DOCSLIB.ORG

Role of Cytokine Receptor-Like Factor 1 in Hepatic Stellate Cells and Fibrosis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Role of Cytokine Receptor-Like Factor 1 in Hepatic Stellate Cells and Fibrosis Online Submissions: http://www.wjgnet.com/esps/ World J Hepatol 2012 December 27; 4(12): 356-364 [email protected] ISSN 1948-5182 (online) doi:10.4254/wjh.v4.i12.356 © 2012 Baishideng. All rights reserved. ORIGINAL ARTICLE Role of cytokine receptor-like factor 1 in hepatic stellate cells and fibrosis Lela Stefanovic, Branko Stefanovic Lela Stefanovic, Branko Stefanovic, Department of Biomedi- function. Human mutations suggested a role in devel- cal sciences, College of Medicine, Florida State University, Tal- opment of autonomous nervous system and a role of lahassee, FL 32306, United States CRLF1 in immune response was implied by its similarity Author contributions: Stefanovic L performed the research; to interleukin (IL)-6. Here we show that expression of Stefanovic B designed the research, analyzed the data and wrote CRLF1 was undetectable in quiescent HSCs and was the paper. highly upregulated in activated HSCs. Likewise, expres- Supported by Scleroderma Research Foundation and NIH sion of CRLF1 was very low in normal livers, but was grants, to Stefanovic B highly upregulated in fibrotic livers, where its expres- Correspondence to: Branko Stefanovic, PhD, Department of Biomedical Sciences, College of Medicine, Florida State Uni- sion correlated with the degree of fibrosis. A cofactor versity, 1115 West Call Street, Tallahassee, FL 32306, of CLRF1, cardiotrophin-like cytokine factor 1 (CLCF1), United States. [email protected] and the receptor which binds CRLF1/CLCF1 dimer, the Telephone: +1-850-6452932 Fax:+1-850-6445781 CNTFR, were expressed to similar levels in quiescent Received: November 18, 2011 Revised: July 6, 2012 and activated HSCs and in normal and fibrotic livers, Accepted: November 14, 2012 indicating a constitutive expression. Overexpression of Published online: December 27, 2012 CLRF1 alone in the normal liver did not stimulate ex- pression of profibrotic cytokines, suggesting that the factor itself is not pro-inflammatory. Ectopic expression in quiescent HSCs, however, retarded their activation Abstract into myofibroblasts and specifically decreased expres- sion of type Ⅲ collagen. Inhibition of type Ⅲ collagen AIM: To elucidate the role of cytokine receptor-like fac- expression by CRLF1 was also seen in the whole liver. tor 1 (CRLF1) in hepatic stellate cells and liver fibrosis. Our results suggest that CLRF1 is the only component of the CRLF1/CLCF1/CNTFR signaling system that is METHODS: Rat hepatic stellate cells (HSCs) were inducible by a profibrotic stimulus and that activation of isolated by Nykodenz gradient centrifugation and ac- this system by CLRF1 may regulate expression of type tivated by culturing in vitro . Differentially expressed Ⅲ collagen in fibrosis. genes in quiescent and culture activated HSCs were identified using microarrays. Injections of carbon tetra- CONCLUSION: By regulating activation of HSCs and chloride (CCl4) for 4 wk were employed to induce liver expression of type Ⅲ collagen, CRLF1 may have an fibrosis. The degree of fibrosis was assessed by Sirius ability to change the composition of extracellular matrix red staining. Adenovirus expressing CRLF1 was injected in fibrosis. through tail vein into mice to achieve overexpression of CRLF1 in the liver. The same adenovirus was used to © 2012 Baishideng. All rights reserved. overexpress CRLF1 in quiescent HSCs cultured in vitro. Expression of CRLF1, CLCF1 and ciliary neurotrophic Key words: Hepatic stellate cells; Liver fibrosis; Cyto- factor receptor (CNTFR) in hepatic stellate cells and fi- kine receptor-like factor 1; Cardiotrophin-like cytokine brotic livers was analyzed by semi-quantitative reverse factor 1; Ciliary neurotrophic factor receptor; Type Ⅲ transcription-polymerase chain reaction and Western collagen blotting. Expression of profibrotic cytokines and colla- gens was analyzed by the same method. Peer reviewers: Guang-Cun Huang, MD, PhD, Center for Clinical and Translational Research, The Research Institute at RESULTS: CRLF1 is a secreted cytokine with unknown Nationwide Children’s Hospital, 700 Childrens Dr, Research WJH|www.wjgnet.com 356 December 27, 2012|Volume 4|Issue 12| Stefanovic L et al . CRLF1 in liver fibrosis II, WA 2112, Columbus, OH 43205, United States; Can-Hua days after birth[16]. No craniofacial deformations were Huang, PhD, Oncoproteomics group, The State Key Laboratory observed and the reason for suckling defect is unknown. of Biotherapy, Sichuan University, No. 1 Keyuan Rd 4, Gao- CLRF1 was found to be expressed at high levels in peng ST, High Tech Zone, Chengdu 610041, Sichuan Province, China; Yasemin Hatice Balaban, Professor, Hacettepe Univer- osteoarthritic human knee cartilage and was upregulated sity, Birlik Mahallesi 415. Sokak Oyak Sitesi No.45/3 Cankaya, by stimulating mouse chondrocytes by transforming [17] 06570 Ankara, Turkey growth factor-β (TGF-β) . CRLF1/CLCF1 complex promoted the proliferation of chondrocyte precursors Stefanovic L, Stefanovic B. Role of cytokine receptor-like and suppressed the expression level of aggrecan and factor 1 in hepatic stellate cells and fibrosis. World J Hepatol type Ⅱ collagen[17]. This suggests that the CRLF1/CLC 2012; 4(12): 356-364 Available from: URL: http://www.wjg- complex may disrupt cartilage homeostasis and promote net.com/1948-5182/full/v4/i12/356.htm DOI: http://dx.doi. the progress of osteoarthritis. org/10.4254/wjh.v4.i12.356 Ectopic bone formation can be induced by injec- tion of bone morphogenetic protein-2 (BMP-2) into the muscle. When gene expression was analyzed in such ectopically induced bone, expression of CRLF1 was in- INTRODUCTION duced 5-fold at day 5 after BMP-2 injection. Temporally, Cytokine receptor-like factor 1 (CRLF1) is a secreted CRLF1 induction preceded the stage of chondrogenesis [18] protein belonging to the family of cytokine type Ⅰ recep- in this model of endochondral osteogenesis . tors and has homology to two other secreted receptors: Based on the results described above two roles of IL12B and EBI3[1,2]. Both of these receptors are impli- CLRF1 can be inferred; mediation of immune response cated in regulating immune response by T-lymphocytes. and regulation of autonomic nervous system. However, Expression of CRLF1 is induced by tumour necrosis association of bone deformities with CLRF1 mutation factor-α (TNF-α), interleukin-6 (IL-6) and γ-interferon in humans, as well as regulation of CRLF1 by TGF-β and it is expressed in lymphatic tissue, placenta, stomach and its induction by BMP-2, suggests a role in forma- and lungs[3]. CRLF1 forms a heterodimer with cardiotro- tion of the extracellular matrix. There are no reports on phin-like cytokine factor 1 (CLCF1, also known as B-cell expression of CRLF1 in the liver or its association with stimulating factor 3) and this complex binds to the ciliary liver fibrosis. Here we describe the expression of CRLF1 neurotrophic factor receptor (CNTFR)[4]. CNTFR is a in hepatic stellate cells and fibrotic livers and the effect non-signaling component of the heterotrimeric receptor of CLRF1 overexpression in the liver. composed of CNTFR, interleukin 6 signal transducer [5] (IL6ST) and LIFR . The IL6ST and LIFR subunits of MATERIALS AND METHODS this heterotrimeric receptor are also components of IL-6 receptor. However, while IL-6 receptor binds IL-6, Isolation and culture of hepatic stellate cells CNTFR/IL6ST/LIFR receptor binds either CLRF1/ Hepatic stellate cells (HSCs) were isolated by perfusion CLCF1 dimer or ciliary neurotrophic factor (CNTF)[6]. of rat livers with pronase and collagenase, followed by [19] Like IL-6 receptor, the CNTFR/IL6ST/LIFR recep- centrifugation over Nycodenz gradient, as described . tor signals to activate STAT/ERK pathway[7]. CNTF is The purity of cells was estimated to be > 95% by des- required for development of central nervous system and min staining. The cells were cultured in uncoated plastic has neurotrophic activity for motor neurons. Knock out dishes in Dulbecco’s modified Eagle’s medium/10% fe- of CNTF gene results in progressive muscular atrophy tal bovine serum for 2 d and used as quiescent HSCs or and loss of motor neurons[8]. Elson et al[4] have shown were cultured for 7 d and used as activated HSCs. that CLRF1/CLCF1 dimer is a competitive inhibitor for binding of CNTF to CNTFR/IL6ST/LIFR receptor. Induction of liver fibrosis The physiological role of CRLF1 is unknown. Muta- Liver fibrosis was induced in rats by intraperitoneal in- tions in CRLF1 gene were associated with cold sweat jections of carbon tetrachloride (CCl4), 2 µL/g, twice a syndrome type 1 and Crisponi syndrome[9-14]. Cold sweat week for 4 wk. Livers were extracted, fixed in formalin syndrome type 1 is characterized by profuse sweating in- and paraffin embedded sections were stained with Sirius duced by cold and craniofacial deformities[12,14]. Crisponi red according to the standard procedure[20]. syndrome is associated with dismorphic facial features, facial muscle contractions, scoliosis and hyperther- Adenovirus construction and injection mia[9,13]. Interestingly, mutation of CLCF1 causes cold Adenovirus expressing human CRLF1 was constructed sweat syndrome type 2, which is similar to cold sweating by cloning CRLF1 cDNA into pAdCMV TRACK vec- syndrome type 1[15], suggesting the common signaling tor and by subsequent recombination with pEasy vector defect of the CLRF1/CLCF1 pathway. These syndromes in Escherichia coli, as described[21]. Viral particles were as- implicated the role of CLRF1/CLCF1 in the function of sembled and amplified in HEK 293 cells and purified by the autonomic nervous system. Mice lacking the CLRF1 CsCl centrifugation, as described[22]. CRLF1 adenovirus gene were unable to suckle and died from starvation few also expressed green fluorescent protein (GFP) from an WJH|www.wjgnet.com 357 December 27, 2012|Volume 4|Issue 12| Stefanovic L et al . CRLF1 in liver fibrosis Table 1 Primers used in reverse transcription-polymerase identity of products was confirmed by the expected size chain reaction analysis and by sequencing. To avoid saturation, the number of cycles in the PCR step was kept at a minimum, sufficient CRLF1-r 5’primer GGACAATCTGGTGTGTCACG to give signals.
Load more

Recommended publications
  • Despite Differential Gene Expression Profiles Pediatric MDS Derived Mesenchymal Stromal Cells Display Functionality in Vitro☆ F.G.J
    Stem Cell Research (2015) 14, 198-210 Available online at www.sciencedirect.com ScienceDirect www.elsevier.com/locate/scr Despite differential gene expression profiles pediatric MDS derived mesenchymal stromal cells display functionality in vitro☆ F.G.J. Calkoen a,⁎, C. Vervat a, M. van Pel b, V. de Haas c, L.S. Vijfhuizen d, E. Eising d, W.G.M. Kroes e, P.A.C. 't Hoen d, M.M. van den Heuvel-Eibrink c,f, R.M. Egeler a,g, M.J.D. van Tol a, L.M. Ball a a Department of Pediatrics, Section Immunology, Hematology/Oncology and Hematopoietic Stem Cell Transplantation, Leiden University Medical Center, Leiden, The Netherlands b Department of Immunohematology and Blood Transfusion, Leiden University Medical Center, Leiden, The Netherlands c Dutch Childhood Oncology Group (DCOG), The Hague, The Netherlands d Department of Human Genetics, Leiden University Medical Center, Leiden, The Netherlands e Laboratory for Diagnostic Genome Analysis, Leiden University Medical Center, Leiden, The Netherlands f Department of Pediatric Oncology/Hematology, Erasmus MC-Sophia Children's Hospital, Rotterdam, The Netherlands g Department of Hematology/Oncology and Hematopoietic Stem Cell Transplantation, Hospital for Sick Children, University of Toronto, Toronto, Canada Received 24 June 2014; received in revised form 3 December 2014; accepted 19 January 2015 Available online 28 January 2015 Abstract Pediatric myelodysplastic syndrome (MDS) is a heterogeneous disease covering a spectrum ranging from aplasia (RCC) to myeloproliferation (RAEB(t)). In adult-type MDS there is increasing evidence for abnormal function of the bone-marrow microenvironment. Here, we extensively studied the mesenchymal stromal cells (MSCs) derived from children with MDS.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Early Growth Response 1 Regulates Hematopoietic Support and Proliferation in Human Primary Bone Marrow Stromal Cells
    Hematopoiesis SUPPLEMENTARY APPENDIX Early growth response 1 regulates hematopoietic support and proliferation in human primary bone marrow stromal cells Hongzhe Li, 1,2 Hooi-Ching Lim, 1,2 Dimitra Zacharaki, 1,2 Xiaojie Xian, 2,3 Keane J.G. Kenswil, 4 Sandro Bräunig, 1,2 Marc H.G.P. Raaijmakers, 4 Niels-Bjarne Woods, 2,3 Jenny Hansson, 1,2 and Stefan Scheding 1,2,5 1Division of Molecular Hematology, Department of Laboratory Medicine, Lund University, Lund, Sweden; 2Lund Stem Cell Center, Depart - ment of Laboratory Medicine, Lund University, Lund, Sweden; 3Division of Molecular Medicine and Gene Therapy, Department of Labora - tory Medicine, Lund University, Lund, Sweden; 4Department of Hematology, Erasmus MC Cancer Institute, Rotterdam, the Netherlands and 5Department of Hematology, Skåne University Hospital Lund, Skåne, Sweden ©2020 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol. 2019.216648 Received: January 14, 2019. Accepted: July 19, 2019. Pre-published: August 1, 2019. Correspondence: STEFAN SCHEDING - [email protected] Li et al.: Supplemental data 1. Supplemental Materials and Methods BM-MNC isolation Bone marrow mononuclear cells (BM-MNC) from BM aspiration samples were isolated by density gradient centrifugation (LSM 1077 Lymphocyte, PAA, Pasching, Austria) either with or without prior incubation with RosetteSep Human Mesenchymal Stem Cell Enrichment Cocktail (STEMCELL Technologies, Vancouver, Canada) for lineage depletion (CD3, CD14, CD19, CD38, CD66b, glycophorin A). BM-MNCs from fetal long bones and adult hip bones were isolated as reported previously 1 by gently crushing bones (femora, tibiae, fibulae, humeri, radii and ulna) in PBS+0.5% FCS subsequent passing of the cell suspension through a 40-µm filter.
    [Show full text]
  • CRLF1 Promotes Malignant Phenotypes of Papillary Thyroid
    Yu et al. Cell Death and Disease (2018) 9:371 DOI 10.1038/s41419-018-0352-0 Cell Death & Disease ARTICLE Open Access CRLF1 promotes malignant phenotypes of papillary thyroid carcinoma by activating the MAPK/ERK and PI3K/AKT pathways Shi-Tong Yu1,2, Qian Zhong3,Ren-HuiChen1,2,PingHan1,2,Shi-BingLi3,HuaZhang3,LiYuan3, Tian-Liang Xia3, Mu-Sheng Zeng 3 and Xiao-Ming Huang1,2 Abstract Papillary thyroid carcinoma (PTC) is the one of the most common types of endocrine cancer and has a heterogeneous prognosis. Tumors from patients with poor prognosis may differentially express specific genes. Therefore, an analysis of The Cancer Genome Atlas (TCGA) database was performed and revealed that cytokine receptor-like factor 1 (CRLF1) may be a potential novel target for PTC treatment. The objective of the current study was to explore the expression of CRLF1 in PTC and to investigate the main functions and mechanisms of CRLF1 in PTC. PTC tissues exhibited higher CRLF1 expression at both the mRNA and protein levels than it did with normal thyroid tissues. High CRLF1 levels were associated with aggressive clinicopathological features and poor disease-free survival rates. By using loss-of-function and gain-of-function assays, we found that CRLF1 not only increased cell migration and invasion in vitro but also promoted tumor growth both in vitro and in vivo. In addition, CRLF1 induced epithelial–mesenchymal transitions. Overexpression of CRLF1 activated the ERK1/2 and AKT pathways. The oncogenic effects induced by CRLF1 were suppressed by treating the cells with the MEK inhibitor U0126 or the AKT inhibitor MK-2206.
    [Show full text]
  • Impacts of Ciliary Neurotrophic Factor on the Retinal Transcriptome in a Mouse Model of Photoreceptor Degeneration
    www.nature.com/scientificreports OPEN Impacts of ciliary neurotrophic factor on the retinal transcriptome in a mouse model of photoreceptor degeneration Yanjie Wang1, Kun-Do Rhee1, Matteo Pellegrini2 & Xian-Jie Yang1* Ciliary neurotrophic factor (CNTF) has been tested in clinical trials for human retinal degeneration due to its potent neuroprotective efects in various animal models. To decipher CNTF-triggered molecular events in the degenerating retina, we performed high-throughput RNA sequencing analyses using the Rds/Prph2 (P216L) transgenic mouse as a preclinical model for retinitis pigmentosa. In the absence of CNTF treatment, transcriptome alterations were detected at the onset of rod degeneration compared with wild type mice, including reduction of key photoreceptor transcription factors Crx, Nrl, and rod phototransduction genes. Short-term CNTF treatments caused further declines of photoreceptor transcription factors accompanied by marked decreases of both rod- and cone-specifc gene expression. In addition, CNTF triggered acute elevation of transcripts in the innate immune system and growth factor signaling. These immune responses were sustained after long-term CNTF exposures that also afected neuronal transmission and metabolism. Comparisons of transcriptomes also uncovered common pathways shared with other retinal degeneration models. Cross referencing bulk RNA-seq with single-cell RNA-seq data revealed the CNTF responsive cell types, including Müller glia, rod and cone photoreceptors, and bipolar cells. Together, these results demonstrate the infuence of exogenous CNTF on the retinal transcriptome landscape and illuminate likely CNTF impacts in degenerating human retinas. Retinal degeneration (RD) is known as an irreversible, progressive neurologic disorder caused by genetic muta- tions and/or environmental or pathological damage to the retina.
    [Show full text]
  • Association of Cardiotrophin-Like Cytokine Factor 1 Levels in Peripheral
    Chen et al. BMC Musculoskeletal Disorders (2021) 22:62 https://doi.org/10.1186/s12891-020-03924-9 RESEARCH ARTICLE Open Access Association of cardiotrophin-like cytokine factor 1 levels in peripheral blood mononuclear cells with bone mineral density and osteoporosis in postmenopausal women Xuan Chen1†, Jianyang Li2†, Yunjin Ye1, Jingwen Huang1, Lihua Xie1, Juan Chen1, Shengqiang Li1, Sainan Chen1 and Jirong Ge1* Abstract Background: Recent research has suggested that cardiotrophin-like cytokine factor 1 (CLCF1) may be an important regulator of bone homeostasis. Furthermore, a whole gene chip analysis suggested that the expression levels of CLCF1 in the peripheral blood mononuclear cells (PBMCs) were downregulated in postmenopausal women with osteoporosis. This study aimed to assess whether the expression levels of CLCF1 in PBMCs can reflect the severity of bone mass loss and the related fracture risk. Methods: In all, 360 postmenopausal women, aged 50 to 80 years, were included in the study. A survey to evaluate the participants’ health status, measurement of bone mineral density (BMD), routine blood test, and CLCF1 expression level test were performed. Results: Based on the participants’ bone health, 27 (7.5%), 165 (45.83%), and 168 (46.67%) participants were divided into the normal, osteopenia, and osteoporosis groups, respectively. CLCF1 protein levels in the normal and osteopenia groups were higher than those in the osteoporosis group. While the CLCF1 mRNA level was positively associated with the BMD of total femur (r =0.169,p = 0.011) and lumbar spine (r =0.176,p = 0.001), the protein level was positively associated with the BMD of the lumbar spine (r =0.261,p <0.001),femoralneck(r =0.236,p = 0.001), greater trochanter (r =0.228,p =0.001),andWard’striangle(r =0.149,p = 0.036).
    [Show full text]
  • Engineering a Potent Receptor Superagonist Or Antagonist from a Novel IL-6 Family Cytokine Ligand
    Engineering a potent receptor superagonist or antagonist from a novel IL-6 family cytokine ligand Jun W. Kima, Cesar P. Marquezb,c, R. Andres Parra Sperberga, Jiaxiang Wua,d, Won G. Baee, Po-Ssu Huanga, E. Alejandro Sweet-Corderob,1, and Jennifer R. Cochrana,f,1 aDepartment of Bioengineering, Stanford University, Stanford, CA 94305; bDivision of Hematology and Oncology, Department of Pediatrics, University of California, San Francisco, CA 94158; cSchool of Medicine, Stanford University, Stanford, CA 94305; dTencent AI Lab, 518000 Shenzhen, China; eDepartment of Electrical Engineering, Soongsil University, 156-743 Seoul, Korea; and fDepartment of Chemical Engineering, Stanford University, Stanford, CA 94305 Edited by Joseph Schlessinger, Yale University, New Haven, CT, and approved May 5, 2020 (received for review December 26, 2019) Interleukin-6 (IL-6) family cytokines signal through multimeric re- facilitate neuronal regeneration, while a CNTFR antagonist could ceptor complexes, providing unique opportunities to create novel inhibit this signaling axis for cancer or other disease treatment. ligand-based therapeutics. The cardiotrophin-like cytokine factor 1 We used a combinatorial screening approach facilitated by yeast (CLCF1) ligand has been shown to play a role in cancer, osteopo- surface display to identify CLCF1 variants that altered receptor- rosis, and atherosclerosis. Once bound to ciliary neurotrophic fac- mediated cell signaling and biochemical function in disparate tor receptor (CNTFR), CLCF1 mediates interactions to coreceptors ways. CLCF1 variants with significantly increased CNTFR affinity glycoprotein 130 (gp130) and leukemia inhibitory factor receptor drove enhanced tripartite receptor complex formation and func- (LIFR). By increasing CNTFR-mediated binding to these coreceptors tioned as superagonists of cell signaling and axon regeneration.
    [Show full text]
  • Development and Validation of a Protein-Based Risk Score for Cardiovascular Outcomes Among Patients with Stable Coronary Heart Disease
    Supplementary Online Content Ganz P, Heidecker B, Hveem K, et al. Development and validation of a protein-based risk score for cardiovascular outcomes among patients with stable coronary heart disease. JAMA. doi: 10.1001/jama.2016.5951 eTable 1. List of 1130 Proteins Measured by Somalogic’s Modified Aptamer-Based Proteomic Assay eTable 2. Coefficients for Weibull Recalibration Model Applied to 9-Protein Model eFigure 1. Median Protein Levels in Derivation and Validation Cohort eTable 3. Coefficients for the Recalibration Model Applied to Refit Framingham eFigure 2. Calibration Plots for the Refit Framingham Model eTable 4. List of 200 Proteins Associated With the Risk of MI, Stroke, Heart Failure, and Death eFigure 3. Hazard Ratios of Lasso Selected Proteins for Primary End Point of MI, Stroke, Heart Failure, and Death eFigure 4. 9-Protein Prognostic Model Hazard Ratios Adjusted for Framingham Variables eFigure 5. 9-Protein Risk Scores by Event Type This supplementary material has been provided by the authors to give readers additional information about their work. Downloaded From: https://jamanetwork.com/ on 10/02/2021 Supplemental Material Table of Contents 1 Study Design and Data Processing ......................................................................................................... 3 2 Table of 1130 Proteins Measured .......................................................................................................... 4 3 Variable Selection and Statistical Modeling ........................................................................................
    [Show full text]
  • Molecular Characterization of Pediatric Gastrointestinal Stromal Tumors Narasimhan P
    Cancer Therapy: Preclinical Molecular Characterization of Pediatric Gastrointestinal Stromal Tumors Narasimhan P. Agaram,1Michael P. Laquaglia,2 Berrin Ustun,1Tianhua Guo,1Grace C.Wong,1 Nicholas D. Socci,4 Robert G. Maki,3 Ronald P. DeMatteo,4 Peter Besmer,5 and Cristina R. Antonescu1, 5 Abstract Purpose: Pediatric gastrointestinal stromal tumors (GIST) are rare and occur preferentially in females as multifocal gastric tumors, typically lacking mutations in KIT and PDGFRA .AsKIT oncoprotein is consistently overexpressed in pediatric GIST, we sought to investigate the activa- tion of KIT downstream targets and alterations of KIT/PDGFRA gene copy number, mine novel therapeutic targets by gene expression, and test tyrosine kinase receptor activation by proteomic profiling. Experimental Design: Seventeen pediatric GISTs were investigated for KIT/PDGFRA genotype and biochemical activation of KIT downstream targets. The transcriptional profile of 13 nodules from 8 pediatric patients was compared with 8 adult wild-type (WT) GISTs, includ- ing 3 young adults. The drug sensitivity of second-generation kinase inhibitors was tested in murine Ba/F3 cells expressing human WT KIT, as well as in short-term culture of explants of WT GISTcells. Results: A KIT/PDGFRA WT genotype was identified in all 12 female patients, whereas two of five males had either a KIT exon 11or PDGFRA exon 18 mutation. KIT downstream targets were consistently activated. Pediatric GISTs showed a distinct transcriptional signature, with overexpression of BAALC, PLAG1, IGF1R, FGF4,andNELL1. In vitro studies showed that nilotinib, sunitinib, dasatinib, and sorafenib are more effective than imatinib against WT KIT. Conclusions: Rare cases of pediatric GIST may occur in male patients and harbor activating KIT/PDGFRA mutations.
    [Show full text]
  • A High Throughput, Functional Screen of Human Body Mass Index GWAS Loci Using Tissue-Specific Rnai Drosophila Melanogaster Crosses Thomas J
    Washington University School of Medicine Digital Commons@Becker Open Access Publications 2018 A high throughput, functional screen of human Body Mass Index GWAS loci using tissue-specific RNAi Drosophila melanogaster crosses Thomas J. Baranski Washington University School of Medicine in St. Louis Aldi T. Kraja Washington University School of Medicine in St. Louis Jill L. Fink Washington University School of Medicine in St. Louis Mary Feitosa Washington University School of Medicine in St. Louis Petra A. Lenzini Washington University School of Medicine in St. Louis See next page for additional authors Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Recommended Citation Baranski, Thomas J.; Kraja, Aldi T.; Fink, Jill L.; Feitosa, Mary; Lenzini, Petra A.; Borecki, Ingrid B.; Liu, Ching-Ti; Cupples, L. Adrienne; North, Kari E.; and Province, Michael A., ,"A high throughput, functional screen of human Body Mass Index GWAS loci using tissue-specific RNAi Drosophila melanogaster crosses." PLoS Genetics.14,4. e1007222. (2018). https://digitalcommons.wustl.edu/open_access_pubs/6820 This Open Access Publication is brought to you for free and open access by Digital Commons@Becker. It has been accepted for inclusion in Open Access Publications by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. Authors Thomas J. Baranski, Aldi T. Kraja, Jill L. Fink, Mary Feitosa, Petra A. Lenzini, Ingrid B. Borecki, Ching-Ti Liu, L. Adrienne Cupples, Kari E. North, and Michael A. Province This open access publication is available at Digital Commons@Becker: https://digitalcommons.wustl.edu/open_access_pubs/6820 RESEARCH ARTICLE A high throughput, functional screen of human Body Mass Index GWAS loci using tissue-specific RNAi Drosophila melanogaster crosses Thomas J.
    [Show full text]
  • CLCF1 (28-225, His-Tag) Human Protein – AR39121PU-L | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for AR39121PU-L CLCF1 (28-225, His-tag) Human Protein Product data: Product Type: Recombinant Proteins Description: CLCF1 (28-225, His-tag) human recombinant protein, 0.5 mg Species: Human Expression Host: E. coli Tag: His-tag Predicted MW: 24.6 kDa Concentration: lot specific Purity: >90% Buffer: Presentation State: Purified State: Liquid purified protein Buffer System: 20mM sodium citrate (pH 3.5), 0.4M Urea, 10% glycerol Preparation: Liquid purified protein Protein Description: Recombinant human CLCF1, fused to His-tag at N-terminus, was expressed in E.coli and purified by using conventional chromatography. Storage: Store undiluted at 2-8°C for up to two weeks or (in aliquots) at -20°C or -70°C for longer. Avoid repeated freezing and thawing. Stability: Shelf life: one year from despatch. RefSeq: NP_001159684 Locus ID: 23529 UniProt ID: Q9UBD9 Cytogenetics: 11q13.2 Synonyms: BSF-3; BSF3; CISS2; CLC; NNT-1; NNT1; NR6 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 CLCF1 (28-225, His-tag) Human Protein – AR39121PU-L Summary: This gene is a member of the glycoprotein (gp)130 cytokine family and encodes cardiotrophin-like cytokine factor 1 (CLCF1). CLCF1 forms a heterodimer complex with cytokine receptor-like factor 1 (CRLF1). This dimer competes with ciliary neurotrophic factor (CNTF) for binding to the ciliary neurotrophic factor receptor (CNTFR) complex, and activates the Jak-STAT signaling cascade.
    [Show full text]