Chapter 4.2 Chapter 4.2 Chapter 4.2 Chapter 4.2 Chapter 4.2 Chapter 4.2

University of Groningen

Identification of biomarkers for diabetic retinopathy Fickweiler, Ward

DOI: 10.33612/diss.95666609

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record

Publication date: 2019

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA): Fickweiler, W. (2019). Identification of biomarkers for diabetic retinopathy. University of Groningen. https://doi.org/10.33612/diss.95666609

Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license. More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne- amendment.

Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.

Download date: 10-10-2021 A. Keenan, Lloyd Paul Aiello, Jennifer K. Sun, George L. King L. George Sun, K. Jennifer PaulAiello, Lloyd Keenan, A. Avery, L. J. Tinsley,Pober, Robert Liane P. Edward Hillary Kern, Feener,S. Timothy M. David Wu, SayakaKatagiri, I-Hsien Sun, Bei Ishikado, Atsushi FabricioSimao, Paniagua, M. Wang, Samantha Chih-Hao Li, Ward Qian Fickweiler, Hernandez, L. Sonia Clermont, C. KyoungminAllen Yokomizo,Park, Yasutaka Maeda, Hisashi retinopathy to diabetic resistant diabetes with of patients retina the in increased R C Science Translational Medicine (2019) Medicine Translational Science etinol binding protein 3 is 3is protein binding etinol hapter 4.2

Chapter 4.2 Chapter 4.2 Chapter 4.2 Chapter 4.2 Chapter 4.2 Chapter 4.2

Abstract

The Joslin Medalist Study characterized people affected with type 1 diabetes for 50 years or longer. More than 35% of these individuals exhibit no to mild diabetic retinopathy (DR), independent of glycemic control, suggesting the presence of endogenous protective factors against DR in a subpopulation of patients. Proteomic analysis of retina and vitreous identified retinol binding protein 3 (RBP3), a retinol transport protein secreted mainly by the photoreceptors, as elevated in Medalist patients protected from advanced DR. Mass spectrometry and protein expression analysis identified an inverse association between vitreous RBP3 concentration and DR severity. Intravitreal injection and photoreceptor-specific overexpression of RBP3 in rodents inhibited the detrimental effects of vascular endothelial growth factor (VEGF). Mechanistically, our results showed that recombinant RBP3 exerted the therapeutic effects by binding and inhibiting VEGF receptor tyrosine phosphorylation. In addition, by binding to glucose transporter 1 (GLUT1) and decreasing glucose uptake, RBP3 blocked the detrimental effects of hyperglycemia in inducing inflammatory cytokines in retinal endothelial and Müller cells. Elevated expression of photoreceptor- secreted RBP3 may have a role in protection against the progression of DR due to hyperglycemia by inhibiting glucose uptake via GLUT1 and decreasing the expression of inflammatory cytokines and VEGF.

126 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy

INTRODUCTION

Diabetic retinopathy (DR) affects most of the people with diabetes lasting longer than 20 years and is a leading cause of vision loss in developed countries (1, 2). Multiple mechanisms related to the toxic effects of hyperglycemia on the retina have been proposed to underlie the initiation and progression of DR (3). For example, elevated vascular endothelial growth factor (VEGF) expression in the retina plays a causal role in development of proliferative DR (PDR), and anti-VEGF agents are effective therapies for PDR and diabetic macular edema (4, 5). However, clinical trials targeting the adverse effects of hyperglycemia have not proven to delay or prevent the progression of non-PDR (NPDR) (6). Recent epidemiological reports on factors that contribute to the development of diabetic (DM) complications have indicated that endogenous protective factors could be as important as risk factors (7). Studies of the Joslin 50-year Medalist cohort, composed of individuals who have had insulin-dependent diabetes for 50 years or longer, strongly suggest that endogenous protective factors exist that neutralize the toxic effects of hyperglycemia. More than 35% of the Medalist cohort does not exhibit advanced retinopathy, nephropathy, or neuropathy despite glycemic control similar to those that develop these complications (8). DR severity in the Medalist cohort exhibits a bimodal distribution with a substantial proportion of individuals with either no-mild NPDR (35%) or PDR (50%) but only a small group of Medalist patients with moderate-severe NPDR (5%) (9, 10). The bimodal distribution of DR severity, and the Chapter 4.2 lack of association with glycemic control, suggests that protective factors might exist in the retina that delay progression of DR. To identify potential retinal protective factors, we assessed protein profiles of the retina and vitreous in cadaveric eyes from patients in the Medalist cohort with no-mild NPDR by mass spectrometry and compared to those with documented PDR. Candidate secretory proteins that were found to be elevated in both the retina and the vitreous of the protected patients were selected for further cell and animal studies to test their capacity to prevent or ameliorate DR progression.

RESULTS

Characterization of proteins elevated in both the retina and vitreous To identify potential protective factors against the development of PDR, we compared the retina and vitreous from patients in the Medalist cohort with no-mild NPDR (n = 6 eyes and n = 4 individuals) to those with PDR (n = 11 eyes and n = 6 individuals) using mass spectrometry [liquid chromatography–tandem mass spectrometry (LC-MS/MS)]. Clinical characteristics of the Medalist patients did not differ between groups (table S1). Proteomic analysis by LC-MS/MS showed that retinol binding protein 3 (RBP3) and three other proteins were elevated (P < 0.05) in both retina and vitreous (tables S2 and S3). Peptide numbers of

127 Chapter 4.2

RBP3 were increased by 1.6-fold in the retina (P = 0.04) and by 1.9-fold in the vitreous (P = 0.005) of Medalist patients with no-mild NPDR compared to PDR (Fig. 1, A and B). RBP3 was selected for further analysis due to its unique presence in the neuroretina and to the fact that previous studies showed that its deficiency can cause neuroretinal degeneration 11( –13). In addition, RBP3 has been reported to be decreased in DR (14).

Validation of elevated concentrations of RBP3 in protected eyes Vitreous RBP3 concentrations were assessed further in a larger and more diverse cohort that included 33 Medalist patients (type 1 diabetes, n = 33) and 21 non-Medalist patients [type 1 diabetes, n = 2; type 2 diabetes, n = 6; nondiabetic (NDM) controls, n = 13] using a specific and highly sensitive enzyme-linked immunosorbent assay (ELISA) for RBP3 (table S4), which did not detect albumin, immunoglobulin G, or RBP4 (fig. S1A). Age at DM onset and DM duration was different between the DR groups, as expected, due to group differences in diabetes type. Other clinical characteristics including hemoglobin A1c (HbA1c) did not change substantially between DR groups (HbA1c, 7.0 to 7.4% from NPDR to PDR groups). Median vitreous RBP3 concentrations measured by ELISA in individuals with no-mild NPDR, moderate NPDR, and PDR were 2.20 μg/ml (16.3 nM, P < 0.05), 1.91 μg/ml (14.1 nM, P < 0.05), and 0.95 μg/ml (7.1 nM, P < 0.01), respectively, and were decreased compared to the NDM group, 5.42 μg/ml (40.1 nM; Fig. 1C). Vitreous RBP3 concentration was not correlated with HbA1c (P = 0.83; fig. S9) (9, 15). Vitreous VEGF concentration in the same cohort demonstrated gradual elevation with increasing severity of DR (P < 0.05; Fig. 1D). The ratio of RBP3 to VEGF concentrations, a possible index of protective capacity, steadily declined from NDM to no-mild NPDR, moderate NPDR, and PDR (P < 0.01 to P < 0.0001; Fig. 1E). Vitreous interleukin-6 (IL-6) concentrations were elevated in people with PDR compared to no- mild NPDR (fig. S1B).

Effects of diabetes and retinopathy on molecular sizes of vitreous RBP3 Immunoblot analysis with a polyclonal antibody made against human RBP3 (hRBP3) showed multiple bands in addition to 135-kDa expected band in the vitreous of people without diabetes and those with diabetes with various grades of DR (n = 74 individuals, n = 105 eyes; NDM controls, n = 12; no-mild NPDR, n = 25; moderate NPDR, n = 11; PDR, n = 26). The ratio of non–135-kDa/total bands increased from NDM to PDR (Fig. 1, F and G).

Fig. 1. Measurement of RBP3 peptide and protein expression and its correlation of VEGF in human vitreous of different grades of DR. (A and B) Proteomic analysis of RBP3 in Medalist patients with no-mild NPDR (protected eyes) and those with PDR (nonprotected eyes) in the retina and vitreous. (C and D) Vitreous RBP3 and VEGF concentration in the mixed population of individuals with type 1 and type 2 diabetes and without diabetes (NDM). (E) The ratio of RBP3 to VEGF concentration in vitreous. (F) Representative immunoblot (IB) for RBP3 expression (#, ungradable) in human vitreous and (G) quantification of degraded RBP3 by ratio of RBP3 bands (<135 kDa) to all RBP3 bands. n = numbers of eyes (individuals). Bars indicate median and quartiles (top and bottom, respectively). P values were calculated using Wilcoxon’s test. Analysis for RBP3 concentration and ratio of RBP3 to VEGF were performed with Kruskal-Wallis test. When overall omnibus tests were significant P( < 0.05), Mann-Whitney U tests were used to determine the location of any significant pairwise differences. 

128 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy SCIENCE TRANSLATIONAL MEDICINE | RESEARCH ARTICLE

A Retina B Vitreous 800 800 * **

600 600

400 400

200 200 RBP3 (peptide hit numbers) RBP3 (peptide hit numbers)

0 0 No-mild NPDR PDR No-mild NPDR PDR n = 6 (4) n = 11 (6) n = 6 (4) n = 11 (6)

P = 0.07 C * D * * ** ** ** ** ** 12 9000 Downloaded from 6000 10 3000 3000 8 2500 6 2000 1500 4

1000 http://stm.sciencemag.org/ Vitreous RBP3 (µg/ml) 2 Vitreous VEGF (pg/ml) 500 0 0 No-mild Moderate No-mild Moderate NDM PDR NDM PDR NPDR NPDR NPDR NPDR n = 79 (54) n = 17 (13) n = 30 (19) n = 9 (8) n = 23 (14) n = 65 (43) n = 12 (9) n = 24 (15) n = 8 (7) n = 21 (12)

E * F ** *** No-mild Chapter 4.2 NPDR NPDR No-mild NDM Moderate PDR NDM *** kDa # NPDR PDR kDa by guest on August 7, 2019 **** 60,000 250 250 150 150 100 100 75 75 40,000

50 50

20,000 37 37

25 25

Ratio of RBP3 to VEGF concentration in human vitreous 0 No-mild Moderate NDM PDR NPDR NPDR n = 65 (43) n = 12 (9) n = 24 (15) n = 8 (7) n = 21 (12) Fig. 1. Measurement of RBP3 peptide and protein expression and its correlation of VEGF in human vitreous of different grades of DR. (A and B) Proteomic analysis of RBP3 G (%) Human vitreous 100 in Medalist patients with no-mild NPDR (protected eyes) and those with PDR (nonpro- 80 tected eyes) in the retina and vitreous. (C and D) Vitreous RBP3 and VEGF concentration 60 40 in the mixed population of individuals with type 1 and type 2 diabetes and without dia- 40 betes (NDM). (E) The ratio of RBP3 to VEGF concentration in vitreous. (F) Representative immunoblot (IB) for RBP3 expression (#, ungradable) in human vitreous and (G) quantifi- 30 cation of degraded RBP3 by ratio of RBP3 bands (<135 kDa) to all RBP3 bands. n = numbers 20 of eyes (individuals). Bars indicate median and quartiles (top and bottom, respectively). P values were calculated using Wilcoxon’s test. Analysis for RBP3 concentration and ratio 10 of RBP3 to VEGF were performed with Kruskal-Wallis test. When overall omnibus tests

Bands (<135 kDa)/all RBP3 bands were significant (P < 0.05), Mann-Whitney U tests were used to determine the location of 0 any significant pairwise differences. Biopsy Biopsy Biopsy Biopsy Autopsy Autopsy Autopsy Autopsy

No-mild Moderate NDM PDR NPDR NPDR

Yokomizo et al., Sci. Transl. Med. 11, eaau6627 (2019) 3 July 2019 2 of 14

129 Chapter 4.2 hRBP3 concentrations in the serum RBP3 is highly expressed in the retina and, to a much lesser extent, in the pineal region of the brain (16, 17). Using a highly specific and sensitive ELISA (0.1 to 2 ng/ml, 1 to 15 pM), mean serum RBP3 concentration was observed at 1000- to 5000-fold lower than vitreous RBP3 concentration in NDM individuals (Fig. 2A, inset).

Intravitreous application of RBP3 in Lewis rats: Intervention study The effect of rhRBP3 on retinal vascular function in Lewis rats was evaluated by measuring VEGF- and diabetes-induced RVP using Evan’s blue dye. Doses were determined from the concentrations measured in human vitreous. Because vitreous RBP3 concentrations measured by ELISA were 1 to 2 μg/ml (8 to 16 nM) in NDM rats, 2.5 μg/ml (20 nM) of RBP3 concentration was used for intravitreal (IVT) injection. IVT injection of rhRBP3 inhibited 200 ng/ml (7.4 nM) VEGF-induced RVP when IVT injections were given together (P < 0.01, premix; fig. S1C) or 1 day after VEGF injection (P < 0.001, intervention; fig. S1D). IVT injection of rhRBP3 in various doses (0.1 to 2.5 μg/ml, 1 to 20 nM) 1 day after VEGF (200 ng/ml) reduced VEGF-induced RVP in a dose-dependent manner with significant reduction observed at 10 and 20 nM of RBP3 P( < 0.01; Fig. 2B). After 2 months of diabetes, IVT injection of rhRBP3 (2.5 μg/ml, 20 nM) for 3 days reduced RVP in DM rats to those in NDM (P < 0.01; Fig. 2C), but boiled rhRBP3 (2.5 μg/ml, 20 nM) was not effective. Three days after IVT injection of rhRBP3, retinal mRNA expression of Vegfa and Il-6 and retinal VEGFA protein expression in DM rats were significantly reduced P( < 0.05; Fig. 2, D and E, and fig. S1E). After 2 months of diabetes, ERG amplitudes of oscillatory potential (OP) 2, OP3, and B waves were significantly decreased compared to NDM rats P( < 0.01; Fig. 2F and fig. S1F). IVT injection of rhRBP3 increased amplitudes of each of these waveforms in both NDM and DM rats (Fig. 2, G to J, and fig. S1G). The presence of vitreous RBP3 at various molecular weights after IVT injection was evaluated using polyclonal antibody that recognizes both human and rodent RBP3. Immunoblot analysis of rat vitreous showed major protein bands at 25, 40, 60, 80, and 135 kDa at 10 min with and without rhRBP3 injection. After 1 day, a major band was present at 40 kDa (fig. S1, H and I). However, IVT injection of rhRBP3 for 3 days did not reverse the thinning of retinal photoreceptor layers [inner segment ellipsoid (ISE) + end tip (ET)] induced by diabetes as measured by optical coherence tomography (OCT; fig. S2, A to D).

Fig. 2. Assessment of RBP3 concentrations in human biofluid and effects of intravitreal injection with hRBP3 peptide on DR in rats. (A) RBP3 ELISA for vitreous and serum concentrations of RBP3 in individuals. Colorimetric ELISA for vitreous RBP3 concentration and luminescent ELISA (high sensitivity) for serum RBP3 concentration. Black circles are serum RBP3 concentration from individuals with NDM. A.U., arbitrary units. (B) Effects of recombinant hRBP3 (rhRBP3) on VEGF-mediated retinal vascular permeability (RVP) in rat (n = 4 to 5). (C to E) Ef- fects of IVT injected rhRBP3 (20 nM) on (C) RVP, (D) VEGF protein expression, and (E) Il-6 mRNA expression in DM retina (n = 4 to 8). rRNA, ribosomal RNA. (F to J) Electroretinogram (ERG) at (F) baseline; NDM (n = 21), DM (n = 35), and (G to J) 3 days after IVT injection (n = 9 to 14). n = numbers of eyes. b-RBP3, boiled RBP3. All data are represented as means ± SEM. Group comparison was performed by analysis of variance (ANOVA). When overall F tests were significant P( < 0.05), Fisher’s least significant difference test was used to determine the location 

130 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy SCIENCE TRANSLATIONAL MEDICINE | RESEARCH ARTICLE

Fig. 2. Assessment of RBP3 concentrations A Human bioﬂuid B ** ** in human biofluid and effects of intravitreal High sensitivity 200 A.U.)

4 35 injection with hRBP3 peptide on DR in rats. (1 to 15 pM) 30 (A) RBP3 ELISA for vitreous and serum concen- 150 2 2 trations of RBP3 in individuals. Colorimetric ELISA 0.7 25 R = 0.9534 R = 0.9981 0.6 20 for vitreous RBP3 concentration and luminescent 0 5 10 15 100

Luminescence ( × 10 RBP3 (pM) 100 0.5 No-mild ELISA (high sensitivity) for serum RBP3 concen- NPDR NDM 0.4 80 tration. Black circles are serum RBP3 concentra- 50 0.3 PDR Moderate 60 NPDR permeability (µl/g/hour)

tion from individuals with NDM. A.U., arbitrary Retinal Evans blue albumin 40 B 0.2 units. ( ) Effects of recombinant hRBP3 (rhRBP3) 20 Absorbance (450 nm) 0.1 0 on VEGF-mediated retinal vascular permeability 0.0 0

n C E 0 2 4 6 8 Human vitreous RBP3 (nM) VEGF (RVP) in rat ( = 4 to 5). ( to ) Effects of IVT in- Vehicle VEGF + VEGF + VEGF + RBP3 (nM) 1 nM RBP3 jected rhRBP3 (20 nM) on (C) RVP, (D) VEGF pro- 10 nM RBP3 20 nM RBP3 tein expression, and (E) Il-6 mRNA expression C D *** ** ** **** in DM retina (n = 4 to 8). rRNA, ribosomal RNA. **** *** ** ** (F to J) Electroretinogram (ERG) at (F) baseline; 80 100 NDM (n = 21), DM (n = 35), and (G to J) 3 days 80 after IVT injection (n = 9 to 14). n = numbers of 60 eyes. b-RBP3, boiled RBP3. All data are repre- 60 Downloaded from sented as means ± SEM. Group comparison was 40 performed by analysis of variance (ANOVA). When 40 Retinal VEGF overall F tests were significant (P < 0.05), Fisher’s (pg/mg protein) 20 20 least significant difference test was used to de- permeability (µl/g/hour) Retinal Evans blue albumin termine the location of any significant pairwise 0 0 differences. Vehicle b-RBP3 RBP3 Vehicle b-RBP3 RBP3 Vehicle b-RBP3 RBP3 Vehicle b-RBP3 RBP3 http://stm.sciencemag.org/ NDM DM NDM DM E F 500 ** 2.5 *** * 450 Nondiabetes Diabetes 400 2.0 (fig. S4, A and B). Retinal mRNA and 350 300 protein expressions of RBP3 were in- 1.5 Chapter 4.2 creased by 1.7-fold in RBP3 Tg mice 250 *** 200 1.0 compared to wild-type (WT) mice (Fig. 4, Amplitude (µV) 150 *** by guest on August 7, 2019 A and B, and fig. S4, C and D). After 0.5 100 / 18 S rRNA (fold change) 50 2 months of streptozotocin-induced di- Retinal Il-6 mRNA expression abetes (fig. S4E), protein expressions of 0 0 Vehicle b-RBP3 RBP3 Vehicle b-RBP3 RBP3 OP1 OP2 OP3 OP4 RBP3 in the retina were decreased by A wave B wave NDM DM Signal 49% (P = 0.03), as compared to NDM + G H WT mice. RBP3 mRNA and protein Nondiabetes Diabetes 400 400 expressions were elevated by 1.8- and Vehicle RBP3 Vehicle Boiled RBP3 Boiled RBP3 2.1-fold (P = 0.026 and P = 0.032), 300 RBP3 300 RBP3 RBP3 Boiled RBP3 respectively, in DM + RBP3Tg mice 200 Boiled RBP3 200 (Fig. 4, A and B), compared to DM + WT Vehicle 100 mice. Body weight and blood glucose Vehicle 100

concentrations did not differ between Amplitude (µV) 0 Amplitude (µV) 0

NDM + WT and NDM + RBP3Tg –100 –100 mice or between DM + WT and DM + –200 –200 RBP3Tg mice, although blood glucose 0 20 40 60 80100 120 140 0 20 40 60 80100 120 140 concentrations were elevated in both Time (ms) Time (ms) DM models (fig. S4, F and G). ERG I Nondiabetes J Diabetes analysis of retinal function and struc- 600 600 Vehicle ** Vehicle Boiled RBP3 * ture using OCT demonstrated that 500 Boiled RBP3 ** 500 RBP3 RBP3 ** diabetes-induced decreases in ERG 400 400 amplitudes of A, B, and OP3 waves * 300 300 ** and thinning of the photoreceptor * ** * * 200 * * layers (ISE + ET) were not observed in 200 Amplitude (µV) Amplitude (µV) ** * ** DM + RBP3Tg mice (Fig. 4, C and D). 100 100 The elevation in DM + WT mice of retinal Vegf mRNA and VEGF pro- 0 0 OP1 OP2 OP3 OP4 OP1 OP2 OP3 OP4 tein expression (Fig. 4E and fig. S4H), A wave B wave A wave B wave Il-6 mRNA expressions (Fig. 4F), and Signal Signal

Yokomizo et al., Sci. Transl. Med. 11, eaau6627 (2019) 3 July 2019 4 of 14 131 Chapter 4.2

Effects of overexpressing RBP3 on neuroretinal dysfunction induced by diabetes The therapeutic potential for RBP3 to prevent diabetes-induced retinal dysfunction was studied by overexpressing RBP3 through subretinal injection of lentiviral vector containing either full-length hRBP3 or luciferase plasmid in Lewis rats (fig. S3, A and B). The expression of hRBP3 was increased by 85% (P = 0.02; Fig. 3A) and maintained for 6 months compared to control eyes (fig. S3, C to E). Diabetes decreased the endogenous expression of RBP3 protein by 53% (P = 0.04); however, lentiviral hRBP3 infection elevated RBP3 in the retina by 2.8-fold (P = 0.03) and comparable to NDM rats (Fig. 3A). Functional changes, assessed by ERG 2 months after the induction of diabetes, showed decreased amplitudes of B wave in response to light stimuli (36%; P < 0.05), which were prevented by overexpression of hRBP3 (P < 0.05; Fig. 3B). OCT assessment demonstrated that total and individual retinal layer [outer nuclear layer (ONL) and ISE + ET] thickness was decreased in DM rats compared to controls (P < 0.05), which were prevented especially in the photoreceptor layers by hRBP3 overexpres- sion (ONL and ISE + ET, P < 0.05; Fig. 3C). VEGF protein expression in the retina and vitreous was increased by 1.9- and 2.9-fold, respectively, in DM versus NDM rats (Fig. 3, D and E), which were completely prevented by hRBP3 overexpression (Fig. 3, D and E). Vascular permeability was increased by 2.9-fold (P < 0.0001) in DM rats compared to NDM controls (Fig. 3F), which was also prevented by the overexpression of hRBP3. Acellular capillary number, a classic diabetes-associated retinal pathology, was increased by 1.4-fold (P < 0.05) after 6 months of diabetes compared to age-matched NDM controls. Again, the overexpression of hRBP3 reduced diabetes-induced acellular capillaries by 91% (P = 0.03; Fig. 3G). Immunoblot analysis of retinal RBP3 protein bands exhibited at least two major bands at 80 and 135 kDa, with the fraction at 80 kDa, normalized by the total detected RBP3, increased from 26 to 52% in DM compared to NDM rats (P < 0.001; fig. S3, F and G).

Effects of photoreceptor-specifc overexpression of RBP3 To test the therapeutic effects of RBP3 on diabetes-induced retinal dysfunction without IVT injections, we generated RBP3 transgenic (Tg) mice on a C57BL6 background that specifically overexpressed hRBP3 in photoreceptors using a rhodopsin promoter (fig. S4, A and B). Retinal mRNA and protein expressions of RBP3 were increased by 1.7-fold in RBP3 Tg mice compared to wild-type (WT) mice (Fig. 4, A and B, and fig. S4, C and D). After 2 months of streptozotocin-induced diabetes (fig. S4E), protein expressions of RBP3 in the retina were

Fig. 3. Protective effects of lentiviral-mediated subretinal overexpression of hRBP3 on DR in rats. (A) The expressions of endogenous RBP3 and exogenous RBP3 tagged with Myc in retina by immunoblot (n = 6), (B) ERG (n = 10 to 11), (C) OCT (n = 6 to 7), (D and E) VEGF expression in retina and vitreous (n = 6), and (F) RVP (n = 7 to 8) of DM rats for 2 months. (G) Quantification of acellular capillaries in retinal vascular pathology of DM rats for 6 months (n = 6 to 8). hRBP3−, eye injected with luciferase gene only; hRBP3+, eye injected with hRBP3 and luciferase genes. n = numbers of eyes. All data are represented as means ± SEM. Group comparison was performed by ANOVA (same as Fig. 2). 

132 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy SCIENCE TRANSLATIONAL MEDICINE | RESEARCH ARTICLE

A NDM DM B Lenti – + – + -RBP3

RBP3 ERG

500 NDM Myc-tag ** NDM + RBP3 400 DM β-Actin DM + RBP3 300 * 4 ** * * * P = 0.05 200 Amplitude (µV) **** 3 P = 0.08 *

in retina 100 2

0 1 /β-actin (fold change) A wave OP1 OP2 OP3 OP4 B wave RBP3 expression Signal Downloaded from 0 – + – + hRBP3 NDM DM

C OCT D P = 0.05

* http://stm.sciencemag.org/ 225 NDM ** ** 200 400 NDM + RBP3 175 300 75 DM ** * DM + RBP3 200 * **

50 Chapter 4.2

TOT: total retina Retinal VEGF Thickness (μm) (pg/mg protein) * IPL: inner plexiform layer 100 25 INL: inner nuclear layer by guest on August 7, 2019 ONL: outer nuclear layer 0 ISE: inner segment ellipsoid hRBP3 – + – + 0 ET: end tip NDM DM TOTIPL INLONL ISE + ET Layer E F *** *** 1500 60 **** **

1000 40

500 20 Vitreous VEGF (pg/ml) permeability (µl/g/hour) Retinal Evans Blue Albumin 0 0 + + hRBP3 – + – + hRBP3 – –

NDM DM NDM DM G * * 35 30 Fig. 3. Protective effects of lentiviral-mediated subretinal overexpression of hRBP3 25 ) 2 on DR in rats. (A) The expressions of endogenous RBP3 and exogenous RBP3 tagged 20 with Myc in retina by immunoblot (n = 6), (B) ERG (n = 10 to 11), (C) OCT (n = 6 to 7), (D and 15 E) VEGF expression in retina and vitreous (n = 6), and (F) RVP (n = 7 to 8) of DM rats for (acell/mm 10 G Acellular capillary 2 months. ( ) Quantification of acellular capillaries in retinal vascular pathology of DM − + 5 rats for 6 months (n = 6 to 8). hRBP3 , eye injected with luciferase gene only; hRBP3 , n 0 eye injected with hRBP3 and luciferase genes. = numbers of eyes. All data are repre- hRBP3 – + – + Control NDM sented as means ± SEM. Group comparison was performed by ANOVA (same as Fig. 2). w/o injection NDM DM

Yokomizo et al., Sci. Transl. Med. 11, eaau6627 (2019) 3 July 2019 5 of 14 133 Chapter 4.2 decreased by 49% (P = 0.03), as compared to NDM + WT mice. RBP3 mRNA and protein expressions were elevated by 1.8- and 2.1-fold (P = 0.026 and P = 0.032), respectively, in DM + RBP3Tg mice (Fig. 4, A and B), compared to DM + WT mice. Body weight and blood glucose concentrations did not differ between NDM + WT and NDM + RBP3Tg mice or between DM + WT and DM + RBP3Tg mice, although blood glucose concentrations were elevated in both DM models (fig. S4, F and G). ERG analysis of retinal function and structure using OCT demonstrated that diabetes-induced decreases in ERG amplitudes of A, B, and OP3 waves and thinning of the photoreceptor layers (ISE + ET) were not observed in DM + RBP3Tg mice (Fig. 4, C and D). The elevation in DM + WT mice of retinal Vegf mRNA and VEGF protein expression (Fig. 4E and fig. S4H), Il-6 mRNA expressions Fig.( 4F), and RVP (Fig. 4G) was prevented in DM + RBP3Tg mice. Similarly, diabetes-induced formation of acellular capillaries in the retina in DM + WT mice were decreased in DM + RBP3Tg mice by 58% (P = 0.0002; Fig. 4H).

Effects of hRBP3 on endothelial cell migration In bovine retinal endothelial cells (BRECs), elevating glucose concentrations from 5.6 mM [low glucose (LG)] to 25 mM [high glucose (HG)] or the addition of VEGF (2.5 ng/ml) increased cellular migration by 59% (P < 0.05) and 49% (P < 0.05), compared to LG or vehicle, respectively. The addition of rhRBP3 (0.25 μg/ml, 2 nM) inhibited HG- and VEGF-induced migration of BRECs by 50% (P < 0.05) and 32% (P < 0.05), compared to HG and VEGF, respectively (Fig. 5, A and B, and fig. S10, A and B), which were reversed by neutralizing antibodies against rhRBP3 (P < 0.01 and P < 0.05), respectively. Vitreous from a Medalist patient with NPDR, incubated with 3.1 μg/ml (23 nM) and 101.1 pg/ml of RBP3 and VEGF, respectively, completely inhibited BREC migration induced by VEGF (P < 0.001), and the inhibition was abolished by anti-RBP3 antibodies (P < 0.01; Fig. 5C and fig. S10C). Vitreous IL-6 concentration was elevated in patients with PDR (96.1 pg/ml) compared to those with NPDR (41.4 pg/ml), and its concentration in the Medalist vitreous used in the migration assay was 25.8 pg/ml. In BRECs, RBP3 (20 nM) decreased cellular migration by 29% (P = 0.07), which was not significant. The addition of VEGF (2.5 ng/ml) increased cellular migration by 57% (P = 0.01), which was inhibited by rhRBP3 (20 nM; 48%; P < 0.001), whereas the addition of rhRBP3 (5 nM) did not have any effect (Fig. 5D and fig. S5A). RBP3 did not inhibit the actions of fibroblast growth factor (FGF) to induce EC migrations (fig. S5B). Structurally, RBP3 has four distinct domains: The first domain (D1; amino acids 19 to 320, 34 kDa) has some similarities to other retinol binding proteins (RBP1, RBP2, RBP4, and RBP5), and the second domain (D2; amino acids 321 to 630, 35 kDa) is known to have lipid binding sites. The effects of D1 and D2 (20 nM) on VEGF- induced migration were studied (13, 18, 19).

Fig. 4. Protective effects of hRBP3 on DR in RBP3 Tg mice with specific overexpression in the retina. (A) Rbp3 mRNA expressions (n = 3 to 5), (B) RBP3 protein expressions by immunoblot (n = 4 to 7), (C) ERG (n = 7 to 8), (D) OCT (n = 6 to 8), (E) VEGF protein expression (n = 4 to 7), (F) Il-6 mRNA expression (n = 5), and (G) RVP (n = 4) inthe retina of DM mice for 2 months. (H) Quantification of acellular capillaries in retina of DM mice for 6 months (n = 5 to 7). n = numbers of eyes. All data are represented as means ± SEM. Group comparison was performed by ANOVA (same as Figs. 2 and 3). 

134 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy SCIENCE TRANSLATIONAL MEDICINE | RESEARCH ARTICLE

Fig. 4. Protective effects A B *** * NDM DM of hRBP3 on DR in RBP3 P = 0.066 *** WT RBP3Tg WT T3PBR g Tg mice with specific over- 2.5 expression in the retina. RBP3 2.0 (A) Rbp3 mRNA expressions (n = 3 to 5), (B) RBP3 protein 1.5 β-Actin expressions by immunoblot 1.0 (n = 4 to 7), (C) ERG (n = 7 to 8), * * 2.0 D n E * ** ( ) OCT ( = 6 to 8), ( ) VEGF 0.5 protein expression (n = 4 / 18 S rRNA (fold change) Retina l Rbp3 mRNA expression 1.5 to 7), (F) Il-6 mRNA expression 0 (n = 5), and (G) RVP (n = 4) in WT RBP3Tg WT gT3PBR 1.0 the retina of DM mice for NDM DM 2 months. (H) Quantification C 0.5 of acellular capillaries in retina ERG /β-actin (fold change) of DM mice for 6 months NDM + WT RBP3 expression in retina (n = 5 to 7). n = numbers of NDM + RBP3Tg 0 WT RBP3Tg WT T3PBR g eyes. All data are represented 500 DM + WT NDM DM as means ± SEM. Group com- 400 DM + RBP3Tg Downloaded from ** *** D parison was performed by OCT 300 ** *** * * ** * **** ** ANOVA (same as Figs. 2 and 3). 225 NDM + WT 200 NDM + RBP3Tg 175 100 DM + WT 125 100 * DM + RBP3Tg 75 (μm) Amplitude (μV) 75 *** *** http://stm.sciencemag.org/ TOT: total retina 50 50 IPL: inner plexiform layer Thickness INL: inner nuclear layer

0 25 ONL: outer nuclear layer A wave OP1 OP2 OP3 OP4 B wave ISE: inner segment ellipsoid 0 ET: end tip Signal TOTIPL INLONL ISE+ET Layer

E F Chapter 4.2 * * * ** 45 4 by guest on August 7, 2019

3 30

Retinal VEGF 15

(pg/mg protein) 1 / 18 S rRNA (fold change) Retinal Il-6 mRNA expression 0 0 WT RBP3Tg WT gT3PBR WT RBP3Tg WT T3PBR g NDM DM NDM DM

G H **** *** ** ** ** 60 25

20 40 15

10 20 (acell/mm²) Acellular capillary 5 permeability (μl/g/hour) Retinal Evans blue albumin

0 0 WT RBP3Tg WT gT3PBR WT RBP3Tg WT T3PBR g NDM DM NDM DM

RVP (Fig. 4G) was prevented in DM + RBP3Tg mice. Similarly, Effects of hRBP3 on endothelial cell migration diabetes-induced formation of acellular capillaries in the retina in In bovine retinal endothelial cells (BRECs), elevating glucose con- DM + WT mice were decreased in DM + RBP3Tg mice by 58% centrations from 5.6 mM [low glucose (LG)] to 25 mM [high glucose (P = 0.0002; Fig. 4H). (HG)] or the addition of VEGF (2.5 ng/ml) increased cellular migration

Yokomizo et al., Sci. Transl. Med. 11, eaau6627 (2019) 3 July 2019 6 of 14

135 Chapter 4.2

ECs were incubated with vehicle, rhRBP4, rhRBP3 (full; amino acids 1 to 1247, 135 kDa), rhRBP3 (D1), rhRBP3 (D2), or rhRBP3 (D1 + D2). VEGF increased EC migration (P < 0.05). However, RBP3 (20 nM) inhibited VEGF-induced migration by 47% (P < 0.0001). D1, D2, and combination of D1 and D2 inhibited VEGF-induced EC migration by 51, 37, and 45%, (P < 0.0001, P < 0.0001, and P < 0.0001), respectively (all 20 nM; Fig. 5E and fig. S5C). D1 consistently inhibited VEGF-induced migration more than D2 (P < 0.05), and the inhibitory effect of D1 was similar to the full length of hRBP3 and D1 + D2 (Fig. 5E and fig. S5C). RBP4 (20 nM) did not inhibit VEGF-induced migration.

Effects of rhRBP3 on VEGFR2 signaling Preincubation of rhRBP3 (0.25 μg/ml, 2 nM) with VEGF (2.5 ng/ml) inhibited VEGF-induced pTyr-VEGFR2 in BRECs (P < 0.01), whereas co-addition of rhRBP3 did not (Fig. 5F). To test the hypothesis that RBP3 inhibited VEGF-induced pTyr-VEGFR2, by binding to VEGFR2, we coincubated cells with rhRBP4, rhRBP3, or phosphate-buffered saline (PBS) with reversible cross-linkers (DTSSP), and cell lysate was immunoprecipitated (IP) with anti-VEGFR2 antibody and then blotted with anti–tyrosine phosphorylation antibody. Immunoblot analysis showed that rhRBP3 (20 nM) inhibited VEGF (2.5 ng/ml)–induced pTyr- VEGFR2 by 25% (P < 0.01) but had no effect when cells were treated with VEGF (25 ng/ml). rhRBP4 (20 nM) was ineffective (Fig. 5G).

Effects of rhRBP3 on HG-induced VEGF expression rhRBP3 (20 nM) reduced mRNA expression of Vegf and Il-6, as well as HG-induced protein expression of VEGF in Müller cells, the primary retinal cell type responsible for their production in diabetes (20). Although rhRBP3 at 0.5 μg/ml reduced Vegf mRNA expression induced by HG, it did not alter VEGFA protein expression (Fig. 6, A and B, and fig. S6, A to C). RhRBP3 also reduced HG-induced mRNA expression of Vegfa and Il-6 in BRECs (fig. S6, D and E). To

Fig. 5. Characterization of rhRBP3 on retinal vascular cells and Müller cells. (A to C) Effects of rhRBP3 (0.25 µg/ml, 2 nM) or Medalist patient vitreous from protected eyes on 25 mM HG or rhVEGF (2.5 ng/ml)– induced endothelial migration in BRECs. (A) *P < 0.05, LG versus HG; #P < 0.05, HG versus HG + rhRBP3; †P < 0.05, ††P < 0.01 HG + rhRBP3 versus HG + rhRBP3 + anti- RBP3. n = 4. (B) *P < 0.05, vehicle versus rhVEGF; #P < 0.05, ##P < 0.01 VEGF versus VEGF + rhRBP3; †P < 0.05, ††P < 0.01 VEGF + rhRBP3 versus VEGF + rhRBP3 + anti-RBP3. n = 4 to 5. (C) **P < 0.01, bovine serum albumin (BSA) versus rhVEGF + BSA; ##P < 0.01, ###P < 0.001 rhVEGF + BSA versus rhVEGF + vitreous + BSA; †P < 0.05, ††P < 0.01 VEGF + vitreous + BSA versus VEGF + vitreous + anti- RBP3 + BSA. n = 3. (D) Effects of rhRBP3 (5 or 20 nM) on rh- VEGF (2.5 ng/ml)–induced endothelial migration in BRECs (n = 4). (E) Effects of different peptide of rhRBP3 (20 nM) on rhVEGF (2.5 ng/ml)– induced endothelial migration in bovine aortic endothelial cell (n = 4). (F) Tyrosine phosphorylation of VEGFR2 (pTyr-VEGFR2) under rhRBP3 (0.25 µg/ml) and rhVEGF (2.5 ng/ml) stimulation in BRECs (n = 3). (G) pTyr-VEGFR2 under rhRBP4 (20 nM) or rhRBP3 (2.5 µg/ml, 20 nM) and rhVEGF stimulation with cross-linking assay by 3,3’-dithiobis( sulfosuccinimidyl propionate) (DTSSP) in BRECs (n = 3). P-tyrosine, tyrosine phosphorylation. All data are represented as means ± SEM. Group comparison was performed by ANOVA (same as Figs. 2 to 4). 

136 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy SCIENCE TRANSLATIONAL MEDICINE | RESEARCH ARTICLE

Fig. 5. Characterization of A B C rhRBP3 on retinal vascular EC EC EC Vehicle VEGF + RBP3 VEGF + vitreous cells and Müller cells. (A to LG BSA VEGF + RBP3 + BSA C  VEGF ) Effects of rhRBP3 (0.25 g/ml, HG †† + anti-RBP3 VEGF + BSA 100 100 100 VEGF + vitreous 2 nM) or Medalist patient vit- HG + RBP3 RBP3 † †† + anti-RBP3 + BSA †† Vitreous + BSA reous from protected eyes on ## HG + RBP3 Anti-RBP3 + BSA 25 mM HG or rhVEGF (2.5 ng/ml)– 80 + anti-RBP3 80 80 * *# # ** induced endothelial migra- ## tion in BRECs. (A) *P < 0.05, † ** 60 60 60 ## LG versus HG; #P < 0.05, HG * ** ### versus HG + rhRBP3; †P < 0.05, ** † ### † 40 40 40 Migration (%) Migration (%)

P Migration (%) †† < 0.01 HG + rhRBP3 versus †† n * HG + rhRBP3 + anti-RBP3. = †† P 4. (B) * < 0.05, vehicle versus 20 20 20 rhVEGF; #P < 0.05, ##P < 0.01 VEGF versus VEGF + rhRBP3; 0 0 †P < 0.05, ††P < 0.01 VEGF + 0 0 6 12 18 24 0 6 12 18 24 0 6 12 18 24 rhRBP3 versus VEGF + rhRBP3 + Time (hours) Time (hours) Time (hours) n P anti-RBP3. = 4 to 5. (C) ** < Downloaded from D 0.01, bovine serum albumin EC E EC (BSA) versus rhVEGF + BSA; Low RBP3 High RBP3 VEGF (–) VEGF (+) ##P < 0.01, ###P < 0.001 rhVEGF + (5 nM) (20 nM) 100 100 100 100 BSA versus rhVEGF + vitreous + BSA; †P < 0.05, ††P < 0.01 80 VEGF + vitreous + BSA versus 80 80 80 VEGF + vitreous + anti-RBP3 + http://stm.sciencemag.org/ BSA. n = 3. (D) Effects of 60 60 60 60 rhRBP3 (5 or 20 nM) on rh- VEGF (2.5 ng/ml)–induced 40 40 Migration (%) Migration (%) 40

Migration (%) 40 endothelial migration in BRECs Migration (%) n E ( = 4). ( ) Effects of different 20 20 20 20 peptide of rhRBP3 (20 nM) on rhVEGF (2.5 ng/ml)–induced Chapter 4.2 0 0 0 0 endothelial migration in bo- 0 6 12 18 24 0 6 12 18 24 0 6 12 18 0 6 12 18 Time (hours) Time (hours) Time (hours) vine aortic endothelial cell Time (hours) by guest on August 7, 2019 (n = 4). (F) Tyrosine phosphory- Vehicle RBP3 (D1) Vehicle VEGF + Vehicle VEGF + RBP3 RBP3 (D1) lation of VEGFR2 (pTyr-VEG- VEGF  RBP3 (D2) VEGF + FR2) under rhRBP3 (0.25 g/ml) RBP3 RBP4 RBP3 (D2) VEGF + RBP3 and rhVEGF (2.5 ng/ml) stim- VEGF + RBP4 VEGF + + anti-RBP3 RBP3 (full) RBP3 ulation in BRECs (n = 3). (G) pTyr- VEGF (D1 + D2) RBP3 (D1 + D2) VEGFR2 under rhRBP4 (20 nM) VEGF + RBP3 (full)  or rhRBP3 (2.5 g/ml, 20 nM) F G and rhVEGF stimulation with EC EC cross-linking assay by 3,3′- IP: VEGFR2 IP: VEGFR2 dithiobis(sulfosuccinimidyl IB: p-tyrosine IB: p-tyrosine propionate) (DTSSP) in BRECs (n = 3). P-tyrosine, tyrosine IB: VEGFR2 IB: VEGFR2 phosphorylation. All data are VEGF – – + + + represented as means ± SEM. RBP3 – + – + + RBP4 RBP3 – RBP3 – RBP3 Group comparison was per- VEGF (ng/ml) formed by ANOVA (same as CoadditionPreincubation 0 2.5 25 Figs. 2 to 4). 4 P = 0.06 1.5 ** ** ** Vehicle 3 RBP3 1.0 2

(fold change) 0.5 (fold change) P-tyrosine/VEGFR2 1 P-tyrosine/VEGFR2

0 0 VEGF – – + + + 2.5 ng/ml VEGF 25 ng/ml VEGF RBP3 – + – + +

ncubation CoadditionPrei

Yokomizo et al., Sci. Transl. Med. 11, eaau6627 (2019) 3 July 2019 8 of 14

137 SCIENCE TRANSLATIONAL MEDICINE | RESEARCH ARTICLE

Chapter 4.2

A B Müller cell

VEGF (42 kDa)

β-Actin Müller cell RBP3 (μg/ml) – – – – 0.5 2.5 – ** STF31 (10 μM) ––+ + –– – ** *** PMA (100 nM) – –– – – – + 6

Glucose (mM) 5.6 25 5.6 5

**** 4 6 **** **** 3

5 Downloaded from 2 4 Il-6 mRNA expression

/ 18 S rRNA (fold change) 1 3 0

2 LG HG PMA /β-actin (fold change) http://stm.sciencemag.org/

VEGF protein expression 1 HG + STF31 0 HG + 0.5 µg/mlHG + RBP3 2.5 µg/ml RBP3 LG HG PMA

LG + STF31 HG + STF31

HG + 0.5 µg/mlHG + RBP3 2.5 µg/ml RBP3 C D E Müller cell Müller cell Müller cell

Irreversible cross-linker Reversible cross-linker Reversible cross-linker by guest on August 7, 2019 (formaldehyde) (DTSSP) (DTSSP) IP- αGLUT1 kDa IP- αRBP3 kDa kDa kDa Double IP- αRBP3 + αGLUT1 kDa kDa 250 250 250 250 250 250 150 150 150 150 100 100 150 150 75 75 IB- αRBP3 100 100

Silver staining 75 75

100 100 50 kDa kDa 50

100 100 IB- αGLUT1 75 75 75 75

BSA RBP3 b-RBP3 IP- αRBP3 50 50 kDa 50 50

250 IB- αGLUT1

150 IB- αGLUT1

BSA RBP3 b-RBP3 250 BSA RBP3 b-RBP3 150

IB- αRBP3 100 Fig. 6. Characterization of rhRBP3 on Müller cells. (A and B) Effects of rhRBP3 on HG-induced VEGF protein 75 expression (n = 8) and Il-6 mRNA expression (n = 6). PMA, phorbol 12-myristate 13-acetate. (C) Cross-linking assay with formaldehyde. Silver staining and immunoblot. (D and E) Cross-linking assay with DTSSP. All data are BSA RBP3 represented as means ± SEM. Group comparison was performed by ANOVA (same as Figs. 2 to 5). b-RBP3

YokomizoFig. et al 6.., Sci. Characterization Transl. Med. 11, eaau6627 of (2019) rhRBP3 3 July on 2019 Müller cells. 9 of 14 (A and B) Effects of rhRBP3 on HG-induced VEGF protein expression (n = 8) and Il-6 mRNA expression (n = 6). PMA, phorbol 12-myristate 13-acetate. (C) Cross-linking assay with formaldehyde. Silver staining and immunoblot. (D and E) Cross-linking assay with DTSSP. All data are represented as means ± SEM. Group comparison was performed by ANOVA (same as Figs. 2 to 5).

138 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy determine the mechanism by which RBP3 inhibits HG-induced Vegf and Il-6 mRNA expression, we studied the role of glucose transporter expression in Müller cells. Potential glucose transporters were screened by measuring the expression of multiple transporter genes (Glut1, Glut4, Sglt1, and Sglt2) by quantitative reverse transcription polymerase chain reaction. We found that Glut1 is dominantly expressed in Müller cells (fig. S7A). In addition, HG-induced migration was inhibited by a glucose transporter 1 (GLUT1) selective inhibitor (STF31) in ECs (fig. S7B). The role of GLUT1 in mediating HG-induced increases in VEGF and IL-6 mRNA and protein expression was supported by STF31 inhibition of HG-induced expression of these cytokines (Fig. 6, A and B, and fig. S6, A to C). Further, in crosslinking experiments, Müller cells were coincubated with BSA, boiled rhRBP3, or rhRBP3 with either reversible DTSSP or the irreversible cross-linker formaldehyde. Then, cellular membranes were isolated and IP with anti-GLUT1 or anti-RBP3 antibody. Immunoblot analysis showed selective association with GLUT1 but not with BSA or boiled rhRBP3 (Fig. 6, C to E).

Effects of rhRBP3 on 3-O-methyl-d-glucose and 2-deoxy-d-glucose uptake Because rhRBP3 may bind to GLUT1 transporters, the effect of rhRBP3 on 3-O-methyl-d- glucose (3-O-MG) and 2-deoxy-d-glucose (2DG) uptake was studied after incubating Müller cells and BRECs with rhRBP3 for 1 hour. RhRBP3 inhibited [3H]3-O-MG uptake by 65.4 and 65.0% compared with PBS in Müller cell and BRECs (P < 0.01 and P < 0.001), respectively (Fig. 7A and fig. S7C). RhRBP3 (5 μg/ml) also inhibited [3H]2DG uptake by 74, 26, and 62% Chapter 4.2 compared with PBS in Müller cells, BRECs, and Y79 cells (P < 0.001, P < 0.0001, and P < 0.001), respectively; [3H]2DG uptake was also reduced by 71, 45, and 83% by STF31 (P < 0.001, P < 0.0001, and P < 0.0001) compared with PBS, respectively, but not by BSA or boiled rhRBP3 (5 μg/ml; Fig. 7, B to D). RhRBP3 also inhibited [3H]2DG uptake in a dose-dependent manner from 0.05 to 5.0 μg/ml range, and its inhibitory actions by rhRBP3 (5 μg/ml) were reduced by the addition of anti-RBP3 antibodies in Müller cells, BRECs, and Y79 cells (P < 0.001, P < 0.0001, and P < 0.05), respectively (Fig. 7, B to D). In contrast, rhRBP3 did not inhibit [3H]2DG uptake into human retinal pigment epithelial cells (RPEs; Fig. 7E). rhRBP3 (5 ng/ml) did not inhibit [3H]2DG uptake into undifferentiated and differentiated C2C12 and adipocytes (fig. S7, D to G). The concentration of rhRBP3 (5 ng/ml) used for this experiment was comparable to physiological serum concentrations of RBP3 (0.4 to 4 ng/ml or 3 to 30 pM) based on the results from ELISA (Fig. 2A). Vitreous from Medalist patients with PDR (low RBP3, 5.0 ± 0.6 nM) inhibited [3H]2DG glucose uptake in Müller cells much less than vitreous from NPDR individuals (high RBP3, 15.7 ± 2.2 nM) (P < 0.01; fig. S8A).

Effects of rhRBP3 of different structural domains on 2DG uptake The effects of D1 and D2 (40 nM) on 2DG uptake were studied after the incubation of Müller cells with D1 and D2 for 1 hour. Full-length rhRBP3 (5 μg/ml, 40 nM) inhibited [3H]2DG uptake by 44% (P < 0.0001), whereas D1, D2, and the combination of D1 and D2 inhibited 34, 19, and 36%, (P < 0.0001, P < 0.0001, and P < 0.0001), compared with PBS, respec-

139 Chapter 4.2 tively. D1 inhibited [3H]2DG uptake significantly more than D2 P( < 0.05), whereas D1 + D2 combination had inhibitory effects similar to D1, and rhRBP4 (40 nM) had no effect (Fig. 7F). Cross-linking experiments with DTSSP showed that full-length rhRBP3 or D1 inhibited VEGF-induced pTyr-VEGFR2, whereas rhRBP4 and D2 had no effect (fig. S8B).

Effects of hRBP3 on extracellular acidifcation rate in Müller cells and mouse retina Because rhRBP3 could be decreasing glucose uptake in retinal Müller cells and ECs, we determined its effects on glycolytic rates by measuring extracellular acidification using the seahorse apparatus (21). ECAR analysis of vehicle-treated Müller cells showed that LG (5.6 mM) increases basal ECAR by 1.7-fold (P < 0.05), which was increased further by HG (25 mM) to 2.0-fold (P < 0.001), compared to basal ECAR. For control, ECAR was maximized by 5.2-fold with addition of a combination of RAA, inhibitor of mitochondria complexes I and III (P < 0.0001), compared to basal ECAR, and reduced by 2DG (P < 0.001), compared to ECAR by RAA (Fig. 7G). The basal ECAR and maximal ECAR by RAA were inhibited by rhRBP3 (5.0 μg/ml; P <0.01 and P < 0.01) compared to boiled rhRBP3 (5.0 μg/ml), respectively (Fig. 7G). In contrast, rhRBP3 did not affect palmitate’s effect on oxygen consumption ratio (OCR) in Müller cells (fig. S8C). Analysis of ECAR in the isolated retina of NDM + WT or DM + WT and RBP3Tg mice was performed. ECAR analysis of NDM + WT showed that LG, HG, and RAA increased ECAR by 2.2-, 2.1-, and 2.3-fold (P < 0.001, P < 0.0001, and P < 0.0001), compared to basal ECAR, respectively, and reduced by 2DG (P < 0.01), compared to ECAR by RAA. Basal ECAR and LG- and HG-induced ECAR in DM + WT mice were increased by 1.7-, 1.6-, and 1.5-fold (P < 0.001, P < 0.01, and P < 0.001), respectively, compared to ECAR in NDM + WT mice. ECAR in DM + WT mice was consistently increased by 1.6- and 1.6-fold with RAA and 2DG (P < 0.001 and P < 0.01), respectively, compared to ECAR in NDM + WT mice. There was no difference in ECAR between NDM + WT mice and NDM + RBP3Tg mice. However, basal ECAR and LG- and HG-induced ECAR in the retina of DM + RBP3Tg mice were reduced by 33, 30, and 32% (P < 0.01, P < 0.01, and P < 0.01), respectively, compared to those of DM + WT mice. Consistently, ECAR in DM + RBP3Tg mice was reduced by 36 and 31% with RAA and 2DG (P < 0.001 and P < 0.05), respectively, compared to those of DM + WT mice (Fig. 7H).

Fig. 7. Effects of rhRBP3 on glucose uptake and glycolytic flux in vitro and ex vivo. (A) Effects of rhRBP3 on 3-OMG uptake into Muller cells (n = 3). (B to E) Effects of rhRBP3 on 2DG uptake. (B) Muller cells (n = 3 to 6). (C) BRECs (n = 3 to 10). (D) Y79 cells (n = 3). (E) RPE cells (n = 4). (F) Effects of different size of rhRBP3 peptide on 2DG uptake (n = 6). Full, D1 and D2: full length, D1 and D2 of rhRBP3. (G) Extracellular acidification rate (ECAR) in Muller cells. LG, 5.6 mM glucose; HG, 25 mM glucose. Rote- none/antimycin A (RAA; 0.5 µM) and 2DG (50 mM) (n = 8). (H) ECAR in isolated retinas of all mice group of NDM or DM. RAA, 2.0 µM; 2DG, 100 mM. Number of retinas evaluated: n = 4. All data are represented as means ± SEM. Group comparison was performed by ANOVA (same as Figs. 2 to 6). (A to F) **P < 0.01, ***P < 0.001, and ****P < 0.0001, versus PBS; #P < 0.05, ##P < 0.01, ###P < 0.001, and ####P < 0.0001, versus RBP3 (5 µg/ml); †P < 0.05, ††P < 0.01, and ††††P < 0.0001, versus 40 nM RBP3 (D2); ‡‡‡‡P < 0.0001, 40 nM RBP4 versus 40 nM RBP3 (full). (G) *P < 0.05, **P < 0.01, b-RBP3 (5.0 µg/ml) versus RBP3 (5.0 µg/ ml). (H) *P < 0.05, **P < 0.01, ***P < 0.001, versus DM + WT. n.s., not significant. 

140 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy SCIENCE TRANSLATIONAL MEDICINE | RESEARCH ARTICLE

Fig. 7. Effects of rhRBP3 on A B *** # C glucose uptake and glyco- *** **** #### **** # lytic flux in vitro and ex vivo. ** ### 1.5 1.5 *** **** #### #### 1.5 (A) Effects of rhRBP3 on 3-O- **** #### MG uptake into Müller cells 1.0 1.0 (n = 3). (B to E) Effects of 1.0 rhRBP3 on 2DG uptake. (B) Müller cells (n = 3 to 6). (C) 0.5 0.5 0.5 BRECs (n = 3 to 10). (D) Y79 cells n n ( = 3). (E) RPE cells ( = 4). Ratio of 2DG uptake in BREC

(F) Effects of different size of 0 Ratio of 2DG uptake in Müller cell 0 0 Ratio of 3- O -MG uptake in Müller cell PBS PBS PBS rhRBP3 peptide on 2DG up- STF31 STF31 n g/ml BSA g/ml BSA take ( = 6). Full, D1 and D2: g/ml RBP3 g/ml RBP3g/ml RBP3g/ml RBP3g/ml RBP3g/ml RBP3 g/ml RBP3g/ml RBP3g/ml RBP3g/ml g/ml RBP3 RBP3g/ml RBP3g/ml RBP3 5 µ g/ml b-RBP3 5 µ g/ml b-RBP3 5 µ 5 µ Cytochalasin B Cytochalasin B 5 µ 5 µ + anti-RBP3 Cytochalasin B + anti-RBP3 5 µ 0.5 µ 2.5 µ 5 µ 0.5 µ 2.5 µ 10 µ 20 µ full length, D1 and D2 of 0.25 µ 0.05 µ 0.05 µ rhRBP3. (G) Extracellular acid- D # E F ‡‡‡‡ ification rate (ECAR) in Müller **** **** ### **** **** †††† cells. LG, 5.6 mM glucose; n.s. † **** ## **** **** 1.5 1.5 n.s. 1.5 **** †† HG, 25 mM glucose. Rotenone/ *** #  ****

antimycin A (RAA; 0.5 M) and Downloaded from 2DG (50 mM) (n = 8). (H) ECAR 1.0 1.0 1.0 in isolated retinas of all mice group of NDM or DM. RAA, 2.0 M; 2DG, 100 mM. Num- 0.5 0.5 0.5 ber of retinas evaluated: n = 4. Ratio of 2DG uptake in Y79 Ratio of 2DG uptake in RPE

All data are represented as Ratio of 2DG uptake in Müller cell 0 0 0 means ± SEM. Group com- http://stm.sciencemag.org/ PBS PBS PBS parison was performed by STF31 STF31 STF31 g/ml BSA g/ml BSA g/ml RBP3g/ml RBP3g/ml RBP3g/ml RBP3g/ml RBP3 g/ml RBP3g/ml RBP3g/ml RBP3g/ml RBP3g/ml RBP3 40 nM RBP4 ANOVA (same as Figs. 2 to 6). 5 µ g/ml b-RBP3 5 µ 5 µ 5 µ g/ml b-RBP3 Cytochalasin B + anti-RBP3 Cytochalasin B 5 µ 5 µ + anti-RBP3 5 µ 0.5 µ 2.5 µ 5 µ 0.5 µ 2.5 µ 40 nM RBP340 (D1)nM RBP3 (D2) (A to F) **P < 0.01, ***P < 0.001, 0.05 µ 0.05 µ 40 nM RBP3 (full) and ****P < 0.0001, versus PBS; 40 nM RBP3 (D1 + D2) #P < 0.05, ##P < 0.01, ###P < 0.001, G Müller cell H Retina P LG HG RAA 2DG and #### < 0.0001, versus RBP3 LG HG RAA 2DG  17.5 1.75 NDM + WT Chapter 4.2 (5 g/ml); †P < 0.05, ††P < 0.01, Vehicle and ††††P < 0.0001, versus 40 nM 15.0 1.50 NDM + RBP3Tg 5.0 μg/ml b-RBP3 P RBP3 (D2); ‡‡‡‡ < 0.0001, 12.5 1.25 DM + WT by guest on August 7, 2019 40 nM RBP4 versus 40 nM 0.05 μg/ml RBP3 10.0 1.00 DM + RBP3Tg RBP3 (full). (G) *P < 0.05, **P < 0.01, 0.5 μg/ml RBP3 7.5 0.75 b-RBP3 (5.0 g/ml) versus RBP3 2.5 μg/ml RBP3 (5.0 g/ml). (H) *P < 0.05, **P < 0.01, 5.0 0.50 5.0 μg/ml RBP3 ***P < 0.001, versus DM + WT.

ECAR (mpH/min/μg protein) 0.25

2.5 ECAR (mpH/min/μg protein) n.s., not significant. 0 0 0 40 80 120 0 40 80 120 160 200 Time (min) Time (min)

Müller cell Retina NDM + WT 18 Vehicle NDM + RBP3Tg P = 0.09 1.75 ***** ****** ** ** DM + WT 5.0 μg/ml b-RBP3 ** 1.50 DM + RBP3Tg 13 0.05 μg/ml RBP3 0.5 μg/ml RBP3 1.25 ** * 8 2.5 μg/ml RBP3 8 5.0 μg/ml RBP3 * 1.00 P = 0.09 *** ** 6 0.75 P = 0.09 4 ** 0.50 ECAR (mpH/min/μg protein) ECAR (mpH/min/μg protein)

2 0.25

0 0 Basal LG HGRAA 2DG Basal LGHGRAA 2DG

Effects of hRBP3 on extracellular acidification rate in Müller suring extracellular acidification using the seahorse apparatus (21). cells and mouse retina ECAR analysis of vehicle-treated Müller cells showed that LG (5.6 mM) Because rhRBP3 could be decreasing glucose uptake in retinal Müller increases basal ECAR by 1.7-fold (P < 0.05), which was increased cells and ECs, we determined its effects on glycolytic rates by mea- further by HG (25 mM) to 2.0-fold (P < 0.001), compared to basal

Yokomizo et al., Sci. Transl. Med. 11, eaau6627 (2019) 3 July 2019 10 of 14

141 Chapter 4.2

DISCUSSION

This study suggests that RBP3 may play a major role in protecting against the development of severe DR through its ability to ameliorate the actions of hyperglycemia on retinal ECs and Müller cells. Critical to this study was the availability of retina and vitreous from Medal- ist patients, which allowed for screening for potential protective factors that neutralize the adverse effects of hyperglycemia on the progression of DR. From the candidate proteins up-regulated in the retina and vitreous of Medalist patients with no-mild NPDR, RBP3 was selected for further study due to its specific expression to the photoreceptors and its unique function. RBP3 was also selected because its expression has been reported to decrease in DR (14). RBP3 is a large 135-kDa secreted protein produced mainly in the photoreceptors with a well-established function of binding and transporting cis/trans retinols between photoreceptors and RPE (16, 22). Further, RBP3 protein structures have separate domains of binding for retinols and lipids. RBP3 may have retinol trophic actions because people with RBP3 mutations develop retinal degeneration (12). Our findings showed that there was an about five fold decrease in RBP3 expression in the retina and vitreous in people with severe DR compared to NDM eyes. This marked reduction of RBP3 in the vitreous was related to the severity of DR and likely related to the extent of hyperglycemia. This conclusion is based on the finding that RBP3 expression was decreased in the retina of DM mice. RBP3 concentrations in the vitreous of people with type 1 or type 2 diabetes exhibit gradual decreases from the highest expression in no DR to the lowest expression in severe NPDR. In addition, a previous study reported a relative reduction of RBP3 expressions in the vitreous of people with type 2 diabetes by immunoblot analysis (14), and the authors suggested that this decrease in RBP3 could be due to hyperglycemia and, possibly, elevated inflammatory cytokines. It is unlikely that the reduction of RBP3 in the vitreous is due to loss of the photoreceptor layer resulting from laser panretinal photocoagulation, because RBP3 reduction occurred with severe NPDR before photocoagulation procedures. With the development of a highly selective and sensitive ELISA, we were able to measure serum RBP3 concentration and directly compare to vitreous RBP3 expression in the same individual, which showed that RBP3 in serum is 1000 times less concentrated than in vitreous. This is expected, given that RBP3 is predominately produced in the retina and the observed dilution factor is consistent with the ratio of vitreous volume to serum volume (16, 17). Analysis of the relationship between RBP3, VEGF, and IL-6 in the vitreous indicated that RBP3 concentrations were inversely correlated with the inflammatory cytokines with their ratios decreasing with increasing severity of DR. These findings suggest that ratios of RBP3 and VEGF or IL-6 in the vitreous might be a potential indicator of resistance to development of advanced DR (23). However, circulating VEGF and IL-6 concentrations are not reflective of retinal changes because both are secreted by many tissues. Future studies are needed to evaluate the utility of serum RBP3 as a biomarker for the progression of DR.

142 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy

Immunoblot analysis of RBP3 expression in the vitreous and retina of rodents and people yielded multiple bands of proteins at 100, 80, and 40 kDa. These findings suggest that there is substantial degradation of RBP3 under physiological conditions, which is exacerbated by the presence of diabetes. This idea is supported by the findings of elevated concentrations of the smaller molecular weight bands in the vitreous of people with PDR and in the retina of rodents with increased DM duration. The finding of discrete bands of similar molecular weight in people and rodents also suggests that specific proteases in the retina could be involved and their expressions can be enhanced by diabetes. These findings also indicate that degradation of RBP3 may be an additional mechanism for regulation of its physiological actions in the retina. This study has identified several actions of RBP3, a secreted neuroretinal protein that may have direct effects on other retinal cells and vasculature. There is great interest in the role of neuroretinal abnormalities on the development of DR because neuroretinal changes detected by ERG have been reported to precede vascular pathologies in DR (24, 25). Until now, no direct molecular signaling mechanism has been identified between the neuroretina and the vascular retina that affected progression of DR (26). Evaluation of RBP3 by the intravitreous administration or its overexpression in DM Tg rodent models showed that elevating RBP3 to physiological concentrations (20 nM) can prevent and even reverse vascular permeability and other retinal abnormalities, such as the decreases in neuroretinal responses measured by ERG, induced by diabetes. IVT injection of RBP3 appears to increase ERG amplitude, but Chapter 4.2 the overexpression of RBP3 in the retina did not change ERG. This could be related to the duration of the increases in RBP3 exposure, which was assessed in 3 days after IVT injection, whereas the overexpression models were studied after 2 to 3 months. There may be multiple mechanisms by which RBP3 exerts protective actions. One mechanism suggests that RBP3 can inhibit pTyr- VEGFR2, possibly by blocking VEGF binding to VEGFR2. However, the unexpected finding that RBP3 can reduce the expression of VEGF and IL-6 may indicate that RBP3 actions are broader than simply blocking VEGF actions. RBP3 may decrease glucose uptake and metabolism in several, but not all, retinal cell types, possibly by binding to GLUT1. Results from the retinal cell–based assays demonstrated that hyperglycemia increased the expression of VEGF and IL-6 via GLUT1, the major glucose transporter in Müller cells, because the effects of HG were inhibited by the GLUT1-selective inhibitor, STF31. Under physiological concentrations, RBP3 inhibited glucose transport and uptake in the retinal cells. However, at lower concentrations comparable to those detected with increasing severe DR, inhibitory actions of RBP3 on glucose uptake were decreased. GLUT1-specific inhibitor, STF31, inhibited the effect of HG on ECs and Müller cells equally as RBP3, strongly suggesting that the inhibitory actions of RBP3 are mainly mediated by decreasing glucose uptake via GLUT1. Further, RBP3 selectively cross-linked with GLUT1 and inhibited gly- colysis in the presence of HG in Seahorse assays in Müller cells and intact retina from WT and RBP3Tg mice. However, the inhibitory effects of RBP3 on glucose transport are selective, because RBP3 was not effective at reducing glucose uptake in RPE,

143 Chapter 4.2 adipocytes, and skeletal cells. In addition, RBP3 did not alter the effects of palmitate, a fatty acid, as measured by OCR. The mechanisms underlying the selectivity of RBP3 binding and inhibition of glucose uptake in various cells are related to its binding to GLUT1. Systemic action on glucose metabolism by RBP3 is unlikely because serum RBP3 concentrations are more than thousand times lower than its inhibitory concentration. In the retina, inhibitory actions of RBP3 on glucose uptake are partial and may be more active during HG than in LG conditions. It is unlikely that RBP3 inhibitory actions on GLUT1 at normal concentrations of glucose will have substantial effect on retinal fuel consumptions because individuals with GLUT1 gene defects have no reported any visual defects, although they exhibit neurological pathologies and seizures (27). Another protective action of RBP3 appears to be its binding to VEGFR2 as shown by its reduction of pTyr-VEGFR2. RBP3’s binding to VEGFR2 is likely dependent on the ambient retinal concentration of VEGF and RBP3, as suggested by the correlation of RBP3/ VEGF ratio in the vitreous to the severity of DR. This is supported by the finding that IVT injection of VEGF at 200 ng/ml induced RVP even in the presence of 1 to 2 μg/ml (8 to 16 nM) of endogeneous RBP3. This is further supported by the dose-response studies, showing that median inhibitory concentration of RBP3 is between 0.7 to 2.0 μg/ml (5 to 16 nM) with its concentrations in PDR at 0.5 to 1.0 μg/ml (4 to 8 nM), which is at the low end of its actions. In dose-response studies, RBP3 concentrations at 1 to 2.5 μg/ml were required to inhibit vascular permeability induced by VEGF in the retina. In addition, vitreous from Medalist patients with NPDR (high RBP3, 15.7 ± 2.2 nM) and PDR (low RBP3, 5.0 ± 0.6 nM) showed that the vitreous from PDR individuals was not as effective as vitreous from NPDR individuals. The mechanism of RBP3 binding to GLUT1 and possibly other cell surface proteins such as VEGFR2 is selective but not specific because our data have shown that RBP3 could bind to both GLUT1 and VEGFR2 but not FGF or fatty acid transporters. RBP3 has at least two retinol binding domains and a separate and evolutionarily conserved domain that may bind other lipids (13, 18). There has been speculation that RBP3 may have other retinal functions besides transporting cis/trans retinols, because mutations in RBP3 genes cause retinal degeneration, which has also been observed in mice with deletion of the RBP3 gene (11). Cross-linkage and structure/functional analysis showed that RBP3 can bind to VEGFR2 receptors but cannot inhibit the actions of FGF. Further, 34-kDa fragment of RBP3 (amino acids 19 to 320; D1) inhibited 2DG glucose uptake and VEGF- induced migration better than another RBP3 fragment containing D2 (amino acids 321 to 630). Experiments using reversible cross-linker also showed that full-length RBP3, as well as D1, inhibited VEGF- induced pTyr-VEGFR2 better than D2. These findings indicated that protective actions of RBP3 may be mediated selectively via binding to GLUT1 and VEGFR2, possibly via the retinol binding regions of RBP3. These new findings on the structure/function properties of the RBP3 and two different domains of RBP3 (D1 and D2) strengthen the mechanistic relationship between RBP3, GLUT1, and VEGFR2. Future studies will be needed to determine whether RBP3 can bind to other cell surface proteins using similar or other domains.

144 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy

There are several limitations to this study. The patients with diabetes studied here were mostly people with long duration of type 1 diabetes. The results will need to be replicated in people with type 1 diabetes of short duration and those with type 2 diabetes. In addition, more precise definition for the mechanism of RBP3 on its effects to decrease the toxic actions of hyperglycemia is needed.

In summary, we have found that preservation of RBP3, through either supplementation or increased expression from the photoreceptors, can protect neuroretina and vascular retina from diabetes-induced retinal dysfunction and pathology. This protective activity is partially mediated by RBP3 binding to GLUT1 and inhibition of glucose uptake in retinal cells, with subsequent decreased expression of VEGF and inflammatory cytokines. These results pro- vide evidence of a definitive pathway from the neuroretina that can regulate vascular retinal glucose metabolism and function in the DM eye.

MATERIALS AND METHODS

Study design The Joslin 50-year Medalist Study consists of participants recruited from across 50 states in the United States between 2004 and 2019. Participants were included in the study if they had Chapter 4.2 ≥50 years of well- documented type 1 diabetes at time of recruitment. The Medalist Study has been previously described in detail (9, 10). All Medalist patients were extensively characterized at Joslin Diabetes Center (JDC) through detailed history, clinical and ophthalmologic examinations, and biospecimen collections. Several Medalist patients also consented to postmortem organ donations. The goal of this study is to identify factors in the retina or vitreous that are associated with resistance to the initiation or progression of retinopathy in the presence of hyperglycemia. By 2010, we had gathered 17 eyes through these postmortem eye donations. For our initial pilot and feasibility study at this time, proteomic analysis was performed in donated retinas and vitreous postmortem samples from Medalist patients diagnosed with only no-mild NPDR (n = 6 eyes and n = 4 individuals) and compared to those with PDR (n = 11 eyes and n = 6 individuals). Both groups had comparable HbA1c. These numbers were based on a previous comparable vitreous proteomic study performed by the Joslin mass spectroscopy core (28). Validation (via ELISA and immunoblot analysis) and replication studies of RBP3, the candidate protein that emerged from this initial pilot study, were then conducted on the basis of using a larger pool of all the available postmortem and alive vitreous samples collected from Medalist patients by 2017. Through collaborative efforts of the Beetham Eye Clinic at JDC, as well as California Retina Consultants and other tissue procurement networks, we also procured postmortem and alive vitreous samples from non- Medalist patients, including type 1 diabetes, type 2 diabetes, and NDM controls, all of whom had known DR status (NDM, no-mild NPDR, moderate NPDR, and PDR). These samples

145 Chapter 4.2 were also included in our validation and replication studies of RBP3. The grading of DR in the replication sets was performed in a shielded manner. Although all available samples were used for the ELISA, the immunoblot studies were performed in a subset of the replication cohort due to the limitations of biospecimen quantity available. Along with RBP3, vitreous VEGF concentrations were also assessed by ELISA in the replication sets. For the various animal models used in this investigation, we reported the number of replication experiments or number of mice and rats in the figure legends. As described previously (9, 10) at initial visit, Medalist patients were evaluated at the JDC by medical history questionnaire and clinical and ophthalmic examination, and biospecimens were collected. HbA1c was determined by high-performance liquid chromatography (Tosoh, Tokyo, Japan), and lipid profiles by enzymatic methods (Roche Diagnostics, Indianapolis, IN and Denka Seiken and Asahi Kasei, Tokyo, Japan). Dilated eye examination was performed, and DR was graded on Early Treatment Diabetic Retinopathy Study protocol 7 standard field stereoscopic fundus photographs 29( ). Institutional review boards at the JDC and each participating site approved the study protocols.

Statistical analysis Comparisons among two groups were made with independent sample t tests. For comparisons of more than two groups, ANOVA was used. When overall F tests were significant, pairwise comparisons were examined using Fisher’s least significant difference test. When data exhibited significant lack of normality, nonparametric analogs (such as Mann-Whitney U test) were used. Association between continuous variables was assessed with linear regression. When repeated measures were made within individuals (such as rat subretinal injection experiments; fig. S3C), linear mixed-effects models were performed. Statistical significance was determined a priori because P < 0.05 and all statistical tests were two-sided. Analysis was performed using SAS v9.4, and figures were produced using GraphPad Prism software. Fold change in peptide expression was calculated by the ratio in the more severe disease group to the no-mild DR group in human studies and of the experimental groups to control in in vivo studies. The eyes were treated as independent observations. In rat experiments, animals with dense cataracts or whole corneal defects were excluded from analysis due to inability to obtain reliable optical results. Significance was defined asP * < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

146 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy

REFERENCES AND NOTES

1. J. L. Leasher, R. R. A. Bourne, S. R. Flaxman, J. B. Jonas, J. Keeffe, K. Naidoo, K. Pesudovs, H. Price, R. A. White, T. Y. Wong, S. Resnikoff, H. R. Taylor, Global estimates on the number of people blind or visually impaired by diabetic retinopathy: A meta-analysis from 1990 to 2010. Diabetes Care 39, 1643–1649 (2016). 2. A. Das, Diabetic retinopathy: Battling the global epidemic. Invest. Ophthalmol. Vis. Sci. 57, 6669–6682 (2016). 3. J. W. Y. Yau, S. L. Rogers, R. Kawasaki, E. L. Lamoureux, J. W. Kowalski, T. Bek, S.-J. Chen, J. M. Dekker, A. Fletcher, J. Grauslund, S. Haffner, R. F. Hamman, M. K. Ikram, T. Kayama, B. E. K. Klein, R. Klein, S. Krishnaiah, K. Mayurasakorn, J. P. O’Hare, T. J. Orchard, M. Porta, M. R e m a , M. S. Roy, T. Sharma, J. Shaw, H. Taylor, J. M. Tielsch, R. Varma, J. J. Wang, N. Wa n g , S. West, L. Xu, M. Yasuda, X. Zhang, P. Mitchell, T. Y. Wong; Meta-Analysis for Eye Disease (META-EYE) Study Group, Global prevalence and major risk factors of diabetic retinopathy. Diabetes Care 35, 556–564 (2012). 4. T. W. Olsen, Anti-VEGF pharmacotherapy as an alternative to panretinal laser photocoagulation for proliferative diabetic retinopathy. JAMA 314, 2135–2136 (2015). 5. D. F. Martin, M. G. Maguire, Treatment choice for diabetic macular edema. N. Engl. J. Med. 372, 1260–1261 (2015). 6. W. M. K. Amoaku, S. Saker, E. A. Stewart, A review of therapies for diabetic macular oedema and rationale for combination therapy. Eye 29, 1115–1130 (2015). 7. C. Rask-Madsen, G. L. King, Vascular complications of diabetes: Mechanisms of injury and protective factors. Cell Metab. 17, 20–33 (2013). Chapter 4.2 8. W. Qi, H. A. Keenan, Q. Li, A. Ishikado, A. Kannt, T. Sadowski, M. A. Yorek, I.-H. Wu, S. Lockhart, L. J. Coppey, A. Pfenninger, C. W. Liew, G. Qiang, A. M. Burkart, S. Hastings, D. Pober, C. Cahill, M. A. Niewczas, W. J. Israelsen, L. Tinsley, I. E. Stillman, P. S. Amenta, E. P. Feener, M. G. Vander Heiden, R. C. Stanton, G. L. King, Pyruvate kinase M2 activation may protect against the progression of diabetic glomerular pathology and mitochondrial dysfunction. Nat. Med. 23, 753–762 (2017). 9. H. A. Keenan, T. Costacou, J. K. Sun, A. Doria, J. Cavellerano, J. Coney, T. J. Orchard, L. P. Aiello, G. L. King, Clinical factors associated with resistance to microvascular complications in diabetic patients of extreme disease duration: The 50-year Medalist study. Diabetes Care 30, 1995–1997 (2007). 10. J. K. Sun, H. A. Keenan, J. D. Cavallerano, B. F. Asztalos, E. J. Schaefer, D. R. Sell, C. M. Strauch, V. M. Monnier, A. Doria, L. P. Aiello, G. L. King, Protection from retinopathy and other complications in patients with type 1 diabetes of extreme duration: The Joslin 50-year Medalist study. Diabetes Care 34, 968–974 (2011). 11. G. I. Liou, Y. Fei, N. S. Peachey, S. Matragoon, S. Wei, W. S. Blaner, Y. Wang, C. Liu, M. E. Gottes- man, H. Ripps, Early onset photoreceptor abnormalities induced by targeted disruption of the interphotoreceptor retinoid-binding protein gene. J. Neurosci. 18, 4511–4520 (1998). 12. A. I. den Hollander, T. L. McGee, C. Ziviello, S. Banfi, T. P. Dryja, F. Gonzalez-Fernandez, D. Ghosh, E. L. Berson, A homozygous missense mutation in the IRBP gene (RBP3) associated with autosomal recessive retinitis pigmentosa. Invest. Ophthalmol. Vis. Sci. 50, 1864–1872 (2009). 13. F. Gonzalez-Fernandez, T. Bevilacqua, K.-I. Lee, R. Chandrashekar, L. Hsu, M. A. Garlipp, J. B. Griswold, R. K. Crouch, D. Ghosh, Retinol-binding site in interphotoreceptor retinoid-binding protein (IRBP): A novel hydrophobic cavity. Invest. Ophthalmol. Vis. Sci. 50, 5577–5586 (2009).

147 Chapter 4.2

14. M. Garcia-Ramírez, C. Hernández, M. Villarroel, F. Canals, M. A. Alonso, R. Fortuny, L. Mas- miquel, A. Navarro, J. García-Arumí, R. Simó, Interphotoreceptor retinoid-binding protein (IRBP) is downregulated at early stages of diabetic retinopathy. Diabetologia 52, 2633–2641 (2009). 15. L. J. Tinsley, V. Kupelian, S. A. D’Eon, D. Pober, J. K. Sun, G. L. King, H. A. Keenan, Association of glycemic control with reduced risk for large-vessel disease after more than 50 years of type 1 diabetes. J. Clin. Endocrinol. Metab. 102, 3704–3711 (2017). 16. F. Gonzalez-Fernandez, D. Ghosh, Focus on molecules: Interphotoreceptor retinoid- binding protein (IRBP). Exp. Eye Res. 86, 169–170 (2008). 17. M. M. Rodrigues, J. Hackett, R. Gaskins, B. Wiggert, L. Lee, M. Redmond, G. J. Chader, Interpho- toreceptor retinoid-binding protein in retinal rod cells and pineal gland. Invest. Ophthalmol. Vis. Sci. 27, 844–850 (1986). 18. D. Ghosh, K. M. Haswell, M. Sprada, F. Gonzalez-Fernandez, Structure of zebrafish IRBP reveals fatty acid binding. Exp. Eye Res. 140, 149–158 (2015). 19. D. Ghosh, K. M. Haswell, M. Sprada, F. Gonzalez-Fernandez, Fold conservation and proteolysis in zebrafish IRBP structure: Clues to possible enzymatic function?Exp. Eye Res. 147, 78–84 (2016). 20. J. Wang, X. Xu, M. H. Elliott, M. Zhu, Y.-Z. Le, Müller cell-derived VEGF is essential for diabetes- induced retinal inflammation and vascular leakage.Diabetes 59, 2297–2305 (2010). 21. S. A. Mookerjee, A. A. Gerencser, D. G. Nicholls, M. D. Brand, Quantifying intracellular rates of glycolytic and oxidative ATP production and consumption using extracellular flux measurements. J. Biol. Chem. 292, 7189–7207 (2017). 22. M. Jin, S. Li, S. Nusinowitz, M. Lloyd, J. Hu, R. A. Radu, D. Bok, G. H. Travis, The role of interphotoreceptor retinoid-binding protein on the translocation of visual retinoids and function of cone photoreceptors. J. Neurosci. 29, 1486–1495 (2009). 23. U. E. Koskela, S. M. Kuusisto, A. E. Nissinen, M. J. Savolainen, M. J. Liinamaa, High vitreous concentration of IL-6 and IL-8, but not of adhesion molecules in relation to plasma concentrations in proliferative diabetic retinopathy. Ophthalmic Res. 49, 108–114 (2013). 24. C. D. Luu, J. A. Szental, S.-Y. Lee, R. Lavanya, T. Y. Wong, Correlation between retinal oscillatory potentials and retinal vascular caliber in type 2 diabetes. Invest. Ophthalmol. Vis. Sci. 51, 482–486 (2010). 25. N. Pescosolido, A. Barbato, A. Stefanucci, G. Buomprisco, Role of electrophysiology in the early diagnosis and follow-up of diabetic retinopathy. J. Diabetes Res. 2015, 319692 (2015). 26. E. P. Moran, Z. Wang, J. Chen, P. Sapieha, L. E. H. Smith, J.-x. Ma, Neurovascular cross talk in diabetic retinopathy: Pathophysiological roles and therapeutic implications. Am. J. Physiol. Heart Circ. Physiol. 311, H738–H749 (2016). 27. S. Sen, K. Keough, J. Gibson, Clinical reasoning: Novel GLUT1-DS mutation: Refractory seizures and ataxia. Neurology 84, e111–e114 (2015). 28. B.-B. Gao, X. Chen, N. Timothy, L. P. Aiello, E. P. Feener, Characterization of the vitreous proteome in diabetes without diabetic retinopathy and diabetes with proliferative diabetic retinopathy. J. Proteome Res. 7, 2516–2525 (2008). 29. Early Treatment Diabetic Retinopathy Study Research Group, Fundus photographic risk factors for progression of diabetic retinopathy. ETDRS report number 12. Ophthalmology 98, 823–833 (1991). 30. P. Geraldes, J. Hiraoka-Yamamoto, M. Matsumoto, A. Clermont, M. Leitges, A. Marette, L. P. Aiello, T. S. Kern, G. L. King, Activation of PKC-δ and SHP-1 by hyperglycemia causes vascular cell apoptosis and diabetic retinopathy. Nat. Med. 15, 1298–1306 (2009).

148 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy

31. C.-C. Liang, A. Y. Park, J.-L. Guan, In vitro scratch assay: A convenient and inexpensive method for analysis of cell migration in vitro. Nat. Protoc. 2, 329–333 (2007). 32. C. Rask-Madsen, G. L. King, Differential regulation of VEGF signaling by PKC-α and PKC-ε in endothelial cells. Arterioscler. Thromb. Vasc. Biol. 28, 919–924 (2008). 33. K. Park, Q. Li, N. D. Evcimen, C. Rask-Madsen, Y. Maeda, E. Maddaloni, H. Yokomizo, T. Shinjo, R. St-Louis, J. Fu, D. Gordin, M. Khamaisi, D. Pober, H. Keenan, G. L. King, Exogenous insulin infusion can decrease atherosclerosis in diabetic rodents by improving lipids, inflammation, and endothelial function. Arterioscler. Thromb. Vasc. Biol. 38, 92–101 (2018).

34. T. D. Schmittgen, K. J. Livak, Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 3, 1101–1108 (2008). 35. K. Park, Q. Li, C. Rask-Madsen, A. Mima, K. Mizutani, J. Winnay, Y. Maeda, K. D’Aquino, M. F. White, E. P. Feener, G. L. King, Serine phosphorylation sites on IRS2 activated by angiotensin II and protein kinase C to induce selective insulin resistance in endothelial cells. Mol. Cell. Biol. 33, 3227–3241 (2013). 36. A. Clermont, T. J. Chilcote, T. Kita, J. Liu, P. Riva, S. Sinha, E. P. Feener, Plasma kallikrein mediates retinal vascular dysfunction and induces retinal thickening in diabetic rats. Diabetes 60, 1590–1598 (2011). L. Lancerotto, A. Wagers, D. P. Orgill, G. L. King, Overexpressing IRS1 in endothelial cells enhances angioblast differentiation and wound healing in diabetes and insulin resistance. Diabetes 65, 2760–2771 (2016). 37. A. Clermont, N. Murugesan, Q. Zhou, T. Kita, P. A. Robson, L. J. Rushbrooke, D. M. Evans, L. P. Aiello, E. P. Feener, Plasma kallikrein mediates vascular endothelial growth factor-induced retinal dysfunction and thickening. Invest. Ophthalmol. Vis. Sci. 57, 2390–2399 (2016).

38. S. Kissler, P. Stern, K. Takahashi, K. Hunter, L. B. Peterson, L. S. Wicker, In vivo RNA interference Chapter 4.2 demonstrates a role for Nramp1 in modifying susceptibility to type 1 diabetes. Nat. Genet. 38, 479–483 (2006). 39. T. S. Kern, C. M. Miller, Y. Du, L. Zheng, S. Mohr, S. L. Ball, M. Kim, J. A. Jamison, D. P. Bingaman, Topical administration of nepafenac inhibits diabetes-induced retinal microvascular disease and underlying abnormalities of retinal metabolism and physiology. Diabetes 56, 373–379 (2007).

149 Chapter 4.2

SUPPLEMENTARY MATERIALS

Materials and Methods Fig. S1. Specificity of hRBP3 ELISA, human vitreous IL-6 concentrations, and effects of intravitreal (IVT) injection with rhRBP3 in rats. Fig. S2. Effects of IVT injection with rhRBP3 on retinal thickness by OCT at 2 months after diabetes in rats. Fig. S3. Establishment of subretinal overexpression of hRBP3 in rats and effects of diabetes on degradation of RBP3 in rat retina. Fig. S4. Establishment of Tg mice with hRBP3 overexpression in retina. Fig. S5. Effects of hRBP3 on VEGF- and FGF-induced migration. Fig. S6. Effects of rhRBP3 on HG induced Vegf and Il-6 mRNA expression. Fig. S7. Glucose transporter gene expressions and effects of rhRBP3 on 3-O-MG and 2DG uptake. Fig. S8. Effects of human vitreous or different peptide of hRBP3 on 2DG uptake, VEGF-induced pTyr- VEGFR2, and palmitate-induced OCR. Fig. S9. Human vitreous RBP3 concentrations and HbA1c. Fig. S10. Effects of rhRBP3 or Medalist patient vitreous from protected eye on endothelial migration. Table S1. Clinical and demographic characteristics by disease status for Medalist patients included in proteomic analysis by mass spectroscopy. Table S2. Four candidates of up-regulated proteins selected by proteomic analysis in retina and vitreous of Medalist patients with no-mild NPDR (n = 6, protected) versus PDR (n = 11, nonprotected). Table S3. RBP3 protein was selected from among the four candidates in table S2. Table S4. Clinical and demographic characteristics by disease status for individuals included in pro- teomics and ELISA assays. Table S5. Up-regulated proteins in the retina from Joslin Medalist patients: protected versus nonprotected. Table S6. Up-regulated proteins in the vitreous from Joslin Medalist patients: protected versus nonprotected. Table S7. Primers sequences used in reverse transcription polymerase chain reaction. Table S8. Raw data (Excel file). Data fle S1. Full immunoblot and silver staining. References (30–40)

150 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy

Materials and Methods

Proteomic analysis. Post-mortem ocular globes from medalist patients were procured ≈10 hours after death and shipped on ice. Approximately 1-1.5 cc of vitreous and retina were extracted from each eye and frozen at -80°C. Retinal lysate (120 μg) and vitreous (20 μl) was separated by 10% SDS–PAGE, stained with Coomassie Blue and analyzed by LC–MS/ MS using a linear ion-trap mass spectrometer as described before (28). Complete proteomic peptide hits are included in tables S5 and S6. Collection of validation specimens. RBP3 was quantified in the vitreous from 54 medalist patients and other diabetic patients with type 1 and 2 diabetes. This group consists of non- diabetic controls (NDM, n [participants]=13), no-mild nonproliferative DR (no-mild NPDR, n=19), moderate NPDR (n=8) and PDR (n=14). DR status was assessed in non-medalist patients by clinical examinations as reported by medical record (8). PDR includes some patients with the history of treatment with laser photocoagulation. RBP3 concentrations in the vitreous were determined by specific ELISA for RBP3 as described above. Vitreous VEGF concentrations were measured by ELISA (R&D systems) in a subgroup of 43 of these individuals (NDM, n [participants]=9; no-mild NPDR, n=15; moderate NPDR, n=7 and PDR, n=12) who had adequate volume of vitreous for the assay. Vitreous IL-6 concentrations were measured by ELISA (R&D systems) in a subgroup of 12 of these individuals (NPDR, n=6; PDR, n=6). For the detection of degradation of vitreous RBP3, bands (<135 kDa) /all RBP3 Chapter 4.2 bands were assessed by immunoblot in the vitreous from 74 medalist patients and other diabetic patients with type 1 and 2 diabetes. This group consists of NDM (n=12), no-mild NPDR (n=25), moderate NPDR (n=11), PDR (n=26). Establishment of transgenic mice with human RBP3 overexpression in retina. We generated RBP3 transgenic (RBP3Tg) mice that specifically overexpressed human RBP3 to the retina (RhRBP3 Tg) using the rhodopsin promotor on a C57BL/6J background. RBP3 transgenic mice, which overexpress human RBP3 (hRBP3) was cloned into the pRho-DsRed vector (Addgene) (pRho-RBP3-Myc-T2A-DsRed) after digested with EcoRI and MluI (New England BioLabs) and driven by the mouse rhodopsin promotor. The pRho-RBP3-Myc-T2A- DsRed was microinjected into embryo of C57BL/6J as background in the Transgenic Core at Brigham and Women’s Hospital. Founders were screened by genotyping with PCR using a forward primer (5’-AATAACGCCCCCAATCTCCG-3’) and a reverse primer (5’-GATC- GTTCAGGGAGCTCTGC-3’). The PCR conditions were 94°C for 3 minutes, followed by 35 cycles of 94°C for 30 seconds, 57°C for 30 seconds, and 72°C for 30 seconds. After 2 months of diabetes induced by STZ, retinal mRNA and protein expressions of RBP3 and VEGF (Mouse VEGF Quantikine ELISA, cat. # MMV00, R&D systems), retinal mRNA expressions of IL-6 as well as analysis of retinal functions by ERG, structures by OCT, and RVP were assessed. Retinal vascular pathology was assessed at six months after STZ injection by identification of acellular capillaries per square millimeter of retinal area.

151 Chapter 4.2

Establishment of Specifc ELISA for RBP3. Nunc ELISA/EIA 96 well plates (Thermo Fisher Scientific) were coated with a 100 μl of polyclonal RBP3 antibody in filtered PBS (4 μg/mL/well, ProteinTech) and incubated overnight at room temperature (RT). Plates were washed 3 times with 400 μl/well of washing buffer including 0.05% Tween-20 and 0.01% SDS and blocked with 300 μl/well of dilution buffer containing 5% of Tween-20 for 30 minutes at 37°C. Duplicates of 100 μl of serially diluted rhRBP3 peptides (Origene) as a standard, human vitreous samples (1/10 dilution) and the same amount concentration of IgG (1 μg/ mL), albumin (1 μg/mL) and RBP4 peptides (1 μg/mL) as a negative control were loaded on the same plate. After 1 hour incubation at 37°C, the plates were washed 5 times with 400 μl/ well of washing buffer and incubated with 100 μl of biotinylated monoclonal RBP3 antibody (2 μg/mL/well, Sigma-Aldrich) for 1 hour at 37°C. Plates were washed 5 times with 400 μl of washing buffer and incubated with 100 μl of Streptavidin-HRP (1:200, R&D systems) for 30 minutes at 37°C. After 30 minutes incubation at 37°C, the plates were washed and incubated with 100 μl/well of TMB for 10-20 minutes at RT. The reaction was stopped with 50 μl of 1 M

H2SO4 and absorbance was read at 450 nm using a Plate Reader (Promega). Reagents. Heparin (cat. # H3149), bovine serum albumin (BSA, cat. # A7888), Streptozoto- cin (STZ), and Cytochalasin B (cat. # C2743), rotenone (cat. # R8875), and antimycin A (cat. # A8674) were purchased from Sigma-Aldrich. Endothelial cell growth supplement (ECGS, cat. # J64516) was purchased from Roche Applied Science. RIPA buffer (cat. # BP-115) was purchased from Boston Bioproducts. Protease inhibitor (cat. # 11836153001) was purchased from Roche Diagnostics. Phosphatase inhibitor (cat. # 78420) was purchased from Thermo Scientific. STF31 (cat. # sc-364692) was purchased from Santa Cruz Biotechnology. Antibod- ies used for specific ELISA assay for RBP3 were: polyclonal RBP3 antibody as acapture antibody was purchased from ProteinTech (cat. # 14352-1-AP); monoclonal RBP3 antibody as a detection antibody was purchased from Sigma-Aldrich (cat. # WH0005949M1). Antibod- ies used for immunoprecipitation were: VEGFR2 antibody (cat. # sc-504) was purchased from Santa Cruz Biotechnology; Anti-RBP3 antibody (cat. # 14352-1-AP) was from Proteintech; Anti-GLUT1 antibody (cat. # NB300-666) was from Novus Biologicals. Antibodies used for immunoblots are as follows: Anti-RBP3 antibodies were from Abcam (cat. # ab101456), from Proteintech (cat. # 14352-1-AP) and from Sigma-Aldrich (cat. # WH0005949M1); Phospho- tyrosine antibody (cat. # 05-321) was from Millipore; VEGFR2 antibody (cat. # 05-554) was from Upstate; Anti-GLUT1 antibody (cat. # NB300-666) was from Novus Biologicals. Anti-Myc-Tag (cat. # 2272) were from Cell Signaling Technology. Anti-human retinol-binding protein antibody (cat. # A0040) was from Dako. VEGF (cat. # sc-152) and HRP-conjugated anti-β-Actin (cat. # sc-47778) were purchased from Santa Cruz. Recombinant human protein are as follows: recombinant human RBP3 protein (rhRBP3, cat. # TP603816) from human HEK293 cells was obtained from Origene Technologies. Recombinant human VEGF 165 (rhVEGF, cat. # 293-VE-010) and recombinant human RBP4 protein (rhRBP4, cat. # 3378-LC) were purchased from R&D Systems. Different peptides of RBP3 were: rhRBP3 (aa19-320, 34

152 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy kDa, D1, cat. # LS-G12036) was obtained from LSBio, Inc and rhRBP3 (aa321-630, 35 kDa, D2, cat. #ab215617) was obtained from Abcam.

Cell cultures. Cells were maintained at 37 °C in a humidified atmosphere of 5% CO2. Bo- vine retinal endothelial cells (BRECs) and bovine aortic endothelial cells (BAECs). Primary cultures of BREC and BAEC were isolated as reported previously (30). BREC and BAEC were grown in DMEM with 10% horse serum, 100 µg/ml heparin and 50 µg/ml endothelial cell growth supplement on 0.2% gelatin–coated dishes. We used cells from passages 3 through 6. Serum free DMEM with 0.1% BSA was used for overnight starvation. Müller cell. Müller cell (cat. # ENW001, Kerafast) were cultured in DMEM containing 10% Fetal Bovine Serum (FBS) and 1% penicillin/streptomycin.Y79 cell. Y79 human retinoblastoma cells (cat. # HTB-18, ATCC) were grown in RPMI-1640 medium supplemented with 10% FBS and 1% penicillin/streptomycin. Y79 cells were seeded in plates previously coated with poly-L-Lysine (cat. #0403, Sciencell, ScienCell Research Lab.) for experiments. RPE cell. Human retinal pigmented epithelium (RPE) cells (cat. #6540, ScienCell Research Lab.) were maintained in epithelial cell medium (EpiCM, cat. #4101, ScienCell Research Lab.) supplemented with 10 % FBS, 1x epithelial cell growth supplement (EpiCGS, cat. #4101, ScienCell Research Lab.) and 1% penicillin/streptomycin. Cells were seeded in plates previously coated with poly- L-Lysine (cat. #0403, ScienCell Research Lab.) for experiments C2C12 myoblast. C2C12 myoblasts (ATCC) were cultured in DMEM containing 10% FBS, 25 mM glucose (HG) and 1% penicillin/streptomycin for proliferation. Differentiation was induced by incubating the cells Chapter 4.2 in DMEM containing 2% horse serum, HG and 1% penicillin/streptomycin for 8 days. WT-1 cell. Immortalized brown preadipocytes (WT-1) were cultured in DMEM containing HG supplemented with GlutaMAX 10% FBS. For adipogenic induction, WT-1 cells were seeded at a density of 1 ×105 cells/cm2. Two days later when cells were fully confluent, cells were then exposed to an induction cocktail for two days, which consisted of 0.5 mM of 3-isobutyl-1- methylxanthine (IBMX), 125 μM of indomethacin, 5 μM of dexamethasone, 20 nM of insulin and 1 nM of T3 in HG DMEM, followed by a six-day maintenance phase (DMEM containing HG, 20 nM of insulin and 1 nM of T3). Cell-based assays. Purity of recombinant human RBP3 protein (rhRBP3), obtained from Origene Technologies, was determined by Coomassie blue staining and SDS-PAGE gel. Scratch assay assessed migration, as published (31). Cells were grown to confluence on 0.2% gelatin-coated 35 mm plates in growth media. Confluent cells were starved in DMEM/0.1% BSA overnight. Scratch wounds were created in confluent monolayers using a sterile p200 pipette tip. Perpendicular marks were placed at intervals of 1 mm across each scratch on the external surface of the well. After the suspended cells were washed, the wounded monolayers were incubated in each conditions of test medium in DMEM/0.1% BSA media. Osmotic pres- sure was adjusted in low glucose conditions by adding 19.4 mM mannitol. Every 6 hours up to 24 hours, repopulation of the wounded areas was observed under phase-contrast microscopy (Olympus). Using the NIH ImageJ image processing program, the size of the denuded area was determined at each time point from digital images. The percentage of migration area

153 Chapter 4.2 was calculated as the ratio of covered area (original wound area - open wound area) to the original wound area. Effects of rhRBP3 (0.25 μg/mL) or medalist patient vitreous with high RBP3 expression from protected eyes on high glucose (25 mM glucose, HG)- or VEGF (2.5 ng/mL)-induced endothelial migration were measured in BRECs. Anti-RBP3 antibody was added as a neutralizing antibody (1 μg/mL). 17.2 mg/mL of BSA was added in the group of BSA, VEGF+BSA and Anti-RBP3+BSA while 8.6 mg/mL of BSA was added in the group of Vitreous+BSA, VEGF+Vitreous+BSA and VEGF+Vitreous+Anti-RBP3+BSA. The effects of hRBP3 on tyrosine phosphorylation and protein expression of VEGFR2 (Flk) in BREC were assessed by immunoprecipitation (IP) with a VEGFR2 antibody (cat. # sc-504, Santa Cruz Biotechnology) followed by immunoblotting (IB) with a phospho-tyrosine antibody (cat. # 05-321, Millipore) or VEGFR2 antibody (cat. # 05-554, Millipore) as previously described (32). Cells were incubated with vehicle, rhVEGF, rhRBP3, both of rhVEGF and rhRBP3 for 10 minutes after overnight starvation in DMEM with 0.1% BSA. Both of rhVEGF and rhRBP3 were kept at RT for 10 minutes respectively, and then cells were incubated at the same time (Co-addition). Both of rhVEGF and rhRBP3 were premixed at RT for 10 minutes, and then cells were incubated (Pre-incubation). Then, cells were washed with ice-cold PBS and lysed immediately with RIPA buffer including protease inhibitor and phosphatase inhibitor. Cell lysates were immunoprecipitated (IP) with a VEGFR2 antibody followed by immunoblotting (IB). Ratio of tyrosine phosphorylation to total VEGFR2 was quantified by immunoblot and shown as fold-change to basal condition. Reverse transcription and quantitative real-time PCR analysis. Total RNA was extracted from the retina and cells using RNeasy mini kit (Qiagen), and cDNA was synthesized as previously described (33). All mRNA expressions were normalized to 18S and quantified using the threshold cycle method (34). PCR primers used in the study are listed in table S7. Immunoblotting. The immunoblot analysis was described previously (35). Briefly, retina lysates or cell lysates were loaded on an SDS-PAGE gel and electroblotted onto a nitrocellulose membrane. After blocking, the membranes were incubated with antibodies. Degradation of RBP3 was calculated as bands <135kDa / all RBP3 bands in each blot. The quantifications of western blotting were performed using ImageJ. Uncropped western gels are shown in Datafile S1. High glucose (HG) effects in Müller cell. LG or HG was added in Müller cell with rhRBP3 (0, 0.5, 2.5 μg/mL) for 24 hours in DMEM with 3%FBS. 10 μM of STF31 was added as a GLUT1 inhibitor. 100 nM of PMA was added for 3 hours. Crosslinking. Müller cells were incubated with BSA, boiled rhRBP3, and rhRBP3 for 1 hour at 37 °C, followed by the addition with 2 mM of DTSSP crosslinker (cat. # 21578, Fisher) for 2 hours or Formaldehyde for 30 minutes at 4 °C. After subcellular fractionation (cat. # 78840, Fisher), isolated membrane was immunoprecipitated (IP) with GLUT1 antibody (cat. # NB300-666, Novus Biologicals) or RBP3 antibody (cat. # 14352-1-AP, Proteintech), then immunoblot (IB) was performed.

154 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy

BRECs were incubated with RBP4, RBP3, and PBS for 1h in 0.2%BSA+DMEM-LG after a 16 hour starvation with 0.2%BSA+DMEM-LG, followed by washing by PBS, then rhVEGF (2.5 ng/mL) was added for 10min in 0.2%BSA+DMEM-LG. Cells were washed by PBS, followed by the addition with 2mM of DTSSP for 2h at 4 °C. Cell lysates were IP with VEGFR2 antibody, then IB was performed. Silver staining. After electrophoresis of the proteins in the polyacrylamide gel, silver staining is performed by silver stain kit (cat. # PROT-SIL2, Sigma-Aldrich) according to manufac- turer’s instructions. Radioactive materials.3-O-[3H]methyl-D-glucose ([3H]3-O-MG, cat. #NET379001MC) and 2-deoxy-D-1-[3H]glucose ([3H]2DG, cat. #NET328A001MC) were obtained from PerkinElmer. Measurement of 3-O-MG uptake. The cells were rinsed 5 times with PBS and incubated with the assay medium (0.1%BSA+PBS+1 mM of CaCl2 and 2.5 mM of MgSO4) containing rhRBP3 (0, 0.25 μg/mL) for 1 hour at 37 °C, and incubated with 0.1 mM of 3-O-MG, 2 μCi of [3H]3-O-MG for 1 minute at RT. Noncarrier-mediated uptake was determined in incubations containing 10 μM of cytochalasin-B for 5 minutes. The uptake was terminated by the addition of 50 μM of cytochalasin-B for 30 seconds, followed by 5 washes with ice-cold PBS. After washes, cell associated radioactivity was solubilized in 50 mM of NaOH, and taken for liquid scintillation counting. Results shown are corrected for total cellular protein content, as assessed by the bicinchoninic acid (BCA) assay (Thermofisher Scientific). Measurement of 2DG uptake. The cells were rinsed and incubated with the assay medium Chapter 4.2 as described above containing several concentrations of rhRBP3 for 1 hour at 37 °C, and then incubated with 0.1 mM of 2DG, 1 μCi of [3H]2DG for 5 minutes at RT. Noncarrier-mediated uptake was determined in incubations containing 10 μM of cytochalasin-B for 5 minutes. 10 μM of STF31 (cat. # sc-364692, Santa Cruz Biotechnology) was used as a GLUT1 inhibitor for 5 minutes. Anti-RBP3 antibody was added as a neutralizing antibody (1 μg/mL). The uptake was terminated by 5 washes with ice-cold PBS. After washes, the cells were processed for liquid scintillation counting. Results shown are corrected for total cellular protein content as described above. Measurement of 2DG uptake with different fragment of RBP3. Different molecular sizes of RBP3 such as rhRBP3 (aa19-320, 34 kDa, D1, cat. # LS-G12036, LSBio, Inc) and rhRBP3 (aa321-630, 35 kDa, D2, cat. #ab215617, Abcam) were used. Müller cells were rinsed and incubated with 40 nM of rhRBP4 (RBP4, 22 kDa, cat. #3378-LC, R&D Systems), 40 nM of full length of rhRBP3 (full, 135 kDa, cat. # TP603816, Origene Technologies), and 40 nM of different peptides of rhRBP3 (D1, D2, and combination with D1 and D2) for 1 hour at 37 °C after a 4 hour starvation with 0.2%BSA+DMEM-L, and then incubated with 0.1 mM of 2DG, 1 μCi of [3H]2DG for 5 minutes at RT. 10 μM of STF31 was used as a GLUT1 inhibitor for 5 minutes. [3H]2DG uptake was terminated by 5 washes with ice-cold PBS. After washes, the cells were processed for liquid scintillation counting. Results were corrected for total cellular protein content as described above.

155 Chapter 4.2

Extracellular acidifcation rate (ECAR). All ECAR were measured by a Seahorse XFe96 Flux Analyzer (Agilent Technologies). In vitro study, Müller cells were seeded into a 96-well plate 1 day before measurement. Cells were incubated with vehicle, boiled rhRBP3 (b-RBP3), or rhRBP3 (RBP3) for 1 hour in assay medium (0.2%BSA+KRB buffer: 110 mM of NaCl,

4.7 mM of KCL, 2 mM of MgSO4, 1.2 mM of Na2HPO4, and 0.24 mM of MgCL2, pH7.4) before measurement. For ex vivo study, whole retinas were isolated from mice after 4 months duration of diabetes. One fourth of the retina was loaded into the 96-well plate and was incubated in the assay medium for 1 hour before measurements. No glucose was included in the assay medium. Data are calculated after the addition of LG, HG, rotenone (0.5 μM or 2.0 μM) and antimycin A (0.5 μM or 2.0 μM), 2DG (50 mM or 100 mM) for Müller cell or retina, respectively, and corrected for total protein content measured by BCA assay. For each experiment, the means from 2- 4 replicate wells were recorded. In vivo study. Insulin deficient diabetic rats were produced by intraperitoneal injection of streptozotocin (STZ, 55 mg/kg) after a 12 hours overnight fast at 6 weeks of age and insulin deficient diabetic mice were produced by 5 consecutive days of intraperitoneal injection of STZ (50 mg/kg) at 7 weeks of age. Diabetes is ascertained by blood glucose values > 250 mg/dl as measured by a glucometer and followed at 3-4 week intervals (36, 37). The experimental protocols were approved by the Joslin Diabetes Center Institutional Animal Care and Use Committee. The experiments were carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. In vivo intravitreal (IVT) injection. IVT injections were performed by injecting 5µL volumes via a 32G Hamilton syringe (Hamilton Corp.) at 2 mm below the limbus of male Lewis rats at 8 weeks of age (Charles River Laboratories, Inc.), as described previously (38). In the premix study, recombinant human VEGF (rhVEGF, 200 ng/mL) and rhRBP3 (2.5 μg/ml, 20 nM) were combined and immediately injected into the vitreous. Each rat was ‘infused with Evans blue dye 10 minutes after IVT injection, and 2 hours later retinal vascular permeability (RVP) was assessed (36). In an intervention study, IVT of rhVEGF (200 ng/mL) was followed 24 hours later by an IVT of vehicle, boiled rhRBP3 (2.5 μg/ml, 20 nM), or rhRBP3 (2.5 μg/ml, 20 nM). In dose dependent of rhRBP3 study, IVT of rhVEGF (200 ng/mL) was followed 24 hours later by an IVT of vehicle or rhRBP3 (1, 10, 20 nM). At 10 minutes after IVT injection with rhRBP3, each rat was infused with Evans blue dye and 2 hours later RVP was assessed. After 2 months of diabetes, vehicle, boiled rhRBP3, or rhRBP3 were IVT injected (2.5 μg/ml, 20 nM). At 3 days after IVT injection, RVP and retinal mRNA expressions of Vegf and Il-6 and retinal protein expressions of VEGF (Rat VEGF Quantikine ELISA Kit, cat. # RRV00, R&D systems) were assessed. In addition, at 3 days post IVT injection, scotopic responses of the neuroretina to maximal white light flash was measured by dark-adapted electroretinogram (ERG) (ADInstru- ments). Thickness of the retina and sub-layers were also evaluated by spectral domain optical coherence tomography (SD-OCT 840) and segmentation software Diver v2.4 (Bioptigen) (38). Boiled rhRBP3 was obtained by boiling with 100°C for 30 minutes, and left for 30 minutes at RT.

156 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy

In vivo gene therapy with human RBP3. Subretinal overexpression of hRBP3, in male Lewis rats (Charles River Laboratories International, Inc.), was performed using lentiviral vectors expressing RBP3 or luciferase-GFP driven by CMV-promoter (39). We confirmed luciferase expression in rat eyes at one week, three months and six months after injection using in vivo imaging system (IVIS SPECTRUM CT system; Caliper Life Sciences) with intraperitoneal injection of D-Luciferin Firefly (50 mg/g BW, Caliper Life Sciences). Luciferase-GFP was used to determine efficacy of the vector, which correlated well with the expression of RBP3. Subretinal injections of lentivirus at the concentrations of luciferase-GFP (OD: 2.5x106 IFU) and a cocktail of RBP3/luciferase-GFP (OS: 2.25/0.25 x106 IFU) were performed by a trans-corneal method at 2 weeks of age to express hRBP3 and luciferase reporter gene. Differences in luciferase activity between OS and OD were found because different amounts of lentivirus containing luciferase plasmid were injected to track the persistent expression of proteins by sub-retinal injections of lentivirus to assure that each eye has equal amount of virus injected, one retina was injected with both luciferase and RBP3 plasmids in the treated retina and only luciferase plasmid in the untreated retina. At two months after diabetes, scotopic responses of the neuroretina were measured by ERG, and thickness of the retina and sub-layers were evaluated by OCT (36). Protein expressions of VEGF in retina and vitreous were assessed as described above. RVP was measured using Evans blue dye permeation (36). Retinal vascular pathology was assessed at six months after STZ injection to identify acellular capillaries per square millimeter of retinal area (40). Chapter 4.2

In Vivo Retinal Assessments.

Optical Coherence Tomography (OCT). The thickness of the total retina and retinal sub- layers were measured by spectral domain optical coherence tomography (SD-OCT 840) and segmentation software Diver v2.4 (Bioptigen) (36). Elecroretinogram (ERG). Scotopic responses of the neuroretina to maximal white light flash are measured by dark-adapted ERG (ADInstruments) at 2 months after STZ injection (36). The ERG system consists of a light stimulator (WLS-20, Mayo Co.), differential amplifer (Bio Amp), analog to digital convertor (PowerLab/4sp, ADInstruments) and software (Scope for Windows V3.6.4). The light source consists of a white light emitting diode, contact lens with embedded gold wire electrode which connects to the stimulator. Prior to each session, the LED lens is calibrated using the WLS-20 light sensor and calibration routine. At 2 months after STZ injection, rats were dark-adapted within the ERG room overnight. For maximum light flash stimulation, intensity of 1.4x104 cd/m2 with duration of 5 msec used. The signals were filtered with a bandpass filter between 1 and 500Hz (PowerLab ML750) to reduce background noise. At least three signals were recorded with an interval of 60 seconds between stimulations. An average of all signals are used in the data analysis. Analysis of the data is performed using the ADInstruments Scope V3.6.4 software.

157 Chapter 4.2

158 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy

 Fig. S1. Specificity of hRBP3 ELISA, human vitreous IL-6 concentrations, and effects of intravitreal (IVT) injection with rhRBP3 in rats. (A) Specific and sensitivity of ELISA for RBP3. Positive control= human vitreous from NPDR. n = 3. (B) Hu- man vitreous IL-6 concentrations from NPDR and PDR. n = 6. (C) Retinal vascular permeability (RVP) by premixed with recombinant human VEGF (rhVEGF) and rhRBP3. n = 4. (D) RVP by intervention in rat. n =5-8. (E) Retinal Vegf mRNA expression at 2 month after STZ injection. n = 4-6. (F and G) Electroretinogram (ERG) at 2 month after STZ injection. (F) ERG at baseline. (G) ERG at 3 days after IVT injection. n = 9-13. (H and I) Degradation of vitreous RBP3 in rat at 10min and 1 day after IVT injection with rhRBP3 by immunoblot analysis. n = 1. NDM = non-diabetic rats. DM = diabetic rats. Vehicle, b-RBP3, and RBP3 = injected with vehicle, boiled rhRBP3 and rhRBP3. n = numbers of eyes. All data are represented as mean ± SEM. Group comparison was done by ANOVA. When overall F tests were significant (p < 0.05), Fisher’s LSD test was used to determine the location of any significant pairwise differences. ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05. Chapter 4.2

159 Chapter 4.2

160 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy

 Fig. S2. Effects of IVT injection with rhRBP3 on retinal thickness by OCT at 2 months after diabetes in rats. (A) baseline. NDM, n = 16; DM, n = 21, (B) 3 days after IVT injection. n = 9-11. (C) OCT-B scan and (D) OCT-enface. n = numbers of eyes. NDM = non-diabetic rats. DM = diabetic rats. Vehicle, b-RBP3, and RBP3 = injected with vehicle, boiled rhRBP3 and rhRBP3. All data are represented as mean ± SEM. Group comparison was done by ANOVA (same as fig. S1). Chapter 4.2

161 Chapter 4.2

162 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy

 Fig. S3. Establishment of subretinal overexpression of hRBP3 in rats and effects of diabetes on degradation of RBP3 in rat retina. (A) Lentiviral vector expressing hRBP3 driven by CMV-promoter. (B) Time course of overall in vivo experimental period. (C) Luciferase expression in rat eyes using in vivo imaging system (IVIS Lumina system; Caliper Life Sciences, Hopkinton, MA). OD = 15 eyes, OS = 15 eyes. p-values were calculated by linear mixed effects modeling, comparison by paired t-test were conducted to determine the location of any significant pairwise differences. (D) Co-registered optical and micro CT showing 3D localization of signal. (E) Associa- tion of luciferase activity and the expression of RBP3 in retina assessed by linear regression. N = 10 eyes. (F and G) Effects of diabetes on degradation of RBP3 by immunoblot analysis in rat retina. n =5. n = numbers of eyes. NDM = non-diabetic rats. DM = diabetic rats. All data are represented as mean ± SEM. Chapter 4.2

163 Chapter 4.2

164 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy

 Fig. S4. Establishment of Tg mice with hRBP3 overexpression in retina. (A) Rhodopsin-promoter derived RBP3 transgene. (B) Genotyping. (C and D) RBP3 expressions in (C) retina, n = 3 and (D) several tissues by western blot. rhRBP3 = recombinant human RBP3. rhRBP4 = recombinant human RBP4. (E) Timeline of the in vivo experiment. (F and G) Changes of body weight and blood glucose. n = 7-10. (H) Vegf mRNA expression in retina at 2 months after diabetes. n = 3-5. WT= wild type mice, RBP3Tg= RBP3 transgenic mice, All data are represented as mean ± SEM. Group comparison was done by ANOVA (same as fig. S1 and 2). Chapter 4.2

165 Chapter 4.2

166

Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy

 Fig. S5. Effects of hRBP3 on VEGF- and FGF-induced migration. (A) Effects of rhRBP3 (5 nM or 20 nM) on rhVEGF (2.5 ng/mL)-induced endothelial migration in BREC. Area under the curve (AUC) for Fig. 5D. n = 4. (B) Effects of rhRBP3 (20 nM) on FGF (10 pg/mL)-induced endothelial migration in BAEC. n =3-4. (C) Effects of RBP4 (20 nM) or different peptide of rhRBP3 (20 nM) on rhVEGF (2.5 ng/mL)-induced endothelial migration in BAEC. AUC for Fig. 5E. full: full length of RBP3. D1: fragment of RBP3 (AA19-320, domain 1). D2: fragment of RBP3 (AA321-630, domain 2). n = 4. All data are represented as mean ± SEM. Group comparison was done by ANOVA (same as fig. S1, S2 and S4). (C) *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001 versus VEGF+control; #p<0.05, ##p<0.01, ###p<0.001 and ####p<0.0001 versus VEGF+RBP3 (D1). Chapter 4.2

167 Chapter 4.2

168 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy

 Fig. S6. Effects of rhRBP3 on HG induced Vegf and Il-6 mRNA expression. (A and B) Vegf and Il-6 mRNA expression in Müller cell. n = 4. (C) Effects of rhRBP3 on HG induced Vegf mRNA expression in Müller cell. n = 6. (D and E) Effects of rhRBP3 on HG induced Vegf and Il-6 mRNA expression in BREC. rhRBP3 (RBP3, 0.25 μg/mL). n = 4. LG = 5.6 mM glucose. HG = 25 mM glucose. Man = 25 mM Mannitol. 10 μM STF31 was added as a GLUT1 inhibitor. 100 nM of PMA was added for 3 hours. All data are represented as mean ± SEM. Group comparison was done by ANOVA (same as fig. S1, S2, S4 and S5). Chapter 4.2

169 Chapter 4.2

170 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy

 Fig. S7. Glucose transporter gene expressions and effects of rhRBP3 on 3-O-MG and 2DG uptake. (A) Amplification plot and cycle threshold of potential glucose transporter gene expressions using qRT-PCR in Müller cell. n = 4. (B) Effects of STF31, GLUT1 inhibitor (10 μM), on low glucose (LG, 5 mM) or high glucose (HG, 25 mM)-induced migration in BAEC. n = 3. (C) Effects of rhRBP3 on 3-O-MG uptake in BREC. n = 3. (D to G) Effects of rhRBP3 on 2DG uptake; (D) Undifferentiated C2C12. n = 3-7; STF31 (n = 2). (E) Differ- entiated C2C12. n = 3-7; STF31 (n = 2). (F) Undifferentiated adipocyte. n = 3-6. (G) Differentiated adipocyte. n = 3-6; STF31 (n = 2). b-RBP3 = boiled RBP3. All data are represented as mean ± SEM. Group comparison was done by ANOVA (same as fig. S1, S2 and S4-S6). (A) ****p<0.0001 versus Glut1. (B) *p<0.05 HG versus HG+STF31. (C-G) *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001 versus PBS. Chapter 4.2

171 Chapter 4.2

Fig. S8. Effects of human vitreous or different peptide of hRBP3 on 2DG uptake, VEGF-induced pTyr- VEGFR2,Fig. S8. andEffects palmitate-induced of human vitreous OCR. or different peptide of hRBP3 on 2DG uptake, (A) Effects of rhRBP3 (5 μg/mL, 40 nM) or human vitreous from NPDR (RBP3; 15.7 ± 2.2 nM, VEGF; 8.6 ± 1.6 pM), PDR (RBP3; 5.0 ± 0.6 nM, VEGF; 196.1 ± 69.2 pM) on 2DG uptake in Müller cell. T-test was used to evaluateVEGF -theinduced difference pTyr between-VEGFR2, NPDR and PDR. palmitate n = 3. (-Binduced) Effects ofOCR. RBP4 (20 nM) or different peptide of rhRBP3 (20 nM) on VEGF (2.5 ng/mL)-induced tyrosine phosphorylation (p-tyrosine) of VEGFR2 in BAEC. full:(A )full Effects length of of rhRBP3 RBP3. D1: (5 fragment μg/mL, of40 RBP3 nM) (AA19-320,or human domainvitreous 1). from D2: fragmentNPDR (RBP3; of RBP3 15.7 (AA321-630, ± 2.2 domain 2). n = 1. (C) Effects of rhRBP3 on palmitate-induced oxygen consumption ratio (OCR) in Műller cell. Cells were incubated with PBS, boiled rhRBP3 (b-RBP3), rhRBP3 (2.5 μg/mL, 20 nM) for 1 hour in 0.2%BSA+KRBnM, VEGF; 8.6 buffer ± 1.6 (no pMglucose).), PDR 200 (RBP3; μM of BSA 5.0 or± 0.6Palmitate-BSA nM, VEGF; was 196.1 added ±to 69.2 start pM)seahorse on 2DGassay. n = 4-6. All data are represented as mean ± SEM. Group comparison was done by ANOVA (same as fig. S1, S2 and S4-S7). uptake in Müller cell. T-test was used to evaluate the difference between NPDR and PDR. n =

172 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy

Fig. S9. Human vitreous RBP3 concentrations and HbA1c. The correlation between human vitreous RBP3 concentrations and HbA1c plotted with a regression line. n=55. Fig. S9. Human vitreous RBP3 concentrations and HbA1c.

The correlation between human vitreous RBP3 concentrations and HbA1c plotted with a

regression line. n=55.

Chapter 4.2

Fig. S10. Effects of rhRBP3 or Medalist patient vitreous from protected eye on endothelial migration. Effects of rhRBP3 (0.25μg/mL, 2nM) or medalist patient vitreous from protected eye on 25mM glucose (HG) or rhVEGF (2.5ng/mL)-induced endothelial migration in bovine retinal endothelial cell (BREC). AUC for Fig. 5A-C. All data are represented as mean ± SEM. Group comparison was done by ANOVA. (A) *p<0.05 versus HG; ##p<0.01 versus HG+RBP3. n=4. (B) *p<0.05 versus VEGF; #p<0.05 versus VEGF+RBP3. n=4-5. (C) ***p<0.001 versus VEGF+BSA; ##p<0.01 versus VEGF+Vitreous+BSA. n=3.

173 Chapter 4.2

Table S1. Clinical and demographic characteristics by disease status for Medalist patients included in proteomic analysis by mass spectroscopy. No-mild NPDR PDR Total number 4 6 Number of medalist patients 4 6 Percentage or Median [lower quartile, upper quartile] Age (years) 79 [65, 86 ] 77 [71, 78] Gender (Female, %) 25.0% 33.3% Type of diabetes (Type 1, %) 100% 100% Duration of disease (years) 64 [53, 76] 67 [57, 72] Age at diagnosis (years) 12 [6, 17] 8 [7, 10] HbA1c (%) 7.3 [6.4, 8.2] 7.2 [6.6, 7.3] BMI (kg/m2)* 20.8 [17.8, 23.8] (2†) 27.8 [22.7, 30.4] Total Cholesterol (mg/dL) 155 [129,179] 156 [131, 158] Triglycerides (mg/dL) 71 [65, 86] 54 [43, 75] HDL (mg/dL) 55 [49, 59] 62 [46, 75] LDL (mg/dL) 83 [62, 108] 69 [65, 70] CRP (mg/L)* 2.0 [0.6, 7.9] 1.8 [0.9, 3.3] eGFR (ml/min /1.73m2)* 59.4 [48.1, 73.4] 47.7 [43.2, 71.8] Hypertension (%)* 50.0% 83.3% Neuropathy (%) 75.0% 83.3% CVD (%) 50.0% 100% DM= diabetes mellitus. PDR= proliferative diabetic retinopathy. BMI= body mass index. HDL= high-density lipoprotein cholesterol. LDL= low-density lipoprotein cholesterol. CRP= C-reactive protein. eGFR= estimated glomerular filtration rate. CVD= cardiovascular disease. *Available only in medalist patients. †Number lacking data. P-values were calculated by Kruskal-Wallis or Fisher’s Exact Test.

Table S2. Four candidates of up-regulated proteins selected by proteomic analysis in retina and vitreous of Medalist patients with no-mild NPDR (n = 6, protected) versus PDR (n = 11, nonprotected). p < 0.05 cutoff by Mann–Whitney U test.

Retina Vitreous Protein Name Fold change P value Fold change P value RBP3 Interphotoreceptor 1.61 0.0444 1.88 0.0049 retinoid-binding protein precursor PTPRZ1 Protein Tyrosine Phosphatase, 1.33 0.0484 1.20 0.0480 Receptor Type Z1 PPME1 Isoform 3 of Protein phosphatase 1.20 0.0484 1.17 0.0484 methylesterase 1 TNR Isoform 2 of Tenascin-R precursor 1.48 0.0496 1.54 0.0428

174 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy

Table S3. RBP3 protein was selected from among the four candidates in table S2. Protein Name Retina n=17 eyes, 10 people Vitreous n=17 eyes, 10 people Retinol Binding No-Mild PDR n=11 Fold- P-value No-Mild PDR n=11 Fold- P-value Protein 3 NPDR eyes, change NPDR eyes, change (Interphotoreceptor n=6 eyes, 6 people (Mean) n=6 eyes, 6 people (Mean) retinoid-binding 4 people 4 people protein) Peptide hit numbers 414.5 268 1.61 0.04 560 269 1.88 <0.01 (Median) Total numbers of detected peptide hits of RBP3 were 318 (retina) and 327 (vitreous) in median of all subjects. The selecting criteria was a minimum 1.5-fold increase of peptide hit numbers with p-value <0.05 in both retina and vitreous. P-values were calculated using Mann–Whitney U test.

Table S4. Clinical and demographic characteristics by disease status for individuals included in pro- teomics and ELISA assays. Non-DM (NDM) No-Mild NPDR Moderate NPDR #PDR Total number (eyes, 17[13] 30[19] 9[8] 23[14] subjects) Number of medalist patients 0 12 7 14 Number of non-medalist 13 7 1 0 patients Percentage or Median [lower quartile, upper quartile] Age (years) 78 [73, 83] (1†) 81 [77, 86] 75 [64.5, 83.5] 76[73, 87]

Gender (Female, %) 50%(1†) 42.1% 50.0 57.1% Chapter 4.2 Type of diabetes (Type 1, %)* N/A 68.4.% 100% 100% Duration of disease (years)* N/A 56 [35-60] (2†) 54.5[50.5-63.0] 63.5[57-75] Age at diagnosis (years) ** N/A 20 [15-47] (3†) 13[6-18.5] 8[4-12] HbA1c (%) N/A 7.0 [6.5, 7.5] (3†) 7.4 [5.8, 8.4] (1†) 7.3 [7.1, 7.5] BMI (kg/m2) ^ N/A 25.1 [22.5, 29.0] (7†) 28.3 [23.8, 29.1] (2†) 26.6 [21.8, 32.4] Total Cholesterol (mg/dL) N/A 142 [122, 158] (4†) 138 [134, 162] (1†) 155 [135, 162] Triglycerides (mg/dL) N/A 80.5 [53, 137] (5†) 61 [41, 71] (1†) 64.5 [41, 83] HDL (mg/dL) N/A 51 [45, 70] (6†) 60 [59, 72] (1†) 61.5 [49, 75] LDL (mg/dL) N/A 66 [57, 76] (6†) 55 [52, 76] (1†) 74 [55, 89] CRP (mg/L) ^ N/A 0.74[0.5-0.9] (7†) 1.00[0.6-1.3] (3†) 0.90 [0.6-3.3] eGFR (ml/min /1.73m2) ^ N/A 52.4 [41.7, 63.8] (7†) 59.3 [56.1, 60.9] (1†) 59.2 [45.6, 91.2] Hypertension (%) ^ N/A 57.9% (5†) 75.0% 78.6% Neuropathy (%) N/A 47.3 (5†) 62.5% 64.3%(2†) CVD (%) N/A 42.1%(4†) 62.5% 92.9% DM= diabetes mellitus. DR= diabetic retinopathy. NPDR= non-proliferative DR. PDR= proliferative DR. BMI= body mass index. HDL= high-density lipoprotein cholesterol. LDL= low-density lipoprotein cholesterol. CRP= C-reactive protein. eGFR= estimated glomerular filtration rate. CVD= cardiovascular disease. From 54 unique subjects, 2 medalist patients have different diabetic retinopathy grades in eyes. #All PDR are quiescent PDR. ^Available only in medalist patients. †Number lacking data. Group comparison was done by Kruskal–Wallis test and Chi-square test where applicable. *p < 0.05, **p < 0.01.

175 Chapter 4.2

Table S5. Up-regulated proteins in the retina from Joslin Medalist patients: protected versus nonprotected. MRPS26 28S ribosomal protein S26, mitochondrial 1.30 0.012660 TOMM20 Mitochondrial import receptor subunit TOM20 homolog 1.73 0.012660 LRG1 Leucine-rich alpha-2-glycoprotein precursor 1.60 0.012660 AGT Angiotensinogen precursor 1.43 0.012660 PTMA Putative uncharacterized protein 1.50 0.012660 HMGN1 High-mobility group nucleosome binding domain 1 2.97 0.012660 UQCRB UQCRB protein 1.43 0.013171 PCCA propionyl-Coenzyme A carboxylase, alpha polypeptide isoform b 1.51 0.013996 LOC153364 Isoform 2 of Beta-lactamase-like protein FLJ75971 1.64 0.014325 MTX1 metaxin 1 isoform 1 1.57 0.014660 RGS9 Isoform 3 of Regulator of G-protein signaling 9 1.62 0.014930 DLAT Pyruvate dehydrogenase complex component E2 1.58 0.015224 BASP1 Brain acid soluble protein 1 1.48 0.015605 IDH3B Isocitrate dehydrogenase 3, beta subunit isoform a precursor 1.77 0.015605 VAMP2 Uncharacterized protein VAMP2 1.88 0.015797 NUCB1 Nucleobindin-1 1.75 0.016661 RHOG Rho-related GTP-binding protein RhoG 0.67 0.017257 LCN1 Lipocalin-1 precursor 1.49 0.017708 VDAC2 Voltage-dependent anion-selective channel protein 2 1.62 0.017831 CEND1 Cell cycle exit and neuronal differentiation protein 1 2.08 0.017989 RGR retinal G-protein coupled receptor isoform 1 0.41 0.018884 ARPC5L Actin-related protein 2/3 complex subunit 5-like protein 0.64 0.018958 NDUFA12 13kDa differentiation-associated protein variant (Fragment) 1.58 0.019871 RPS3 40S ribosomal protein S3 0.65 0.020179 PTGDS Prostaglandin D2 synthase 21kDa 1.91 0.020489 - Transthyretin 2.66 0.020489 CLTC Isoform 2 of Clathrin heavy chain 1 1.43 0.020800 KIAA1576 Probable oxidoreductase KIAA1576 0.55 0.023567 ACO2 Aconitase 2, mitochondrial 1.40 0.023653 NDUFB11 Isoform 2 of NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 11, 1.81 0.024967 mitochondrial

176 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy

COX7A2 Uncharacterized protein COX7A2 2.24 0.025477 RAB6A Isoform 2 of Ras-related protein Rab-6A 0.81 0.025912 ACSL6 79 kDa protein 1.84 0.025912 REEP6 Receptor expression-enhancing protein 6 1.52 0.026749 ANXA1 Annexin A1 0.32 0.026843 PTBP1 Isoform 2 of Polypyrimidine tract-binding protein 1 0.63 0.028118 COX6B1 12 kDa protein 1.31 0.028230 PGM5 Isoform 2 of Phosphoglucomutase-like protein 5 0.70 0.028389 ATIC Bifunctional purine biosynthesis protein PURH 0.47 0.029383 HINT2 Histidine triad nucleotide-binding protein 2 1.70 0.029995 RAB18 Ras-related protein Rab-18 1.19 0.030402 RNF170 Isoform 5 of RING finger protein 170 0.73 0.031409 GPX3 Glutathione peroxidase 3 precursor 1.96 0.032084 IDH3G Isocitrate dehydrogenase [NAD] subunit gamma, mitochondrial 1.63 0.032084 EGFR Isoform 3 of Epidermal growth factor receptor 1.50 0.032198 NDUFA2 NADH dehydrogenase [ubiquinone] 1 alpha 1.34 0.033332 subcomplex subunit 2 VCL Isoform 2 of Vinculin 0.57 0.033481 MTPN Myotrophin 0.71 0.033527 LARS2 Probable leucyl-tRNA synthetase, mitochondrial 1.31 0.033827 ATP5L ATP synthase subunit g, mitochondrial 1.44 0.034143 FHL1 Four and a half LIM domains 1 0.56 0.034253 Chapter 4.2 BCL2L13 35 kDa protein 1.58 0.034253 UBC;UBB;RPS27A 79 kDa protein 1.69 0.034808 SELENBP1 54 kDa protein 0.56 0.034971 ACOX1 Isoform 2 of Peroxisomal acyl-coenzyme A oxidase 1 1.35 0.035440 FECH Ferrochelatase, mitochondrial precursor 1.46 0.036936 COX5B Cytochrome c oxidase subunit 5B, mitochondrial precursor 1.45 0.037093 LAP3 Isoform 2 of Cytosol aminopeptidase 0.66 0.038166 TPT1 Translationally-controlled tumor protein 0.67 0.038525 PRPF19 Pre-mRNA-processing factor 19 1.28 0.038765 TOMM70A Mitochondrial precursor proteins import receptor 1.53 0.038765 MSN Uncharacterized protein MSN (Fragment) 0.53 0.039126 COX4I1 Cytochrome c oxidase subunit 4 isoform 1, mitochondrial precursor 1.57 0.039247

177 Chapter 4.2

GFM1 66 kDa protein 1.34 0.039857 NDUFA13 cell death-regulatory protein GRIM19 1.62 0.040425 GDPD1 Isoform 2 of Glycerophosphodiester phosphodiesterase 1.49 0.042808 domain-containing protein 1 PTGES2 Prostaglandin E synthase 2 1.56 0.044033 MARCKS Myristoylated alanine-rich C-kinase substrate 1.60 0.044033 GSN Isoform 1 of Gelsolin precursor 0.62 0.044293 CNDP2 Cytosolic non-specific dipeptidase 0.68 0.044293 GOT2 Aspartate aminotransferase, mitochondrial precursor 1.60 0.044423 RBP3 Interphotoreceptor retinoid-binding protein precursor 1.61 0.044423 MXRA7 Isoform 3 of Matrix-remodeling-associated protein 7 1.65 0.045588 SPCS2 hypothetical protein 0.69 0.046530 LYPLA1 Isoform 2 of Acyl-protein thioesterase 1 1.32 0.047223 NDUFB4 Putative uncharacterized protein (Fragment) 1.42 0.047706 BCAM basal cell adhesion molecule isoform 2 precursor 0.69 0.047779 BCS1L Mitochondrial chaperone BCS1 1.20 0.047968 COL3A1 Isoform 1 of Collagen alpha-1(III) chain 1.13 0.047968 PDCD5 Programmed cell death protein 5 1.13 0.047968 PCDH1 protocadherin 1 isoform 1 precursor 1.20 0.047968 TST Thiosulfate sulfurtransferase 1.20 0.047968 RHOT1 ras homolog gene family, member T1 isoform 2 1.20 0.047968 CCDC47 Isoform 2 of Coiled-coil domain-containing protein 47 1.13 0.047968 HSPA4L cDNA FLJ55529, highly similar to Heat shock 70 kDa protein 4L 1.13 0.047968 RABL4 Protein 1.13 0.047968 SNRPD1 16 kDa protein 1.53 0.047968 IPIr00871555 1.27 0.047968 GAA acid alpha-glucosidase preproprotein 1.24 0.048058 EIF3D Eukaryotic translation initiation factor 3 subunit D 1.17 0.048406 SEPT4 cDNA FLJ55761, highly similar to Septin-4 1.17 0.048406 DNAJA1 DnaJ homolog subfamily A member 1 1.30 0.048406 LETM1 Leucine zipper-EF-hand-containing transmembrane protein 1, mitochondrial 1.33 0.048406 precursor SLC4A7 Isoform 3 of Sodium bicarbonate cotransporter 3 1.37 0.048406 TRIM36 Tripartite motif-containing protein 36 1.17 0.048406 MLF2 Myeloid leukemia factor 2 1.17 0.048406

178 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy

M6PR Cation-dependent mannose-6-phosphate receptor 1.33 0.048406 - 22 kDa protein 1.17 0.048406 TMEM109 Transmembrane protein 109 precursor 1.37 0.048406 MAP4 Isoform 3 of Microtubule-associated protein 4 1.17 0.048406 PCNP Isoform 2 of PEST proteolytic signal-containing nuclear protein 1.23 0.048406 TXNDC10 Isoform 1 of Protein disulfide-isomerase TXNDC10 1.17 0.048406 UBQLN1 Isoform 1 of Ubiquilin-1 1.40 0.048406 CHMP5 Charged multivesicular body protein 5 1.20 0.048406 LOC255374 Beta-lactamase-like protein LOC255374 1.37 0.048406 PCP2 Purkinje cell protein 2 homolog 1.47 0.048406 H2AFZ Histone H2A.Z 1.27 0.048406 FABP3 Fatty acid-binding protein, heart 1.30 0.048406 CRYBA2 Beta-crystallin A2 1.17 0.048406 FRZB Secreted frizzled-related protein 3 1.47 0.048406 LSM4 U6 snRNA-associated Sm-like protein LSm4 1.27 0.048406 CHMP6 Charged multivesicular body protein 6 1.40 0.048406 RGS9BP Regulator of G-protein signaling 9-binding protein 1.27 0.048406 IPI00396023 1.27 0.048406 PPME1 Isoform 3 of Protein phosphatase methylesterase 1 1.20 0.048406 ATP6V1H Isoform 2 of Vacuolar proton pump subunit H 1.27 0.048406 MAP6 Isoform 1 of Microtubule-associated protein 6 1.43 0.048406 Chapter 4.2 TCEAL3 Transcription elongation factor A protein-like 3 1.50 0.048406 CPLX3 Complexin-3 1.33 0.048406 TARS2 Threonyl-tRNA synthetase, mitochondrial 1.20 0.048406 SURF4 Surfeit 4 1.23 0.048406 SNRPC Small nuclear ribonucleoprotein polypeptide C 1.57 0.048406 PPIH Peptidyl-prolyl cis-trans isomerase 1.27 0.048406 CTPS2 CTP synthase 2 1.23 0.048406 TIMM50 Isoform 1 of Mitochondrial import inner membrane translocase subunit TIM50 1.30 0.048406 LOC650883 similar to KIAA1990 protein 1.17 0.048406 INSR insulin receptor isoform Short precursor 1.23 0.048406 GAP43 24 kDa protein 1.17 0.048406 PNPLA6 Isoform 1 of Neuropathy target esterase 1.20 0.048406 SLC25A36 Isoform 3 of Solute carrier family 25 member 36 1.20 0.048406 - PC1/MRPS28 fusion protein 1.23 0.048406

179 Chapter 4.2

PTPRZ1 265 kDa protein 1.33 0.048406 - cDNA FLJ60514, highly similar to Fructosamine-3-kinase 1.37 0.048406 TNR Isoform 2 of Tenascin-R precursor 1.48 0.049596 NSDHL Sterol-4-alpha-carboxylate 3-dehydrogenase, decarboxylating 1.22 0.049715 CLSTN1 Isoform 1 of Calsyntenin-1 precursor (Fragment) 1.45 0.049969 PODXL podocalyxin-like isoform 1 precursor 1.35 0.049969 CCDC90B Isoform 2 of Coiled-coil domain-containing protein 90B, mitochondrial 1.46 0.049969 Joslin medalist patients with no-mild NPDR (n=6, Protected) vs. PDR (n=11, Non-protected). Values are expressed as fold change and p value was calculated using Mann–Whitney U test. The data are sorted by P value using p<0.05 cut off.

Table S6. Up-regulated proteins in the vitreous from Joslin Medalist patients: protected versus nonprotected. B3GNT1 N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase 1.92 0.01921 GLOD4 Isoform 2 of Glyoxalase domain-containing protein 4 1.63 0.02093 BTD Uncharacterized protein BTD (Fragment) 1.59 0.02210 FGB Fibrinogen beta chain precursor 1.93 0.02564 LGALS3BP Galectin-3-binding protein precursor 1.28 0.02878 COL18A1 Isoform 2 of Collagen alpha-1(XVIII) chain precursor 1.62 0.02945 NRCAM Isoform 3 of Neuronal cell adhesion molecule precursor 1.98 0.02945 hCG_1983058 hypothetical protein LOC644820 1.42 0.03186 SOD3 Extracellular superoxide dismutase [Cu-Zn] precursor 2.06 0.03252 APLP1 amyloid precursor-like protein 1 isoform 1 precursor 2.02 0.03321 CUTA Isoform B of Protein CutA precursor 1.31 0.03384 SH3BGRL 13 kDa protein 1.27 0.03384 PLG Plasminogen precursor 0.53 0.03425 A2M Alpha-2-macroglobulin precursor 1.71 0.03481 FCGBP IgGFc-binding protein precursor 2.98 0.03757 LRP2 Low-density lipoprotein receptor-related protein 2 precursor 1.75 0.03943 OAF Out at first protein homolog precursor 2.13 0.03943 ANP32A ANP32A protein (Fragment) 1.92 0.03943 HNRNPD HNRPD protein 1.99 0.03943 DPYSL3 Dihydropyrimidinase-related protein 3 2.37 0.03943 TIMP2 22 kDa protein 1.37 0.04203 CLEC3B Putative uncharacterized protein DKFZp686H17246 0.51 0.04209 ACP1 Acid phosphatase 1, soluble 1.49 0.04219 PPP1R7 Isoform 1 of Protein phosphatase 1 regulatory subunit 7 1.29 0.04258 HDHD2 Isoform 1 of Haloacid dehalogenase-like hydrolase domain-containing protein 2 1.43 0.04258 ATP6V1E1 Vacuolar proton pump subunit E 1 1.83 0.04281 TNR Isoform 2 of Tenascin-R precursor 1.54 0.04281 EIF4A2 Isoform 1 of Eukaryotic initiation factor 4A-II 1.97 0.04283 TKT Transketolase variant (Fragment) 2.54 0.04283 NCAM1 neural cell adhesion molecule 1 isoform 2 1.39 0.04523

180 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy

MAT2B Isoform 1 of Methionine adenosyltransferase 2 subunit beta 1.13 0.04797 NSF Vesicle-fusing ATPase 1.13 0.04797 C6orf108 c-Myc-responsive protein Rcl 1.27 0.04797 PURA Transcriptional activator protein Pur-alpha 1.20 0.04797 GALM Aldose 1-epimerase 1.33 0.04797 COPS8 COP9 signalosome subunit 8 isoform 2 1.20 0.04797 GNB3 GNB3 protein 1.47 0.04797 PSMD1 Isoform 2 of 26S proteasome non-ATPase regulatory subunit 1 1.33 0.04797 MYH10 Isoform 2 of Myosin-10 1.13 0.04797 CACYBP cDNA FLJ36106 fis, clone TESTI2021531, highly similar to Calcyclin-binding 1.33 0.04797 protein PSMA4 26 kDa protein 1.20 0.04797 PTPRZ1 265 kDa protein 1.20 0.04797 SEPT7 Putative uncharacterized protein DKFZp586I031 1.13 0.04797 CLIC5;LOC100131610 chloride intracellular channel 5 isoform a 1.13 0.04797 ACTR2 Actin-related protein 2 1.23 0.04841 LANCL1 LanC-like protein 1 1.17 0.04841 HDGFRP3 Hepatoma-derived growth factor-related protein 3 1.30 0.04841 ATP6V1B2 Vacuolar ATP synthase subunit B, brain isoform 1.30 0.04841 PTPLAD1 Protein tyrosine phosphatase-like protein PTPLAD1 1.17 0.04841 NAPA Alpha-soluble NSF attachment protein 1.23 0.04841 CTSL1 Cathepsin L1 precursor 1.20 0.04841 Chapter 4.2 UNC119 Isoform A of Protein unc-119 homolog A 1.40 0.04841 SEZ6L2 Isoform 3 of Seizure 6-like protein 2 1.17 0.04841 NDRG1 Protein NDRG1 1.33 0.04841 USO1 Putative uncharacterized protein DKFZp451D234 1.37 0.04841 FDPS Farnesyl diphosphate synthase 1.23 0.04841 LXN Latexin 1.27 0.04841 HEBP1 Heme-binding protein 1 1.23 0.04841 SFRS1 Isoform ASF-1 of Splicing factor, arginine/serine-rich 1 1.40 0.04841 APRT Adenine phosphoribosyltransferase 1.23 0.04841 PSMA2 Proteasome subunit alpha type-2 1.30 0.04841 CALB1 Calbindin 1.33 0.04841

181 Chapter 4.2

SERPINA7 Thyroxine-binding globulin 1.47 0.04841 BLVRA Biliverdin reductase A precursor 1.47 0.04841 NONO Non-POU domain-containing octamer-binding protein 1.53 0.04841 XPOT Exportin-T 1.23 0.04841 TARS Threonyl-tRNA synthetase, cytoplasmic 1.27 0.04841 ACLY ATP citrate lyase isoform 2 1.23 0.04841 PPME1 Isoform 3 of Protein phosphatase methylesterase 1 1.17 0.04841 AP1B1 Isoform B of AP-1 complex subunit beta-1 1.23 0.04841 MAP2 Isoform 3 of Microtubule-associated protein 2 1.37 0.04841 FLNB Filamin B 1.30 0.04841 PSMD13 HSPC027 1.20 0.04841 PGM2 Phosphoglucomutase-2 1.47 0.04841 TPP2 Tripeptidyl peptidase II 1.53 0.04841 ANP32E Acidic 1.47 0.04841 HNRNPU cDNA FLJ54020, highly similar to Heterogeneous nuclear ribonucleoprotein U 2.07 0.04841 PACSIN1 Protein kinase C and casein kinase substrate in neurons 1 1.30 0.04841 PHYHIPL Isoform 2 of Phytanoyl-CoA hydroxylase-interacting protein-like 1.23 0.04841 SUB1 LOC533984 protein 1.40 0.04841 EIF3B Isoform 2 of Eukaryotic translation initiation factor 3 subunit B 1.17 0.04841 FAM169A Isoform 1 of UPF0611 protein FAM169A 1.23 0.04841 LOC652147 hypothetical protein, partial 1.17 0.04841 GARS Glycyl-tRNA synthetase 1.27 0.04841 KTN1 kinectin 1 isoform b 1.33 0.04841 IGLV1-40 V1-13 protein (Fragment) 1.30 0.04841 SNX3 Isoform 1 of Sorting nexin-3 1.17 0.04841 TXNL1 hypothetical protein LOC509142 1.30 0.04841 ANP32B 29 kDa protein 1.23 0.04841 PGM1 65 kDa protein 1.20 0.04841 GNB2L1 Guanine nucleotide-binding protein subunit beta-2-like 1 1.23 0.04841 KHSRP Isoform 2 of Far upstream element-binding protein 2 1.20 0.04841 AKAP12 Isoform 2 of A-kinase anchor protein 12 1.43 0.04841

ILF2 Interleukin enhancer binding factor 2 variant (Fragment) 1.23 0.04841 DNM1 Isoform 2 of Dynamin-1 1.37 0.04841 - cDNA FLJ59206, highly similar to Eukaryotic translation initiation factor 4B 1.30 0.04841 - cDNA FLJ51276, highly similar to Secretogranin-2 1.33 0.04841 SERPINI1 Neuroserpin precursor 1.58 0.04997 Joslin medalist patients with no-mild NPDR (n=6, Protected) vs. PDR (n=11, Non-protected). Values are expressed as fold change and p value was calculated using Mann–Whitney U test. The data are sorted by P value using p<0.05 cut off.

182 Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy

Table S7. Primers sequences used in reverse transcription polymerase chain reaction. Gene Primers (5’-3’) Access Number 18s F GCTTAATTTGACTCAACACGGGA NR_003278.3 R AGCTATCAATCTGTCAATCCTGTC Vegf (rat, mouse) F CTCGCAGTCCGAGCCGGAGA NM_001204384.1 R GGTGCAGCCTGGGACCACTTG Vegf (bovine) F TACCCAGATGAGATTGAGTT NM_001287044.1 R CCTTGCTTTATCTTTCTTTG Il6 (rat) F TGATGCACTGTCAGAAAACA XM_011515390.2 R ACCAGAGCAGATTTTCAATAGGC Il6 (mouse) F ACCAGAGGAAATTTTCAATAGGC NM_001314054.1 R TGATGCACTTGCAGAAAACA Il6 (bovine) F GATGACTTCTGCTTTCCCTACC XM_019959556.1 R TTGTGGCTGGAGTGGTTATTAG Glut-1 (rat) F TGATTGGTTCCTTCTCTGTGG NM_006516.2 R CCCAGGATCAGCATCTCAAAG Glut-4 (rat) F ACTGGTCCTTGCTGTATTCTC NM_001042.2 R CCAAGTTGCATTGTAGCTCTG Sglt-1 (rat) F TCCCTATTTACATCAAGGCTGG XM_011530331.1 R GGACAGAACGGAAAGGTAGATC Sglt-2 (rat) F TTCCTCACACTCGCAATCTC NM_022590.2 Chapter 4.2 R CCTCTAACTCTTCAGCATCCAG Rbp3 (retinol binding protein F AGAGCACAAGGCTGAGATGG NM_015745.2 3, interstitial) (mouse) R CTCCGAGCTGCTGGTAGAAC

183