© 2018. Published by The Company of Biologists Ltd | Development (2018) 145, dev164897. doi:10.1242/dev.164897

RESEARCH ARTICLE RPM-1 and DLK-1 regulate pioneer axon outgrowth by controlling Wnt signaling Eun Chan Park and Christopher Rongo*

ABSTRACT White et al., 1986). Conserved extracellular guidance cues, including β Axons must correctly reach their targets for proper nervous system Netrin/UNC-6, Slit/SLT-1 and TGF /UNC-129, guide the polarized function, although we do not fully understand the underlying migration of axons (Colavita et al., 1998; Garriga et al., 1993; Hao mechanism, particularly for the first ‘pioneer’ axons. In C. elegans, et al., 2001; Hedgecock et al., 1990; Ishii et al., 1992; Wadsworth, AVG is the first neuron to extend an axon along the ventral midline, 2002). However, few such cues have been identified for pioneers and this pioneer axon facilitates the proper extension and guidance of like AVG (Hutter, 2003). follower axons that comprise the ventral nerve cord. Here, we show Whereas AVG axon guidance does not depend on established that the ubiquitin ligase RPM-1 prevents the overgrowth of the AVG cues, the polarity of the AVG soma and the site of axon sprouting axon by repressing the activity of the DLK-1/p38 MAPK pathway. is regulated by the ubiquitin ligase PLR-1, which inhibits the Unlike in damaged neurons, where this pathway activates CEBP-1, surface expression of the Wnt receptors Ror/CAM-1 and Ryk/ we find that RPM-1 and the DLK-1 pathway instead regulate LIN-18 (Bhat et al., 2015; Moffat et al., 2014). Wnts are secreted the response to extracellular Wnt cues in developing AVG axons. glycoproteins that act as long-range signals in development The Wnt LIN-44 promotes the posterior growth of the AVG axon. In the (Gammons and Bienz, 2017; Loh et al., 2016). In the absence of absence of RPM-1 activity, AVG becomes responsive to a different PLR-1, the AVG neuron inappropriately responds to the Wnts Wnt, EGL-20, through a mechanism that appears to be independent CWN-1 and CWN-2, reorienting its polarity towards these anteriorly of canonical Fz-type receptors. Our results suggest that RPM-1 and expressed cues during embryogenesis (Harterink et al., 2011; the DLK-1 pathway regulate axon guidance and growth by preventing Kennerdell et al., 2009; Song et al., 2010). Unlike for AVG cell Wnt signaling crosstalk. polarity, the factors that regulate AVG anterior-posterior axon guidance remain unknown. KEY WORDS: Axon guidance, Wnt, p38 MAPK, C. elegans, RPM-1 One known regulator of anterior-posterior axon growth is RPM-1, a founding member of the Pam/Highwire/RPM-1 protein family (Grill et al., 2016; Schaefer et al., 2000). Loss of RPM-1 INTRODUCTION function results in abnormal neuronal morphology, axon overgrowth, Proper nervous system development requires that neurons extend impaired presynaptic differentiation, and internalization of postsynaptic axons to precise targets. Groups of neurons exhibit similar patterns of AMPA receptors (Opperman and Grill, 2014; Park et al., 2009; axon outgrowth depending on their spatial position and sequential Schaefer et al., 2000; Zhen et al., 2000). RPM-1 is a signaling hub timing during development. Growing ‘pioneer’ axons often blaze with multiple protein-protein interaction domains. RPM-1 binds the pathways through the nervous system, with ‘follower’ axons extending F-box protein FSN-1, and together they act as a ubiquitin ligase to along these pathways using the pioneers as a guide (Chitnis and target the DLK-1 MAPKKK for degradation (Liao et al., 2004; Kuwada, 1991; Hidalgo and Brand, 1997; Hutter, 2003; Klose and Nakata et al., 2005). In the absence of RPM-1, stabilized DLK-1 Bentley, 1989; McConnell et al., 1989). Extracellular signals act as acts through the MAPKK MKK-4 and the p38 MAPK PMK-3 to guidance cues for growing axons, yet how the nervous system activate the translation of the transcription factor CEBP-1 (Yan employs a small number of guidance cues over a vast array of neuron et al., 2009). This MAP kinase pathway, which is activated in types and developmental time points remains poorly understood response to damage, promotes axon regeneration; however, its role (Kaplan et al., 2014; Morales and Kania, 2017; Petrovic and in normal axon outgrowth is unclear. RPM-1 has a role in normal Schmucker, 2015). Modulation of the signal transduction pathways axon growth, as rpm-1 mutants have PLM mechanosensory neurons downstream of these guidance cues might provide one explanation for with overgrown axons and DA/DB motor neurons with dorsal- how the same cues are used in multiple contexts. ventral axon guidance defects (Li et al., 2008; Schaefer et al., 2000). In the nematode Caenorhabditis elegans, one well-studied RPM-1 regulates these axons by reducing the surface levels of pioneer neuron is AVG. The AVG soma is in the retrovesicular Robo/SAX-3 and UNC-5 guidance receptors (Li et al., 2008). This ganglion, is the first neuron to extend an axon along the ventral function is not mediated through FSN-1 or the DLK-1 MAP kinase midline, and is required for the guidance of the follower axons cascade; rather, RPM-1 separately binds to the Rab GEF GLO-4, that comprise the ventral nerve cord (Durbin, 1987; Hutter, 2003; which activates the Rab GLO-1 to regulate axon guidance and outgrowth (Grill et al., 2007; Li et al., 2008). Here, we reveal a new function for RPM-1: guidance and growth The Waksman Institute, Department of Genetics, Rutgers The State University of New Jersey, Piscataway, NJ 08854, USA. of the AVG pioneer axon through regulation of Wnt signaling crosstalk. Normally, AVG makes specific turns in the posterior and *Author for correspondence ([email protected]) arrests growth at the lumbar ganglion. In the absence of RPM-1, E.C.P., 0000-0002-6147-4088; C.R., 0000-0002-1361-5288 AVG overgrows past the lumbar ganglion and into the tip of the tail. AVG overgrowth in rpm-1 mutants is not mediated through GLO-4,

Received 22 February 2018; Accepted 27 July 2018 but through the overactivation of the DLK-1/p38 MAPK pathway. DEVELOPMENT

1 RESEARCH ARTICLE Development (2018) 145, dev164897. doi:10.1242/dev.164897

Surprisingly, the downstream target of this pathway, CEBP-1, is not required. Instead, the Wnt LIN-44 and its Fz-type receptor LIN-17 promote posterior growth of the AVG axon, and in loss-of-function rpm-1 mutants, AVG responds to an additional Wnt ligand, EGL- 20, resulting in overgrowth. Our results indicate that RPM-1 inhibits AVG axon growth by modulating Wnt/Fz signaling, controlling the timing and specificity of ligand/receptor sensitivity.

RESULTS RPM-1 and DLK-1 signaling regulates AVG axon outgrowth To analyze AVG axon growth, we examined kyIs51[Podr-2b::GFP] and otIs182[Pinx-18::GFP] transgenic animals, both of which express GFP in AVG and a handful of other neurons (Chou et al., 2001; Sarin et al., 2009). In wild type, AVG extends its axon during embryogenesis (Durbin, 1987). By the L1 larval stage, its axon has extended beyond the end of the intestine and preanal ganglion, exited the ventral midline, and migrated dorsally towards the dorsorectal ganglion (Fig. 1A). When AVG reaches the DVA soma in the dorsorectal ganglion, it then turns and migrates posteriorly to the end of the lumbar ganglion before stopping (Fig. 1B-G). The cues for this guidance are unknown. We previously identified alleles of rpm-1 in a screen for mutants with defective GLR-1 synaptic localization (Park et al., 2009). GLR-1 is expressed in AVG, and we noticed that rpm-1 mutants expressing GLR-1::GFP had an elongated axon that extended to the posterior tip of the tail (Fig. 1H,I). We classified animals based on whether AVG terminated growth at the preanal ganglion or dorsal rectal ganglion (indicative of undergrowth), the lumbar ganglion (the normal termination point in wild type), or the most posterior tip of the tail (indicative of overgrowth) (Fig. 1J). All rpm-1 mutants have AVG axons that overgrow to the tail tip. Expression of a wild-type rpm-1 cDNA from the glr-1 promoter, which is expressed in AVG and a handful of other interneurons (Hart et al., 1995; Maricq et al., 1995), restored normal AVG migration in these mutants (Fig. 1J). To characterize AVG axon guidance more thoroughly, we introduced kyIs51 into rpm-1(ok364) deletion (molecular null) mutants (Chou et al., 2001). We used DAPI staining to visualize neuronal and hypodermal nuclei in the tail, using conditions that Fig. 1. RPM-1 prevents AVG axon posterior overgrowth. (A) Diagram of the C. elegans posterior, including the position of neuron cell bodies (circles) for preserved GFP fluorescence. Unlike in wild type, the AVG axon in the preanal ganglion (dark blue), dorsorectal ganglion (light blue) and lumbar rpm-1(ok364) null mutants extends posteriorly to the tail tip ganglion (gray). The secretion of Wnt/LIN-44 from the tail hypodermis is (Fig. 2A-C), similar to what we observed in rpm-1(od14) mutants indicated by red shading. The green line indicates the wild-type AVG after the expressing GLR-1::GFP. Interestingly, we often observed the AVG completion of growth and guidance during embryogenesis. (B-G) L4-stage axon making a U-turn and migrating anteriorly back along the same nematodes expressing GFP in the AVG axon (arrow) (B,E) and DsRed2 in the ventral midline. Taken together, these results indicate that RPM-1 dorsorectal ganglion (C,F) from the indicated transgenes. Images in B-D and E-G are from slightly different focal planes to allow the separate visualization of acts cell autonomously to stop AVG axon migration. the DVA, DVB and DVC neuron cell bodies (arrows). (D,G) DIC image. RPM-1 regulates mechanosensory axon guidance by binding to (H,I) GLR-1::GFP in wild type (H) and rpm-1(od14) mutants (I) in the PVC the Rab GLO-1 and its GEF GLO-4 (Grill et al., 2007; Li et al., neuron cell body and the AVG axon (arrows). (J) Percentage of animals with 2008). We did not observe axon overgrowth in either glo-1 or glo-4 the indicated AVG axon guidance phenotype. Red bars indicate animals in mutants (Fig. 2C). RPM-1 also acts as an ubiquitin ligase through its which the AVG axon is overgrown to the tail tip. Gray bars indicate animals in binding to the F-box protein FSN-1 (Liao et al., 2004; Nakata et al., which the AVG axon stops growth in the lumbar ganglion (the wild-type phenotype). Light blue bars indicate animals in which the AVG axon stops at 2005). We noted that fsn-1 mutants have a similar overgrowth the dorsorectal ganglion. ****P<0.0001, Kruskal–Wallis/Dunn’s correction phenotype to that of rpm-1 mutants (Fig. 2C), suggesting that the compared with wild type. ####P<0.0001, Kruskal–Wallis/Dunn’s correction ubiquitin ligase function of RPM-1 regulates AVG growth. compared with rpm-1 mutants. n=50 animals/genotype. Scale bars: 20 μm. RPM-1 and FSN-1 ubiquitylate the MAPKKK DLK-1, thereby inhibiting DLK/p38 MAPK signaling. Although loss-of-function mutations in dlk-1, mkk-4 and pmk-3 alone had no effect on AVG and promoting the translation and activity of the transcription factor axon outgrowth, mutations in any of these genes suppressed the CEBP-1 (Yan et al., 2009). Surprisingly, mutations in either mak-2 rpm-1 phenotype (Fig. 2C). Moreover, overexpression of a or cebp-1 did not suppress the rpm-1 overgrowth phenotype transgenic, wild-type dlk-1 cDNA from the glr-1 promoter in an (Fig. 2C). The DLK/p38 MAPK pathway can promote axon otherwise wild-type animal was sufficient to cause AVG axon regeneration by activating PARG-1 and PARG-2 (Byrne et al., overgrowth (Fig. 2C). RPM-1 and the DLK/p38 MAPK cascade 2016). We found that mutations in parg-1 and parg-2 did not result regulate presynaptic differentiation by activating the kinase MAK-2 in AVG axon growth defects and did not suppress axon overgrowth DEVELOPMENT

2 RESEARCH ARTICLE Development (2018) 145, dev164897. doi:10.1242/dev.164897

Fig. 2. RPM-1 regulates AVG axon growth through DLK-1/ p38 MAPK signaling. (A,B) Wild-type (A) and rpm-1 mutant (B) L4-stage nematodes expressing GFP in the AVG axon (yellow), with nuclei stained for DAPI (blue). The arrow points to a second fiber: the AVG axon making its U-turn. (C,D) Percentage of animals with the indicated phenotype. Red bars indicate animals in which the AVG axon is overgrowth to the tail tip. Gray bars indicate animals in which the AVG axon stops growth in the lumbar ganglion (the wild-type phenotype). Light blue bars indicate animals in which the AVG axon stops at the dorsorectal ganglion. Dark blue bars indicate animals in which the AVG axon stops at the preanal ganglion. ***P<0.001, ****P<0.0001, Kruskal– Wallis/Dunn’s correction compared with wild type. ####P<0.0001, Kruskal–Wallis/Dunn’s correction compared with rpm-1 mutants or for the indicated comparison. n=50 animals/genotype. Scale bars: 20 μm.

in rpm-1 mutants (Fig. 2D). Finally, DLK MAP kinase signaling can UNC-5 (Li et al., 2008; Tulgren et al., 2014). However, AVG axon promote endocytosis through activation of the small GTPase RAB-5 growth is normal in 98% of unc-5(e53) and 96% of unc-6(ev400) (Park et al., 2009; van der Vaart et al., 2015). Although expression of mutants (n=50 animals for each genotype). A better candidate a constitutively active RAB-5 mutant protein mimics the effects of guidance cue is the Wnt LIN-44, which is expressed and secreted rpm-1 mutations on GLR-1 recycling, it does not mimic the AVG (Fig. 1A) from hypodermal cells in the tail of comma-stage embryos axon overgrowth phenotype (Fig. 1J). Similarly, although expression and larva (Harterink et al., 2011; Herman et al., 1995; Klassen and of a dominant-negative, GDP-locked mutant form of RAB-5 can Shen, 2007). We examined lin-44(n1792) loss-of-function (null) suppress the effects of rpm-1 on GLR-1 recycling, the same mutants and observed that 96% of mutant animals had AVG axons transgene does not suppress the AVG axon overgrowth phenotype of that terminated prematurely at either the preanal ganglion (Fig. 3A) or rpm-1 (Fig. 1J). Thus, RPM-1 prevents AVG axons from the dorsal rectal ganglion (Fig. 3B). A wild-type Plin-44::gfp::lin-44 overgrowing by repressing DLK/p38 MAPK signaling that transgene robustly rescued the defects of lin-44 mutants (Fig. 3F). otherwise would promote axon growth by a novel mechanism. The Wnt EGL-20 is expressed near the rectum in comma-stage Mutants for the cytoskeleton regulators NAV2/UNC-53 and embryos and larva, where it also could act as a guidance cue Trio/UNC-73 have AVG axons that show some midline-crossing (Harterink et al., 2011; Herman et al., 1995; Klassen and Shen, 2007). defects (Bhat et al., 2015). We found that a small number of unc- We examined egl-20(n585) mutants but observed wild-type AVG 53(e2432) and unc-73(ev801) mutants terminated AVG axon axon growth (Fig. 3F). Taken together, our results suggest that Wnt growth prematurely, either at the dorsal rectal ganglion or the end LIN-44 acts as a distal attractive cue for the AVG axons to migrate of the preanal ganglion (Fig. 2D). Mutations in unc-53 strongly beyond the preanal ganglion. suppressed axon overgrowth in rpm-1, whereas unc-73 mutations showed only mild suppression (Fig. 2D), suggesting that the The Fz receptor LIN-17 acts cell-autonomously to promote overgrowth observed in rpm-1 mutants requires UNC-53. AVG axon outgrowth Wnts regulate axon guidance through either Frizzled (Fz) receptors Wnt/LIN-44 signaling promotes AVG axon outgrowth or Ryk/Derailed receptors (Ackley, 2014; Onishi et al., 2014; Wang RPM-1 regulates the growth of some axons by regulating the et al., 2016). The Wnt LIN-44 acts as a repulsive cue through Fz signaling of guidance cues such as Netrin/UNC-6 and its receptor LIN-17 in D-type motor neurons (Maro et al., 2009; Sawa et al., 1996). DEVELOPMENT

3 RESEARCH ARTICLE Development (2018) 145, dev164897. doi:10.1242/dev.164897

Fig. 3. Wnt/LIN-44 signaling promotes AVG axon outgrowth. (A,B) L4-stage mutants for lin-44 expressing GFP in the AVG axon (yellow), with nuclei stained for DAPI (blue), arrest growth at either the preanal ganglion (A) or the dorsorectal ganglion (B). (C) L4-stage mutant for lin-17 expressing GFP in the AVG axon (yellow), with nuclei stained for DAPI (blue). (D,E) LIN-17::GFP is localized to the growing axon tip of AVG (arrow). (F) Percentage of animals with the indicated phenotype. ****P<0.0001, Kruskal–Wallis/Dunn’s correction compared with wild type. ####P<0.0001, Kruskal– Wallis/Dunn’s correction compared with lin-44 or lin-17 mutants. n=50 animals/genotype. Scale bars: 20 μm.

We examined lin-17(n671) loss-of-function (null) mutants and has three Dsh proteins: DSH-1, DSH-2 and MIG-5. Unlike in found that AVG terminated growth at the preanal ganglion D-type neurons, AVG axon guidance is, based on statistical (Fig. 3C,F). We generated transgenes, Pglr-1::LIN-17 and Podr-2b:: significance, normal in mig-5(rh94) mutants (Fig. 4A). By LIN-17, that express wild-type LIN-17 cDNA in AVG, introduced contrast, the AVG axon terminates at the preanal ganglion in these transgenes into lin-17 mutants, and found that they robustly most dsh-1(ok1445) and dsh-2(ok2162) loss-of-function (null) restored AVG axon growth, indicating that LIN-17 acts cell- mutants (Fig. 4A). In canonical Wnt signaling, Dsh sequesters a autonomously in AVG to promote posterior axon growth (Fig. 3F). destruction complex, including the kinase GSK3 and the We also generated Pglr-1::LIN-17::GFP, which expressed a tagged scaffolding molecule Axin, thereby preventing it from targeting receptor that localized to the posterior axonal growth cone of AVG β-catenin for proteolysis. Surprisingly, AVG axon growth looked (Fig. 3D,E), consistent with LIN-17 functioning as a sensor of statistically normal in gsk-3(nr2047), pry-1(mu38), axl-1(tm1095) axon guidance cues. and apr-1(ok2970) loss-of-function (null) mutants (Fig. 4A). There are three additional Fz-type receptors (MIG-1, MOM-5 Thus, whereas Dsh is required for AVG axon guidance, the and CFZ-2) in C. elegans (Gleason et al., 2006; Pan et al., 2006; destruction complex – the key inhibitor of β-catenin – is not. Zinovyeva and Forrester, 2005). We observed premature AVG axon Is β-catenin even required for AVG axon outgrowth? We expected termination at the dorsal rectal ganglion in about one-third of mig- that loss-of-function β-catenin mutants would show the same early 1(e1787) mutants, whereas we observed no statistically significant termination of AVG growth as loss-of-function lin-44 and lin-17 defects in mom-5(gk812) or cfz-2(ok1201) mutants (Fig. 3F). We mutants. C. elegans has four different β-catenin orthologs (BAR-1, conclude that initial AVG axon outgrowth from its anterior soma WRM-1, HMP-2 and SYS-1) with separable functions (Korswagen along the ventral midline does not require Wnt/Fz signaling, but the et al., 2000). Unlike in D-type neurons, AVG axon guidance is Fz-type receptor LIN-17 and (to some degree) the Fz-type receptor statistically normal in bar-1(ga80) loss-of-function (null) mutants MIG-1 promote the AVG axon to grow past the preanal ganglion (Fig. 4B). Whereas transgenic animals that overexpress wild-type and into the tail. BAR-1 show synaptic defects in AVG and other command interneurons (Dreier et al., 2005), they have normal AVG axon Atypical Wnt signaling promotes AVG axon outgrowth via guidance (Fig. 4B). Null mutants for sys-1 are embryonic lethal, TCF/POP-1 precluding analysis of AVG; however, the partial loss-of-function The Wnt LIN-44 is a repulsive cue for the D-type motor neurons mutation sys-1(q544) results in viable homozygous animals with through the downstream effectors Dsh/MIG-5, GSK-3, Axin/PRY- reduced Wnt signaling (Kidd et al., 2005; Miskowski et al., 2001).

1, β-catenin/BAR-1 and TCF/POP-1 (Maro et al., 2009). C. elegans We observed weakly penetrant defects in AVG guidance in DEVELOPMENT

4 RESEARCH ARTICLE Development (2018) 145, dev164897. doi:10.1242/dev.164897

Fig. 4. Atypical Wnt signaling promotes AVG axon outgrowth via TCF/POP-1. (A-D) Percentage of L4-stage animals with the indicated phenotype. *P<0.05, ****P<0.0001, Kruskal–Wallis/Dunn’s correction compared with wild type. ##P<0.01, ####P<0.0001, Kruskal–Wallis/Dunn’s correction compared with hmp-2 mutants (C) or pop-1 mutants (D). n=50 animals/genotype.

sys-1(q544) single mutants and sys-1(q544) bar-1(ga80) double hmp-2(qm39) and either lin-44(n1792), lin-17(n671) or dsh- mutants (Fig. 4B). Null mutants for wrm-1 are also embryonic lethal, 1(ok1445). All three of these double mutant combinations although wrm-1(ne1982) mutants are viable and show a temperature- resulted in early termination of AVG axon growth at the preanal sensitive embryonic-lethal phenotype (Nakamura et al., 2005; ganglion, suggesting that lin-44, lin-17 and dsh-1 are epistatic to Wu and Herman, 2006). We examined wrm-1(ne1982) mutants at hmp-2 (Fig. 4C). One explanation for why hmp-2 mutants have (20°C), an intermediate temperature that results in embryonic axon overgrowth defects could be that AVG axon guidance is lethality for some but not all animals, but we did not observe AVG sensitive to cadherin/catenin adhesion; however, AVG axon growth axon guidance defects that were statistically significant (Fig. 4B). appears normal in mutants for hmp-1, which encodes α-catenin WRM-1 is an atypical β-catenin that functions as a regulatory (Lockwood et al., 2008; Fig. 4C). Our results suggest that HMP-2 subunit of the LIT-1 MAPK (Rocheleau et al., 1999; Yang et al., inhibits AVG axon overgrowth, but does so not as a β-catenin 2015). We examined lit-1(or131) partial loss-of-function mutants effector acting downstream of Wnt/LIN-44 and Fz/LIN-17, or as at 20°C but did not observe AVG axon guidance defects (Fig. 4B). part of a cadherin/catenin adhesion complex. As sys-1 and wrm-1 mutants are embryonic lethal, and given that Canonical Wnt signaling also acts through TCF, which forms a AVG axon guidance occurs during embryogenesis, we have not complex with β-catenin, binding specific sites in DNA to regulate been able to examine the sys-1 and wrm-1 temperature-sensitive transcription (Gammons and Bienz, 2017; Loh et al., 2016). mutations at the most restrictive temperature. Cell-specific RNAi C. elegans has a single TCF gene called pop-1 (Lin et al., 1998, (Esposito et al., 2007) against sys-1 or wrm-1 also only resulted in 1995; Rocheleau et al., 1997). We examined AVG in two different weakly penetrant AVG axon defects (Fig. S1A). mutants: pop-1(hu9) and pop-1(q645) (Korswagen et al., 2002; In C. elegans, HMP-2 is the sole β-catenin that interacts with the Siegfried and Kimble, 2002). AVG stops early at either the preanal α-catenin HMP-1 and the cadherin HMR-1 at adherens junctions ganglion or the dorsal rectal ganglion in both mutants (Fig. 4D). We (Costa et al., 1998; Korswagen et al., 2000; Natarajan et al., 2001). generated a transgene, Podr-2b::LIN-17, that expresses wild-type Surprisingly, hmp-2(qm39) partial loss-of-function mutants showed POP-1 cDNA in AVG, introduced it into pop-1 mutants, and found overgrowth of the AVG axon past the lumbar ganglion and into the that it robustly restored AVG axon growth, indicating that POP-1 tail tip (Fig. 4C), the opposite phenotype that would be expected if acts cell-autonomously in AVG to promote posterior axon growth. HMP-2 were a canonical β-catenin effector of this pathway. If Wnt Overexpression of either mammalian TCF or its C. elegans ortholog LIN-44 and Fz LIN-17 signaling were transduced through HMP-2 POP-1 lacking the amino-terminal β-catenin interaction domain in AVG, then hmp-2 mutations should be epistatic to lin-44, lin-17 results in a potent dominant-negative phenotype (Clevers and van and dsh-1/2 mutations. We examined double mutants between de Wetering, 1997; Korswagen et al., 2000; Molenaar et al., 1996). DEVELOPMENT

5 RESEARCH ARTICLE Development (2018) 145, dev164897. doi:10.1242/dev.164897

Thus, we also generated a transgene containing dominant-negative POP-1 (ΔN-POP-1) lacking the first 44 amino acids and expressed from the glr-1 promoter. Transgenic animals show an AVG axon growth arrest (Fig. 4D). We introduced the pop-1(q645) mutation into hmp-2(qm39) mutants and found that AVG axons stop early in their migration in pop-1 hmp-2 double mutants (Fig. 4C). Taken together, POP-1 acts in AVG to promote axon outgrowth, although whether it requires a β-catenin co-activator remains unclear.

RPM-1 regulates AVG sensitivity to specific Wnts If Wnt/LIN-44 promotes posterior AVG axon growth past the preanal ganglion, then RPM-1 might prevent overgrowth by inhibiting Wnt signaling. To test this hypothesis, we generated lin-44(n1792) rpm-1(ok364) double mutants. Like in wild type (Fig. 5A,B), the AVG axon in rpm-1 single mutants grows past the preanal ganglion, turns up through the dorsal rectal ganglia, and migrates through the lumbar ganglion (Fig. 5C). Unlike in wild type, the axon in rpm-1 mutants then continues to grow past the lumbar ganglion to the tail tip at L3 stage and beyond (Fig. 5D). By contrast, the axon in lin-44 mutants stops at the preanal ganglion in L1 (Fig. 5E) and does not turn dorsal at any subsequent stage (Fig. 5F). The AVG axon stops prematurely at the preanal ganglion in lin-44 rpm-1 double mutants in L1 larvae (Fig. 5G), like the phenotype observed in lin-44 single mutants. This arrest appears temporary, however, as AVG resumes growth and extends into the tail tip starting at the L2 stage and onward into adulthood, without turning to grow up through the dorsal rectal ganglion (Fig. 5H). Thus, the Wnt LIN-44 is required for AVG to grow dorsally after reaching the preanal ganglion, but AVG responds to other cues to grow posteriorly after a period of time if LIN-44 and RPM-1 are impaired. The Wnt EGL-20 is also expressed in the posterior of the nematode, although we did not observe defects in AVG axon growth in egl-20(n585) (Fig. 3F). We introduced egl-20(n585) mutations into animals with rpm-1(ok364) and found that these double mutants had the same axon overgrowth phenotype observed in rpm-1 single mutants (Fig. 5I). Reasoning that redundancy with LIN-44 Wnt signaling might obscure any contribution from EGL-20 Wnt signaling, we examined AVG axon growth in lin-44 egl-20 double mutants and lin-44 egl-20 rpm-1 triple mutants. Double mutants for lin-44 and egl-20 show a similar axon arrest phenotype to that observed in lin-44 single mutants even in older animals (Fig. 5I). Surprisingly, more than two-thirds of lin-44 egl-20 rpm-1 triple mutants show a similar axon arrest phenotype as in Fig. 5. RPM-1 regulates AVG sensitivity to specific Wnts. (A-H) L1-stage (A,C,E,G) or L4-stage (B,D,F,H) nematodes expressing GFP in the AVG axon lin-44 single mutants even at later stages of development (Fig. 5I). (yellow), with nuclei stained for DAPI (blue, with bracket indicating the lumbar Our data indicate that the AVG axon overgrowth observed in ganglion). Genotypes include wild type (A,B), rpm-1 mutants (C,D), lin-44 rpm-1 mutants is due to a combination of LIN-44 and EGL-20 Wnt mutants (E,F) and rpm-1 lin-44 double mutants (G,H). (I) Percentage of signaling, as well as possibly other cues given that some overgrowth animals with the indicated phenotype for each indicated genotype and remains in the triple mutant. developmental stage. *P<0.001, **P<0.0001, Kruskal–Wallis/Dunn’s # ## – AVG axon growth in egl-20 mutants is like that in wild type, and correction compared with wild type, L1 stage. P<0.05, P<0.0001, Kruskal Wallis/Dunn’s correction compared with rpm-1 mutants at L1 stage, or for the axon growth arrest is similar in lin-44 single mutants compared with indicated comparison. n=50-100 animals/genotype. Scale bars: 20 μm. lin-44 egl-20 double mutants, suggesting that normally AVG is not sensitive to the EGL-20 Wnt. However, in the absence of RPM-1 and LIN-44, the AVG neuron becomes sensitive to the EGL-20 Wnt their AVG axons arrested growth in the preanal ganglion throughout signal, as EGL-20 is required for the resumption of AVG axon development, like in lin-44 egl-20 rpm-1 triple mutants (Fig. 5I). growth observed in older larvae. One possible explanation is that Thus, our results suggest that the reactivation of growth triggered by both Wnts are able to bind and activate the Fz-type receptor LIN-17, EGL-20 in rpm-1 mutants is unlikely to be through LIN-17. with LIN-44 being the preferred ligand. We examined axon growth We also observed the AVG axon not only stopping at the preanal in lin-17 rpm-1 double mutants and found that AVG arrests growth ganglion in rpm-1 mutants that are also impaired for Wnt signaling at the preanal ganglion in L1 larvae, but then resumes growth in L2 (e.g. rpm-1 lin-44 egl-20 triple mutants), but making a U-turn at this larvae, moving to the tail tip without turning dorsally first (Fig. 5I). position and continuing growth in the anterior direction (Fig. 6A-C),

We also examined lin-17 egl-20 rpm-1 triple mutants and found that similar to the phenotype observed at the tail tip of rpm-1 single DEVELOPMENT

6 RESEARCH ARTICLE Development (2018) 145, dev164897. doi:10.1242/dev.164897

Fig. 6. RPM-1 regulates both guidance and growth of axons through disparate mechanisms. (A,B) The AVG axon grows posteriorly to the tail tip (arrow), makes a U-turn, and then grows anteriorly in rpm-1 single mutants (A) and rpm-1 lin-44 double mutants (B) (L4 stage shown). (C) L4-stage quintuple mutant for rpm-1, mig-1, lin-17, mom-5 and cfz-2. The AVG axon arrests posterior growth at the pre-anal ganglion (arrow), but then makes a U-turn and migrates anteriorly along the lateral body wall. (D) Percentage of L4-stage animals with the indicated phenotype. Black bars indicate that growth terminates without any subsequent change in direction regardless of the position of termination. Orange bars indicate that growth continues in the anterior direction after making a U-turn at either the tail tip or the preanal ganglion. ****P<0.0001, Kruskal–Wallis/Dunn’s correction compared with wild type. ####P<0.0001, Kruskal–Wallis/ Dunn’s correction compared with rpm-1 mutants. n=50 animals/genotype. Scale bars: 20 μm.

mutants. Neither the LIN-44/EGL-20 Wnt combination, nor the (lin-18), ROR (cam-1)orLRP5/6(lrp-1 and lrp-2), and none of these LIN-17 receptor, is required for this U-turn (Fig. 6D). However, mutations dramatically blocked the overgrowth defects caused by DLK/p38 MAPK signaling is required, as pmk-3 lin-17 rpm-1 triple rpm-1 mutations (Fig. 7B,C). We examined Flamingo ( fmi-1)and mutants and pmk-3 rpm-1 double mutants do not make the U-turn Vangl (vang-1) mutants, but did not observe AVG axon guidance and grow anteriorly. Triple mutants for cebp-1, lin-17 and rpm-1 defects. We were not able to examine fmi-1 rpm-1 double mutants due still make the U-turn regardless of where they arrest posterior to their close linkage. However, vang-1 mutations did not block the growth, suggesting a CEBP-1-indendent role for DLK/p38 MAPK overgrowth of AVG observed in rpm-1 mutants (Fig. 7C). We also signaling in promoting this growth. It appears that absolute axon examined combinatorial mutants for multiple Fz-type receptors, the growth and the direction of axon growth become uncoupled in non-canonical Ryk receptor lin-18,andrpm-1. Like in lin-17 rpm-1 rpm-1 mutants. double mutants, the AVG axon initially stops during L1 but then resumes growth during later larval stages (Fig. 7B). These results AVG axon overgrowth in rpm-1 mutants appears to be suggest that AVG axon overgrowth might occur in rpm-1 mutants independent of Fz-type receptors even in the absence of all known Wnt receptors. Is AVG using a different receptor to respond to EGL-20? There are Finally, we also examined whether overgrowth in rpm-1 mutants four Fz-type receptors in C. elegans: LIN-17, MIG-1, MOM-5 and is dependent on other Wnt signaling components even if it is not CFZ-2 (Gleason et al., 2006; Pan et al., 2006; Thorpe et al., 1997). dependent on the receptors. Wntless/MIG-14 promotes the release AVG grows past the dorsal rectal ganglion in about one-third of mig- of Wnts through retrograde recycling, and the secretion of most 1(e1787) mutants (Fig. 3F). Mutants for mom-5(gk812) show normal (perhaps all) Wnts is depressed in mig-14(ga62) mutants (Pan AVG axon growth, as do mutants for cfz-2(ok1201) (Fig. 3F). Unlike et al., 2008; Yang et al., 2008). AVG axons arrest prematurely in for lin-17 mutations, which can temporarily arrest AVG axon growth both mig-14 single mutants and mig-14 rpm-1 double mutants at the L1 stage when introduced into rpm-1 mutants, mutations in any throughout development (Fig. 7D). Mutations in dsh-1 or pop-1 of the other three Fz-type receptors do not dramatically prevent axon also prevent much of the overgrowth observed in rpm-1 mutants at overgrowth when placed in combination with rpm-1 mutations all developmental stages (Fig. 7D). Thus, AVG axon posterior (Fig. 7A). A quadruple mutant for all four Fz-type receptors has overgrowth in rpm-1 mutants requires downstream Wnt signaling arrested AVG axon growth like that of lin-17 single mutants components even though Wnt receptors are not required. (Fig. 7A). Surprisingly, AVG axon outgrowth still resumes in 75% Interestingly, mutations in pop-1 do not prevent the AVG axon of older rpm-1 mutants that lack all four Fz-type receptors from making a U-turn and growing in the anterior direction when (Fig. 7A), suggesting that EGL-20 might be activating a non- RPM-1 is absent (Fig. 6D), supporting an additional, Wnt- canonical Wnt receptor when RPM-1 is removed. The axon often independent role for RPM-1 in AVG axon growth. makes a U-turn and continues growth in the anterior direction, suggesting that axon growth, regardless of direction, does not DISCUSSION require the Fz-type receptors (Fig. 6C,D). The mechanism by which pioneer axons such as AVG navigate the Wnts can signal through non-canonical receptors, including Ryk, nervous system during development is not understood. We found ROR, the Flamingo/Vangl2/PCP pathway, and LRP5/6. We did not that the ubiquitin ligase comprising RPM-1 and FSN-1 keeps the observe AVG axon guidance defects in mutants for C. elegans Ryk AVG pioneer axon from overgrowing past the lumbar ganglion and DEVELOPMENT

7 RESEARCH ARTICLE Development (2018) 145, dev164897. doi:10.1242/dev.164897

Fig. 7. AVG axon overgrowth in rpm-1 mutants appears to be independent of Fz- type receptors. (A-D) Percentage of L4-stage animals with the indicated phenotype. ***P<0.001, ****P<0.0001, Kruskal–Wallis/ Dunn’s correction compared with wild type. #P<0.05, ####P<0.0001, Kruskal–Wallis/Dunn’s correction compared with rpm-1 mutants or for the genotypes compared by brackets. Expression of wild-type pop-1 in AVG (via the odr-2b promoter) in rpm-1 pop-1 double mutants suppresses axon growth arrest and results in overgrowth similar to that in rpm-1 single mutants. n=50 animals/genotype.

into the tail tip. RPM-1 and FSN-1 repress the activity of a p38 in the CNS through its interaction with the RYK receptor Derailed MAPK pathway comprising DLK-1, MKK-4 and PMK-3, but do (Yoshikawa et al., 2003). In mammals, Wnts either attract or repel not act through CEBP-1. Instead, RPM-1 and the DLK-1 pathway corticospinal axons along the anteroposterior axis through Fz-type regulate how AVG responds to the Wnts LIN-44 and EGL-20. LIN- or RYK receptors, respectively (Liu et al., 2005; Lyuksyutova et al., 44 promotes the posterior growth of the AVG axon. In the absence 2003; Schmitt et al., 2006). Wnts also repel axons in the corpus of RPM-1 activity, AVG responds to EGL-20, which appears to callosum via RYK receptors (Hutchins et al., 2011). Wnts can act as promote AVG axon growth even in the absence of all four Fz-type attractants for the dorsal root ganglion and monoaminergic neurons receptors. Taken together, our results suggest that RPM-1 and the in the CNS in mice and in retinal photoreceptor cells in Drosophila DLK-1/p38 MAPK pathway regulate axon guidance and growth by (Fenstermaker et al., 2010; Lu et al., 2004; Sato et al., 2006). The modulating signal transduction downstream of distinct Wnt signals. Wnt EGL-20 acts as a repellant to guide the touch receptor neurites The Wnt LIN-44 is required for proper AVG axon guidance, yet via the Fz-type receptors MIG-1 and MOM-5 in C. elegans (Pan its role is more complicated than that of a simple attractive et al., 2006; Prasad and Clark, 2006). Indeed, LIN-44 itself acts guidance cue. In the absence of LIN-44 (and indeed all the Wnts), through the Fz-receptor LIN-17 to repel the D-type motor neurons the AVG axon migrates along the ventral cord to the preanal from extending into the posterior tail (Maro et al., 2009). ganglion, suggesting that signals other than Wnts guide the initial Wnts typically act through the planar cell polarity (PCP) pathway journey of the growth cone. After reaching the preanal ganglion, to guide axon growth cones (Goodrich and Strutt, 2011; Onishi the AVG growth cone responds to extracellular LIN-44 to turn et al., 2014; Zallen, 2007). This seems an unlikely mechanism for dorsally and migrate up to the dorsal rectal ganglion, then to turn how Wnt LIN-44 and Fz LIN-17 promote AVG axon outgrowth, as and migrate posteriorly through the lumbar ganglion. Dorsal mutations in various conserved PCP components did not regulate migration is orthogonal to the source of LIN-44 Wnt release, so it AVG axon migration, whereas canonical Wnt-Fz downstream seems unlikely that the growth cone is simply moving towards the signaling components, such as TCF POP-1, are required for AVG Wnt as an attractive cue. axon migration. Wnts can act as either attractive or repellant guidance cues The role of Wnt-Fz signaling in AVG axon growth likely requires depending on the specific circuit. In Drosophila, Wnt5 repels axons changes in transcription. We found that Fz/LIN-17 and TCF POP-1 DEVELOPMENT

8 RESEARCH ARTICLE Development (2018) 145, dev164897. doi:10.1242/dev.164897 act cell-autonomously in AVG to promote axonal growth. TCF/POP-1 senses LIN-44. LIN-44 activates Fz LIN-17 on the growth cone, in binds to β-catenin, and this resulting complex acts as a turn activating DSH-1 and DSH-2 and sending POP-1 back to the transcriptional activator on multiple target genes. Surprisingly, none AVG neuronal nucleus. POP-1 activates the expression of another of the mutants for the C. elegans β-catenin genes has penetrant defects receptor, which is then placed on the growth cone membrane to sense in AVG migration out of the preanal ganglion. One possibility is that local guidance cues. Those cues and that hypothesized receptor then there is functional redundancy between these genes, although this has promote exit of the growth cone from the preanal ganglion and entry not been observed previously (Korswagen et al., 2000). Alternatively, into the dorsal rectal ganglion and the lumbar ganglion. Given that the wehadtoanalyzesys-1 hypomorphs and cell-specific RNAi initial migration of the growth cone is dorsal, one candidate cue is knockdowns rather than sys-1 null mutants to circumvent the Netrin/UNC-6; however, we found that mutations in either unc-5 or problem of embryonic lethality observed in the nulls (Kidd et al., unc-6 had no effect on AVG migration into the dorsal rectal ganglion. 2005; Miskowski et al., 2001). The sys-1 hypomorphs might possess Whereas Wnt/LIN-44 promotes AVG axon guidance in the tail, we enough β-catenin activity to accomplish AVG axon guidance for most also uncovered a role for RPM-1 in preventing Wnt crosstalk and animals, as a small percentage of these mutants did have AVG axon AVG axon overgrowth (Fig. 8B). The function of RPM-1 in axon guidance defects. Finally, there are some reports of POP-1 acting as a growth is best understood with respect to axon damage, where it transcriptional repressor independently of β-catenin (Calvo et al., regulates the damaged-induced DLK/p38 MAPK pathway to allow 2001; Shetty et al., 2005; Yang et al., 2011). This explanation also axon regeneration (Hammarlund et al., 2009; Xiong et al., 2010; Yan seems unlikely, as the expression of a POP-1 protein lacking the β- et al., 2009). RPM-1 also prevents inappropriate anterior overgrowth catenin interaction domain created a dominant-negative effect on and turning of the touch neuron axon PLM, as well as the anterior and AVG axon growth, similar to the phenotype observed in pop-1 loss- posterior overgrowth of the D-type GABAergic motor neurons (Maro of-function mutants. Regardless of whether POP-1 is a lone repressor et al., 2009; Opperman and Grill, 2014; Schaefer et al., 2000). This or an activator working with SYS-1, it is not intuitive how a signal regulation is through the combined actions on the DLK-1/p38 MAPK transduction pathway with a final output of a transcription factor pathway and the GLO-4/GLO-1 small GTPase pathway, whereas we could specify direction or polarity in a mononuclear cell. find that RPM-1 regulates AVG axon growth solely through its We suggest that POP-1 regulates the expression of another actions on the DLK-1/p38 MAPK pathway (Baker et al., 2014; Grill receptor, which in turn makes the AVG axon competent to respond et al., 2007; Li et al., 2008; Opperman and Grill, 2014). to other guidance cues present in the posterior of the animal (Fig. 8A). One common element of how RPM-1 regulates PLM, AVG and In this model, the AVG axon reaches the preanal ganglion, where it GABAergic motor neuron axon growth is Wnt signaling. A small

Fig. 8. A model for the regulation of AVG axon guidance and growth by Wnts and RPM-1. (A) (1) As the AVG axon (red line) migrates posteriorly into the tail, it encounters Wnt/LIN-44 (red shading). (2) We hypothesize that Wnt/LIN-44 activity alters gene expression in AVG (indicated by the change in line color from red to green) such that AVG expresses a new receptor sensitive to dorsal guidance cues (green shading), (3) allowing the axon to grow in the dorsal direction towards the dorsorectal ganglion. (B) Our findings suggest that Wnt/LIN-44 regulates AVG axon guidance through Fz/LIN-17 signaling (solid arrows), resulting in POP-1-mediated transcriptional changes that promote dorsal axon guidance. RPM-1 prevents AVG overgrowth by preventing crosstalk from the Wnt/EGL-20 through an unknown receptor. RPM-1 has an additional role, independent of Wnt signaling, in restricting growth. Damage and stress can disinhibit these two mechanisms (dotted lines) to allow new axon growth and regeneration in older animals. DEVELOPMENT

9 RESEARCH ARTICLE Development (2018) 145, dev164897. doi:10.1242/dev.164897 percentage of lin-44 and bar-1 mutants show the same PLM axon MATERIALS AND METHODS termination defects observed in rpm-1 mutants (Tulgren et al., Growth conditions and strains 2014). By contrast, lin-44 and rpm-1 mutants show the opposite Standard methods were used to culture C. elegans (Brenner, 1974). Animals phenotypes for AVG axon termination, and BAR-1 has no obvious were grown at 20°C on standard NGM plates seeded with OP50 Escherichia role. Moreover, PLM overgrowth in rpm-1 mutants depends on the coli. Strains were backcrossed to our laboratory N2 two to four times. Genes regulation of BAR-1 nuclear import by EMR-1 and ANC-1, and we and mutations used in this study are listed in Table S1. Transgenic strains include: OH4887 otIs182[P ::GFP], OH3701 otIs173[P ::DsRed2], did not observe a similar phenotype for AVG growth in these inx-18 rgef-1 KP1476 nuIs25[P ::GLR-1::GFP], OR856 rpm-1(od14), OR1977 nuIs25; mutants (Fig. S1B). Similarly, lin-44 mutants show a BAR-1- glr-1 odEx[Pglr-1::RFP::RAB-5(GDP)], nuIs142[Pglr-1::bar-1::gfp], OR1129 dependent overgrowth of GABAergic motor neuron axons, nuIs25; odEx[Pglr-1::RFP::RAB-5(GTP)], OR1456 rpm-1(od14); nuIs25; suggesting that LIN-44 acts as a repellant for these neurons (Maro odEx[Pglr-1::RPM-1(+)], OR1125 nuIs25; odEx[Pglr-1::RFP::DLK-1, rol-6dm] et al., 2009). By contrast, we find that lin-44 mutants have an and kyIs51[Podr-2b::GFP]. undergrowth of the AVG axon, indicating that LIN-44 acts as an attractant or stimulator of AVG posterior growth. Given the opposite Transgenes and germline transformation effects of LIN-44 on growth, as well as the disparate reliance on Plin- 44::signal sequence::flag::gfp::lin-44 genomic coding::lin-44 3’UTR BAR-1 and downstream RPM-1 effectors, our results demonstrate a and Pegl-20:: lin-44(+) were kind gifts from Kang Shen (Stanford University, novel mechanistic role for Wnt signaling and RPM-1 in regulating CA, USA). These constructs were injected into OR3385 lin-44(n1792); AVG axon growth and guidance. kyIs51 at 3 ng/μl and 15 ng/μl, respectively. In addition to increased Wnt signaling, the overgrowth defects The Pglr-1::lin-17(pOR826) and Pglr-1::lin-17::gfp(pOR827) transgenic for PLM in rpm-1 mutants are also due to augmented signaling of plasmids were generated by PCR-amplifying cDNA from an the guidance cues Netrin/UNC-6 and Slit/SLT-1 through their OpenBiosystems clone followed by Gateway recombination to introduce respective receptors UNC-5 and Robo/SAX-3 (Li et al., 2008). the products into the Gateway destination vectors ( pOR298 and pOR478, respectively) containing the glr-1 promoter. These constructs were injected RPM-1 might regulate how PLM responds to guidance cues by into N2 at 10 ng/μl. inhibiting the amount of UNC-5 and SAX-3 receptors that accumulate To generate a dominant-negative version of POP-1, Pglr-1::pop-1(D/N), on the neuron surface. We have not observed a change in LIN-17:: lacking the first 44 amino acids (the activation domain), cDNA was PCR GFP subcellular localization in rpm-1 mutants (data not shown). amplified from the ORFeome RNAi collection using upstream primer Instead, we favor a model in which RPM-1 prevents one or more Wnt AAAATGGCAGAATTAGACGGTGCCGGTCGAAATCCATC followed receptors from inappropriate activation by the EGL-20 Wnt. A more by the Gateway recombination explained above. This construct was injected detailed mechanistic understanding of how RPM-1 prevents Wnt into kyIs51 strain at 10 ng/μl. crosstalk will require the identification of the receptor(s) activated Transgenes that synthesize a sense and an antisense mRNA under the by EGL-20 in rpm-1 mutants, as none of the Fz-type receptor control of the glr-1 promoter to knock down the lin-17, wrm-1 and sys-1 mutations or known non-canonical receptor mutations appears to genes were generated (Esposito et al., 2007). The lin-17 cDNA was amplified by PCR using upstream primer ATGATGCATTCTTTGGGC- block the overgrowth defects observed in rpm-1 mutants to the ATCATTCTACTAT and downstream primer GACGACCTTACTGGGTC- same extent as double Wnt lin-44 egl-20 mutations. However, it is TCCATGAATTCTG. The sys-1a and wrm-1a cDNA were synthesized by important to note that we cannot examine AVG axon growth in a GENEWIZ (South Plainfield, New Jersey). The cDNAs were subcloned strain in which both maternal and zygotic contributions are into pCR8 (Invitrogen) by the TOPO cloning reaction, resulting in sense and completely null for all the Fz-type receptors; a small amount antisense donor vectors. The donor cDNAs were then moved into pOR298,a residual receptor activity could be sufficient. destination vector containing the glr-1 promoter and unc-54 3′UTR, Even in the absence of both LIN-44 and EGL-20 Wnts, the AVG resulting in sense transgenes and antisense transgenes. Plasmids for the axon still continues to overgrow in rpm-1 mutants, albeit in the sense and antisense transgenes were equally mixed (5 or 10 ng/µl each) and wrong (anterior) direction. Although this overgrowth requires injected into the kyIs51 strain. the DLK-1/p38 MAPK pathway, it does not require the lone TCF Podr-2b::lin-17 ( pOR830)andPodr-2b::pop-1 ( pOR831) transgenic plasmids were generated by the Gibson Assembly cloning technology with POP-1, suggesting that it is entirely independent of β-catenin fusion of the three overlapping linearized DNA fragments: PCR-amplified signaling. It also does not require CEBP-1, suggesting that it works odr-2b promoter, PCR-amplified pop-1 or lin-17 cDNA, and a linearized through a different mechanism than that used following axonal ∼2.8 kb DNA as a backbone, which is a digestion product of pOR829 with injury (Yan et al., 2009). This additional mechanism of axon growth SacIandEcoRV. For the Podr-2b::lin-17 (pOR830) plasmid, the odr-2b regulation might be related to the ability of RPM-1 and its homologs promoter was PCR amplified with upstream primer TCACGGTACC- to inhibit axon growth by promoting growth cone collapse (Borgen CTTAATTAACGAGCTCTGTGAGTTAATTGAACTGATACTAG and et al., 2017; Hendricks and Jesuthasan, 2009). This mechanism is downstream primer AGAATGCATCATTTTTTCTGTCTGAAATATAAA- through the inhibition of DLK-1/p38 MAPK signaling, which TGTTCC, and lin-17 cDNA was amplified with upstream primer ATATTT- otherwise stabilizes microtubules. In the absence of RPM-1, axonal CAGACAGAAAAAATGATGCATTCTTTGGG and downstream primer microtubules become overly stabilized, which not only provides TAGACCCATATGCCACGCGTCCGATTTAGACGACCTTACTGGGTC. For the P ::pop-1 (pOR831) plasmid, the odr-2b promoter was PCR additional structural support for axon growth but also facilitates odr-2b amplified with upstream primer TCACGGTACCCTTAATTAACGAGCTC- transport of materials to the growing axon tip. TGTGAGTTAATTGAACTGATACTAG and downstream primer GTCGG- In summary, we suggest that RPM-1 acts as a dual-purpose CCATCATTTTTTCTGTCTGAAATATAAATGTTCC, and pop-1 cDNA switch. First, it prevents axon guidance cue crosstalk as the was amplified with upstream primer ATATTTCAGACAGAAAAAATGAT- expression of different cues wax and wane over developmental GGCCGACGAAGAG and downstream primer TAGACCCATATGCCA- time and as a growth cone enters new regions of the body containing CGCGTCCGATTTAAATAGTACACATCGATTCCTGCATAAG. new cues. Second, it provides a brake on growth cone extension by destabilizing microtubules. Axonal injury can deactivate this switch, DAPI staining allowing for the needed crosstalk required to get axons re-growing To stain animals bearing kyIs51[Podr-2b::GFP] with DAPI, animals were and regenerating in adult tissue, long after the original guidance cue washed twice with PBS and then fixed with 4% paraformaldehyde (PFA) at landscape of the embryo has vanished. 4°C for 2 h. PFA-fixed animals were washed twice with cold PBS and then DEVELOPMENT

10 RESEARCH ARTICLE Development (2018) 145, dev164897. doi:10.1242/dev.164897 re-suspended in 100% methanol (pre-chilled at −20°C) for 5 min at −20°C. Durbin, R. M. (1987). Studies on the Development and Organisation of the Nervous After twice washing with PBS, animals were stained with DAPI solution System of Caenorhabditis elegans. PhD thesis, University of Cambridge, UK. (200 ng/ml in PBS; Sigma-Aldrich) for 30 min. Esposito, G., Di Schiavi, E., Bergamasco, C. and Bazzicalupo, P. (2007). Efficient and cell specific knock-down of gene function in targeted C. elegans neurons. Gene 395, 170-176. Fluorescence microscopy Fenstermaker, A. G., Prasad, A. A., Bechara, A., Adolfs, Y., Tissir, F., Goffinet, GFP fluorescence and DAPI staining were visualized in nematodes by A., Zou, Y. and Pasterkamp, R. J. (2010). Wnt/planar cell polarity signaling mounting on 2% agarose pads with 20 mM levamisole. Fluorescent images controls the anterior-posterior organization of monoaminergic axons in the were observed using an Axioplan II (Carl Zeiss) with 10× (N.A.=0.3), 40× brainstem. J. Neurosci. 30, 16053-16064. Gammons, M. and Bienz, M. (2017). Multiprotein complexes governing Wnt signal (N.A.=1.3) and 63× (N.A.=1.4) PlanApo objectives. Imaging was transduction. Curr. Opin. Cell Biol. 51, 42-49. performed with an ORCA charge-coupled device camera (Hamamatsu) Garriga, G., Desai, C. and Horvitz, H. R. (1993). Cell interactions control the using iVision software (Biovision Technologies). Maximum intensity direction of outgrowth, branching and fasciculation of the HSN axons of projections of z-series stacks were obtained and out-of-focus light was Caenorhabditis elegans. Development 117, 1071-1087. removed with a constrained iterative deconvolution algorithm (iVision). Gleason, J. E., Szyleyko, E. A. and Eisenmann, D. M. (2006). Multiple redundant Wnt signaling components function in two processes during C. elegans vulval development. Dev. Biol. 298, 442-457. Acknowledgements Goodrich, L. V. and Strutt, D. (2011). Principles of planar polarity in animal We thank Roshni Shah for technical assistance. We also thank the C. elegans development. Development 138, 1877-1892. Genetics Center, Kang Shen, Bill Wadsworth, Yishi Jin, Massimo Hilliard, Grill, B., Bienvenut, W. V., Brown, H. M., Ackley, B. D., Quadroni, M. and Jin, Y. Oliver Hobert, Peter Juo and Lars Drier for reagents and strains. (2007). C. elegans RPM-1 Regulates Axon Termination and Synaptogenesis through the Rab GEF GLO-4 and the Rab GTPase GLO-1. Neuron 55, 587-601. Competing interests Grill, B., Murphey, R. K. and Borgen, M. A. (2016). The PHR proteins: intracellular The authors declare no competing or financial interests. signaling hubs in neuronal development and axon degeneration. Neural development 11,8. Hammarlund, M., Nix, P., Hauth, L., Jorgensen, E. M. and Bastiani, M. (2009). Axon Author contributions regeneration requires a conserved MAP kinase pathway. Science 323, 802-806. Conceptualization: E.C.P., C.R.; Methodology: E.C.P.; Validation: E.C.P.; Formal Hao, J. C., Yu, T. W., Fujisawa, K., Culotti, J. G., Gengyo-Ando, K., Mitani, S., analysis: E.C.P., C.R.; Investigation: E.C.P.; Resources: E.C.P.; Writing - original Moulder, G., Barstead, R., Tessier-Lavigne, M. and Bargmann, C. I. (2001). C. draft: C.R.; Writing - review & editing: E.C.P., C.R.; Visualization: E.C.P., C.R.; elegans slit acts in midline, dorsal-ventral, and anterior-posterior guidance via the Supervision: C.R.; Project administration: C.R.; Funding acquisition: C.R. SAX-3/Robo receptor. Neuron 32, 25-38. Hart, A. C., Sims, S. and Kaplan, J. M. (1995). Synaptic code for sensory Funding modalities revealed by C. elegans GLR-1 glutamate receptor. Nature 378, 82-85. This work was supported by funding from the National Institutes of Health Harterink, M., Kim, D. H., Middelkoop, T. C., Doan, T. D., van Oudenaarden, A. (R01NS42023, R01GM101972 and R21NS102780 to C.R.). Deposited in PMC and Korswagen, H. C. (2011). Neuroblast migration along the anteroposterior for release after 12 months. axis of C. elegans is controlled by opposing gradients of Wnts and a secreted Frizzled-related protein. Development 138, 2915-2924. Hedgecock, E. M., Culotti, J. G. and Hall, D. H. (1990). The unc-5, unc-6, and unc- Supplementary information 40 genes guide circumferential migrations of pioneer axons and mesodermal cells Supplementary information available online at on the epidermis in C. elegans. Neuron 2, 61-85. http://dev.biologists.org/lookup/doi/10.1242/dev.164897.supplemental Hendricks, M. and Jesuthasan, S. (2009). PHR regulates growth cone pausing at intermediate targets through microtubule disassembly. J. Neurosci. 29, References 6593-6598. Ackley, B. D. (2014). Wnt-signaling and planar cell polarity genes regulate axon Herman, M. A., Vassilieva, L. L., Horvitz, H. R., Shaw, J. E. and Herman, R. K. guidance along the anteroposterior axis in C. elegans. Dev. Neurobiol. 74, (1995). The C. elegans gene lin-44, which controls the polarity of certain 781-796. asymmetric cell divisions, encodes a Wnt protein and acts cell nonautonomously. Baker, S. T., Opperman, K. J., Tulgren, E. D., Turgeon, S. M., Bienvenut, W. and Cell 83, 101-110. Grill, B. (2014). RPM-1 uses both ubiquitin ligase and phosphatase-based Hidalgo, A. and Brand, A. H. (1997). Targeted neuronal ablation: the role of pioneer mechanisms to regulate DLK-1 during neuronal development. PLoS Genet. 10, neurons in guidance and fasciculation in the CNS of Drosophila. Development e1004297. 124, 3253-3262. Bhat, J. M., Pan, J. and Hutter, H. (2015). PLR-1, a putative E3 ubiquitin ligase, Hutchins, B. I., Li, L. and Kalil, K. (2011). Wnt/calcium signaling mediates axon growth controls cell polarity and axonal extensions in C. elegans. Dev. Biol. 398, 44-56. and guidance in the developing corpus callosum. Dev. Neurobiol. 71, 269-283. Borgen, M. A., Wang, D. and Grill, B. (2017). RPM-1 regulates axon termination by Hutter, H. (2003). Extracellular cues and pioneers act together to guide axons in the affecting growth cone collapse and microtubule stability. Development 144, ventral cord of C. elegans. Development 130, 5307-5318. 4658-4672. Ishii, N., Wadsworth, W. G., Stern, B. D., Culotti, J. G. and Hedgecock, E. M. Brenner, S. (1974). The genetics of C. elegans. Genetics 77, 71-94. (1992). UNC-6, a laminin-related protein, guides cell and pioneer axon migrations Byrne, A. B., McWhirter, R. D., Sekine, Y., Strittmatter, S. M., Miller, D. M. and in C. elegans. Neuron 9, 873-881. Hammarlund, M. (2016). Inhibiting poly(ADP-ribosylation) improves axon Kaplan, A., Kent, C. B., Charron, F. and Fournier, A. E. (2014). Switching regeneration. eLife 5, e12734. responses: spatial and temporal regulators of axon guidance. Mol. Neurobiol. 49, Calvo, D., Victor, M., Gay, F., Sui, G., Luke, M. P.-S., Dufourcq, P., Wen, G., 1077-1086. Maduro, M., Rothman, J. and Shi, Y. (2001). A POP-1 repressor complex Kennerdell, J. R., Fetter, R. D. and Bargmann, C. I. (2009). Wnt-Ror signaling to restricts inappropriate cell type-specific gene transcription during Caenorhabditis SIA and SIB neurons directs anterior axon guidance and nerve ring placement in elegans embryogenesis. EMBO J. 20, 7197-7208. C. elegans. Development 136, 3801-3810. Chitnis, A. B. and Kuwada, J. Y. (1991). Elimination of a brain tract increases Kidd, A. R., III, Miskowski, J. A., Siegfried, K. R., Sawa, H. and Kimble, J. (2005). errors in pathfinding by follower growth cones in the zebrafish embryo. Neuron A beta-catenin identified by functional rather than sequence criteria and its role in 7, 277-285. Wnt/MAPK signaling. Cell 121, 761-772. Chou, J. H., Bargmann, C. I. and Sengupta, P. (2001). The Caenorhabditis Klassen, M. P. and Shen, K. (2007). Wnt signaling positions neuromuscular elegans odr-2 gene encodes a novel Ly-6-related protein required for olfaction. connectivity by inhibiting synapse formation in C. elegans. Cell 130, 704-716. Genetics 157, 211-224. Klose, M. and Bentley, D. (1989). Transient pioneer neurons are essential for Clevers, H. and van de Wetering, M. (1997). TCF/LEF factors earn their wings. formation of an embryonic peripheral nerve. Science 245, 982-984. Trends Genet. 13, 485-489. Korswagen, H. C., Herman, M. A. and Clevers, H. C. (2000). Distinct beta- Colavita, A., Krishna, S., Zheng, H., Padgett, R. W. and Culotti, J. G. (1998). catenins mediate adhesion and signalling functions in C. elegans. Nature Pioneer axon guidance by UNC-129, a C. elegans TGF-beta. Science 281, 406, 527-532. 706-709. Korswagen, H. C., Coudreuse, D. Y., Betist, M. C., van de Water, S., Zivkovic, D. Costa, M., Raich, W., Agbunag, C., Leung, B., Hardin, J. and Priess, J. R. (1998). and Clevers, H. C. (2002). The Axin-like protein PRY-1 is a negative regulator of a A putative catenin-cadherin system mediates morphogenesis of the canonical Wnt pathway in C. elegans. Genes Dev. 16, 1291-1302. Caenorhabditis elegans embryo. J. Cell Biol. 141, 297-308. Li, H., Kulkarni, G. and Wadsworth, W. G. (2008). RPM-1, a Caenorhabditis Dreier, L., Burbea, M. and Kaplan, J. M. (2005). LIN-23-mediated degradation of elegans protein that functions in presynaptic differentiation, negatively regulates beta-catenin regulates the abundance of GLR-1 glutamate receptors in the ventral axon outgrowth by controlling SAX-3/robo and UNC-5/UNC5 activity. J. Neurosci.

nerve cord of C. elegans. Neuron 46, 51-64. 28, 3595-3603. DEVELOPMENT

11 RESEARCH ARTICLE Development (2018) 145, dev164897. doi:10.1242/dev.164897

Liao, E. H., Hung, W., Abrams, B. and Zhen, M. (2004). An SCF-like ubiquitin Rocheleau, C. E., Downs, W. D., Lin, R., Wittmann, C., Bei, Y., Cha, Y.-H., Ali, M., ligase complex that controls presynaptic differentiation. Nature 430, 345-350. Priess, J. R. and Mello, C. C. (1997). Wnt signaling and an APC-related gene Lin, R., Thompson, S. and Priess, J. R. (1995). pop-1 encodes an HMG box specify endoderm in early C. elegans embryos. Cell 90, 707-716. protein required for the specification of a mesoderm precursor in early C. elegans Rocheleau, C. E., Yasuda, J., Shin, T. H., Lin, R., Sawa, H., Okano, H., Priess, J. R., embryos. Cell 83, 599-609. Davis, R. J. and Mello, C. C. (1999). WRM-1 activates the LIT-1 protein kinase to Lin, R., Hill, R. J. and Priess, J. R. (1998). POP-1 and anterior-posterior fate transduce anterior/posterior polarity signals in C. elegans. Cell 97, 717-726. decisions in C. elegans embryos. Cell 92, 229-239. Sarin, S., Antonio, C., Tursun, B. and Hobert, O. (2009). The C. elegans Tailless/ Liu, Y., Shi, J., Lu, C.-C., Wang, Z.-B., Lyuksyutova, A. I., Song, X.-J. and Zou, Y. TLX transcription factor nhr-67 controls neuronal identity and left/right asymmetric (2005). Ryk-mediated Wnt repulsion regulates posterior-directed growth of fate diversification. Development 136, 2933-2944. corticospinal tract. Nat. Neurosci. 8, 1151-1159. Sato, M., Umetsu, D., Murakami, S., Yasugi, T. and Tabata, T. (2006). DWnt4 Lockwood, C., Zaidel-Bar, R. and Hardin, J. (2008). The C. elegans zonula regulates the dorsoventral specificity of retinal projections in the Drosophila occludens ortholog cooperates with the cadherin complex to recruit actin during melanogaster visual system. Nat. Neurosci. 9, 67-75. morphogenesis. Curr. Biol. 18, 1333-1337. Sawa, H., Lobel, L. and Horvitz, H. R. (1996). The Caenorhabditis elegans gene Loh, K. M., van Amerongen, R. and Nusse, R. (2016). Generating cellular diversity lin-17, which is required for certain asymmetric cell divisions, encodes a putative and spatial form: Wnt signaling and the evolution of multicellular animals. Dev. seven-transmembrane protein similar to the Drosophila frizzled protein. Genes Dev. 10, 2189-2197. Cell 38, 643-655. Schaefer, A. M., Hadwiger, G. D. and Nonet, M. L. (2000). rpm-1, a conserved Lu, W., Yamamoto, V., Ortega, B. and Baltimore, D. (2004). Mammalian Ryk is a neuronal gene that regulates targeting and synaptogenesis in C. elegans. Neuron Wnt coreceptor required for stimulation of neurite outgrowth. Cell 119, 97-108. 26, 345-356. Lyuksyutova, A. I., Lu, C. C., Milanesio, N., King, L. A., Guo, N., Wang, Y., Schmitt, A. M., Shi, J., Wolf, A. M., Lu, C.-C., King, L. A. and Zou, Y. (2006). Wnt- Nathans, J., Tessier-Lavigne, M. and Zou, Y. (2003). Anterior-posterior guidance Ryk signalling mediates medial-lateral retinotectal topographic mapping. Nature of commissural axons by Wnt-frizzled signaling. Science 302, 1984-1988. 439, 31-37. Maricq, A. V., Peckol, E., Driscoll, M. and Bargmann, C. I. (1995). Mechanosensory Shetty, P., Lo, M. C., Robertson, S. M. and Lin, R. (2005). C. elegans TCF protein, signalling in C. elegans mediated by the GLR-1 glutamate receptor. Nature 378, POP-1, converts from repressor to activator as a result of Wnt-induced lowering of 78-81. nuclear levels. Dev. Biol. 285, 584-592. Maro, G. S., Klassen, M. P. and Shen, K. (2009). A beta-catenin-dependent Wnt Siegfried, K. R. and Kimble, J. (2002). POP-1 controls axis formation during early pathway mediates anteroposterior axon guidance in C. elegans motor neurons. gonadogenesis in C. elegans. Development 129, 443-453. PLoS ONE 4, e4690. Song, S., Zhang, B., Sun, H., Li, X., Xiang, Y., Liu, Z., Huang, X. and Ding, M. McConnell, S. K., Ghosh, A. and Shatz, C. J. (1989). Subplate neurons pioneer the (2010). A Wnt-Frz/Ror-Dsh pathway regulates neurite outgrowth in Caenorhabditis first axon pathway from the cerebral cortex. Science 245, 978-982. elegans. PLoS Genet. 6, e1001056. Miskowski, J., Li, Y. and Kimble, J. (2001). The sys-1 gene and sexual dimorphism Thorpe, C. J., Schlesinger, A., Carter, J. C. and Bowerman, B. (1997). Wnt during gonadogenesis in Caenorhabditis elegans. Dev. Biol. 230, 61-73. signaling polarizes an early C. elegans blastomere to distinguish endoderm from Moffat, L. L., Robinson, R. E., Bakoulis, A. and Clark, S. G. (2014). The mesoderm. Cell 90, 695-705. conserved transmembrane RING finger protein PLR-1 downregulates Wnt Tulgren, E. D., Turgeon, S. M., Opperman, K. J. and Grill, B. (2014). The Nesprin signaling by reducing Frizzled, Ror and Ryk cell-surface levels in C. elegans. family member ANC-1 regulates synapse formation and axon termination by Development 141, 617-628. functioning in a pathway with RPM-1 and beta-Catenin. PLoS Genet. 10, e1004481. Molenaar, M., van de Wetering, M., Oosterwegel, M., Peterson-Maduro, J., van der Vaart, A., Rademakers, S. and Jansen, G. (2015). DLK-1/p38 MAP kinase Godsave, S., Korinek, V., Roose, J., Destrée, O. and Clevers, H. (1996). XTcf-3 signaling controls cilium length by regulating RAB-5 mediated endocytosis in transcription factor mediates beta-catenin-induced axis formation in Xenopus Caenorhabditis elegans. PLoS Genet. 11, e1005733. embryos. Cell 86, 391-399. Wadsworth, W. G. (2002). Moving around in a worm: netrin UNC-6 and Morales, D. and Kania, A. (2017). Cooperation and crosstalk in axon guidance cue circumferential axon guidance in C. elegans. Trends Neurosci. 25, 423-429. integration: additivity, synergy, and fine-tuning in combinatorial signaling. Dev. Wang, Y., Chang, H., Rattner, A. and Nathans, J. (2016). Frizzled receptors in Neurobiol. 77, 891-904. development and disease. Curr. Top. Dev. Biol. 117, 113-139. Nakamura, K., Kim, S., Ishidate, T., Bei, Y., Pang, K., Shirayama, M., Trzepacz, White, J. G., Southgate, E., Thomson, J. N. and Brenner, S. (1986). The structure C., Brownell, D. R. and Mello, C. C. (2005). Wnt signaling drives WRM-1/beta- of the nervous system of the Nematode Caenorhabditis elegans. Philos. catenin asymmetries in early C. elegans embryos. Genes Dev. 19, 1749-1754. Trans. R. Soc. Lond. B Biol. Sci. 314, 1-340. Nakata, K., Abrams, B., Grill, B., Goncharov, A., Huang, X., Chisholm, A. D. and Wu, M. and Herman, M. A. (2006). A novel noncanonical Wnt pathway is involved in Jin, Y. (2005). Regulation of a DLK-1 and p38 MAP kinase pathway by the ubiquitin the regulation of the asymmetric B cell division in C. elegans. Dev. Biol. 293, ligase RPM-1 is required for presynaptic development. Cell 120, 407-420. 316-329. Natarajan, L., Witwer, N. E. and Eisenmann, D. M. (2001). The divergent Xiong, X., Wang, X., Ewanek, R., Bhat, P., Diantonio, A. and Collins, C. A. (2010). Caenorhabditis elegans beta-catenin proteins BAR-1, WRM-1 and HMP-2 make Protein turnover of the Wallenda/DLK kinase regulates a retrograde response to distinct protein interactions but retain functional redundancy in vivo. Genetics 159, axonal injury. J. Cell Biol. 191, 211-223. Yan, D., Wu, Z., Chisholm, A. D. and Jin, Y. (2009). The DLK-1 kinase promotes 159-172. mRNA stability and local translation in C. elegans synapses and axon Onishi, K., Hollis, E. and Zou, Y. (2014). Axon guidance and injury-lessons from regeneration. Cell 138, 1005-1018. Wnts and Wnt signaling. Curr. Opin. Neurobiol. 27, 232-240. Yang, P.-T., Lorenowicz, M. J., Silhankova, M., Coudreuse, D. Y. M., Betist, M. C. Opperman, K. J. and Grill, B. (2014). RPM-1 is localized to distinct subcellular and Korswagen, H. C. (2008). Wnt signaling requires retromer-dependent compartments and regulates axon length in GABAergic motor neurons. Neural recycling of MIG-14/Wntless in Wnt-producing cells. Dev. Cell 14, 140-147. Dev. 9, 10. Yang, X.-D., Huang, S., Lo, M.-C., Mizumoto, K., Sawa, H., Xu, W., Robertson, S. Pan, C.-L., Howell, J. E., Clark, S. G., Hilliard, M., Cordes, S., Bargmann, C. I. and Lin, R. (2011). Distinct and mutually inhibitory binding by two divergent beta- and Garriga, G. (2006). Multiple Wnts and frizzled receptors regulate anteriorly catenins coordinates TCF levels and activity in C. elegans. Development 138, directed cell and growth cone migrations in Caenorhabditis elegans. Dev. Cell 10, 4255-4265. 367-377. Yang, X.-D., Karhadkar, T. R., Medina, J., Robertson, S. M. and Lin, R. (2015). Pan, C. L., Baum, P. D., Gu, M., Jorgensen, E. M., Clark, S. G. and Garriga, G. beta-Catenin-related protein WRM-1 is a multifunctional regulatory subunit of the (2008). C. elegans AP-2 and retromer control Wnt signaling by regulating mig-14/ LIT-1 MAPK complex. Proc. Natl. Acad. Sci. USA 112, E137-E146. Wntless. Dev. Cell 14, 132-139. Yoshikawa, S., McKinnon, R. D., Kokel, M. and Thomas, J. B. (2003). Wnt- Park, E. C., Glodowski, D. R. and Rongo, C. (2009). The ubiquitin ligase RPM-1 and mediated axon guidance via the Drosophila Derailed receptor. Nature 422, 583-588. the p38 MAPK PMK-3 regulate AMPA receptor trafficking. PLoS ONE 4, e4284. Zallen, J. A. (2007). Planar polarity and tissue morphogenesis. Cell 129, 1051-1063. Petrovic, M. and Schmucker, D. (2015). Axonal wiring in neural development: Zhen, M., Huang, X., Bamber, B. and Jin, Y. (2000). Regulation of presynaptic target-independent mechanisms help to establish precision and complexity. terminal organization by C. elegans RPM-1, a putative guanine nucleotide BioEssays 37, 996-1004. exchanger with a RING-H2 finger domain. Neuron 26, 331-343. Prasad, B. C. and Clark, S. G. (2006). Wnt signaling establishes anteroposterior Zinovyeva, A. Y. and Forrester, W. C. (2005). The C. elegans Frizzled CFZ-2 is neuronal polarity and requires retromer in C. elegans. Development 133, required for cell migration and interacts with multiple Wnt signaling pathways. Dev. 1757-1766. Biol. 285, 447-461. DEVELOPMENT

12