DOCSLIB.ORG

FACT SHEET Genetic Sequence Data and Databases

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
FACT SHEET Genetic Sequence Data and Databases 3 April 2018 Version 1 FACT SHEET Genetic sequence data and databases Background GSD databases Genetic sequence data (GSD) GSD databases are databases that receive, host and Organisms are built, and their functions are provide access to GSD that has been submitted to determined, by their genetic code. This code is them. Most databases also provide important contained in DNA molecules, which are found in additional, contextual information related to the human, animal and plant cells, as well as in sequences, to enrich the sequence data with microorganisms like bacteria and viruses. DNA has information about the patient/animal/other source four components, or building blocks, called C from which the sample was extracted. This additional (cytosine), G (guanine), A (adenine), or T (thymine). information is known as “metadata”. The nucleotides line up in an order particular to each organism, comprising the genetic code. The code can Principal databases that host influenza GSD be “read” by the cell to produce RNA – which is also a There are more than 1700 molecular biology type of genetic information, encoded by the databases2, at least six of which contain influenza GSD. nucleotides A (adenine), C (cytosine), G (guanine) and These are: U (uracil) – and in turn, proteins that are responsible • GISAID EpifluTM: https://www.gisaid.org/ for all of the structure and function of a living • Influenza Research Database: organism. https://www.fludb.org/brc/home.spg?decorat or=influenza The order of the nucleotides in DNA and RNA – that is, • Openflu database: http://openflu.vital- the sequence – is critical because genetic sequences it.ch/browse.php contain information about the structure and specific • The three databases are part of the properties of an organism. In the case of viruses, this International Nucleotide Sequence Database includes characteristics such as pathogenicity, Collaboration (INSDC) 3: transmissibility and antiviral susceptibility. o GenBank: Laboratories can determine the genetic sequence of a https://www.ncbi.nlm.nih.gov/genban particular organism, using sequencing technologies. k/ The data generated through this process is called o European Nucleotide Archive: genetic sequence data (GSD), which is represented by https://www.ebi.ac.uk/ena listing the nucleotides in order (e.g., an RNA sequence o DNA Data Bank of Japan: might look like AGAAAUGAAAUGGCUCCUGUCAA). http://www.ddbj.nig.ac.jp/ Providers and users of influenza GSD GSD and databases in the PIP Framework The main providers of GSD from influenza viruses are Although GSD is not included in the definition of PIP GISRS laboratories. Other providers include national Biological Materials, genetic sequences are defined in public health laboratories and public and private section 4.2: “‘Genetic sequences’ means the order of laboratories that may sequence influenza viruses. GSD nucleotides found in a molecule of DNA or RNA. They can be uploaded to one or more databases by the contain the genetic information that determines the sequencing laboratory.1 biological characteristics of an organism or a virus”. Additionally, the PIP Framework has several GISRS laboratories, academia and industry are the references to GSD and databases: main influenza GSD users. They generally use the data to conduct risk assessment and monitor the • 5.2.1 Genetic sequence data, and analyses emergence and evolution of influenza viruses; develop arising from that data, relating to H5N1 and diagnostics; generate candidate vaccine viruses; and other influenza viruses with human pandemic produce new types of vaccines such as recombinant potential should be shared in a rapid, timely vaccine and vaccines using synthetic candidate and systematic manner with the originating vaccine viruses. laboratory and among WHO GISRS laboratories. 1 • 5.2.2 Recognizing that greater transparency overview of the main approaches taken by existing and access concerning influenza virus genetic databases. sequence data is important to public health and there is a movement towards the use of public- domain or public-access databases such as Genbank and GISAID respectively; and • 5.2.3 Recognizing that in some instances the publication of genetic sequence data has been considered sensitive by the country providing the virus; • 5.2.4 Member States request the Director- General to consult the Advisory Group on the best process for further discussion and resolution of issues relating to the handling of genetic sequence data from H5N1 and other influenza viruses with pandemic potential as part of the Pandemic Influenza Preparedness Framework.4 The PIP Framework also sets out certain expectations regarding GSD: • Annex 5: WHO Collaborating Center Terms of Reference, section B.5: WHO CC “upload available haemagglutinin, neuraminidase and other gene sequences of A(H5) and other influenza viruses with pandemic potential to a publicly accessible database in a timely manner but no later than three months after sequencing is completed, unless otherwise instructed by the laboratory or country providing the clinical specimens and/or viruses 5 (Guiding Principle 9)”. • Annex 4, Guiding Principle 9: “WHO GISRS laboratories will submit genetic sequences data to GISAID and Genbank or similar databases in a timely manner consistent with the Standard Material Transfer Agreement”.6 Main features of GSD databases As elaborated in the table below, GSD databases vary according to several factors, including • Scope of data coverage • Level of data curation and analysis • Database access • Terms and conditions of access to, and use of, data • Intellectual property (IP) and other legal rights over the data Databases address these factors, depending on their purpose and the community of data providers and data users they serve. The table below provides an 2 3 Glossary This glossary provides definitions of terms frequently used in the context of data access and databases. It does not purport to be comprehensive as new terms come into use and definitions evolve. The definitions provided in the Glossary are commonly used but not necessarily universally agreed. Therefore, some terms may be used differently in different contexts. Data access A Data access agreement is a contract between a database user (this includes data providers agreement (also and data users) on the one hand and the database (custodian of the data) on the other. It referred to as ‘database generally contains terms and conditions for accessing and using data hosted by the database. access agreement’ or These terms and conditions can include: conditions of access, use and re-use of data; further ‘data use agreement’) distribution of data; attribution and collaboration with the data provider; intellectual property rights, commercialization and licensing rights over data; suspension and termination of access. Open access23 The concept of ‘Open access’ arose in response to the growing demand for unrestricted, free access to scholarly research.24 According to the Berlin Declaration on Open Access to Knowledge in the Sciences and Humanities and the Bethesda Statement on Open Access Publishing, open access contributions must satisfy two conditions. The Berlin Declaration states: 1. The author(s) and right holder(s) of such contributions grant(s) to all users a free, irrevocable, worldwide, right of access to, and a license to copy, use, distribute, transmit and display the work publicly and to make and distribute derivative works, in any digital medium for any responsible purpose, subject to proper attribution of authorship (community standards, will continue to provide the mechanism for enforcement of proper attribution and responsible use of the published work, as they do now), as well as the right to make small numbers of printed copies for their personal use. 2. A complete version of the work and all supplemental materials, including a copy of the permission as stated above, in an appropriate standard electronic format is deposited (and thus published) in at least one online repository using suitable technical standards (such as the Open Archive definitions) that is supported and maintained by an academic institution, scholarly society, government agency, or other well-established organization that seeks to enable open access, unrestricted distribution, interoperability, and long-term archiving.25 Open data ‘Open data’ is a relatively recent term. The concept behind “open data” however predates the invention of the Internet and has arisen from the belief that knowledge is a common good26 and “that the enormous amount of information routinely collected by government entities should be available to all citizens.”27 According to Open Knowledge International, ‘open data’ is data that can be “freely used, modified, and shared by anyone for any purpose”28. For example, the European Data Portal, which gives access to “metadata of Public Sector Information available on public data portals across European countries”29, states that: “[open data] should have no limitations that prevent it from being used in any particular way”, “[it] must be free to use, but this does not mean that it must be free to access”, and “once the user has the data, they are free to use, reuse and redistribute it – even commercially.”30 The World Bank states that open data has two dimension: “1. The data must be legally open, which means they must be placed in the public domain or under liberal terms of use with minimal restrictions. 2. The data must be technically open, which means they must be published in electronic formats that are machine readable and preferably non-proprietary, so that anyone can access and use the data using common, freely available software tools. Data must also be publicly available and accessible on a public server, without password or firewall restrictions.”31 Open source The concept of open source arose from the field of computer programming.32 Open source licenses allow a community of users to access source materials, tools and platforms under terms that are meant to encourage free flow of information, collaboration and innovation. Open source licenses usually require that no intellectual property rights be asserted on the materials, tools or platforms.
Load more

Recommended publications
  • Bioinformatics Study of Lectins: New Classification and Prediction In
    Bioinformatics study of lectins : new classification and prediction in genomes François Bonnardel To cite this version: François Bonnardel. Bioinformatics study of lectins : new classification and prediction in genomes. Structural Biology [q-bio.BM]. Université Grenoble Alpes [2020-..]; Université de Genève, 2021. En- glish. NNT : 2021GRALV010. tel-03331649 HAL Id: tel-03331649 https://tel.archives-ouvertes.fr/tel-03331649 Submitted on 2 Sep 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. THÈSE Pour obtenir le grade de DOCTEUR DE L’UNIVERSITE GRENOBLE ALPES préparée dans le cadre d’une cotutelle entre la Communauté Université Grenoble Alpes et l’Université de Genève Spécialités: Chimie Biologie Arrêté ministériel : le 6 janvier 2005 – 25 mai 2016 Présentée par François Bonnardel Thèse dirigée par la Dr. Anne Imberty codirigée par la Dr/Prof. Frédérique Lisacek préparée au sein du laboratoire CERMAV, CNRS et du Computer Science Department, UNIGE et de l’équipe PIG, SIB Dans les Écoles Doctorales EDCSV et UNIGE Etude bioinformatique des lectines: nouvelle classification et prédiction dans les génomes Thèse soutenue publiquement le 8 Février 2021, devant le jury composé de : Dr. Alexandre de Brevern UMR S1134, Inserm, Université Paris Diderot, Paris, France, Rapporteur Dr.
    [Show full text]
  • A SARS-Cov-2 Sequence Submission Tool for the European Nucleotide
    Databases and ontologies Downloaded from https://academic.oup.com/bioinformatics/advance-article/doi/10.1093/bioinformatics/btab421/6294398 by guest on 25 June 2021 A SARS-CoV-2 sequence submission tool for the European Nucleotide Archive Miguel Roncoroni 1,2,∗, Bert Droesbeke 1,2, Ignacio Eguinoa 1,2, Kim De Ruyck 1,2, Flora D’Anna 1,2, Dilmurat Yusuf 3, Björn Grüning 3, Rolf Backofen 3 and Frederik Coppens 1,2 1Department of Plant Biotechnology and Bioinformatics, Ghent University, 9052 Ghent, Belgium, 1VIB Center for Plant Systems Biology, 9052 Ghent, Belgium and 2University of Freiburg, Department of Computer Science, Freiburg im Breisgau, Baden-Württemberg, Germany ∗To whom correspondence should be addressed. Associate Editor: XXXXXXX Received on XXXXX; revised on XXXXX; accepted on XXXXX Abstract Summary: Many aspects of the global response to the COVID-19 pandemic are enabled by the fast and open publication of SARS-CoV-2 genetic sequence data. The European Nucleotide Archive (ENA) is the European recommended open repository for genetic sequences. In this work, we present a tool for submitting raw sequencing reads of SARS-CoV-2 to ENA. The tool features a single-step submission process, a graphical user interface, tabular-formatted metadata and the possibility to remove human reads prior to submission. A Galaxy wrap of the tool allows users with little or no bioinformatic knowledge to do bulk sequencing read submissions. The tool is also packed in a Docker container to ease deployment. Availability: CLI ENA upload tool is available at github.com/usegalaxy- eu/ena-upload-cli (DOI 10.5281/zenodo.4537621); Galaxy ENA upload tool at toolshed.g2.bx.psu.edu/view/iuc/ena_upload/382518f24d6d and https://github.com/galaxyproject/tools- iuc/tree/master/tools/ena_upload (development) and; ENA upload Galaxy container at github.com/ELIXIR- Belgium/ena-upload-container (DOI 10.5281/zenodo.4730785) Contact: [email protected] 1 Introduction Nucleotide Archive (ENA).
    [Show full text]
  • Six-Fold Speed-Up of Smith-Waterman Sequence Database Searches Using Parallel Processing on Common Microprocessors
    Six-fold speed-up of Smith-Waterman sequence database searches using parallel processing on common microprocessors Running head: Six-fold speed-up of Smith-Waterman searches Torbjørn Rognes* and Erling Seeberg Institute of Medical Microbiology, University of Oslo, The National Hospital, NO-0027 Oslo, Norway Abstract Motivation: Sequence database searching is among the most important and challenging tasks in bioinformatics. The ultimate choice of sequence search algorithm is that of Smith- Waterman. However, because of the computationally demanding nature of this method, heuristic programs or special-purpose hardware alternatives have been developed. Increased speed has been obtained at the cost of reduced sensitivity or very expensive hardware. Results: A fast implementation of the Smith-Waterman sequence alignment algorithm using SIMD (Single-Instruction, Multiple-Data) technology is presented. This implementation is based on the MMX (MultiMedia eXtensions) and SSE (Streaming SIMD Extensions) technology that is embedded in Intel’s latest microprocessors. Similar technology exists also in other modern microprocessors. Six-fold speed-up relative to the fastest previously known Smith-Waterman implementation on the same hardware was achieved by an optimised 8-way parallel processing approach. A speed of more than 150 million cell updates per second was obtained on a single Intel Pentium III 500MHz microprocessor. This is probably the fastest implementation of this algorithm on a single general-purpose microprocessor described to date. Availability: Online searches with the software are available at http://dna.uio.no/search/ Contact: [email protected] Published in Bioinformatics (2000) 16 (8), 699-706. Copyright © (2000) Oxford University Press. *) To whom correspondence should be addressed.
    [Show full text]
  • Bioinformatics Courses Lecture 3: (Local) Alignment and Homology
    C E N Bioinformatics courses T R E Principles of Bioinformatics (BSc) & F B O I Fundamentals of Bioinformatics R O I I N N (MSc) T F E O G R R M A A T T I I Lecture 3: (local) alignment and V C E S homology searching V U Centre for Integrative Bioinformatics VU (IBIVU) Faculty of Exact Sciences / Faculty of Earth and Life Sciences 1 http://ibi.vu.nl, [email protected], 87649 (Heringa), Room P1.28 Divergent evolution sequence -> structure -> function • Common ancestor (CA) CA • Sequences change over time • Protein structures typically remain the same (robust against Sequence 1 ≠ Sequence 2 multiple mutations) • Therefore, function normally is Structure 1 = Structure 2 preserved within orthologous families Function 1 = Function 2 “Structure more conserved than sequence” 2 Reconstructing divergent evolution Ancestral sequence: ABCD ACCD (B C) ABD (C ø) mutation deletion ACCD or ACCD Pairwise Alignment AB─D A─BD 3 Reconstructing divergent evolution Ancestral sequence: ABCD ACCD (B C) ABD (C ø) mutation deletion ACCD or ACCD Pairwise Alignment AB─D A─BD true alignment 4 Pairwise alignment examples A protein sequence alignment MSTGAVLIY--TSILIKECHAMPAGNE----- ---GGILLFHRTHELIKESHAMANDEGGSNNS * * * **** *** A DNA sequence alignment attcgttggcaaatcgcccctatccggccttaa att---tggcggatcg-cctctacgggcc---- *** **** **** ** ****** 5 Evolution and three-dimensional protein structure information Multiple alignment Protein structure What do we see if we colour code the space-filling (CPK) protein model? • E.g., red for conserved alignment positions to blue for variable (unconserved) positions. 6 Evolution and three-dimensional protein structure information Isocitrate dehydrogenase: The distance from the active site (in yellow) determines the rate of evolution (red = fast evolution, blue = slow evolution) Dean, A.
    [Show full text]
  • A Survey on Data Compression Methods for Biological Sequences
    Article A Survey on Data Compression Methods for Biological Sequences Morteza Hosseini *, Diogo Pratas and Armando J. Pinho Institute of Electronics and Informatics Engineering of Aveiro/Department of Electronics, Telecommunications and Informatics (IEETA/DETI), University of Aveiro, 3810-193 Aveiro, Portugal; [email protected] (D.P.); [email protected] (A.J.P.) * Correspondence: [email protected]; Tel.: +351-234-370520; Fax: +351-234-370545 Academic Editor: Khalid Sayood Received: 27 June 2016; Accepted: 29 September 2016; Published: 14 October 2016 Abstract: The ever increasing growth of the production of high-throughput sequencing data poses a serious challenge to the storage, processing and transmission of these data. As frequently stated, it is a data deluge. Compression is essential to address this challenge—it reduces storage space and processing costs, along with speeding up data transmission. In this paper, we provide a comprehensive survey of existing compression approaches, that are specialized for biological data, including protein and DNA sequences. Also, we devote an important part of the paper to the approaches proposed for the compression of different file formats, such as FASTA, as well as FASTQ and SAM/BAM, which contain quality scores and metadata, in addition to the biological sequences. Then, we present a comparison of the performance of several methods, in terms of compression ratio, memory usage and compression/decompression time. Finally, we present some suggestions for future research on biological data compression. Keywords: protein sequence; DNA sequence; reference-free compression; reference-based compression; FASTA; Multi-FASTA; FASTQ; SAM; BAM 1. Introduction With the development of high-throughput sequencing (HTS) technologies, huge volumes of sequencing data are produced everyday, fast and cheaply, that can lead to upgrading the scientific knowledge of genome sequence information as well as facilitating the diagnosis and therapy.
    [Show full text]
  • Biohackathon Series in 2013 and 2014
    F1000Research 2019, 8:1677 Last updated: 02 AUG 2021 OPINION ARTICLE BioHackathon series in 2013 and 2014: improvements of semantic interoperability in life science data and services [version 1; peer review: 2 approved with reservations] Toshiaki Katayama 1, Shuichi Kawashima1, Gos Micklem 2, Shin Kawano 1, Jin-Dong Kim1, Simon Kocbek1, Shinobu Okamoto1, Yue Wang1, Hongyan Wu3, Atsuko Yamaguchi 1, Yasunori Yamamoto1, Erick Antezana 4, Kiyoko F. Aoki-Kinoshita5, Kazuharu Arakawa6, Masaki Banno7, Joachim Baran8, Jerven T. Bolleman 9, Raoul J. P. Bonnal10, Hidemasa Bono 1, Jesualdo T. Fernández-Breis11, Robert Buels12, Matthew P. Campbell13, Hirokazu Chiba14, Peter J. A. Cock15, Kevin B. Cohen16, Michel Dumontier17, Takatomo Fujisawa18, Toyofumi Fujiwara1, Leyla Garcia 19, Pascale Gaudet9, Emi Hattori20, Robert Hoehndorf21, Kotone Itaya6, Maori Ito22, Daniel Jamieson23, Simon Jupp19, Nick Juty19, Alex Kalderimis2, Fumihiro Kato 24, Hideya Kawaji25, Takeshi Kawashima18, Akira R. Kinjo26, Yusuke Komiyama27, Masaaki Kotera28, Tatsuya Kushida 29, James Malone30, Masaaki Matsubara 31, Satoshi Mizuno32, Sayaka Mizutani 28, Hiroshi Mori33, Yuki Moriya1, Katsuhiko Murakami34, Takeru Nakazato1, Hiroyo Nishide14, Yosuke Nishimura 28, Soichi Ogishima32, Tazro Ohta1, Shujiro Okuda35, Hiromasa Ono1, Yasset Perez-Riverol 19, Daisuke Shinmachi5, Andrea Splendiani36, Francesco Strozzi37, Shinya Suzuki 28, Junichi Takehara28, Mark Thompson38, Toshiaki Tokimatsu39, Ikuo Uchiyama 14, Karin Verspoor 40, Mark D. Wilkinson 41, Sarala Wimalaratne19, Issaku Yamada
    [Show full text]
  • Database and Bioinformatic Analysis of BCL-2 Family Proteins and BH3-Only Proteins Abdel Aouacheria, Vincent Navratil, Christophe Combet
    Database and Bioinformatic Analysis of BCL-2 Family Proteins and BH3-Only Proteins Abdel Aouacheria, Vincent Navratil, Christophe Combet To cite this version: Abdel Aouacheria, Vincent Navratil, Christophe Combet. Database and Bioinformatic Analysis of BCL-2 Family Proteins and BH3-Only Proteins. Gavathiotis E. BCL-2 Family Proteins. Methods in Molecular Biology, 1877, Springer Nature, pp.23-43, 2019, Methods in Molecular Biology, 978-1-4939- 8860-0. 10.1007/978-1-4939-8861-7_2. hal-02347884 HAL Id: hal-02347884 https://hal.archives-ouvertes.fr/hal-02347884 Submitted on 5 Nov 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Copyright Database and bioinformatic analysis of BCL-2 family proteins and BH3-only proteins Abdel Aouacheria 1,*, Vincent Navratil 2 and Christophe Combet 3 1 ISEM, Institut des Sciences de l’Evolution de Montpellier, Université de Montpellier, UMR 5554, CNRS, IRD, EPHE, Place Eugène Bataillon, 34095 Montpellier, France 2 PRABI, Rhône Alpes Bioinformatics Center, UCBL, Lyon1, Université de Lyon, Lyon, France. 3 Centre de Recherche en Cancérologie de Lyon, UMR Inserm U1052, CNRS 5286, Université Claude Bernard Lyon 1, Centre Léon Bérard, Lyon, France.
    [Show full text]
  • Protein Database
    UniProt Unit-2 Paper- Bioinformatics (DSE-1) B.Sc. (H) Microbiology V Sem UniProt It provide the scientific community with a comprehensive, high-quality and freely accessible resource of protein sequence and functional information UniProt - Universal protein resource Swiss-Prot & TrEMBL PIR-PSD •Merger of these three databases, since 2002 •Funded mainly by NIH (US) to be the highest quality, most thoroughly annotated protein sequence database •UniProt is a collaboration between the European Bioinformatics Institute (EMBL- EBI), the Swiss Institute of Bioinformatics (SIB) and the Protein Information Resource (PIR). •Collaboration through different tasks such as database curation, software development and support. Source of protein sequence data • Protein sequencing is rare • Most protein sequence Large-scale sequencing Individual Patent derived from nucleotide data projects scientists Offices Nucleotide sequencing Submit Protein sequencing Submit Nucleotide Derive Protein sequence protein sequence sequence database database More than 95 % of the protein sequences provided by UniProtKB are derived from the translation of the coding sequences (CDS) Protein sequence is mainly derived data submit DNA sequence ACGCTCGTACGCATCGTCACTACTAGCTACGACGACGACACGCTACTACTCGACGATTCT may not have direct Predicted Predicted transcribe Predicted evidence start splice sites stop Derived mRNA sequence AUGCGUAGUGAUGAAUGCUGCUGUGCGAUGAGCUGC translate Derived protein sequence MRSNECCCAMSC UniProt • The Universal Protein Resource (UniProt) is a comprehensive resource for protein sequence and annotation data. • The UniProt databases are: 1. UniProt Knowledgebase (UniProtKB), 2. UniProt Reference Clusters (UniRef), 3. UniProt Archive (UniParc). UniProtKB UniProtKB • Reviewed (Swiss-Prot) - Manually annotated Records with information extracted from literature and curator-evaluated computational analysis and and scientific conclusions. • Is a high quality non-redundant protein sequence database • Unreviewed (TrEMBL) - Computationally analyzed Records that await full manual annotation.
    [Show full text]
  • Sequence Database Searching
    Sequence Database Searching 2007-01-14 Gao, Ge Center for Bioinformatics, Peking University Sequence Alignment: A Quick Review Object: see how close two sequences are Usages: To infer functions. To determine the common area of some sequences To infer protein structure, if the structure of one of the sequences is known. To “guess” whether they are descended from a common ancestor (and construct evolutionary trees). © Copyright 2006 Center for Bioinformatics, Peking University Sequence Alignment: in Biology The purpose of a sequence alignment is to line up all residues in the sequence that were derived from the same residue position in the ancestral gene or protein in any number of sequences A B A B © Copyright 2006g aCpe n=te irn fsoer rBtiooinf oorrm dateicles,t iPoenking University Sequence Alignment: Scoring GAATC GAAT-C -GAAT-C CATAC C-ATAC C-A-TAC GAATC- GAAT-C GA-ATC CA-TAC CA-TAC CATA-C Scoring function: measure the quality of a candidate alignment. scoring matrix, gap penalty © Copyright 2006 Center for Bioinformatics, Peking University Sequence Alignment : Global vs. Local Global alignments: align residues in whole sequence, are most useful when the sequences are similar and of roughly equal size. Algorithm: Needleman-Wunsch Local alignments: align residues in regions are more useful for diverged sequences Algorithm: Smith-Waterman With sufficiently similar sequences, there is no difference between local and global alignments. © Copyright 2006 Center for Bioinformatics, Peking University Sequence Database Searching Rather than do the alignment pair-wise, it’s necessary to run database searching in a high-throughput style. Identify similarities between novel query sequences whose structures and functions are unknown and uncharacterized sequences in (public) databases whose structures and functions have been elucidated.
    [Show full text]
  • Accessing Molecular Biology Information * Genome Browsers
    Accessing molecular biology information * Genome browsers - UCSC * NCBI * Galaxy Flow of genetic information and databases Exon 1 Exon 2 Exon 3 Exon 4 intron intron intron DNA transcription 5' 3' RNA Genbank/ EMBL splicing 5' UTR 3' UTR polyA mature coding sequence mRNA translation protein GenPept / SwissProt folding / UniProt Protein Data Bank (PDB) Databases, cont. Redundancy at GenBank => RefSeq Many sequences are represented more than once in GenBank 2003 RefSeq collection : curated secondary database non-redundant selected organisms •Genome DNA (assemblies) •Transcripts (RNA) •Protein http://www.ncbi.nlm.nih.gov/books/bv.fcg i?rid=handbook RefSeq vs GenBank GenBank RefSeq Not curated Curated Author submits NCBI creates from existing data Only author can revise NCBI reivses as new data emerge Multiple records from same loci Single records for each molecule common of major organisms Records can contradict each other No limit to species included Limited to model organisms Akin to primary literature Akin to review articles Archives with nucleotide sequences • Genbank/EMBL • Sequence read archive (NCBI) • GEO (Gene expression omnibus, NCBI) • 1000 Genomes Project • The Cancer Genome Atlas • The Cancer Genome Project • Species-specific databases like –FlyBase – WormBase – Saccharomyces Genome Database Genome sequencing using a shotgun approach Sequenced eukaryotic genomes Sequencing going wild ... BGI : "capacity to sequence the equivalent of 1,600 complete human genomes each day" "BGI and BGI Americas aim to build a library of digital
    [Show full text]
  • Introduction to Bioinformatics
    INTRODUCTION TO BIOINFORMATICS > Please take the initial BIOINF525 questionnaire: < http://tinyurl.com/bioinf525-questions Barry Grant University of Michigan www.thegrantlab.org BIOINF 525 http://bioboot.github.io/bioinf525_w16/ 12-Jan-2016 Barry Grant, Ph.D. [email protected] Ryan Mills, Ph.D. [email protected] Hongyang Li (GSI) [email protected] COURSE LOGISTICS Lectures: Tuesdays 2:30-4:00 PM Rm. 2062 Palmer Commons Labs: Session I: Thursdays 2:30 - 4:00 PM Session II: Fridays 10:30 - 12:00 PM Rm. 2036 Palmer Commons Website: http://tinyurl.com/bioinf525-w16 Lecture, lab and background reading material plus homework and course announcements MODULE OVERVIEW Objective: Provide an introduction to the practice of bioinformatics as well as a practical guide to using common bioinformatics databases and algorithms 1.1. ‣ Introduction to Bioinformatics 1.2. ‣ Sequence Alignment and Database Searching 1.3 ‣ Structural Bioinformatics 1.4 ‣ Genome Informatics: High Throughput Sequencing Applications and Analytical Methods TODAYS MENU Overview of bioinformatics • The what, why and how of bioinformatics? • Major bioinformatics research areas. • Skepticism and common problems with bioinformatics. Bioinformatics databases and associated tools • Primary, secondary and composite databases. • Nucleotide sequence databases (GenBank & RefSeq). • Protein sequence database (UniProt). • Composite databases (PFAM & OMIM). Database usage vignette • Searching with ENTREZ and BLAST. • Reference slides and handout on major databases. HOMEWORK Complete the initial
    [Show full text]
  • An Open-Access Platform for Glycoinformatics
    Glycobiology vol. 21 no. 4 pp. 493–502, 2011 doi:10.1093/glycob/cwq188 Advance Access publication on November 23, 2010 EUROCarbDB: An open-access platform for glycoinformatics Claus-Wilhelm von der Lieth 2,†, Ana Ardá Freire 3, relational database containing glycan structures, their Dennis Blank 4, Matthew P Campbell 5,6,11, Alessio Ceroni 7, biological context and, when available, primary and David R Damerell 7, Anne Dell 7,RaymondADwek6, interpreted analytical data from high-performance liquid Beat Ernst 8, Rasmus Fogh 9,12, Martin Frank 2, chromatography, mass spectrometry and nuclear magnetic Hildegard Geyer 4, Rudolf Geyer 4, Mathew J Harrison 9,13, resonance experiments. Database content can be accessed Kim Henrick 9,14, Stefan Herget 2, William E Hull 2, via a web-based user interface. The database is complemen- John Ionides 9,14, Hiren J Joshi 2,9, Johannis P Kamerling 3, ted by a suite of glycoinformatics tools, specifically designed 3 3,12 Bas R Leeflang , Thomas Lütteke , to assist the elucidation and submission of glycan structure Downloaded from Magnus Lundborg 10, Kai Maass 4,15, Anthony Merry 9, and experimental data when used in conjunction with con- René Ranzinger 2,16, Jimmy Rosen 3, Louise Royle 5,6, temporary carbohydrate research workflows. All software Pauline M Rudd 5,6, Siegfried Schloissnig 2, tools and source code are licensed under the terms of the Roland Stenutz 10, Wim F Vranken 9,14, Göran Widmalm 10, Lesser General Public License, and publicly contributed glycob.oxfordjournals.org and Stuart M Haslam 1,7 structures and data are freely accessible.
    [Show full text]