmitrenko, U., Porotikova, E., Gorislavets, S., Risovannaya, V., Volkov, Y., Stranishevskaya, E., Kamionskaya, A., and Vinogradova, S. (2016). First report of Grapevine rupestris stem pitting-associated virus in Russia. Plant Disease. 100(12), 2542.

Durrant, W. and Dong, X. (2004). Systemic acquired resistance. Annu. Rev. Phytopathol. 42(1), 185–209.

64 Fiore, N., Prodan, S., Montealegre, J., Aballay, E., Pino, A., and Zamorana, A. (2008). Survey of grapevine viruses in chile. J. Plant. Pathol. 90(1), 125–130.

Fiore, N., Zamorano, A., Sanchez-Diana, N., Gonzalez, X., Pallas, V., and Sanchez-Navarro, J. (2016). First detection of Grapevine rupestris stem pitting-associated virus and Grapevine rupestris vein feathering virus, and new phylogenetic groups for Grapevine ﬂeck virus and Hop stunt viroid isolates, revealed from grapevine ﬁeld surveys in Spain. Phytopathologia Mediterranea. 55(2), 1–12.

Gallie, D. and Walbot, V. (1990). RNA pseudoknot domain of Tobacco mosaic virus can functionally substitute for a poly(A) tail in plant and animal cells. Genes Dev. 4, 1149–1157.

Gasteiger, E., Hoogland, C., Gattiker, A., Duvaud, S., Wilkins, M., Appel, R., and A, B. (2005). Protein Identiﬁcation and Analysis Tools on the ExPASy Server,, pages 571–607. Humana Press,.

Giampetruzzi, A., Roumi, V., Roberto, R., Malossini, U., Yoshikawa, N., La Notte, P., Terlizzi, F., Credi, R., and Saldarelli, P. (2012). A new grapevine virus discovered by deep sequencing of virus- and viroid-derived small RNAs in cv pinot gris. Virus Res. 163, 262–268.

Gismondi, A., Di Marco, G., Martini, F., Sarti, L., Crespan, M., Mart´ınez-Labarga, C., Rickards, O., and Canini, A. (2016). Grapevine carpological remains revealed the existence of a neolithic domesticated Vitis vinifera L. specimen containing ancient DNA partially pre- served in modern ecotypes. J. Aarcheol. Sci. 69, 75–84.

Goszczynski, D. (2007). Single-strand conformation polymorphism (SSCP), cloning and sequencing reveal a close association between related molecular variants of Grapevine virus A (GVA) and Shiraz disease in south africa. Plant Pathol. 56, 755–762.

Goszczynski, D. (2010). Rugose wood-associated viruses do not appear to be involved in Shiraz (Syrah) decline in South Africa. Arch. Virol. 155, 1463–1469.

Gramaje, D., Munoz,˜ R., Lerma, M., Garc´ıa-Jimenez,´ J., and Armengol, J. (2009). Fungal grapevine trunk pathogens associated with Syrah decline in Spain. Phytopathol. Mediterr. 48, 396–402.

65 Greener, J., Kandathil, S., and DT, J. (2019). Deep learning extends de novo protein modelling coverage of genomes using iteratively predicted structural constraints. Nat. Commun. 10, 1–13.

Gutierrez,´ P., Alzate, J., and Mar´ın-Montoya, M. (2013). Complete genome sequence of a novel potato virus S strain infecting Solanum phureja in Colombia. Arch Virol. 158(10), 2205–2208.

Głowacki, S., Macioszek, V., and Kononowicz, A. (2011). R proteins as fundamentals of plant innate immunity. Cell Mol. Biol. Lett. 16, 1–24.

Habili, N., Farrokhi, N., Lima, M., Nicholas, P., , and Randles, J. (2006). Distribution of Ru- pestris stem-pitting-associated virus variants in two Australian vineyards showing different symptoms. Ann. Appl. Biol. 148(1), 91–96.

Halim, V., Vess, A., Scheel, D., and Rosahl, S. (2006). The role of salicylic acid and jasmonic acid in pathogen defence. Plant Biol. 8, 307–313.

Haupt, S., Cowan, G., Angelika, Z., Roberts, A., Oparka, K., and Torrance, L. (2005). Two plant–viral movement proteins trafﬁc in the endocytic recycling pathway. The Plant Cell. 17, 164–181.

Heinlein, M. (2015). Plant virus replication and movement. Front. Plant Sci. 479–480, 657– 671.

Hooker, J. (2017). Analysis of the genetic diversity of Grapevine rupestris stem pitting- associated virus in Ontarian vineyards and construction of a full-length infectious clone. Master’s thesis, University of Guelph.

Hooker, J. and Meng, B. (2017). Reﬁning the capsid protein subgenomic promoter in the Grapevine rupestris stem pitting-associated virus clone, pRSP-GFP2(Cam). Master’s thesis, University of Guelph.

Hornsey, I. (2007). Chapter 2: The Vine,, pages 65–113. RSC Publishing,.

66 Howard, A., Heppler, M., Ju, H., Krishnamurthy, K., Payton, M., and Verchot-Lubicz, J. (2004). Potato virus X tgbp1 induces plasmodesmata gating and moves between cells in several host species whereas cp moves only in N. benthamiana leaves. Virology. 328, 185– 197.

Hsu, H., Chou, Y., Tseng, Y., Lin, Y., Lin, T., Lin, N., Hsu, Y., and Chang, B. (2008). Topo- logical properties of the triple gene block protein 2 of Bamboo mosaic virus. Virology. 379, 1–9.

Hu, G., Dong, Y., Zhu, H., Zhang, Z., Fan, X., Ren, F., and Zhou, J. (2015). Molecular char- acterizations of two grapevine rupestris stem pitting-associated virus isolates from China. Arch. Virol. 160(10), 2641–2645.

Ishibashi, K., Masuda, K., Naito, S., Meshi, T., and Ishikawa, M. (2007). An inhibitor of viral RNA replication is encoded by a plant resistance gene. PNAS. 104(34), 13833–13838.

J, K. and Doolittle, R. (1982). A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. pages 105–132.

Jakubiec, A., Drugeon, G., Camborde, L., and Jupin, I. (2007). Proteolytic processing of Turnip Yellow Mosaic Virus replication proteins and functional impact on infectivity. J. Virol. 81(20), 11402–11412.

Jo, Y., Song, M., Choi, H., Park, J., Lee, J., and Cho, W. (2017). First report of Grapevine rupestris stem pitting-associated virus in grapevine in Korea. Plant Disease. 101(6), 1068.

Johnson, P., Kasprzak, W., Shapiro, B., and Simon, A. (2019). RNA2Drawer: geometrically strict drawing of nucleic acid structures with graphical structure editing and highlighting of complementary subsequences. RNA Biol. pages 1–5.

Ju, H., Brown, J., Ye, C., and Verchot-Lubicz, J. (2007). Mutations in the central domain of Potato Virus X TGBp2 eliminate granular vesicles and virus cell-to-cell trafﬁcking. J. Virol. 13(4), 1899–1911.

67 Ju, H., Samuels, T., Wang, Y., Blancaﬂor, E., Payton, M., Mitra, R., Krishnamurthy, K., Nel- son, R., and Verchot-Lubicz, J. (2005). The Potato Virus X TGBp2 movement protein as- sociates with endoplasmic reticulum-derived vesicles during virus infection. Plant Physiol. 138, 1877–1895.

Jupin, I., Ayach, M., Jomat, L., Fieulaine, S., and Bressanelli, S. (2017). A mobile loop near the active site acts as a switch between the dual activities of a viral protease/deubiquitinase. PLoS Pathog. 13(11), 1–33.

Kadare,´ G. and Haenni, A. (1997). Virus-encoded RNA helicases. J. Virol. 71(4), 2583–2590.

Krake, L., Scott, N., Rezaian, M., and Taylor, R. (1999). Vein necrosis. In: Graft-transmitted Diseases of Grapevines. CSIRO Publishing.

Kumagai, M., Donson, J., Della-Cioppa, G., Harvey, D., Hanley, K., and LK, G. (1995). Cy- toplasmic inhibition of carotenoid biosynthesis with virus-derived RNA. Proc. Natl. Acad. Sci. USA. 92, 1679–16783.

Kumar, S., Stecher, G., Li, M., Knyaz, C., and Tamura, K. (2018). MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 35(6), 1547– 1549.

Kurth, E., Peremyslov, V., Prokhnevsky, A., Kasschau, K., Miller, M., Carrington, J., and Dolja, V. (2012). Virus-derived gene expression and RNA interference vector for grapevine. J. Virol. 86(11), 6002–6009.

Lawrence, D., Rozanov, M., and Hillman, B. (1995). Autocatalytic processing of the 223-kDa protein of Blueberry scorch carlavirus by a papain-like proteinase. Virology. 207, 127–135.

Legin, R. and Vuittenez, A. (1973). Molecular analysis of a California strain of Rupestris stem pitting-associated virus isolated from declining Syrah grapevines. Rivista Patol. Veg. 9, 57–63.

Leisner, S. and Schoelz, J. (2018). Joining the crowd: Integrating plant virus proteins into the larger world of pathogen effectors. Annu. Rev. Phytopathol. 56, 89–110.

68 Lima, M., Alkowni, R., Uyemoto, J., Golino, D., Osman, F., and Rowhani, A. (2006a). Molec- ular analysis of a California strain of Rupestris stem pitting-associated virus isolated from declining Syrah grapevines. Arch. Virol. 151, 1889–1894.

Lima, M., Alkowni, R., Yuemoto, J., and Rowhani, A. (2009). Genomic study and detection of a new variant of Grapevine rupestris stem pitting associated virus in declining California Pinot Noir grapevines. J. Plant. Pathol. 91(1), 155–163.

Lima, M., Rosa, C., Golino, D., and A, R. (2006b). Detection of Rupestris stem pitting- associated virus in seedlings of virus-infected maternal grapevine plants. In: Extended abstracts of the 15th meeting of ICVG, Stellenbosch, pages 244–245.

Linnik, O., Liesche, J., Tilsner, J., and Oparka, K. (2013). Unraveling the structure of viral replication complexes at super-resolution. Front. Plant Sci. 4, 1–13.

Lombardi, C., Ayach, M., Beaurepaire, L., Chenon, M., Andreani, J., Guerois, R., Jupin, I., and Bressanelli, S. (2013). A compact viral processing proteinase/ubiquitin hydrolase from the OTU family. PLoS Pathog. 9(8), 1–13.

Lough, T., Netzler, N., Emerson, S., Sutherland, P., Carr, F., Beck, D., Lucas, W., and Forster, R. (2000). Cell-to-cell movement of potexviruses: Evidence for a ribonucleoprotein complex involving the coat protein and ﬁrst triple gene block protein. MPMI. 11(8), 801–814.

Lough, T., Shash, K., Xoconostle-Cazares,´ B., Hofstra, K., Beck, D., Balmori, E., Forster, R., and Lucas, W. (1998). Molecular dissection of the mechanism by which potexvirus triple gene block proteins mediate cell-to-cell transport of infectious RNA. MPMI. 11(8), 801–814.

Madeira, F., Park, Y., Lee, J., Buso, N., Gur, T., Madhusoodanan, N., Basutkar, P., Tivey, A., Potter, S., Finn, R., and Lopez, R. (2019). The EMBL-EBI search and sequence analysis tools APIs in 2019. Nucleic Acids Res. 47, 1–6.

Mann, K. and Meng, B. (2013). The triple gene block movement proteins of a grape virus in the genus Foveavirus confer limited cell-to-cell spread of a mutant Potato virus X. Virus Genes. 47, 93–104.

69 Martelli, G. (2014). Directory of virus and virus-like diseases of the grapevine and their agents. J. Plant. Pathol. 96(1S), 73–88.

Martelli, G. (2017). An Overview on Grapevine Viruses, Viroids, and the Diseases They Cause, chapter Grapevine Viruses: Molecular Biology, Diagnostics and Management. Springer International Publishing.

Martelli, G., Adams, M., Kreuze, J., and Dolja, V. (2007). Family Flexiviridae: A case study in virion and genome plasticity. Annu. Rev. Phytopathol. 45, 73–100.

Martin, G., Bogdanove, A., and Sessa, G. (2003). Understanding the functions of plant disease resistance proteins. Annu. Rev. Plant Biol. 51, 23–61.

Mart´ınez-Perez,´ M., Aparicio, F., Lopez-Gresa,´ M., Belles,´ J., Sanchez-Navarro,´ J., and Pallas,´ V. (2017). Arabidopsis m6a demethylase activity modulates viral infection of a plant virus and the m6a abundance in its genomic RNAs. PNAS. 114(40), 10755–10760.

Matousek,ˇ J., Schubert, J., and Dedi˘ c,ˇ P. (2009). Complementation analysis of triple gene block of Potato virus S (PVS) revealed its capability to support systemic infection and aphid transmissibility of recombinant Potato virus X. Virus Res. 146, 81–88.

Matsumur, E., Coletta-Filho, H., Machado, M., Nouri, S., and Falk, B. (2018). Rescue of Citrus sudden death-associated virus in Nicotiana benthamiana plants from cloned cDNA: insights into mechanisms of expression of the three capsid proteins. Mol. Plant Pathol. 20(5), 611–625.

McGovern, P., Fleming, S., and Katz, S. (1996a). The Origins and Ancient History of Wine. Gordon and Breach Publishers,.

McGovern, P., Glusker, D., Exner, L., and Voigt, M. (1996b). Neolithic resinated wine. Nature. 381, 480–481.

Meng, B. and Li, C. (2010). The capsid protein of Grapevine rupestris stem pitting-associated virus contains a typical nuclear localization signal and targets to the nucleus. Virus Res. 153, 212–217.

70 Meng, B., Pang, S., Forsline, P., McFerson, J., and Gonsalves, D. (1998). Nucleotide sequence and genome structure of grapevine rupestris stem pitting associated virus-1 reveal similarities to apple stem pitting virus. J. Gen. Virol. 79(7), 2059–2069.

Meng, B. and Rowhani, A. (2017). Grapevine rupestris stem pitting-associated virus, chapter Grapevine Viruses: Molecular Biology, Diagnostics and Management. Springer Interna- tional Publishing.

Meng, B., Venkataraman, S., Li, C., and Wang, W. (2013). Construction and biological activities of the ﬁrst infectious cDNA clones of the genus Foveavirus. Virology. 435, 453–462.

Moore, C. and Meng, B. (2019). Prediction of the molecular boundary and evolutionary history of novel viral AlkB domains using homology modeling and principal component analysis. J. Gen. Virol. 100(4), 691–703.

Morelli, M., Minafra, A., and Boscia, D. (2009). Molecular variability and seed transmission of Grapevine rupestris stem pitting-associated virus isolates from southern Italy. J. Plant. Pathol. 91(4), S4.75.

Morozov, S., Miroshnichenko, N., Solovyev, A., Fedorkin, O., Zelenina, D., Lukasheva, L., Karasev, A., Dolja, V., and JG, A. (1991). Expression strategy of the potato virus x triple gene block. J. Gen. Virol. 72, 2039–2042.

Morozov, S. and Solovyev, A. (2003). Triple gene block: modular design of a multifunctional machine for plant virus movement. J. Gen. Virol. 84, 1351–1366.

Muruganantham, M., Moskovitz, Y., Haviv, S., Horesh, T., Fenigstein, A., du Preez, J., Stephan, D., Burger, J., and Mawassi, M. (2009). Grapevine virus A-mediated gene silencing in Nicotiana benthamiana and Vitis vinifera. J. Virol. Methods. 155, 167–174.

Nakaune, R., Inoue, K., Nasu, H., Kakogawa, K., Nitta, H., Imada, J., and Nakano, M. (2008). Detection of viruses associated with rugose wood in Japanese grapevines and analysis of genomic variability of Rupestris stem pitting-associated virus. J. Gen. Plant Pathol. 74, 156– 163.

71 Newburn, L. and White, K. (2015). Cis-acting RNA elements in positive-strand RNA plant virus genomes. Virology. 479–480, 434–443.

Nishi, T., Onozato, H., Ohashi, S., Fukai, K., Yamada, M., Morioka, K., and Kanno, T. (2016). Construction and characterization of a full-length infectious cDNA clone of foot-and-mouth disease virus strain O/JPN/2010 isolated in Japan in 2010. Res. Vet. Sci. 106, 165–169.

Okarpova, O., Zayakina, O., Arkhipenko, M., Sheval, E., Kiselyova, O., Poljakov, V., Yamin- sky, I., Rodionova, N., and Atabekov, J. (2006). Potato virus X RNA-mediated assembly of single-tailed ternary ‘coat protein–RNA–movement protein’ complexes. J. Gen. Virol. 87, 2731–2740.

Osman, T., Hemenway, L., and Buck, K. (2000). Role of the 39 tRNA-like structure in Tobacco mosaic virus minus-strand RNA synthesis by the viral RNA-dependent RNA polymerase in vitro. J. Virol. 74(24), 11671–11680.

Ougland, R., Chang, C., Liiv, A., Johansen, R., Seeberf, E., Hou, Y., Remme, J., and Falnes, P. (2004). AlkB restores the biological function of mRNA and tRNA inactivated by chemical methylation. Mol. Cell. 16(1), 107–116.

Park, M., Jeong, R., and Kim, K. (2014). Understanding the intracellular trafﬁcking and inter- cellular transport of potexviruses in their host plants. Front. Plant Sci. 5, 1–12.

Park, S., Choi, H., Kim, S., Cho, W., and Kim, K. (2016). Development of virus-induced gene expression and silencing vector derived from Grapevine Algerian latent virus. Plant Pathol. J. 32(4), 371–376.

Pattanayak, D., Solanke, A., and Kumar, P. (2013). Plant RNA interference pathways: Diversity in function, similarity in action. Plant Mol. Biol. Rep. 31, 493–506.

Paudel, D. and Sanfac¸on, H. (2018). Exploring the diversity of mechanisms associated with plant tolerance to virus infection. Front. Plant Sci. 9, 1–20.

Prosser, S., Xiao, H., Li, C., Nelson, R., and Meng, B. (2015). Subcellular localization and

72 membrane association of the replicase protein of grapevine rupestris stem pitting-associated virus, family Betaﬂexiviridae. J. Gen. Virol. 96, 921–932.

Puckett, J., Dangl, G., Golino, D., and Rwahnih, M. (2018). Evidence to support Syrah Decline is a non-infectious genetic syndrome in several Syrah selections. In: Proceedings of the 19th Congress of ICVG, Santiago, Chile.

R Core Team (2013). R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing.

Rebel, J., Leendertse, C., Dekker, A., van Poelwijk, F., and Moormann, R. (2000). Construction of a full-length infectious cDNA clone of swine vesicular disease virus strain net/1/92 and analysis of new antigenic variants derived from it. J. Gen. Virol. 81, 2763–2769.

Rebelo, A., Niewiadomski, S., Prosser, S., Krell, P., and Meng, B. (2008). Subcellular localization of the triple gene block proteins encoded by a foveavirus infecting grapevines. Virus Res. 38, 57–69.

Renault-Spilmont, A., Grenan, S., and Boursiquot, J. (2005). Syrah decline. report on the meeting of the national working group. In: Progres` Agricole et Viticole.

Rikkonen, M., Peranen, J., and Kaariainen, L. (1994). ATPase and GTPase activities associated with Semliki forest virus nonstructural protein nsP2. J. Virol. 68(9), 5804–5810.

Rodamilans, B., Shan, H., Pasin, F., and Garc´ıa, J. (2018). Plant viral proteases: Beyond the role of peptide cutters. Front. Plant Sci. 9, 1–11.

Rosa, C., Jimenez, J., Margaria, P., and Rowhani, A. (2011). Symptomatology and effects of viruses associated with rugose wood complex on the growth of four different rootstocks. Am. J. Enol. Vitic. 62(2), 207–2013.

Saika, H., Nishizawa-Yokoi, A., and Toki, S. (2014). The non-homologous end-joining pathway is involved in stable transformation in rice. Front. Plant Sci. 5, 1–5.

Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., Tinevez, J., White, D., Hartenstein, V., Eliceiri, K.,

73 Tomancak, P., and Cardona, A. (2012). Fiji: an open-source platform for biological-image analysis. Nat. Methods 9(7), 676–682.

Schoonen, L., Pille, P., Borrmann, A., Nolte, R., and van Hest, J. (2015). Sortase A-mediated N-terminal modiﬁcation of Cowpea chlorotic mottle virus for highly efﬁcient cargo loading. Bioconjugate Chem. 26, 2429–2434.

Schrodinger,¨ LLC (2015). The PyMOL molecular graphics system, version 1.8. N/A.

Selmi, I., Paciﬁco, D., Harbi Ben Slimane, M., Garﬁ, G., Carimi, F., and Mahfoudhi, N. (2017). First report of Grapevine rupestris stem pitting-associated virus in wild grapevines (Vitis vinifera spp. sylvestris) in Tunisia. Plant Disease 102(2), 458.

Senshu, H., Ozeki, J., Komatsu, K., Hashimoto, M., Hatada, K., Aoyama, M., Kagiwada, S., Yamaji, Y., and Namba, S. (2009). Variability in the level of RNA silencing suppression caused by triple gene block protein 1 (TGBp1) from various potexviruses during infection. J. Gen. Virol. 90, 1014–1024.

Seybert, A., Hegyi, A., Siddell, S., and Ziebuhr, J. (2000). The human coronavirus 229E superfamily 1 helicase has RNA and DNA duplex-unwinding activities with 5’-to-3’ polarity. RNA. 6, 1056–1068.

Srivastava, L. (2002). Plant Growth and Development: Hormones and Environment. Amster- dam: Academic Press.

Steele, J., Peyret, H., Saunders, K., Castells-Graells, R., Marsian, J., Meshcheriakova, Y., and Lomonossoff, G. (2017). Synthetic plant virology for nanobiotechnology and nanomedicine. WIRE: Nanomedicine and Nanobiotechnology. 9, 1–18.

Stewart, S. and Nassuth, A. (2001). RT-PCR based detection of Rupestris stem pitting associated virus within ﬁeld-grown grapevines throughout the year. Plant Disease 85(6), 617–620.

Sztuba-Solinska,´ J., Stollar, V., and JJ, B. (2011). Subgenomic messenger RNAs: Mastering regulation of (+)-strand RNA virus life cycle. Virology. 412, 245–255.

74 Tamura, K. and Nei, M. (1993). Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 10(3), 512–826.

Tao, Y. and Ye, Q. (2010). RNA virus replication complexes. PLoS Pathog. 6(7), 1–3.

Terlizzi, F., Li, C., Ratti, C., Qiu, W., Credi, R., and Meng, B. (2011). Detection of multiple sequence variants of Grapevine rupestris stem pitting-associated virus using primers targeting the polymerase domain and partial genome sequencing of a novel variant. Ann. Appl. Biol. 159, 478–490.

Udaskin, M. (2016). Investigation into the proteolytic processing and localization of the replicase polyprotein of Grapevine Rupestris Stem Pitting-associated Virus. Master’s thesis, Uni- versity of Guelph.

Van den Born, E., Omelchenko, M., Bekkelund, A., Leihne, V., Koonin, E., Dolja, V., and Falnes, P. (2008). Viral AlkB proteins repair RNA damage by oxidative demethylation. Nucleic Acids Res. 36(17), 5451–5461.

Varsani, A., Roumagnac, P., Fuchs, M., Navas-Castillo, J., Moriones, E., Idris, A., Briddon, R., Rivera-Bustamante, R., Zerbini, F., and Martin, D. (2017). Capulavirus and Grablovirus: two new genera in the family Geminiviridae. Arch. Virol. 162, 1819–1831.

Venkataraman, S., Prasad, B., and Selvarajan, R. (2018). RNA dependent RNA polymerases: Insights from structure, function and evolution. Viruses. 10(2), 1–23.

Verchot, J., Angell, S., and Baulcombe, D. (1998). In Vivo translation of the triple gene block of Potato Virus X requires two subgenomic mRNAs. J. Virol. 72(10), 8316–8320.

Voncina,ˇ D. and Almeida, R. (2018). Screening of some Croatian autochthonous grapevine varieties reveals a multitude of viruses, including novel ones. Arch. Virol. 163(8), 2239– 2243.

Xiang, C., Han, P., Lutziger, I., Wang, K., and Oliver, D. (1999). A mini binary vector series for plant transformation. Plant Mol. Biol. 40, 711–717.

75 Xiao, H., Kim, W., and Meng, B. (2015). A highly effective and versatile technology for the isolation of RNAs from grapevines and other woody perennials for use in virus diagnostics. Virol. J. 12(171), 1–15.

Xiao, H. and Meng, B. (2017). Analysis and mapping of subgenomic RNAs of Grapevine rupestris stem pitting-associated virus. Unpublished.

Xiao, H., Shabanian, M., Moore, C., Li, C., and Meng, B. (2018). Survey for major viruses in commercial Vitis vinifera wine grapes in Ontario. Virol. J. 15(127), 1–11.

Xie, L., Zhang, Q., Su, D., Yang, W., Hu, J., Niu, L., and Zhang, Y. (2019). Virus-induced gene silencing in the perennial woody Paeonia ostii. PeerJ. N/A, 1–17.

Yepes, L., Cieniewicz, E., Krenz, B., McLane, H., Thompson, J., Perry, K., and Fuchs, M. (2018). Causative role of Grapevine red blotch virus in Red Blotch Disease. Phytopathology. 108, 902–909.

Yoshida, T., Shiraishi, T., Hagiwara-Komoda, Y., Komatsu, K., Maejima, K., Okano, Y., Fu- jimoto, Y., Yusa, A., Yamaji, Y., and Namba, S. (2019). The plant noncanonical antiviral resistance protein JAX1 inhibits potexviral replication by targeting the viral RNA-dependent RNA polymerase. J. Virol. 93, 1–15.

Yost, S. and Marcotrigiano, J. (2013). Viral precursor polyproteins: Keys of regulation from replication to maturation. Curr. Opin. Viro. 3(2), 137–142.

Zayakina, O., Arkhipenko, M., Kozlovsky, S., Nikitin, N., Smirnov, A., Susi, P., Rodionova, N., Karpova, O., and Atabekov, J. (2008). Mutagenic analysis of Potato virus X movement protein (TGBp1) and the coat protein (CP): in vitro TGBp1–CP binding and viral RNA translation activation. Mol. Plant Pathol. 9(1), 37–44.

Zhao, J., Zhang, X., Hong, Y., and Liu, Y. (2016). Chloroplast in plant-virus interaction. Front. Microbiol. 7, 1–20.

Zohary, D. and Spiegel-Roy, P. (1975). Beginnings of fruit growing in the old world. Science. 87(4174), 319–327.

76 Zuker, M. (2003). Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31(13), 3406–3415.

Zvereva, A. and Pooggin, M. (2012). Silencing and innate immunity in plant defense against viral and non-viral pathogens. Viruses. 4, 2578–2597.

77 A APPENDIX

A.1 Standard Procedures and Procedures

All procedures were performed as described here unless otherwise speciﬁed.

A.1.1 Agarose Gel Puriﬁcation of DNA

Amplified DNA was run on a 0.8–1.0% TAE agarose gel, depending on the size of DNA, and purified using either the Wizard SV Gel and PCR Clean-Up System (ProMega) or GenepHlow Gel/PCR (Geneaid) kits. Purified DNA was concentrated in a Savant DNA SpeedVac (Thermo Fisher) for 3–4 minutes to concentrate the DNA slightly while removing residual ethanol from purification. If the concentration was low, the DNA was subjected to further concentration in a Savant DNA SpeedVac for 5–15 minutes.

A.1.2 Agrobacterium Transformation

100 ng of plasmid DNA was mixed with 50 μL of thawed competent A. tumefaciens EHA105 cells, frozen in liquid nitrogen for 5 minutes, and immediately transferred to ice afterwards. 1 mL of lysogeny broth (LB) was added and cells were incubated for 2–4 hours at 30◦C with 150 rpm shaking. Cells were pelleted by centrifugation at 3000 x g for 30 seconds, resuspended

in 100 μL of LB broth to wash the cells, re-centrifuged, and resuspended for a second time in

100 μL LB broth. The cells were spread on LB plates containing 50 μg/mL kanamycin and 10

μg/mL rifampicin and incubated at 30◦C for 2 days.

A.1.3 Agroinﬁltration of N. benthamiana and V. vinifera

For N. benthamiana, transformed Agrobacterium cells were cultured in LB broth supplemented with 50 μg/mL kanamycin and 10 μg/mL rifampicin and incubated overnight at 30◦C with 220 rpm shaking.5 mL of seed culture was added to 35–50 mL of LB broth containing 10 mM 2-

morpholinoethanesulfonic acid (MES) (pH 5.6), 10 μM acetosyringone, 50 μg/mL kanamycin,

◦ and 10 μg/mL rifampicin and incubated at 30 C with 250 rpm shaking until the OD600 reached ∼0.9 (∼ 3–6 hours depending on the volume of LB broth). Cells were pelleted by centrifugation at 4000 x g for 10 minutes, washed in the inﬁltration buffer consisting of 10 mM MES, 10

78 mM MgCl2, and 0.01% Tween-20, re-centrifuged, and resuspended in inﬁltration buffer until

the OD600 was 0.8–0.95, not exceeding 1.0 (unless otherwise speciﬁed). 150 μM of acetosyringone was added and cells were incubated at 30◦C overnight prior to inﬁltration.

For V. vinifera, the same process was followed with slight changes. Only ∼100 mL of

broth was used to culture cells. Cells were resuspended in inﬁltration buffer until the OD600

was ∼2.0. A. tumefaciens transformed with p24 at an OD600 of 0.5 was added. 150 μM of acetosyringone was added to the cells, grapevine plantlets were submerged in the solution, and then subjected to vacuum pressure. After vacuum inﬁltration, the plantlets were re-potted and grown for 2–3 months.

A.1.4 Broth Culture and Plasmid Miniprep

Cells were subcultured in 5 mL of LB broth supplemented with the appropriate antibiotic(s) and incubated at 37◦C with 220–250 rpm shaking for 14–16 hours. Plasmids were isolated from cultures using the Presto Mini Plasmid Kit (Geneaid).

A.1.5 Competent A. tumefaciens Preparation

A. tumefaciens strain EHA105 cells already transformed with a helper plasmid were thawed

from –70◦C, streaked on an LB plate containing 10 μg/mL rifampicin, and grown at 30◦C for

∼48 hours. An isolated colony was cultured in LB broth supplemented with 10 μg/mL of rifampicin and incubated overnight at 30◦C with 225 rpm shaking. 5 mL of seed culture was

added to 30 mL of LB broth supplemented with 10 μg/mL rifampicin and incubated at 30◦C

until the OD600 was in the range of 0.8–1.0. The culture was chilled in ice for 10 minutes and centrifuged for 15 minutes at 3000 x g and 4◦C. The cell pellet was resuspended in 1–5 mL of

ice-cold 20 mM CaCl2 and ﬂash frozen in liquid nitrogen. Cells were aliquoted and stored at –70◦C.

A.1.6 Competent E. coli Preparation

E. coli strain JM109 cells were thawed from –70◦C, streaked on an LB plate, and grown at 37◦C for ∼16 hours. An isolated colony was cultured in 25 mL LB broth and incubated for ∼6 hours at 37◦C with 250 rpm shaking. ∼1 mL of seed culture was added to 250 mL of LB

◦ broth at 37 C until the OD600 was ∼0.55. The culture was chilled in ice for 10 minutes and

79 centrifuged for 10 minutes at 2500 x g and 4◦C. The supernatant was discarded and tubes were left upside on a paper towel to dry for 2 minutes. The cell pellet was resuspended in 15 mL of

ice-cold transformation buffer (10 mM K, 55 mM MnCl2, 15 mM CaCl2, 25 mM KCl, 10 mM piperazine-N,N’-bis(2-ethanesulfonic acid) (PIPES), 10% glycerol) and incubated on ice for 10 minutes. Cells were centrifuged and dried again to wash. Cells were resuspended in 5 mL

transformation buffer and 375 μL of cold dimethyl sulphoxide (DMSO). Cells were incubated in ice for 10 minutes, aliquoted, and stored at –70◦C.

A.1.7 Dephosphorylation

Vector digestions with a single enzyme or enzymes that produced compatible overhangs were either dephosphorylated at the same time as digestion or after.

Dephosphorylation during digestion was performed using 0.1 U/μL of Antarctic Phos-

phatase (New England Biolabs), 1x phosphatase buffer, 2 μg of DNA, and autoclaved MilliQ water.

Dephosphorylation after digestion was performed by adding 0.1 U/μL of Antarctic phosphatase, 45 minute incubation at 37◦C, and 20 minute incubation at 80◦C to denature the enzyme.

A.1.8 Digestion

Digestions consisted of 0.15–0.2 U/μL of the speciﬁed enzyme(s) (ThermoFisher and New England Biolabs) and their corresponding buffer. Reactions were incubated at 37◦C for 1–

3 hours. 500 ng of DNA was used for diagnostic digests and 1–2 μg of DNA was used for puriﬁcation digests.

A.1.9 E. coli Transformation

20–50 ng of DNA was mixed with 50 μL of thawed competent E. coli strain JM109 or DH5αcells and incubated on ice for 30 minutes followed by heat-shock in a 42◦C water bath for 1 minute.

Heat shocked cells were placed on ice immediately and incubated in 900 μL of LB broth at 37◦C for 1 hour with 150 rpm shaking. Cells were centrifuged at 3000 x g for 1 minute and re-

suspended in 200 μL of LB broth to wash. Cells were re-centrifuged, resuspended in 200 μL of

80 LB broth again, plated in 50–150 μL volumes on LB plates supplemented with the appropriate antibiotic(s), and incubated overnight at 37◦C.

A.1.10 KOD Polymerase Chain Reaction (PCR)

KOD reactions consisted of 0.05 U/μL of KOD polymerase (Millipore Sigma), 0.4 μM of for-

ward and reverse primers, 0.24 mM of each dNTP, 1x PCR Buffer, 1.5 mM of MgSO4, 20–50 ng of template DNA (1 μL if cDNA), and autoclaved MilliQ water. PCR conditions consisted of an initial 3 minute 95◦C denaturation step, followed by 35 cycles of 95◦C for 30 seconds,

◦ ◦ Ta C for 30 seconds (see Table A2 for primer Ta’s), and 70 C for 1 min/kb, and a ﬁnal 10 minute 70◦C extension step.

A.1.11 Ligation

Ligations consisted of 0.5 U/μL T4 ligase (Thermo Fisher or Invitrogen), 1x ligation buffer, 50 ng of vector, insert in a 2–7:1 I:V ratio, and autoclaved MilliQ water. Reactions were incubated at room temperature for 2 hours and 4◦C overnight.

A.1.12 Overlap-Extension PCR (OE-PCR)

DNA molecules with a complementary overlap were joined via OE-PCR using 0.02 U/μL

PaCeR polymerase, 0.6 μM of forward and reverse primers, 0.4 mM of each dNTP, 1x PaCeR HP Buffer, 100–300 ng of each purified DNA template, and autoclaved MilliQ water. PCR conditions consisted of two sets of cycles. The reaction for first set contained all reagents except the primers. Prior to the second set, the primers were added to the reaction and the second set was then performed. The first set consisted of an initial 30 minute 95◦C denaturation step,

◦ ◦ followed by 5 cycles of 95 C for 30 seconds, Ta C for 10 minutes (make sure the Ta is sufﬁ- ciently low for dsDNA to anneal; 50◦C generally works), and 72◦C for 5 minutes, and a ﬁnal 10 minute 72◦C extension step. The second set consisted of an initial 3 minute 95◦C denatura-

◦ ◦ ◦ tion step, followed by 20 cycles of 95 C for 30 seconds, Ta C for 30 seconds, and 72 C for 7 minutes, and a ﬁnal 10 minute of 72◦C extension step.

81 A.1.13 PaCeR PCR

PaCeR reactions consisted of 0.02 U/μL PaCeR polymerase (GeneBio Systems), 0.4 μM of forward and reverse primers, 0.2 mM of each dNTP, 1x PaCeR HP Buffer, 20–50 ng of template

DNA (1 μL of cDNA), and autoclaved MilliQ water. PCR conditions consisted of an initial 3

◦ ◦ ◦ minute 95 C denaturation step, 35 cycles of 95 C for 15 seconds, Ta C for 15 seconds (see ◦ ◦ Table A2 for primer Ta’s), and 72 C for 1 min/kb, and a ﬁnal 5 minute 72 C extension step.

A.1.14 RNA Extraction

Total ssRNA was extracted from grapevine leaves using a modiﬁed version of the Spectrum Plant Total RNA kit (Sigma) (Xiao et al., 2015). RNA concentration and quality were assessed by measuring absorbance at 260 nm using a NanoDrop 1000 spectrophotometer (Thermo Fisher).

A.1.15 Reverse Transcription (RT)

RT reactions consisted of 1 μg of extracted total RNA and 0.5 μM of reverse primer(s). The RNA-primer mixture was incubated at 70◦C for 5 minutes to denature 2◦ RNA structure and allow primers to access and bind to complementary sequences. The mixture was immediately incubated on ice afterwards to prevent reversion of the denatured 2◦ structure. 0.5 mM of

each dNTP, 1x First Strand Buffer (Invitrogen), 10 μM of DTT, 40 U of Recombinant RNasin Ribonuclease Inhibitor (ProMega) or 40 U of Murine Ribonuclease Inhibitor (New England Biolabs), 200 U of Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) (In- vitrogen), and autoclaved MilliQ water were added to the RNA-Primer mixture. Reactions were incubated at 45◦C for 3 hours followed by RT deactivation at 70◦C for 5 minutes.

A.1.16 Site-Directed Mutagenesis (SDM)

SDM was performed 0.02 U/μL of PaCeR polymerase, 0.4 μM of forward and reverse primers, 0.2 mM of each dNTP, 2x PaCeR HP Buffer, 20–50 ng of template DNA, and autoclaved MilliQ water. PCR conditions consisted of an initial 3 minute 95◦C denaturation step, followed by 12

◦ ◦ ◦ cycles of 95 C for 1 minute, Ta C for 1 minute (see Table A2 for primer Ta’s), and 72 C for ◦ ◦ 1 min/kb, a ﬁnal 1 minute Ta C annealing step, and a ﬁnal 30 minute 72 C extension step.

82 The original methylated template was digested with 10 U of DpnI and incubated at 37◦C for 3 hours.

A.1.17 TA cloning

Puriﬁed DNA was A-tailed via incubation at 37◦C for 30 minutes with 0.5 U/μL of Taq polymerase (Froggabio), 0.2–0.4 mM dATP, 1x PCR buffer, puriﬁed DNA, and no water. A-tail reactions were used directly for ligation into T-tailed plasmids pCR2.1 (Invitrogen) or pMD20 (Takara Bio). Ligation reactions were used to transform competent E. coli JM109 cells and plated on LB supplemented with 100 μg/mL of ampicillin, 40 μg/mL of X-Gal, and 0.1 mM of IPTG.

A.1.18 Taq PCR/Colony PCR

Taq PCR was used for all screening/diagnostic tests. This was performed using 0.05 U/μL of

Taq polymerase (Froggabio), 0.2 mM of each dNTP, 1x PCR buffer with Mg2+, 1.25 μM of forward and reverse primers, 20–50 ng of template DNA, and autoclaved MilliQ water. PCR conditions consisted of an initial 3 minute 94◦C denaturation step, 35 cycles of 94◦C for 30

◦ ◦ seconds, Ta C for 30 seconds (see Table A2 for primer Ta’s), and 72 C for 1 min/kb, and a ﬁnal 10 minute 72◦C extension step.

Colony PCR was identical except the template volume was replaced with autoclaved MilliQ water and reactions were inoculated with bacterial colonies. A.2 MGT Consensus Sequence

https://doi.org/10.5281/zenodo.3457138

83 A.3 Supplementary Figures and Tables

Figure A1: Western blot of non-pooled protein extracts from N. benthamiana agroinﬁltrated with MGT, GG, and pCB-301.3 (–) at 7 and 10 days post-inﬁltration (dpi). The MGT clone consistently produced more GFP (∼26 kDa) at 7 and 10 dpi than the GG clone.

Figure A2: Predicted 2◦ and 3◦ RNA structures of the (+)-sense strand of the 3’ UTR of PN. The most energetically favourable structures are presented, with 1 being the most favourable. Red bases form stem loops and black bases are unpaired. Green and red circles surround the 5’- and 3’-most nucleotides, respectively.

84 Figure A3: Predicted 3◦ protein structures of the replicase domains of PN (blue) and MGT (grey).

85 Figure A4: Predicted 2◦ and 3◦ RNA structures of the (–)-sense strands of the 97 and 70 nt CP SGP of PN. The most energetically favourable structures are presented, with 1 being the most favourable. Red bases form stem loops and black bases are unpaired. Green and red circles surround the 5’- and 3’-most nucleotides, respectively.

86 Figure A5: Predicted 2◦ and 3◦ RNA structures of the (+)-sense strands of the GFP sgRNA 5’ UTRs of PN. The three most energetically favourable structures are presented, with 1 being the most favourable. Coloured bases form stem loops and black bases are unpaired. Green and red circles surround the 5’- and 3’-most nucleotides, respectively.

87 Figure A6: Predicted 3◦ protein structures of MGT CP (orange) and the crystal structure of N. benthamiana rubisco large subunit (grey, PDB: 1EJ7).

88 Figure A7: Predicted 3◦ protein structures of V. vinifera rubisco large subunit (green) and the crystal structure of N. benthamiana rubisco large subunit (grey, PDB: 1EJ7).

89 Table A1: Percent similarity (bottom left) and hamming distance (top right) for genomes/proteins of prominent GRSPaV strains. Sequences for –1, CA, GG, SG1, BS, PN, PG, MG, WA, JF, LSL, SY, and VD-102 correspond to accessions NC 001948.1, AF026278.1, JQ922417.1, AY881626.1, AY881627.1, AY368172.2, HE591388.1, FR691076.1, KC427107.1,KR054734.1, KR054735.1, AY368590.1, and MF979534.1, respectively. MGT represents the consensus sequence of the GRSPaV-SY wildtype clone constructed here. Gaps have been included in analyses (e.g. the 18 bp gap in VD-102 that resulted from incomplete sequencing). .

Genome (nt)

–1 CA GG SG1 BS PN PG MG WA JF LSL SY VD-102 MGT –1 174 187 1108 1384 2059 177 1099 1093 2067 2028 1997 2016 2009 CA 98% 209 1118 1394 2083 145 1119 1103 2099 2047 2004 2005 2035 GG 98% 98% 1153 1412 2100 205 1122 1136 2078 2027 2037 2052 2006 SG1 87% 87% 87% 1420 2127 1119 545 40 2099 2047 2016 2068 2056 BS 84% 84% 84% 84% 1918 1398 1384 1407 1809 2021 1983 1996 1980 PN 76% 76% 76% 76% 78% 2089 2100 2119 1466 2082 2037 2054 2045 PG 98% 98% 98% 87% 84% 76% 1105 1098 2084 2028 1999 1989 2024 MG 87% 87% 87% 94% 84% 76% 87% 549 2081 2063 1993 2016 1990 WA 88% 87% 87% 100% 84% 76% 87% 94% 2094 2042 2011 2062 2050 JF 76% 76% 76% 76% 79% 83% 76% 76% 76% 2036 2046 2116 2075 LSL 77% 77% 77% 77% 77% 76% 77% 76% 77% 77% 2052 2059 2042 SY 77% 77% 77% 77% 77% 77% 77% 77% 77% 77% 77% 637 610 VD-102 77% 77% 77% 76% 77% 77% 77% 77% 76% 76% 76% 93% 286

MGT 77% 77% 77% 77% 77% 77% 77% 77% 77% 76% 77% 93% 97%

Replicase (aa)

–1 CA GG SG1 BS PN PG MG WA JF LSL SY VD-102 MGT –1 31 37 173 161 347 26 171 165 327 348 321 315 317 CA 99% 33 170 156 345 25 168 162 328 341 317 316 318 GG 98% 98% 174 164 353 30 172 168 335 351 323 320 322 SG1 92% 92% 92% 181 358 172 96 14 342 340 322 315 323 BS 93% 93% 92% 92% 351 160 171 177 337 349 321 310 320 PN 84% 84% 84% 83% 84% 343 370 353 216 346 336 336 338 PG 99% 99% 99% 92% 93% 84% 168 164 324 347 316 310 312 MG 92% 92% 92% 96% 92% 83% 92% 96 352 344 324 316 326 WA 92% 93% 92% 99% 92% 84% 92% 96% 337 335 317 312 319 JF 85% 85% 85% 84% 84% 90% 85% 84% 84% 342 339 339 340 LSL 84% 84% 84% 84% 84% 84% 84% 84% 85% 84% 334 331 325 SY 85% 85% 85% 85% 85% 84% 85% 85% 85% 84% 85% 95 120 VD-102 85% 85% 85% 85% 86% 84% 86% 85% 86% 84% 85% 96% 48

MGT 85% 85% 85% 85% 85% 84% 86% 85% 85% 84% 85% 94% 98%

90 TGBp1 (aa)

–1 CA GG SG1 BS PN PG MG WA JF LSL SY VD-102 MGT –1 1 1 15 29 30 1 11 15 27 26 32 37 32 CA 100% 2 14 30 29 2 12 14 28 26 31 36 31 GG 100% 99% 16 30 31 2 12 16 28 27 33 38 32 SG1 93% 94% 93% 30 31 16 11 2 31 33 35 37 32 BS 87% 86% 86% 86% 21 30 27 30 18 29 32 40 34 PN 86% 87% 86% 86% 90% 31 30 31 20 31 35 42 37 PG 100% 99% 99% 93% 86% 86% 12 16 28 25 33 38 33 MG 95% 95% 95% 95% 88% 86% 95% 11 29 32 35 37 32 WA 93% 94% 93% 99% 86% 86% 93% 95% 31 33 35 35 30 JF 88% 87% 87% 86% 92% 91% 87% 87% 86% 29 33 38 32 LSL 88% 88% 88% 85% 87% 86% 89% 86% 85% 87% 30 39 34 SY 86% 86% 85% 84% 86% 84% 85% 84% 84% 85% 86% 21 16 VD-102 83% 84% 83% 83% 82% 81% 83% 83% 84% 83% 82% 90% 9

MGT 86% 86% 86% 86% 85% 83% 85% 86% 86% 86% 85% 93% 96%

TGBp2 (aa)

–1 CA GG SG1 BS PN PG MG WA JF LSL SY VD-102 MGT –1 0 0 2 12 19 0 3 2 14 11 16 15 15 CA 100% 0 2 12 19 0 3 2 14 11 16 15 15 GG 100% 100% 2 12 19 0 3 2 14 11 16 15 15 SG1 98% 98% 98% 14 21 2 5 0 16 13 18 17 17 BS 90% 90% 90% 88% 15 12 11 14 3 16 15 14 14 PN 84% 84% 84% 82% 87% 19 20 21 15 19 25 24 24 PG 100% 100% 100% 98% 90% 84% 3 2 14 11 16 15 15 MG 97% 97% 97% 96% 91% 83% 97% 5 13 12 17 16 16 WA 98% 98% 98% 100% 88% 82% 98% 96% 16 13 18 17 17 JF 88% 88% 88% 86% 97% 87% 88% 89% 86% 15 16 16 16 LSL 91% 91% 91% 89% 86% 84% 91% 90% 89% 87% 20 19 19 SY 87% 86% 86% 85% 87% 79% 86% 85% 85% 86% 83% 2 1 VD-102 87% 87% 87% 85% 88% 79% 87% 86% 85% 86% 84% 98% 1

MGT 87% 87% 87% 85% 88% 79% 87% 86% 85% 86% 84% 99% 99%

91 TGBp3 (aa)

–1 CA GG SG1 BS PN PG MG WA JF LSL SY VD-102 MGT –1 1 0 9 9 10 0 8 8 9 16 13 12 12 CA 99% 1 8 9 10 1 7 7 9 16 13 12 12 GG 100% 99% 9 9 10 0 8 8 9 16 13 12 12 SG1 89% 90% 89% 11 13 9 3 1 13 15 17 16 17 BS 89% 89% 89% 86% 6 9 10 10 4 17 18 17 17 PN 88% 88% 88% 84% 93% 10 12 12 2 13 17 16 15 PG 100% 99% 100% 89% 89% 88% 8 8 9 16 13 12 12 MG 90% 91% 90% 96% 88% 85% 90% 2 12 14 16 15 16 WA 90% 91% 90% 99% 88% 85% 90% 98% 12 14 16 15 16 JF 89% 89% 89% 84% 95% 98% 89% 85% 85% 15 17 16 15 LSL 80% 80% 80% 81% 79% 84% 80% 83% 83% 81% 18 18 18 SY 84% 84% 84% 79% 78% 79% 84% 80% 80% 79% 78% 5 5 VD-102 85% 85% 85% 80% 79% 80% 85% 81% 81% 80% 78% 94% 4

MGT 85% 85% 85% 79% 79% 81% 85% 80% 80% 81% 78% 94% 95%

CP (aa)

–1 CA GG SG1 BS PN PG MG WA JF LSL SY VD-102 MGT –1 1 2 10 19 17 2 6 11 18 10 18 17 19 CA 100% 3 11 19 17 3 7 12 18 11 19 18 20 GG 99% 99% 10 19 17 2 6 11 18 10 18 17 19 SG1 96% 96% 96% 24 21 8 8 1 23 15 22 21 23 BS 93% 93% 93% 91% 12 18 19 25 5 12 19 18 20 PN 93% 93% 93% 92% 95% 15 18 22 9 10 17 16 18 PG 99% 99% 99% 97% 93% 94% 4 9 18 8 17 16 18 MG 98% 97% 98% 97% 93% 93% 98% 9 19 11 17 16 18 WA 96% 95% 96% 100% 90% 92% 97% 97% 24 16 23 22 24 JF 93% 93% 93% 91% 98% 97% 93% 93% 91% 12 17 16 18 LSL 96% 96% 96% 94% 95% 96% 97% 96% 94% 95% 13 12 14 SY 93% 93% 93% 92% 93% 93% 93% 93% 91% 93% 95% 4 3 VD-102 93% 93% 93% 92% 93% 94% 94% 94% 92% 94% 95% 98% 5

MGT 93% 92% 93% 91% 92% 93% 93% 93% 91% 93% 95% 99% 98%

92 Table A2: Primers used for cloning and diagnostic assays. Listed alphabetically by name.

◦ Name Sequence (5’→3’) Ta ( C) Location (bp) Target

eGFPbam-F AAAAGGATCCATGGTGAGCAAGGGC 1–20 GAGGA 58 GFP

eGFPnde-R GGGGCATATGTTACTTGTACAGCTC 680–700 GTCC 58 GFP

KpnHDVnos-F TTTTGGTACCGGGTCGGCATGGCAT 58 1–15 HDVnos

KpnNos-R TTTTGGTACCCCCGATCTAGTAAC 328–354 ATAGATGACACC 58 HDVnos

M13F TTGTAAAACGACGGCCAGTG 50 – Plasmids

M13R GAAACAGCTATGACCATG 50 – Plasmids V. vinifera PDS PDSfBamMU-R CCCTGCAGCATATGGTCAAACCATA 267–303 gene TATGTACATTGATCACTGGAACTCC 65 (EU816356.1)

RSP21 7916–7935 GG GAGGATTATAGAGAATGCAC 50 (JQ922417.1)

RSP22 8337–8356 GG GCACTCTCATCTGTGACTCC 50 (JQ922417.1)

RSP-SY-BaPs-Fm GGATCCCTGCAGATGGCTAGCCCAC 8764–8779 CAG 50 MGT clone

RSP-SY-BaPs-Rm CTGCAGGGATCCCTAACAATGTTAA 8743–8763 CAATGATA 50 MGT clone

RSP-GG-SGP97pstF ATACTGCAGGGGCCCTTGCGTCCAC 7670–7687 GG TGT 58 (JQ922417.1) . RSP-GG-SGP97pstR GCGCCTGCAGGCCAATTTAACAATG 7744–7766 GG ATAATCAA 58 (JQ922417.1)

RSP-SY-BaPsF ATCATTGTTGACATTATTAGGGATC 7732–7755 VD-102 CCTGCAGATGG 50 (MF979534.1)

RSP-SY-BaPsR TTTCCTGGTGAACTCGCCATCTGCA 7748–7771 VD-102 GGGATCCCTAA 50 (MF979534.1)

RSP-SY-FaF TCTAGAGATAAACATAACAACAGAA 1–25 SY ATTGCA 52 (AY368590.1)

RSP-SY-FaR 549–568 SY CGGAGATCACACGAGGAACC 50 (AY368590.1)

RSP-SY-FbF1 CCAATTTCTAAAGAGGAGGAACAAG 375–401 VD-102 GA 50 (MF979534.1)

RSP-SY-FbF2 442–466 SY AAAGATGTAAGTCGCTATGGTTCAG 54 (AY368590.1)

RSP-SY-FbF2831 2831–2855 VD-102 CAGACCTTTGTTCTTGCTTTTCTTG 50 (MF979534.1)

RSP-SY-FbR2 4757–4781 SY GTGAAAGGAGTCATGGGATATGAGA 50 (AY368590.1)

RSP-SY-FbR3012 GAGGATTGACTGTTTCTTACTTCTT 2986–3012 VD-102 GG 50 (MF979534.1)

RSP-SY-FcF2 4176–4197 SY CTGGAAATGGATGATGAGTGTAAGG 50 (AY368590.1)

RSP-SY-FcR1 7643–7666 SY ACCAATATGGCTAACCCCTAAAGC 50 (AY368590.1)

RSP-SY-muKpnF 7365–7389 VD-102 GAGGGCGTTATAGGGACGGCACCAA 52 (MF979534.1)

RSP-SY-muKpnNOSF 2623–2661 VD-102 TCGCGC(A)17GAGCTCGAAT 50 (MF979534.1)

93 ◦ Name Sequence (5’→3’) Ta ( C) Location (bp) Target

RSP-SY-muKpnNOSR GAACGATCGGGGAAATTCGAGCTCT 2642–2675 VD-102 TTT 50 (MF979534.1)

RSP-SY-muKpnR CCACAGTATGTTATGCTTTTGGTGC 7380–7407 VD-102 CGT 52 (MF979534.1)

RSP-SY-muSalR 7555–7574 VD-102 GCTGTCGACACGTGCAAGGA 50 (MF979534.1)

RSP-SY-muSpeF CTAATGCCAAATATTCCAAAGCTAG 1201–1231 VD-102 TTATCT 52 (MF979534.1)

RSP-SY-muSpeR CATTCTACAAAAGAAGGAGATAACT 1219–1248 VD-102 AGCTT 52 (MF979534.1)

SGPfBamMU-F ACCATATGCTGCAGGGCCCTTGCGT 1–24 GG CCACTGTGAAGGA 68 (JQ922417.1)

SY1659F 1659–1679 SY TAAGATGGCCTTGGGTGTGG 50 (AY368590.1)

SY1F(Xba) TTTTTCTAGAGATAAACATAACAAC 1–25 SY AGAAATTGCA 52 (AY368590.1)

SY2127R 2107–2127 SY ATTTATGGGATGGGCACATG 50 (AY368590.1)

SY2414F 2414–2437 SY GAAATCCTTGGCTTCACTGGTGG 50 (AY368590.1)

SY2481R 2459–2481 SY CTCATAACAGCTTTCATCATCC 50 (AY368590.1)

SY5938F 5938–5963 SY CACTTCATCTTGTCATTTGAGTTGC 50 (AY368590.1)

SY6074R 6051–6074 SY TCACCCGTAAATCTCATTATGGC 50 (AY368590.1)

SY7581F(Sal) 7581–7602 SY CATGTCGACAGCAATAATGGTG 52 (AY368590.1)

SY8725R(Kpn) 8716–8742 SY GGTACC(T)17GCGCGAAAAC 52 (AY368590.1)

SYmuKpnF (A)27GGGTCGGCATGGCATC 55 1–16 HDVnos

SYmuKpnR GATGCCATGCCGACCC(T)27 55 1–16 HDVnos

SYmuXbF TTCATTTCATTTGGAGAGGGATAAA 1–19 CATAACAACAGAAAT 55 CaMV35S

SYmuXbR ATTTCTGTTGTTATGTTTATCCCTC 1–19 TCCAAATGAAATGAA 55 CaMV35S V. vinifera PDS Vv-PDSbamF ATAGGATCCGGCCTTYTTAGATGGT 1–20 gene AAYC 50 (EU816356.1) V. vinifera PDS Vv-PDSbamR ACGGGATCCSTCAAACCATATATGY 286–304 gene ACA 50 (EU816356.1)