Leontyev Et Al. Tubifera Ferruginosa 1 Short Title

In Press at Mycologia, preliminary version published on August 3, 2015 as doi:10.3852/14-271

Leontyev et al. Tubifera ferruginosa Short title: Tubifera ferruginosa

A critical revision of the Tubifera ferruginosa complex

Dmitry V. Leontyev1

Department of Biotechnology, Kharkiv State Zooveterinary Academy, Akademichna str. 1, Kharkiv,

Ukraine 62341

Martin Schnittler

Institute of Botany and Landscape Ecology, Ernst Moritz Arndt University Greifswald,

Soldmannstr. 15, Greifswald, Germany D-17487

Steven L. Stephenson

Department of Biological Sciences, University of Arkansas, Fayetteville, Arkansas 72701

Abstract: Based on a combination of morphological and molecular investigations, a critical revision of the widely distributed myxomycete Tubifera ferruginosa is presented. A phylogeny of the morphospecies, based on partial 18S nuc rDNA sequences, displays several clearly distinct clades, all differing by a genetic distance (p distance) of at least 0.15, with the distance within the clades below 0.11. These molecular differences correlate with morphological characters, such as the shape of sporothecal tips, the color of immature fructifications and the ultrastructure of the inner surface of the peridium. The combination of morphological and molecular data provides evidence that T. ferruginosa is actually a species complex, representing at least seven species. These are T. ferruginosa sensu stricto, T. applanata, T. corymbosa, T. dudkae, T. magna, T. montana and T. pseudomicrosperma. Among these T. applanata and T. dudkae (as Reticularia dudkae) were described recently based on morphological characters and the 18S nuc rDNA phylogeny confirmed their separation. Another four species, T. corymbosa, T. magna, T. montana and T. pseudomicrosperma, are described here. We propose an epitype for T. ferruginosa sensu stricto and recognize subsp. ferruginosa and subsp. acutissima within this species. All studied taxa of the T. ferruginosa complex are shown to lack a capillitium. Structures formerly described as capillitium represent the hyphae of fungi occurring within the fructifications.

INTRODUCTION

The myxomycete genus Tubifera J.F. Gmel. is characterized by the formation of pseudoaethalia, dense clusters of sporothecae that may extend several centimeters. In Tubifera, the sporothecae mostly are cylindrical, are covered with a membranous peridium and filled with banded-reticulate spores. The most common species in the genus, T. ferruginosa (Batsch) J.F. Gmel., is easy to recognize by its prostrate spongy hypothallus, rusty brown spore mass and sparsely occurring columella, which never reaches the apex of a sporotheca (Martin and Alexopoulos 1969, Nannenga-

Bremekamp 1991, Neubert et al. 1993, Ing 1999). Because of its wide distribution and conspicuous fructifications, T. ferruginosa has been reported in nearly all field surveys that have focused on wood-inhabiting myxomycetes (www.discoverlife.org). As is the case for most lignicolous myxomycetes, there are no reports of the successful culture of T. ferruginosa under laboratory conditions (Clark and Haskins 2010).

During the nearly 200 y that T. ferruginosa has been studied, the taxonomic status of the species has never been seriously questioned, although Lado (2005–2015) listed no less than 19 heterotypic synonyms of this name. A detailed analysis provided by Nannenga-Bremekamp (1961) led to the conclusion that there is “no sufficient reason” to divide T. ferruginosa into several species. However, more than 40 y later, Leontyev and Fefelov (2005) postulated that T. ferruginosa might represent a complex of cryptic species. Later two morphotypes of the species were described as distinct taxa: Tubifera applanata Leontyev & Fefelov (Leontyev and Fefelov 2009, 2012) and

Reticularia dudkae Leontyev & G. Moreno (Leontyev and Moreno 2011). The primary character used to separate these two taxa from the species complex was the shape of the sporothecae, which were cylindrical and convex in typical T. ferruginosa, cylindrical and flat in T. applanata and spherical in R. dudkae. A second distinguishing character was the ultrastructure of the inner surface of the peridium, which was smooth in typical T. ferruginosa, incrusted by rings in T. applanata and covered by wave-like folds in R. dudkae. For the latter the spherical sporothecae was the reason for

Leontyev et al. Tubifera ferruginosa assigning the species to the closely related genus Reticularia (Leontyev and Fefelov 2009, 2012,

Leontyev and Moreno 2011) and not to Tubifera. However, as we will describe herein this placement was incorrect. Nevertheless both new species appear quite similar to T. ferruginosa and the taxonomic value of the characters used in their circumscription remained questionable.

Even after the exclusion of T. applanata and R. dudkae, the T. ferruginosa complex remains rather polymorphic. Both field observations and morphological comparisons of herbarium specimens revealed differences in the color of immature fructifications, the shape of the sporothecal tips, the color and iridescence of the peridium, the overall size of the pseudoaethalium and spore diameter. These observations inspired the present study, which was undertaken to disentangle the various taxonomic entities that make up this intricate species complex.

In an effort to determine the correlation between phenotypic and genotypic variability, we sequenced the first part of the 18S nuc rDNA in T. ferruginosa and a number of related species.

This gene seems to be a promising marker for barcoding of protists in general (Pawlowski et al.

2012) and is especially variable in myxomycetes (Fiore-Donno et al. 2012, 2013; Nandipati et al.

2012). However, the 10 known insertion sites for group I introns (Lundblad et al. 2004, Fiore-

Donno et al. 2013) often make it difficult to obtain the entire 18S gene sequence in myxomycetes.

Fortunately a portion consisting of the first ca. 700 bp of this gene (most of the 5′ domain) is free of introns, possesses three extremely variable helices and can be obtained in one amplification step

(Novozhilov et al. 2013).

MATERIALS AND METHODS

Specimens.—We examined a total of 152 specimens, 111 of which corresponded to the traditional concept of Tubifera ferruginosa sensu Martin & Alexopoulos (1969), Nannenga-Bremekamp (1991) and Ing (1999). Using the morphological characters mentioned above, T. applanata (18 specimens) and Reticularia dudkae (6) were separated.

The remaining 87 specimens were preliminarily considered to be T. ferruginosa.

To reconstruct the phylogeny of the T. ferruginosa complex, we examined several related species. These were

T. microsperma (Berk. & M.A. Curtis) G.W. Martin (five specimens), Lindbladia tubulina Fr. (two), Lycogala epidendrum (L.) Fr. (five), L. flavofuscum (Ehrenb.) Rostaf. (one), L. sp. (four), Reticularia jurana Meyl. (seven), R.

Leontyev et al. Tubifera ferruginosa splendens Morgan (eight), R. lycoperdon Bull. (one), R. olivacea (Ehrenb.) Fr. (two) and four species of the recently revalidated genus Alwisia (see Leontyev et al. 2014 a, b, c), A. bombarda Berk. & Broome (one), A. lloydiae Leontyev,

S.L. Stephenson & Schnittler (three), A. morula G. Moreno, Leontyev, D.W. Mitchell, S.L. Stephenson, C. Rojas &

Schnittler (one) and A. repens Leontyev, Schnittler, G. Moreno, S.L. Stephenson, D.W. Mitchell & C. Rojas (two).

Together with nine already published sequences (Fiore-Donno et al. 2013) labeled as Cribraria cancellata

(Batsch) Nann.-Bremek. (1 specimen), C. violacea Rex (1), C. vulgaris Schrad. (one), T. ferruginosa (one), T. dimorphotheca (one), Reticularia lycoperdon (one), R. jurana (one) and Lycogala epidendrum (two), a total of 161 partial 18S rDNA sequences were used in the present study, of which 118 belong to the genus Tubifera

(SUPPLEMENTARY INFORMATION 1). The majority (156) of the sequences represent the family Reticulariaceae and remaining five (Cribraria spp. and Lindbladia tubulina) belong to the Cribrariaceae, a family that forms a basal clade within the bright-spored myxomycetes (Fiore-Donno et al. 2013). The material examined was collected in 15 countries, mostly from the temperate zone of Eurasia and North America but also from other regions of the world

(SUPPLEMENTARY INFORMATION 1).

Morphological studies.—Specimens were studied with dissecting microscopes (Leica MSV226, Stemi 2000) and light microscopes (Zeiss Axioscop 2 plus, Zeiss Axio Imager A1), equipped with differential interference contrast (DIC).

The freeware program CombineZP was used to create a composite digital image from several stacked images.

Microscopic measurements were made with the program Axio Vision 4.8.0.0 (Carl Zeiss Imaging Solutions GmbH,

Germany). Alphanumeric codes for colors in descriptions are given according to the Munsell color scale (Munsell

1912).

In all studied specimens, the length, width and height of pseudoaethalia were determined. Twenty-five spores, peridial rings and warts were measured for each specimen to derive an estimate for the range of variation. The range of variation for all the structures is (minimum –) mean minus standard deviation – mean plus standard deviation (– maximum).

Scanning electron microscopy (SEM) was carried out at the M. G. Kholodny Botanical Institute, Ukraine, with a Jeol JSM-6060 microscope and at the University of Arkansas, using a FEI Nova Nanolab 200 FIB/SEM microscope.

In both cases, sporocarps were sputter-coated with gold-palladium to form a 5 nm cover and then studied at 5–15 kV.

DNA sequencing and deposition.—As noted above the first ca. 700 bp of the nuc 18S rDNA was chosen as a molecular marker. DNA was extracted from 5–6 adjacent sporocarps using the Invitek Spin Food Kit II and Invitec Spin Plant

Mini Kit (Stratec Molecular GmbH, Germany). Sporocarps were cooled to −80 C in a 2 mL safe-lock Eppendorf tube along with acid-washed glass beads 0.7–1.1 mm diam (Sigma Chemicals, Washington) and disrupted 1 min at 30 Hz with a Wig-L-Bug grinding mill (Reflex Analytical Corporation, New Jersey). We followed the manufacturer’s protocol

Leontyev et al. Tubifera ferruginosa except for the final step, where DNA was eluted in 50 µL of an elution buffer instead of 200 µL.

DNA was amplified with five primers reported by Fiore-Donno et al. (2013). These were S1

AACCTGGTTGATCCTGCC forward, SFATri AATCTGCGAACGGCTCCGTA forward), SF1Tri

CGAACGGCTCCGTATATC forward), SR4 Bright TGCTGGCACCAGACTTGT reverse and SR4Lyc

CCGGACTTGTCCTCCAGT, reverse. About 80% of sequences were obtained with the primer combination

S1/SR4Bright. However, this combination was ineffective for several species, for which other combinations were successful. These were Alwisia lloydiae (SFATri/SR4Bright, SFATri/SR4Lyc), Lycogala epidendrum (S1/SR4Lyc,

SFATri/SR4Lyc, SF1Tri/SR4Lyc) and T. magna (SFATri/SR4Bright).

The PCR reaction was carried out in 40 cycles (95 C, 2.5 min; 52 C, 30 s; 72 C, 1 min). Results were verified by electrophoresis in an agarose gel in TA buffer, stained with a Safe Red (NBS Biologicals Ltd, UK) or Rothi Stain

(Carl Roth GmbH, Germany). The product was purified with MSB Spin PCRapace (Stratec Molecular GmbH,

Germany). In the purification process, we followed the manufacturer’s protocols except we added 20 μL elution buffer instead of the recommended 10 μL when preparing the final solution. Cycle sequencing was carried out in 40 cycles (96

C, 70 s; 53 C, 5 s; 60 C, 4 min); for fragment detection an ABI 3130xl BigDye 3.1 capillary sequencer was used. All unique sequences among the 149 obtained were deposited in GenBank/EMBL (SUPPLEMENTARY MATERIAL I).

Sequence alignment.—Alignments were made with the online version of multiple alignment program MAFFT

(mafft.cbrc.jp/alignment/software/), using the E-INS-option (Katoh et al. 2005) and default gap penalties. The alignment is available on TreeBASE, submission nno. 17296 http://treebase.org/treebase- web/user/submissionList.html).

Sequence comparisons.—To identify a barcode gap between 18S rDNA sequences that let us consider a pair of specimens as separate species (Schoch et al. 2012), we checked the frequency of each value of p-distance index between any two studied sequences (1890 combinations in total). This index is calculated as the proportion (p) of nucleotide sites at which two sequences being compared are different and varies from 0 (sequences identical) to 1 (no matches) (Hall 2011, Tamura et al. 2011). The frequencies of all p-values were visualized with a histogram

(SUPPLEMENTARY INFORMATION 2).

Phylogenetic analyses.—The 1219 positions of the alignment (48–1266) out of the total of 1540 were used to construct the phylogeny. Analyses were carried out with both maximum likelihood (ML) and Bayesian interference (BI). ML was run on MEGA 5.1 (Hall 2011, Tamura et al. 2011), using bootstrap with 1000 replicates and the NNJ heuristic search method. BI was computed with MRBAYES 3.2.1 (Huelsenbeck and Ronquist 2001, 2012) using one cold and three heated Monte Carlo Markov chains in two simultaneous runs with a temperature increment of 0.2. The number of generations, sample frequencies and burn-in ratio were set to 10 million, 10 and 0.25, respectively. Branch support was

Leontyev et al. Tubifera ferruginosa estimated by ML bootstrap replicates and Bayesian posterior probabilities. In both analyses, the evolutionary model was set to GTR with gamma-distributed rate variation across sites with a proportion of invariable sites. The evolutionary model was selected using AICs and BIC tests in MEGA 5.1.

RESULTS

Generic diversity.—In both ML and BI phylogenies, the genera Alwisia, Lycogala and Tubifera form rather well supported clades (FIG. 1), united in one large monophyletic branch of the

Reticulariaceae, with the same topology as presented by Fiore-Donno et al. (2013) and Leontyev et al. (2014c). Within the genus Reticularia, three species (R. jurana, R. lycoperdon, R. splendens) form a cluster sister to Lycogala, while two other species belong to other clades. According to our phylogeny, R. dudkae appears to be the part of the cluster of Tubifera. This led us to transfer R. dudkae to the latter. Another species of Reticularia (R. olivacea) was found to belong to the cluster of the Cribrariaceae, instead of the Reticulariaceae.

Species diversity.—Among the 162 sequences from members of the Reticulariaceae and

Cribrariaceae, we recognized 62 genotypes, 33 belonging to the 118 specimens of Tubifera considered in this study. A pairwise comparison of all possible combinations between these genotypes using p distance revealed a continuum of values, 0.001–0.51, with an average value of

0.37. However, p levels 0.11–0.15 did not occur for any of these combinations (SUPPLEMENTARY

INFORMATION 2). We consider this barcode gap as the natural threshold between the genetic diversity within a species and between species of the studied family. A less pronounced gap, at p value 0.02–0.09, separates the group of specimens that differ from the other closest genotypes at the p-level of 0.09–0.11. This difference, found in only a two genotypic clusters, Tubifera ferruginosa sensu strictu (s. str.) and Lycogala epidendrum, we consider to be a subspecies threshold (see below). Finally, all genotypes differing from the closest genotype at a p level below 0.09 (most of them even below 0.02) are considered to be elements of genetic diversity within a particular species and is indicated herein as sequentially numbered genotypes (gt1, gt2, gt3 etc.) of this species

(SUPPLEMENTARY INFORMATION 1).

Leontyev et al. Tubifera ferruginosa When p values 0.11–0.15 were used as a species threshold, we united our 61 individual genotypes into 30 clusters, which we consider to be genotypic species. As a result, in Alwisia lloydiae, Reticularia jurana, R. lycoperdon, R. splendens and Tubifera microsperma, one morphospecies appeared to be represented by a single genotypic species, sometimes with several genotypes differing by p values below 0.11, thus providing additional evidence of the validity of our approach. However, in the hitherto recognized morphospecies T. ferruginosa, Lycogala epidendrum and R. olivacea more than one genotypic species was found within the morphospecies.

In L. epidendrum, four of the 10 18S genotypes were found to represent four different species not yet formally described. These species were indicated by labels Lycogala spp. 1–4

(SUPPLEMENTARY INFORMATION 1). More material is needed to study these potentially new taxa.

The two studied specimens of R. olivacea revealed a high p difference, suggesting their separation into two genotypic species. One of them has a close relationship with Lindbladia tubulina, while another is distant from Lindbladia but still more distant from all other species of

Reticularia and from Reticulariaceae in general.

In T. ferruginosa sensu lato (s.l.), the 31 genotypes formed 10 clusters with the species level of difference between them (p ≥0.15), suggesting that the T. ferruginosa complex is represented by at least 10 species (FIGS. 2–9). Two of them, with 18 and six investigated specimens belonging to a single genotype, respectively, correspond to the recently described T. applanata (FIG. 4) and R. dudkae (FIG. 5). Our 18S rDNA phylogeny substantially supports the separation of both species.

Among the eight remaining genotypic clusters witin the T. ferruginosa complex, we selected the one represented by the greatest number of specimens (42% of all investigated specimens for this complex) that correspond most closely to the descriptions and illustrations of T. ferruginosa (Batsch

1786, Lister 1925, Martin and Alexopoulos 1969, Emoto 1977, Nannenga-Bremekamp 1991,

Poulain et al. 2011) to represent T. ferruginosa s. str. (FIGS. 2, 3). For this, now more narrowly circumscribed taxon, we present an emended description.

Leontyev et al. Tubifera ferruginosa The original holotype of the T. ferruginosa s.l. was described by Batsch (1786) who kept his herbarium in the University of Jena (Germany). At the present time, none of Batsch’s collection of Tubifera have survived (J. Zündorf pers comm). Therefore, we consider the holotype of the species as lost and designate the original illustration as the lectotype. One of our collections was selected to designate an epitype.

Among the seven genotypic clusters that remained within T. ferruginosa complex, both the number and condition of the herbarium specimens available enable us to describe four new species under the names T. magna, T. montana, T. corymbosa and T. pseudomicrosperma (FIGS. 4–9).

Three other clusters, (Tubifera sp. 1, Tubifera sp. 2, Tubifera sp. 3) are not characterized herein because the limited material available for study is insufficient to let us draw any conclusions about the diagnostic features of these putative new species.

Infraspecific level of diversity.—The cluster representing T. ferruginosa s. str. comprises nine 18S genotypes, differing from each other at a p value level below 0.11 (SUPPLEMENTARY INFORMATION

2). At least some of these genotypes appear to be limited to certain geographical regions: western

Europe (gt1: 28 specimens), eastern Europe (gt2: eight specimens), Asia (gt3: one specimen), North

America (gt4–5: five specimens) and Central America (gt6–7: three specimens). Taking into consideration the fact that T. ferruginosa was described originally from Germany (Batsch 1786,

Gmelin 1792) and that in this region the western European genotype (gt1) seems to be most common, we used a specimen of this genotype for the neotypification of the species.

Fructifications corresponding to the two most distant genotypes of T. ferruginosa s. str. display one prominent peculiarity— the elongated, acute conical tips of the sporothecae. Field observations have revealed that the color of young fructifications in these two 18S genotypes differs from that of other specimens of T. ferruginosa s. str., being pink vs scarlet red. The 18S rDNA sequences of this genotype differ from other genotypes in the group at the “subspecies” level of

0.09–0.11 (see above). Therefore we separate this peculiar genotypic group as a separate subspecies, T. ferruginosa subsp. acutissima (FIG. 3) and consider the remaining genotypes 1–7 as

Leontyev et al. Tubifera ferruginosa the autotype subspecies T. ferruginosa subsp. ferruginosa (FIG. 2). These are the first subspecies to be proposed for myxomycetes and the first intraspecific taxa of this group based on molecular genetic data.

Among the new taxa, only T. montana has some infraspecific genetic variability because it is represented by 11 very similar (p values 0.002–0.020) but different genotypes (FIG. 1,

SUPPLEMENTARY INFORMATION 2). Like T. ferruginosa s. str. the genotypes of T. montana seem to be restricted to certain geographic regions: eastern Europe (gt1–3, four specimens); western Europe

(gt4, four specimens), Asia (gt5–6, two specimens) and North America (gt7–11, eight specimens).

One of the genotypes of T. montana (gt11) was found to be heterozygous, with heterogeneities at six positions of 18S sequence.

TAXONOMY

For all descriptions, additional specimens examined are listed in SUPPLEMENTARY INFORMATION 1.

Tubifera ferruginosa (Batsch) J.F. Gmel. Syst. nat. 2:1472 (1792) s. str., emend. Leontyev,

Schnittler & S.L. Stephenson FIGS. 2–3

≡Stemonitis ferruginosa Batsch, Elenchus fungorum, Continuatio prima: 31, tab. 30, fig. 175

(1786).

≡Lycoperdon ferruginosum (Batsch) Timm, Flora megapolitanae Prodomus exhibeus plantas ductatus Megapolitano: 276 (1788).

MycoBank MBT 201303 (epitype)

Typification. Batsch, Elenchus fungorum, Continuatio prima, tab. 30, fig. 175b. 1786

(lectotype, selected here). GERMANY, MECKLENBURG-VORPOMMERN: Western Pomerania, in the vicinity of Greifswald, Weitenhagen, 54°02′55″N, 13°25′13″E, 47 m, dead wood of Fagus sylvatica (?), 19 Jul 2011, M. Schnittler (epitype, designated here, GFW22067).

Pseudoaethalia solitary or grouped, (3–)4–25(–60) mm long, (3–)4–15(–25) wide, (1–)2–

6(–14) high, rounded, short ovoid or drop-shaped as observed from above, pulvinate to hemispherical, often forming moniliform complexes, yellowish brown (5YR2–4/6) (FIGS. 2c, 3e–g);

Leontyev et al. Tubifera ferruginosa the surface formed by the free tips of sporothecae. Sporothecae cylindrical, rounded in cross section, straight, directed from the base to the external surface of the fructification, 0.3–0.5 mm diam (FIG. 2g–h). Tips of sporothecae uniform in diameter, not accreted, hemispherical to conical, with blunt, papillate or subulate apices (FIGS. 2d–f, i, 3g–k); apices often sclerified and in this case black (FIG. 2f). Hypothallus spongy, white when fresh, sandy-yellow when mature (5Y8/4).

Peridium semitransparent, light brown in reflected light, moderately shining, dull or iridescent with blue, green and purple tints (FIGS. 2f, h, 3i). External surface of the peridium verrucose as observed in SEM (FIGS. 2k, 3i). Internal surface of peridium smooth as observed in SEM (FIGS. 2l, 3m), with wavy folds (FIGS. 2m, 3n, o) and extremely rarely with rings 0.4–1.1 μm diam (FIG. 2n). Columella mostly absent but may appear in some sporothecae of a fructification, never reaching the top of the sporocarp, irregularly cylindrical with a conical tip, composed of loose material and degraded spores, ochraceous brown. Capillitium and pseudocapillitium absent (see FIG. 13 and DISCUSSION below). Spores in mass rust-brown (2.5YR4–5/10–12), pale brownish in transmitted light, globose,

(5.6–)6.4–7.3(–8.9) μm in diam, banded-reticulate (FIGS. 2o, p, 3q, r). Immature fructifications with different tints of pink and red but never bright orange later turning dark-brown or black (FIGS. 2a, b,

3a, b, d).

Habit, habitat and distribution: Found in temperate zones of Europe, Asia and North

America, in different types of forests, on the strongly decomposed wood, covered with bryophytes.

Comments: The main diagnostic characters of T. ferruginosa s. str. are the cylindrical sporothecae with a smoothly rounded, hemispherical or conical tip, which may have blunt or subulate apices, depending on the subspecies (see below). In all other species of the genus, except

T. dudkae, there is a clearly visible “shoulder” between the vertical wall and the flattened tip of the sporothecae (see FIGS. 4g, 7k, 9h). In T. dudkae, the upper surfaces of the sporothecae lack this feature but it is the only species where the sporothecae are not cylindrical.

The upper parts of sporothecae in T. ferruginosa s. str. are free, never tightly attached to each other and thus are not prismatic from mutual pressure. There is only one other species of the

Leontyev et al. Tubifera ferruginosa genus, T. corymbosa, in which the upper parts of the sporothecae are free but in this species they are mostly truncate and brightly iridescent. In addition, T. corymbosa possesses spherical sporothecae near the hypothallus (see below).

The pseudoaethalia in T. ferruginosa s. str. are considerably smaller than those of T. applanata, T. dudkae and T. magna but larger than those of T. corymbosa (FIG. 10). The average spore size in T. ferruginosa s. str. also differs from those of the other species. In T. montana and T. dudkae the spores are larger but in T. pseudomicrosperma they are somewhat smaller (FIG. 14).

Tubifera ferruginosa (Batsch) J.F. Gmel. subsp. ferruginosa Leontyev, Schnittler & S.L.

Stephenson, subsp. nov. FIG. 2

MycoBank MB809786

Tips of the sporothecae hemispherical to obtusely conical, with blunt or papillate apices

(FIG. 2d–g). Young fructifications pale salmon (5YR8/6) to scarlet red (7.5R5/16) (FIG. 2a, b).

Habit, habitat and distribution. Temperate zones of Europe, Asia and North America, in sewveral kinds of forest forests, where it tends to develop in wet depressions, on the strongly decomposed wood of conifers (Picea abies, Abies alba, Pinus sylvestris) and deciduous trees

(Fagus sylvatica, Carpinus betulus), which may be entirely covered with bryophytes.

Tubifera ferruginosa (Batsch) J.F. Gmel. subsp. acutissima Leontyev, Schnittler & S.L.

Stephenson, subsp. nov. FIG. 3

MycoBank MB809787

Typification: USA. VIRGINIA: mixed mesophytic forest, 37°21′55″ N, 80°32′11″ W, 1189 m asl, decaying wood covered with bryophytes, 23 Jun 2013, S.L. Stephenson (holotype UARK

50546).

Etymology. Acutissimus (Latin), the most acute, for the shape of sporothecal apices.

Tips of the sporothecae acute conical, with subulate apices (FIG. 3g–k). Young fructifications deep pink (5R5/12–16) (FIG. 3a, b, d).

Leontyev et al. Tubifera ferruginosa Habit, habitat and distribution. Temperate zones of Europe and North America in deciduous and mixed forests, usually in wet depressions and on strongly decomposed wood of deciduous trees

(Quercus robur), which may be entirely covered with bryophytes. In western and central Europe and also in the western United States, this subspecies is much less common than subsp. ferruginosa but in some localities in eastern Europe, such as the Gomolsha Forests in Ukraine, it is much more abundant than the type subspecies.

Tubifera dudkae (Leontyev & G. Moreno) Leontyev, Moreno & Schnittler, comb. nov. FIG. 5

Basionym: Reticularia dudkae Leontyev & G. Moreno, Bol. Soc. Micol. Madrid 35:86 (2011).

MycoBank MB809788

Typification: UKRAINE, KHARKIV OBLAST: Gomolsha Forests National Park,

49°37′37″ N, 36°19′38″ E, 118 m asl, dead wood, 1 Jul 2003, D.V. Leontyev [holotype CWU MR-

0040(2)].

Etymology: In honor of Irina O. Dudka.

Pseudoaethalia solitary or in small groups, (18–)25–28(–45) mm long, (16–)20–22(–30) mm wide, (5–)7–11(–12) mm high, pulvinate, rounded to short ovate as observed from above, saturated rust-brown (2.5–5YR2/6–8) (FIG. 5d, e); the surface bullate, formed by individual sporothecae with dried slime bands between them (FIG. 5g–i). Sporothecae spherical, ovoid, bag- like, sinuous, (0.1–)0.4–0.6(–1.0) mm diam, never elongated and directed from the base to the top of the pseudoaethalium (FIG. 5f). Hypothallus spongy, white when fresh, brownish (10YR5/6) when mature, forming long strands at the base of the pseudoaethalium (FIG. 5a–c). Peridium smooth, translucent, light brown in reflected light, shining and somewhat iridescent with blue, green and purple tints. External surface of the peridium verrucose as observed in SEM (FIG. 5j). Internal surface of the peridium as observed in SEM, covered by a reticulum consisting of wavy folds (FIG.

5k, l); rings 0.4–1.0 μm diam occasionally observed (FIG. 5m, n). Columella absent. Capillitium absent. Pseudocapillitium may be present in the central part of the pseudoaethalium, where some individual sporothecae can lose their individuality and their peridium is reduced to perforated plates

Leontyev et al. Tubifera ferruginosa and bands. Spores in mass rust brown (2.5YR4–5/10-12), pale brownish in transmitted light, globose, (6.2–)6.9–7.6(–8.1) μm diam, banded-reticulate (FIG. 5o, p). Immature fructifications at first pale pink (7.5R8/2–4), then coral red (7.5R6/10–14), then dirty grayish brown (7.5R2–3/2)

(FIG. 5a–c).

Habit, habitat and distribution. Europe and Asia, both coniferous and mixed forests, mostly on decorticated but not strongly decomposed wood of conifers (Pinus spp.).

Comments. The most prominent character of this species is a pseudoaethalium composed of spherical, ovate or sinuous sporothecae. These sporothecae never take the form of a tuft of parallel cylinders, stretching from the bottom to the top of the fructification, as is the case in all other species in the T. ferruginosa complex. In several species of Reticularia, e.g. R. splendens and R. jurana, one may observe the deep accretion of spherical sporothecae, which partially lose their individual walls and form an aethalium (Lister 1925, Martin and Alexopoulos 1969). Therefore the spherical sporothecae in T. dudkae was considered as the primary argument to assign this species to the genus Reticularia (Leontyev and Moreno 2011)/ However, as indicated above, the 18S rDNA phylogeny contradicts this placement. Although a pseudoaethalium composed of only spherical sporothecae is unique among the species of the Tubifera, their shape per se is not an exclusive feature of T. dudkae. At least two other species, T. dimorphotheca and T. corymbosa, also have a number of spherical sporothecae, situated at the base of the fructification.

The surface of the pseudoaethalium in T. dudkae is formed by irregular, more or less convex sporothecal tips. In this respect, T. dudkae resembles T. montana. Moreover, the spores of both species are similar in size (FIG. 14). However, T. montana lacks the dried slime bands between the sporothecal tips and the surface of the peridium in this species is characterized by a golden and pinkish iridescence.

Tubifera montana Leontyev, Schnittler & S.L. Stephenson, sp. nov. FIG. 6

MycoBank MB809789

Typification: UKRAINE, ZAKARPATTIA OBLAST: Gorgany State Reserve, 48°27′23″ N,

Leontyev et al. Tubifera ferruginosa 24°14′52″ E, 842 m asl, dead wood of Picea abies (?), 13 Aug 2011, D.V. Leontyev (holotype CWU

2912).

Etymology: Montanus (Latin), occurring in mountains.

Pseudoaethalia solitary or grouped, (10–)13–27(–32) mm long, (9–)10–16(–19) mm wide,

(2–)3–7(–8) mm high, pulvinate, elongated, curved, crescent-shaped or irregular as observed from above, ocher brown to golden brown (7.5YR2–4/6) (FIG. 6b–i); the surface bullate, formed by the tips of the sporothecae. Sporothecae cylindrical, irregularly curved, directed mostly from the base to the external surface of the fructification. Tips of the sporothecae variable in size, tightly accreted to each other, ovoid, wormlike to rounded as observed from above, lenticular-convex as viewed from the side, (0.4–)0.6–0.8(–1.0) mm diam (FIG. 6g–i). Hypothallus scanty. Peridium semitransparent, light brown in reflected light, iridescent with golden, bronze, pink or sparsely bluish tints (FIG. 6g– i). External surface of the peridium verrucose as observed in SEM (FIG. 6 j), sometimes bullate inside the pseudoaethalium (FIG.6 k). Internal surface of the peridium, as observed in SEM, covered by a reticulum consisting of wavy folds (FIG. 6l–n), rings 0.4–1.0 μm diam occurring only sparsely (FIG. 6n, o). Columella absent. Capillitium and pseudocapillitium absent. Spores in mass rust-brown (2.5YR4–5/10-12), brownish in transmitted light, globose, (6.6–)7.1–8.1(–8.9) μm diam, banded-reticulate (FIG. 6o, p). Immature fructifications bright orange (2.5YR6/14), then dark brown

(5YR1/2) (FIG. 6a, b).

Habit, habitat and distribution. Temperate zone of Eurasia and North America, in the forests occurring in ravines and on the slopes of mountains, on strongly decomposed wood of conifers

(Picea abies, Pinus pallasiana, P. sibirica), often covered with bryophytes. Field photographs show that it also may occur on leaf litter. At least in central Europe, the peak period of fruiting seems to be summer and not autumn as is the case for T. ferruginosa s. str.

Comments. This is a polymorphous species with several slightly different 18S genotypes.

Tubifera montana is close to T. ferruginosa with respect to both the phenotype and genotype (FIG.

1) and both species are characterized by small, grouped pseudoaethalia, often occurring on

Leontyev et al. Tubifera ferruginosa bryophytes. However, T. montana never displays the free, hemispherical or conical sporothecal tips characteristic of T. ferruginosa and its spores are considerably larger (FIG. 14). The difference in plasmodial color is remarkable in that young fructifications of T. montana are bright orange but never scarlet or pink like those of T. ferruginosa. Tubifera montana also resembles T. dudkae but the latter species is clearly distinguished by its spherical sporothecae (see comments under T. dudkae).

Tubifera magna Leontyev, Schnittler, S.L. Stephenson & T. Kryvomaz, sp. nov. FIG. 7

MycoBank MB809790

Typification: USA, TENNESSEE: Great Smoky Mountains National Park, woodlands and camping area near Cades Cove ATBI residence, 35°43′40″ N, 83°11′09″ W, 1480 m asl, decaying wood, 28 Jul 2003, T.I. Kryvomaz (holotype UARK 20405).

Etymology: Magnus (Latin), large, reflecting the size of the pseudoaethalia.

Pseudoaethalia solitary, (12–)24–61(–127) mm long, (8–)20–32(–51) mm wide, (3–)4–5(–

6) mm high, flat pulvinate or less commonly almost hemispherical, rounded or ovate as observed from above, rust-brown with a delicate copper tint (10R4/10-12) (FIG. 7b–e); the surface formed by the accreted tips of the sporothecae. Sporothecae straight, prismatic, relatively short, directed from the base to the external surface of the fructification (FIG. 7j). Tips of the sporothecae polygonal, somewhat elongated as observed from above, separated from each other by fragmentary patches of the white dried slime, lenticular-convex as viewed from the side, (0.2–)0.4–0.6(–0.8) mm long,

(0.1–)0.3–0.4(–0.5) mm wide (FIG. 7f–h, k). Hypothallus scanty, at first white and then beige

(5Y8/4), sometimes forming an interrupted rim around the pseudoaethalium (FIG.7 e). Peridium semitransparent, bright yellow-brown in reflected light, shining but not iridescent except for the internal surface of the sporothecae (FIG. 7j). External surface of the peridium verrucose as observed in SEM (FIG. 7l). Internal surface of the peridium, as observed in SEM, covered by a reticulum consisting of wavy folds (FIG. 7m, n), irregular, curved rings 0.2–0.7 μm diam only occasionally present (FIG. 7o). Columella absent. Capillitium and pseudocapillitium absent. Spores in mass rust-

Leontyev et al. Tubifera ferruginosa brown (2.5YR4–5/10–12), brownish in transmitted light, globose, (5.7–)6.3–7.2(–8.2) μm diam, banded reticulate (FIG. 7p, q). Immature fructifications bright lilac-pink (2.5R5-6/12-14) (FIG. 7a).

Habit, habitat and distribution. Temperate zones of North America, one collection from

Europe, in coniferous (Picea rubra) and deciduous (Quercus spp., Acer spp.) forests, on moderately decomposed wood and rarely on leaf litter.

Comments. Tubifera magna is one of two species of the T. ferruginosa complex forming very large pseudoaethalia, 3–12 cm across, with flattened sporothecal tips, which coalesce to produce a nearly smooth surface of the fructification. The second species, T. applanata, occurs mostly in Eurasia, whereas T. magna, except for one known specimen, appears to be found mostly in North America. In T. applanata, the pseudoaethalia are rounded from above and the sporothecal tips are isodiametric, roughly hexagonal, similar in size and seated in regular rows, whereas in T. magna the pseudoaethalia are elongated (see FIG. 10), the sporothecal tips are prolate, variable in size and have no regular position (FIG. 11). The peridium in T. applanata appears dull, whereas in

T. magna it is shiny. Only T. magna may have a white hypothallic rim around the base of the pseudoaethalium. Large rings that ornament the peridium in T. applanata are not found in T. magna. Finally, the color of immature fructifications is light pink in T. magna and flesh to dirty salmon in T. applanata.

Tubifera pseudomicrosperma Leontyev, Schnittler & S.L. Stephenson, sp. nov. FIG. 8

MycoBank MB809791

Typification: USA, MICHIGAN: North Lake Lansing Trail, Lake Lansing Park, hardwood forest, 42°45′14″ N, 84°25′59″ W, 267 m asl, decorticated wood, 20 Jun 2004, G.C. Adams

(holotype UARK 20730).

Etymology: Pseudo (Greek), false; Microspermus (Greek), having small spores; indicating its similarity with Tubifera microsperma.

Pseudoaethalia solitary or grouped, (7–)9–18(–23) mm long, (5–)6–12(–15) mm wide, (2–

)3–5(–6) mm high without the hypothallus, rounded, ovoid or vermicular as observed from above,

Leontyev et al. Tubifera ferruginosa often forming a moniliform complexes, pulvinate to hemispherical as in a side view, beige brownish to cinnamon-brown (7.5YR4-6/4) (FIG. 8b–f); the surface formed by the adherent tips of the sporothecae. Sporothecae cylindrical to prismatic, rounded or smoothed polygonal in cross section, straight, directed from the base to the external surface of the fruit body (FIG. 8i). Tips of the sporothecae of uniform diam, penta- to hexagonal as observed from above, flat or inconspicuously convex, accreted to each other, 0.3–0.5 mm diam (FIG. 8g, h). Hypothallus forming a wide stub-like structure, on which the pseudoaethalium is seated, 2–5 mm high, firm, glossy, white when fresh, brownish-black when mature (FIG. 8a–e). Peridium beige brownish in reflected light, dull, not iridescent; pale yellow to almost hyaline in transmitted light (FIG. 8j). External surface of peridium verrucose as observed in SEM (FIG. 8l). Internal surface of peridium, as observed in SEM, covered with rimmed craters 0.2–0.6 μm diam, up to 0.5 μm high (FIG. 8m–o); no wavy folds observed.

Columella absent. Capillitium and pseudocapillitium absent. Spores in mass rust-brown (2.5YR4–

5/10-12), pale brownish in transmitted light, globose, (4.4–)4.8–5.4(–6.1) μm diam, banded- reticulate (FIG. 8p, q). Immature fructifications are pale pinkish cream (2.5YR8/2-4) (FIG. 8a).

Habit, habitat and distribution. Europe and North America, in deciduous and mixed forests, on strongly decomposed wood of deciduous trees, with no moss cover.

Comments. The species differs from all representatives of the complex by its black stub-like hypothallus. Tubifera ferruginosa s. str. is superficially similar but has sporothecae with free hemispherical or conical tips (in contrast to the flat ones in T. pseudomicrosperma), a rust brown, shining and somewhat iridescent color of the peridium (which is beige brownish and dull in T. pseudomicrosperma), and much larger spores (6.4–7.3 μm vs 4.8–5.4 μm in T. pseudomicrosperma). Another species very similar to T. pseudomicrosperma is T. microsperma.

However, the latter has small pseudoaethalia less than 1 cm diam and its thick hypothallic basement looks like a stalk, with the height exceeding the diameter. Spores of T. microsperma are somewhat larger (FIG. 14).

Leontyev et al. Tubifera ferruginosa In both T. microsperma and T. pseudomicrosperma, the peridium is ornamented with so- called rimmed craters, covering its whole inner surface (TABLE I). However, in T. pseudomicrosperma these craters are much smaller and therefore indistinguishable in DIC, whereas in T. microsperma they are clearly visible (FIG. 12).

Tubifera corymbosa Leontyev, Schnittler, S.L. Stephenson & L.M. Walker sp. nov. FIG. 9

MycoBank MB809792

Typification: COSTA RICA, LIMÓN: La Selva Biol. Station, 10°25′52″ N, 84°00′12″ W, 48 m asl, rotting wood, 1 Jul 2011, L.M. Walker (holotype UARK 47853).

Etymology. Corymbus (Latin), bunch, corymb, indicating the shape of the pseudoaethalium, which resembles a corymbose inflorescence.

Pseudoaethalia solitary or grouped, (2.3–)2.5–4.2(–4.8) mm diam, (2.8–)3.0–4.4(–4.6) mm high, occurring as a dense bunch-like tuft of sporothecae, narrowed at the base, bright rust-brown

(2.5YR2–4/6) (FIG. 9a–g); the surface formed by the free tips of the sporothecae. Sporothecae are of two types, the first large and cylindrical, the second small and spherical. Cylindrical sporothecae make up the bulk of the pseudoaethalium, directed from the base to the upper surface of the fruit body with peripheral sporothecae usually deflected outward; smooth, narrowed at the base, expanded and truncate at the top, (0.33–)0.37–0.45(–0.49) mm diam at the upper part (FIG. 9b, d, f).

Spherical sporothecae are less numerous, situated at the base of pseudoaethalium, submerged in hypothallic slime, (0.10–)0.12–0.20(–0.31) mm diam (FIG. 9d, g, i–k). Tips of the cylindrical sporothecae uniform in diameter, more or less convex to truncate, rounded as observed from above, distant from each other, 0.3–0.5 mm diam (FIG. 9g, h). Hypothallus forming the narrowed base of the pseudoethalium, loose, spongy, dirty white, incrusted with spheroid sporothecae (FIG. 9i).

Peridium for the most part of the sporothecae bright rust brown in reflected light, shining, weakly iridescent in blue, green and purple tints, yellowish in transmitted light (FIG. 9f, g); at the sporothecal tips the peridium is much lighter, silvery white or pale golden ocher, sometimes with a metallic luster (FIG. 9h). External surface of peridium covered with warts as observed in SEM (FIG.

Leontyev et al. Tubifera ferruginosa

9l) but absolutely smooth at the tips of sporothecae (FIG. 9m, right). Internal surface of peridium as observed in SEM, covered by a faint reticulum of wavy folds (FIG. 9n); with sparse rings of 0.3–0.9

μm diam (FIG. 9o). Columella absent. Capillitium and pseudocapillitium absent. Spores in mass rust brown (2.5YR4–5/10-12), pale brownish in transmitted light, globose, (5.3–)5.7–6.3(–6.8) μm diam, banded-reticulate (FIG. 9p, q). Immature fructifications unknown.

Habit, habitat and distribution. Tropical forests of Central America, on decaying wood.

Comments. Tubifera corymbosa is a peculiar species, which might be considered as a member of the T. ferruginosa complex. The two available collections of this species were given different preliminary identifications: UARK 47853 as T. ferruginosa and AFMD 251 as T. dimorphotheca. Indeed, these two species are most similar to T. corymbosa morphologically.

However, in our phylogeny, T. corymbosa and T. ferruginosa are situated on distant branches (FIG.

1). The phylogenetic relationship between T. corymbosa and T. dimorphotheca remains unclear.

Tubifera corymbosa differs from all representatives of the T. ferruginosa complex by the presence of the small spherical sporothecae at the base of the pseudoaethalium. On the other hand, this suggests a close relationship with T. dimorphotheca, previously considered to be the only species with this character (Nannenga-Bremekamp and Loerakker 1981). However, in T. dimorphotheca the spherical sporothecae are seated on a prominent hypothallic stalk, which is absent in T. corymbosa. The limited material available from herbaria lets us conclude that the peridium in T. dimorphotheca is dull and not iridescent; however, the authors of the latter species noted that it might be glossy (Nannenga-Bremekamp and Loerakker 1981). In T. corymbosa the lateral surface of the sporothecae the peridium is shining and iridescent with blue, green and purple tints but at the sporothecal tips the peridium has a metallic, silvery or golden luster.

DISCUSSION

Phylogeny vs morphology.—The topology of our 18S rDNA tree generally correlates with the morphological characters of the organisms being considered. This can be demonstrated by the example of Reticularia olivacea, a species traditionally considered to fall within the Reticulariaceae

Leontyev et al. Tubifera ferruginosa but attributed in our phylogeny to the Cribrariaceae. Together with the closely related species R. simulans (Rostaf.) D.W. Mitch. and R. liceoides (Lister) Nann.-Bremek., R. olivacea differs from all other members of the Reticulariaceae by having verrucose spores, an olivaceous spore mass and black plasmodium and young fructifications (Neubert et al. 1993, Poulain et al. 2011). All these characters unite the olive-spored species of Reticularia with members of the Cribrariaceae, especially with Lindbladia tubulina. This similarity first was noted by Rostafinsky, who established the monotypic genus Licaethalium Rostaf. and proposed the new combination Licaethalium olivaceum (Ehrenb.) Rostaf. for R. olivacea (other olive-spored species were not yet known)

(Rostafińsky 1875), thus constructing a hypothetical evolutionary sequence from the sporangiate

Cribaria via pseudoaethaliate Lindbladia to the aethaliate Liacethalium. Our 18S rDNA phylogeny provides a preliminary basis for the possible re-erection of Rostafińsky’s genus Licaethalium.

All other studied species of the Reticulariaceae separate into three basal branches that agree with the genera accepted in the family. These are (i) Alwisia, (ii) Lycogala plus Reticularia and (iii)

Tubifera. Among these branches, Alwisia appears to be closest to the hypothetical last common ancestor of the family, forming the cluster with the shortest distance from the basal node. This correlates with morphological data because the genus is characterized by a number of presumably plesiomorphic features, such as individual sporothecae, fibrous stalks and a tubular capillitium

(Leontyev et al. 2014a, b, c). The cluster that includes Lycogala and Reticularia is divided into two subclusters that correspond to these genera, thus supporting previous data on their monophyly

(Leontyev et al. 2014a, c).

All studied species of Tubifera form a monophyletic cluster. However, the present investigation did not consider four known species currently assigned to the genus, including the morphologically deviating T. casparyi (Rostaf.) T. Macbr. and T. dictyoderma Nann.-Bremek. &

Loer. For these reasons, we currently are unable to draw a final conclusion about the monophyly of the genus Tubifera as traditionally circumscribed.

Leontyev et al. Tubifera ferruginosa It is noteworthy that the Tubifera clade is divided into two groups, the first consisting of T. ferruginosa, T. dudkae, T. magna and T. montana and the second of T. applanata, T. corymbosa, T. microsperma and T. pseudomicrosperma (FIG. 1). These two groups unite species with different pseudoaethalia dimensions, sporothecal tips and different kinds of peridial ornamentation. The only morphological character that clearly corresponds to this subdivision is spore size. The first group unites species with larger spores (6.0–8.5 μm), whereas the second includes taxa with smaller spores (4.5–6.5 μm, FIG. 14).

The color of immature fructifications.—Long-term observations, often in the same localities (20 y in Germany, 17 y in the Ukraine), have revealed that the color of the fructifications in Tubifera passes through two main stages before they are mature. In the first, brightly colored stage, when the plasmodium leaves the substrate, almost every taxon has its own tint: salmon to scarlet in T. ferruginosa subsp. ferruginosa, deep pink in T. ferruginosa subsp. acutissima, coral red in T. dudkae, orange in T. montana, pink in T. magna, pinkish cream in T. pseudomicrosperma and dirty salmon to flesh in T. applanata (Leontyev and Fefelov 2009). In the second dark stage, the fructifications in most taxa become dark grayish or brownish but in T. ferruginosa subsp. acutissima they turn almost black.

Because the color of the initial bright stage is so distinctive, it is important to observe both immature and mature stages of the same pseudoaethalium, or at least in the same group of pseudoaethalia. Unfortunately immature fructifications of Tubifera usually become sclerified and lose their color when collected. As such, wherever possible, images of immature pseudoaethalia should be obtained as part of a voucher.

Size and shape of pseudoaethalia.—The pseudaethalia dimensions in Tubifera species are variable, even in a group of fructifications appearing on one log. Nevertheless, the species have informative differences in this character. Within the T. ferruginosa complex, the smallest pseudoaethalia were recorded for T. corymbosa, then the average size tends to increase from T. ferruginosa toward T. pseudomicrosperma, T. montana, T. applanata and finally, T. magna. The relative proportion of

Leontyev et al. Tubifera ferruginosa pseudoaethalium width to length changes from species to species, varying from low values in the elongated pseudoaethalia of T. magna, T. montana and T. pseudomicrosperma to high in the almost isodiametric fructifications of T. applanata, T. corymbosa and T. dudkae (see coefficients on FIG.

10).

The shapes of the pseudoaethalia are more distinctive (FIG. 10). In both subspecies of T. ferruginosa s. str., they are mostly elongated and moniliform, divided into segments by numerable transverse fissures. The fructifications of T. pseudomicrosperma are similar. In T. applanata and T. dudkae the pseudoaethalia are mostly short ovate, whereas in T. magna they are somewhat angular.

In T. montana the pseudoaethalia are strongly irregular and tend to be crescent-shaped.

Shape of the sporothecae and their tips.—We think the shape of the sporothecae in general and especially the shape of the sporothecal tips to be as the most reliable morphological character to identify species in the T. ferruginosa complex. Sporothecae can be straight and arranged in a single layer (cylindrical in T. ferruginosa, T. pseudomicrosperma and T. corymbosa; prismatic because of mutual pressure in T. applanata and T. magna), or stacked in several layers in a way that not all sporocarps reach both the top and the base of the fructification (elongated and strongly curved in T. montana; spherical or irregularly bag-shaped in T. dudkae).

Each taxon of the T. ferruginosa complex displays an easily recognizable pattern of sporothecal tips situated at the upper surface of the pseudoaethalium (FIG. 11). In freshly matured, undamaged fructifications, these structures are clearly visible with a hand lens and thus useful to identify species in the field. Because of the very fragile peridia in the T. ferruginosa complex, an imaging of the fresh material with a macro lens is recommended to document the shape of sporothecal tips. In T. ferruginosa and T. corymbosa tips are free and not accreted, whereas in all other species tips are tightly accreted, forming a relatively even, flat or bullate surface. The shape of the tips can be hemispherical, papillate or obtuse conical (T. ferruginosa subsp. ferruginosa), subulate (T. ferruginosa subsp. acutissima), truncate (T. corymbosa), lenticular (T. dudkae, T. montana) or almost flat and polygonal (T. applanata, T. pseudomicrosperma). In T. dudkae, T.

Leontyev et al. Tubifera ferruginosa magna and T. applanata, dried slime bands often are observed between the sporothecae; these bands are shiny in the first two species but dull in the latter.

Ornamentation of the peridium.—This character was introduced into the taxonomy of Tubifera when a peculiar ornamentation, referred to as “rimmed craters”, was described for the inner surface of the peridium of T. microsperma (Nelson et al. 1982). In contrast T. ferruginosa was shown to have a smooth inner peridial surface. Later, annular ornamentations of the inner surface of the peridium were observed in T. applanata and ornamentation consisting of a reticulum of wavy folds was observed in T. dudkae (Leontyev and Fefelov 2009, Leontyev and Moreno 2011).

In this study we analyzed both the inner and the outer surface of the peridium in an effort to provide useful characters for distinguishing species in the T. ferruginosa complex (TABLE I). The outer surface of the peridium in T. ferruginosa, T. applanata, T. dudkae and T. corymbosa was found to be covered with granules (0.3–1.0 μm diam); in T. magna, T. montana and T. pseudomicrosperma the outer surface of peridium is rough but individual granules are not apparent.

In general the diagnostic significance of the outer peridial surface is low. However, the ornamentation of the inner peridial surface is of much higher diagnostic value (FIGS. 3–7; cf.

Leontyev and Fefelov 2009, 2012, Leontyev and Moreno 2011). Contrary to an opinion expressed by Leontyev and Fefelov (2009) and Leontyev and Moreno (2011), both rings and wavy folds were found in all species of the T. ferruginosa complex except for T. applanata and T. pseudomicrosperma. Nevertheless these structures are variable in density and morphology. As illustrated peridial rings are frequent and large in T. applanata (FIG. 4m, n) but also common in T. dudkae (FIG. 5n), T. montana (FIG. 6n) and T. magna (FIG. 7o), albeit they are much smaller and less prominent. In T. ferruginosa (FIG. 2n) and T. corymbosa (FIG. 9o), rings are extremely rare. In

T. pseudomicrosperma, the circular ornamentation consists of rimmed craters, which are similar to those of T. microsperma (Nelson et al. 1982) and much taller than the rings present in T. applanata.

In both T. microsperma and T. pseudomicrosperma, these craters are numerous, covering the surface of the peridium. However, in T. pseudomicrosperma they are much smaller than those

Leontyev et al. Tubifera ferruginosa found in T. microsperma, where they sometimes reach 2.5 μm diam (FIG. 12a–b). Therefore peridial craters of T. pseudomicrosperma cannot by identified by DIC (FIG. 12c) whereas in T. microsperma they are clearly visible (FIG. 12d).

A reticulum of wavy folds covers the inner peridium surface not only in T. dudkae but also in T. montana, T. magna and T. corymbosa. In T. montana these ornamentations are reflected in the presence of furrows in the outer surface of the peridium (FIG. 6k). In T. dudkae and T. montana folds and rings may be found on the same portion of the peridium (FIGS. 6n, 7o). In T. ferruginosa wavy folds occupy only small areas and the rest of the peridial surface is smooth (FIGS. 2l, m, 3m– o). In general wavy folds are most abundant in species with iridescent peridia. We suspect that these folds might represent the source of the iridescence, forming microscopic prisms that split the light with different wave lengths.

Pseudocapillitium, true capillitium and false capillitium.—The absence of capillitium was thought to be one of the important characters of the Reticulariaceae. Any thread-like structures found in members of the family usually were called a pseudocapillitium (Martin and Alexopoulos 1969,

Nannenga-Bremekamp 1991, Ing 1999). However, in a strict sense pseudocapillitium refers to a structure formed by the remains of the peridium and columellae of confluent sporothecae within an aethalium or pseudoaethalium (Lister 1925). This was never shown convincingly for Lycogala

Adans. and obviously is not the case in Alwisia bombarda and A. lloydiae. Therefore the thread-like structures in these taxa are likely to represent a true capillitium (see Leontyev et al. 2014 c). In T. casparyi the columella has the shape of a bottle brush as a result of the numerous perpendicular branches. These branches demonstrate all features of a typical capillitium but usually have not been considered as such (Lister 1925, Martin and Alexopoulos 1969). On the other hand a true pseudocapillitium, formed by peridial remains, is known for T. dudkae (Leontyev and Moreno

2011) and all species of Reticularia Bull.

Nannenga-Bremekamp was the first to observe thin, branched threads, covered with adhering spores, in many specimens of T. ferruginosa s.l. and provided good illustrations

Leontyev et al. Tubifera ferruginosa (Nannenga-Bremekamp 1961: 58; 1991: 54). These structures were reported by Neubert et al.

(1993: 142). Nannenga-Bremekamp first considered these threads to be a pseudocapillitium (1961) but later (1991) she referred to them as a true capillitium (FIG. 13a). She also indicated, that this

“capillitium” may or may not be present in T. ferruginosa. Such an inconstancy of this character is unusual for any species of myxomycete.

Our study of herbarium material shows that the structures described by Nannenga-

Bremekamp occur sporadically in several species, namely T. applanata, T. dictyoderma, T. ferruginosa, T. magna and T. montana. In some specimens of each species these threads are abundant, whereas in others they are absent. Within one pseudoaethalium they may be present in only a few sporothecae. As a general estimate, we observed such structures in 18% of studied specimens of Tubifera. The respective structures are thin (ca. 0.5–1.0 μm diam) but readily visible under a dissecting microscope (FIG. 13b, c) because numerous spores adhere to their surface (FIG.

13d–f, h). This adhesion is strong; touching the spores with a needle or rinsing with water does not release them. Such a strong connection of capillitium and spores seemingly contradicts the biological function of a capillitium, which usually is thought to facilitate spore release. The threads do not show a regular connection to either the peridium or the columella; they may be found even at the outer surface of a sporotheca (FIG. 13g). SEM micrographs reveal these threads to be hollow and divided by internal septa (FIG. 13i). All these features indicate that these “capillitial” structures found in members of the T. ferruginosa complex are hyphae of fungi that use the spores as food.

This explains the occasional distribution of the threads in different species and the strong adherence of the spores to them. If this explanation is accepted, all species of the T. ferruginosa complex lack a true capillitium. With respect to a pseudocapillitium, T. dudkae is the only representative of the complex reported to have this structure present (Leontyev and Moreno 2011).

Spore size.—Tubifera ferruginosa s.l. was described originally as having spores 6–8 μm diam.

Spore size was used to distinguish it from T. casparyi with spores 7.5–9 μm and T. microsperma with 5–6 μm diam spores (Lister 1925, Martin and Alexopoulos 1969). Our study, based on

Leontyev et al. Tubifera ferruginosa measurements of 25 spores for each of the 119 studied specimens of the various species of Tubifera, revealed noticeable differences in spore size (FIG. 14). The data indicate that T. ferruginosa s. str. is characterized by more narrow limits of spore size (6.4–7.3 μm) and that the difference between subspecies ferruginosa and acutissima is insignificant. Tubifera pseudomicrosperma, T. corymbosa and T. applanata have smaller spores than T. ferruginosa s. str., whereas in T. dudkae and T. montana the spores are considerably larger. However, spore dimensions are not entirely suitable as an identification tool within the T. ferruginosa complex, because their ranges of variation overlap for most species. Meanwhile, spore size helps to distinguish species that are morphologically similar, such as T. applanata and T. dudkae (spores 5.4–6.1 vs 6.9–7.6 μm), T. applanata and T. magna (5.4–6.1 vs 6.3–7.2 μm), T. ferruginosa and T. montana (6.4–7.3 vs 7.1–8.1 μm), T. microsperma and T. pseudomicrosperma (5.3–6.4 μm vs 4.8–5.4 μm), T. corymbosa and T. dimorphotheca (5.1–5.5 vs 5.7–6.3 μm).

Geographical distribution.—Most of the new taxa in the Tubifera ferruginosa complex occur in the temperate zone of the northern hemisphere. Exceptions are the apparently tropical T. corymbosa, found in Mexico and Costa Rica and some undescribed species, such as Tubifera sp. 2 from the

Seyshelles and Tubifera sp. 3 from New Zealand. In general T. ferruginosa s.l. has been reported from several countries of South America (gwannon.com). However, it is still impossible to attribute these findings to the genotypic species of T. ferruginosa complex described in this study or to undescribed taxa.

At least some species in the complex, T. ferruginosa, T. montana and probably T. pseudomicrosperma, are widely distributed in all studied regions in Europe, Asia and North

America. However, the geographical distribution of their 18S rDNA genotypes is much narrower, suggesting dispersal barriers that limit gene flow.

Other species seem to have a more restricted distribution. For example, T. applanata is common in southeastern Europe and northern Asia, including Italy and Croatia (Renato Cainelli pers comm), the European part of Russia (Inna Zemlyanskaya pers comm), the Ural Mountains and

Leontyev et al. Tubifera ferruginosa Siberia (Leontyev and Fefelov 2009) but rare in eastern North America (only one collection known thus far). Tubifera dudkae is known only from Europe (France, Ukraine) and northern Asia (Russia) and is still unknown from the New World. Finally, T. magna is widespread in North America but only a single collection with a different 18S rDNA genotype is known from Europe.

KEY TO THE SPECIES OF TUBIFERA

1a. Columella always present, thread-like, shining, always reaching the tip of a sporotheca and adherent to its peridium; upper peridium very tough, fructifications durable and resistant to the touch; spore mass ocher, umber or grayish ...... 2

1b. Columella absent or only occasionally present, in this case thick, irregularly conical, dull, never reaching the tip of a sporotheca; peridium delicate and fragile, fructifications easily destroyed upon contact; spore mass rust-brown ...... 3

2a. Columella hollow, tubular, shaped like a bottlebrush because of numerous perpendicular branches; upper peridium umber brown, spore mass umber gray; spores 7.5–8 μm

...... T. casparyi

2b. Columella solid, with irregular branches; upper peridium dark red brown, spore mass cinnamon, hazel brown when fresh, ochraceous in old collections; spores 4.5–6 μm ...... T. dictyoderma

3a (1). Spherical sporothecae aggregated around the base of the pseudoaethalium ...... 4

3b. Spherical sporothecae absent or not distinctly aggregated around the base of the pseudoaethalium ...... 5

4a. Spherical sporothecae numerous, seated on a cylindrical stub-like stalk; sporothecal tips hemispherical, the peridium of the latter with the same color as the remaining part of the sporotheca

...... T. dimorphotheca

4b. Spherical sporothecae few, arranged around the constricted base of the pseudoaethalium, distinct stalk absent; sporothecae tips mostly truncate, the peridium of the latter iridescent with rainbow colors, sometimes with a silvery white apex ...... T. corymbosa

Leontyev et al. Tubifera ferruginosa 5a (3). Hypothallus prominent, smooth, dark brown to black, forming a thick basal structure or a vertical cylindrical stalk, which is at least as tall as the sporothecal layer ...... 6

5b. Hypothallus amorphous, thinner, never forming a basal structure or stalk ...... 8

6a. Sporothecal tips acutely conical; hypothallic stalk strongly constricted at the base; spores 6.5–

7.5 µm ...... T. papillata

6b. Sporothecal tips hemispherical to almost flat; hypothallus flat; spores 4.5–6.5 µm ...... 7

7a. Pseudoaethalia 1–2 cm in extent, hypothallus forming a wide basal structure, sometimes common for a group of pseudoaethalia; internal surface of the peridium covered with rimmed craters 0.2–0.6 μm diam that are visible only with SEM; occurring in temperate regions

...... T. pseudomicrosperma

7b. Pseudoaethalia 0.3–0.7 cm in extent, hypothallus forming a stub-like stalk, the height of the latter structure equal to or exceeding its diameter; internal surface of the peridium covered with rimmed craters 0.5–2.5 μm diam, these clearly visible in DIC; occurring mostly in the tropics .

...... T. microsperma

8a (5). Most of the sporothecae spherical, distributed all over the pseudoaethalium (check a cross section) ...... T. dudkae

8b. Nearly all of the sporothecae elongated, cylindrical or prismatic...... 9

9a. Pseudoaethalia large, mostly 3–12 cm in extent; sporothecal tips flat, angular ...... 10

9b. Pseudoaethalia usually less than 3 cm in extent; sporothecal tips elevated: lenticular, hemispherical or conical ...... 11

10a. Sporothecal tips isodiametric, dull; inner side of the peridium ornamented with rings up to 3

μm diam visible in DIC, immature fructifications dirty flesh to light brownish-salmon; spores 5.4–

6.1 μm; occurring mostly in Eurasia ...... T. applanata

10b. Sporothecal tips elongated, glossy, shining; peridial rings <1 μm in diam observed only in

SEM, immature fructifications pink; spores 6.3–7.2 μm; occurring mostly in North America

...... T. magna

Leontyev et al. Tubifera ferruginosa 11a (9). Immature fructifications bright orange, sporothecal tips adhering to each other, lenticular; peridium weakly iridescent with golden, bronze or pinkish tints; spores 7.1–8.1 μm

...... T. montana

11b. Immature fructifications red to deep pink, sporothecal tips free, strongly convex; peridium weakly iridescent with bluish and greenish tints; spores 6.4–7.3 μm

...... 12 (Tubigera ferruginosa s. str.)

12a. Tips of sporothecae hemispherical, papillate to obtusely conical; immature fructifications pale salmon to scarlet red ...... T. ferruginosa subsp. ferruginosa

12b. Tips of sporothecae bluntly conical, with spine-like apices; immature fructifications deep pink

...... T. ferruginosa subsp. acutissima

ACKNOWLEDGMENTS

The research was supported by a grant from the German Academic Exchange Service (DAAD;

A/12/04515) and a scholarship from the Fulbright Scholar Program (grant 68130017) to the first author. Additional support was provided by the Slime Mold Project at the University of Arkansas.

We thank Laura Walker and Bobbie Okimoto (University of Arkansas), Anja Klahr and Eva

Heinrich (University of Greifswald, Germany) for help with laboratory work. For loans of specimens we are indebted to Yuri Novozhilov (St. Petersburg, Russia), Anna-Maria Fiore-Donno

(Cologne, Germany), Marianne Meyer (Rognaix, France) and Renée Lebeuf (Montréal, Canada).

Thanks in particular are extended to Renato Cainelli (Italy), Renée Lebeuf and administrators of the

Mushroom Observer (United States) for their kind permission to publish several of their field photographs.

LITERATURE CITED

Batsch AJG. 1786. Elenchus Fungorum. Continuatio Prima. Halle, Magdeburg: Gebauer. 280 p.

Clark J, Haskins EF. 2010. Reproductive systems in the myxomycetes: a review. Mycosphere

1:337–353.

Leontyev et al. Tubifera ferruginosa

Emoto Y. 1977. The Myxomycetes of Japan. Tokyo, Japan: Sangyo Tosho. 263 p.

Fiore-Donno AM, Clissmann F, Meyer M, Schnittler M, Cavalier-Smith T. 2013. Two-gene phylogeny of bright-spored myxomycetes (slime moulds, superorder Lucisporidia). PLoS One

8:e62586.

———, Kamono A, Meyer M, Schnittler M, Fukui M, Cavalier-Smith T. 2012. 18S rDNA phylogeny of Lamproderma and allied genera (Stemonitales, Myxomycetes, Amoebozoa). PLoS

One 7:e35359.

Gmelin JF. 1792. Caroli a Linné, systema naturae. Lipsiae. Tom. I. Pars VII:3911–4120.

Hall BG. 2011. Phylogenetic trees made easy. A how-to manual. 4th ed. Sunderland,

Massachusetts: Sinauer Associates. 282 p.

Huelsenbeck JP, Ronquist F. 2001. MrBayes: Bayesian inference of phylogenetic trees.

Bioinformatics 17:754–755.

———, ———. 2012. MrBayes 3.0b4. http://morphbankebcuuse/mrbayes/infophp. Accessed: 28

May 2013.

Ing B. 1999. The Myxomycetes of Britain and Ireland: an identification handbook. Slough, UK:

Richmond Publishing Co. 374 p.

Leontyev et al. Tubifera ferruginosa Katoh K, Kuma K, Toh H, Miyata T. 2005. MAFFT 5: improvement in accuracy of multiple sequence alignment. Nucleic Acids Res 33:511–518.

Lado C. 2005–2015. Nomen.eumycetozoa.com. An online nomenclatural information system of

Eumycetozoa. Madrid: Real Jardín Botánico, CSIC. http://eumycetozoa.com/data/index.php.

Accessed 4 Jan 2015.

Leontyev DV, Fefelov KA. 2005. Heterogeneity of Tubulifera arachnoidea Jacq. and perspective of the new Tubulifera species description. In: Galindo Flores G, Santiago Martínez G, Montoya

Esquivel A, Estrada-Torres A, eds. The 5th International Congress on Systematics and Ecology of

Myxomycetes. Tlaxcala, Mexico: Univ Press. p 58.

———, ———. 2009. Tubulifera applanata. A new myxomycete species from eastern Europe and northern Asia. Bol Soc Mycol Madrid 33:115–127.

———, ———. 2012. Nomenclatural status and morphological notes on Tubifera applanata sp. nov. (Myxomycetes). Mycotaxon 120:247–251.

———, Moreno G. 2011. Reticularia dudkae. A new myxomycete species from oak forests of eastern Ukraine. Bol Soc Mic Madrid 35:85–94.

———, Schnittler M, Moreno G, Stephenson SL, Mitchell DW, Rojas C. 2014a. The genus Alwisia

(Myxomycetes) revalidated, with two species new to science. Mycologia 106:936–948.

———, Stephenson SL, Schnittler M. 2014b. A new species of Alwisia (Myxomycetes) from New

South Wales and Tasmania. Mycologia 106:1212–1219.

Leontyev et al. Tubifera ferruginosa

———, Schnittler M., Stephenson SL. 2014c. Pseudocapillitium or true capillitium? A study of capillitial structures in Alwisia bombarda (Myxomycetes). Nova Hedwigia 99:441–451.

Lundblad EW, Einvik C, Ronnin S, Haugli K, Johansen S. 2004. Twelve group I introns in the same pre-rRNA transcript of the myxomycete Fuligo septica: RNA processing and evolution. Mol Biol

Evol 21:1283–1293.

Lister A. 1925. A monograph of the Mycetozoa. 3rd ed. Revised by G. Lister. London: British

Museum. 296 p.

Martin GW, Alexopoulos CJ. 1969. The Myxomycetes. Iowa City, US: Iowa Univ. Press. 560 p.

Munsell AH. 1912. A pigment color system and notation. Am J Psychol 23:236–244.

Nandipati SCR, Haugli K, Coucheron DH, Haskins EF, Johansen SD. 2012. Polyphyletic origin of the genus Physarum (Physarales, Myxomycetes) revealed by nuclear rDNA mini chromosome analysis and group I intron synapomorphy. BMC Evol Biol 12:166.

Nannenga-Bremekamp NE. 1961. Notes on Myxomycetes IV. Myxomycetes collected in the

Netherlands, chiefly in the vicinity of Doorwerth (Gelderland). Acta Bot Neerl 10:56–66.

———. 1991. A guide to temperate Myxomycota. Bristol, United Kingdom: Biopress Ltd. 410 p.

Leontyev et al. Tubifera ferruginosa ———, Loerakker WM. 1981. Notes on some species of myxomycetes sent to the Dutch Plant

Protection Service. Proceedings van de Koninklijke Nederlandse Akademie van Wetenschappen

Section C 84:233–241.

Nelson RK, Scheetz RW, Alexopoulos CJ. 1982. Taxonomic studies in the myxomycetes. V.

Significance of peridial and spore ornamentations in the genus Tubifera, with a revised key to the species. Mycologia 74:541–548.

Neubert H, Nowotny W, Baumann K. 1993. Die Myxomyceten Deutschlands und des angrenzenden

Alpenraumes unter besonderer Berücksichtigung Österreichs. Bd. 1. Gomaringen, Germany:

Baumann Verlag. 340 p.

Novozhilov YK, Schnittler M, Erastova DA, Okun MV, Shchepin ON, Heinrich E. 2013. Diversity of nivicolous myxomycetes of the Teberda Biosphere Reserve (northwestern Caucasus, Russia).

Fungal Divers 59:109–130.

Pawlowski J, Audic S, Adl S, Bass D, Belbahri L, et al. 2012. CBOL protist working group:

Barcoding eukaryotic richness beyond the animal, plant, and fungal kingdoms. PLoS Biol

10:e1001419.

Poulain M, Meyer M, Bozonnet J. 2011. Les Myxomycètes. Vol. 1. Dauphiné-Savoie, France:

Fédération mycologique et botanique. 568 p.

Rostafiński JT. 1875. Śluzowce Monographia. Paris, France: Biblioteka Kórnicka. 418 p.

Leontyev et al. Tubifera ferruginosa Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W; Fungal

Barcoding Consortium authors. 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. P Natl Acad Sci USA 1109:6241–6246.

Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28:2731–2739.

LEGENDS

FIG. 1. Phylogeny of the Tubifera ferruginosa complex and related species of the Reticulariaceae based on partial 18S rDNA sequences (1219 positions). The tree was constructed by Bayesian inference. ML bootstrap replicates (above 50%) and Bayesian posterior probabilities (below 0.5) are shown for each branch. A hyphen indicates a conflicting topology. Bar indicates the fraction of substitutions per site. Clusters separated by p-distance values ≥ 0.15 are colored and labeled with taxon names, except for the genotypes Tubifera sp. 1–3 and Lycogala sp. 1–4 representing putatively new species not characterized in this study. * the genotype displayed by the type specimen of the respective taxon.

FIG. 2. Tubifera ferruginosa s. str. subsp. ferruginosa. а. Immature pseudoaethalium at the “bright” stage. b. Immature pseudoaethalia showing the “bright” and “dark” stages. c. Mature pseudoaethalium. d–f. Individual sporothecae as observed from above. g. Individual sporothecae in lateral view. h. Iridescent peridium of individual sporothecae in cross section. i. Tips of individual sporothecae. j. Sclerified apex of a sporotheca. k. Outer surface of the peridium, covered with granules.l. Smooth inner surface of the peridium. m. Wavy folds on the inner surface of the peridium. n. Ring ornamentation on the inner surface of the peridium. o, p. Spores. Specimens: a. not collected; b. CWU 2183; c, d. sc22067 (holotype); e. sc22282; f, h, i. sc22099; g. sc22102; j, l, o. sc22230; k, m, p. CWU MR-0071; n. CWU 2925. Bars: a = 10 mm; b = 5 mm; c = 2 mm; d–h =

1 mm; i = 200 μm; j = 50 μm; k = 5 μm; l = 2 μm; m = 10 μm; n–p = 1 μm.

Leontyev et al. Tubifera ferruginosa

FIG. 3. Tubifera ferruginosa subsp. acutissima. a, b. Immature pseudoaethalia at the “bright” stages. c. Immature pseudoaethalium at the ‘dark’ stage. d. Tips of immature sporothecae at the “bright” stage. e. Almost mature pseudoaethalium in the field. f, g. A mature pseudoaethalium. h–j. Tips of individual sporothecae. k. Acute apex of sporotheca. l. Outer surface of peridium, covered with granules. m. Smooth inner surface of peridium. n, o. Wavy folds on the inner surface of peridium. p, q. Spores. Specimens: a–f. CWU MR-0006(2); g–q. UARK 50546 (holotype). Bars: a = 10 mm; b, c, e = 5 mm; d, h = 500 μm; f = 2 mm; g = 1 mm; i = 200 μm; j = 100 μm; k = 50 μm; l, p, q = 1

μm; m = 10 μm; n = 5 μm; o = 2 μm.

FIG. 4. Tubifera applanata. а. Immature pseudoaethalium (courtesy of Renato Cainelli). b, c.

Mature pseudoaethalium on the dead wood (Courtesy of Renée Lebeuf). с. Mature pseudoaethalium on the litter (Courtesy of Renato Cainelli). d–f. Individual sporothecae from above. g, h. Cross section of pseudoaethalia. i. Opened sporothecae with columellae visible. j, k. Tips of individual sporothecae. l. Outer surface of peridium, covered with granules. m, n. Ring ornamentation on inner surface of peridium. o. Spores. Specimens: a, с. RC 8061002; b. RL Myxo30; d. CWU MR-0038; e.

CWU MR-0126; f. CWU MR-0125; g. CWU MR-0136; h. CWU MR-0121; i, k, m, n, o. CWU

MR-0038; j, l. CWU MR-0039 (holotype). Bars: a = 20 mm; b, c = 10 mm; d–h = 1 mm; i, j = 500

μm; k = 100 μm; l–n = 2 μm; o = 1 μm.

FIG. 5. Tubifera dudkae. а–c. Immature pseudoaethalia at the “bright” stage. d, e. Mature pseudoaethalia. f. Cross section of a mature pseudoaethalium with spherical sporothecae visible. g– i. Individual sporothecae observed from above. j. Outer surface of peridium, covered with granules. k, l. Smooth inner surface of peridium, covered by wavy folds. m. Wavy folds and rings (arrows) on the inner surface of the peridium. n. Ring ornamentation on the inner surface of peridium. o, p.

Spores. Specimens: a, d, f, h, i, k, l, p. CWU MR-0040 (holotype); b, c. CWU 3074; e, g. CWU

MR-0120; j, m–o. CWU 2410. Bars: a = 20 mm; b, c = 10 mm; d, e = 2 mm; f = 2 mm; g, h = 1 mm; i = 500 μm; j = 2 μm; k, l = 5 μm; m, n = 2 μm; o, p = 1 μm.

Leontyev et al. Tubifera ferruginosa

FIG. 6. Tubifera montana. а. Immature pseudoaethalium at the “bright” stage. b. Immature pseudoaethalium at the “dark” stage. с–f. Mature pseudoaethalia. g–i. Tips of individual sporothecae as observed from above. j. Outer surface of a sporotheca, covered with granules. k.

Wavy folds on the outer surface of the peridium. l, m. Wavy folds on the inner surface of the peridium. n. Wavy folds and rings (arrows) on the inner surface of the peridium. o, p. Spores.

Specimens: a. sc 27541; b. sc 27530; c. UARK 6348; d, g. CWU 2912; e, f, i, j, n, p. UARK 3587

(holotype); h. UARK 9062; k, o. MM38970; l, m. CWU MR-0072. Bars: a = 5 mm; b, j = 2 mm; с– f = 2 mm; g–i = 1 mm; k = 2 μm; l, m = 5 μm; n–p = 1 μm.

FIG. 7. Tubifera magna. а. Immature pseudoaethalium at the “bright” stage. b–e. Mature pseudoaethalia. f–h, k. Tips of individual sporothecae observed from above. i. Opened sporothecae observed from above. j. Cross section through a pseudoaethalium with the iridescent peridium visible. l. Outer surface of peridium. m, n. Inner surface of peridium, covered by wavy folds. o.

Ring ornamentation on the inner surface of peridium. p, q. Spores. Specimens: a. Not collected; b.

UARK 50645; c. UARK 20393; d, l, m, p. UARK 34118; e–k, n, o, q. UARK 20405 (holotype).

Bars: a, b, d = 10 mm; c, e = 5 mm; f = 2 mm; g, i, j = 1 mm; h = 500 μm; k = 200 μm; l = 10 μm; m, n = 5 μm; o = 0.5 μm; p, q = 1 μm.

FIG. 8. Tubifera pseudomicrosperma. а. Immature pseudoaethalium at the “bright” stage (Courtesy of Mushroom Observer). b–e. Mature pseudoaethalia. f–h, k. Tips of individual sporothecae observed from above. i. Hypothallus and basal parts of sporothecae. j. Peridium observed under

DIC. l. Outer surface of peridium. m–o. Inner surface of peridium, covered by craters. p, q. Spores.

Specimens: a. Not collected; b, c, f, g, l, n–q. UARK 20730 (holotype); d, e, j. UARK 25096; h, i, k, m. CWU MR-0008(2). Bars: a = 5 mm; b, d, e = 2 mm; c, g = 1 mm; f = 2 mm, h = 200 μm; i = 500

μm; j = 20 μm; k = 100 μm; l = 5 μm; m = 10 μm; n, o, q = 1 μm; p = 2 μm.

FIG. 9. Tubifera corymbosa. a–g. Mature pseudoaethalia, spherical sporothecae marked with arrows. h. Tips of individual sporothecae observed from above. i. Hypothallus, impregnated with spherical sporothecae. j, k. Spherical sporothecae observed under LM, with spores visible inside. l. Outer

Leontyev et al. Tubifera ferruginosa surface of peridium in the lateral part of the sporotheca. m. Outer surface of peridium at the border of the side part of a sporotheca (left) and the tip of a sporotheca (right). n. Inner surface of peridium, covered by wavy folds. o. Inner surface of the peridium with ring ornamentation. p, q. Spores.

Specimens: a–f, h–q. UARK 47853 (holotype); g. AMFD 251. Bars: a, c = 2 mm; b, d–g = 1 mm; h, i = 200 μm; j, k = 50 μm; l, n = 5 μm; m, o–q = 2 μm.

FIG. 10. Size and shape of pseudoaethalia observed from above in species of the Tubifera ferruginosa complex. All figures are to the same scale. Contours are drawn from specimens used in this study. Dotted lines indicate adjacent fructifications that are likely to have been formed from the same plasmodium. Numbers in brackets indicate the relative proportion of pseudoaethalium width in relation to length.

FIG. 11. Typical structure of the sporothecal tips in the Tubifera ferruginosa complex. a. Tubifera ferruginosa subsp. ferruginosa. b. T. ferruginosa subsp. acutissima. с. T. montana. d. T. dudkae. e.

T. applanata. f. T. magna. g. T. pseudomicrosperma. h. T. corymbosa.

FIG. 12. Rimmed craters on the inner surface of the peridium in Tubifera pseudomicrosperma (a,

SEM; c, DIC) and T. microsperma (b, SEM; d, DIC). Note that both SEM and both DIC images are the same scale. Specimens: a, c. UARK 20730; b, d. UARK 32758. Bars: a–b = 5 μm; c–d = 10 μm.

FIG. 13. False capillitium, represented by fungal hyphae. a. Illustration from Nannenga-Bremekamp

(1991, p. 54), showing the “capillitium” (c) covered with spores (s) in Tubifera ferruginosa s.l. b.

False capillitium inside sporothecae of T. ferruginosa subsp. ferruginosa. c. False capillitium inside sporothecae of T. applanata. d–f. False capillitium of T. ferruginosa subsp. ferruginosa under a light microscope. g. False capillitium on the outer surface of the peridium of T. montana. h. False capillitium (white arrow) and true capillitium (black arrow) in T. dictyoderma. i. Details of the false capillitium in T. dictyoderma UARK 23966: septa (white arrows) and a portion with broken wall and a cavity visible (black arrow). Specimens: b, d–f. CWU 2183; c. CWU MR-0122; g. CWU MR-

0072; h, i. UARK 23966. Bars: b = 500 μm; c = 1 mm; d = 50 μm; e, f = 20 μm; g, h = 50 μm; i = 2

μm.

Leontyev et al. Tubifera ferruginosa

FIG. 14. Spore dimensions in the Tubifera ferruginosa complex and related species. Bubbles show the relative proportion of spores of a definite size in each species. Numbers indicate the numbers of measured spores/studied specimens.

TABLE I. Peridium ornamentation in the Tubifera ferruginosa complex.

Submitted 15 Oct 2014; accepted for publication 25 May 2015.

1Corresponding author. E-mail: [email protected]

TABLE I. Useful characters in identifying Tubefera complex Outer surface of the peridium Inner surface of the peridium Type Species Rings or craters Density of ring Density of of granular Granules (μm) (μm) ornamentation wavy folds ornamentation Tubifera applanata A (0.3–) 0.6–0.7 (–1.0) (0.4–) 1.5–2.0 (–2.9)++ –

T. dudkae A (0.3–) 0.4–0.5 (–0.7) (0.4–) 0.6–0.8 (–1.0)++ +++

T. ferruginosa A (0.5–) 0.6–0.8 (–1.0) (0.6–) 0.8–0.9 (–1.1)+ +

T. montana B – (0.4–) 0.6–0.8 (–1.0)+ +++

T. magna B – (0.2–) 0.3–0.6 (–0.8)++ ++

T. pseudomicrosperma B – (0.2–) 0.3–0.7 (–1.0)+++ –

T. corymbosa A (0.6–) 0.8–0.9 (–1.2) (0.3–) 0.4–0.8 (–0.9)+ +++ Notes: A, separate rounded granules; B, irregularly verrucose surface; +++, ornamentation dense and prevalent;

++, ornamentation not dense but widespread; +, ornamentation widely spaced and sparse; –, ornamentation absent.