DOCSLIB.ORG

Table S3. List of Predicted Genes Targeted by at Least 5 Mirnas Significantly up Regulated In

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Table S3. List of predicted genes targeted by at least 5 miRNAs significantly up regulated in CD105+ MVs. Official symbol Gene name n° of targeting miRNAs TNRC6B trinucleotide repeat containing 6B 11 BNC2 basonuclin 2 9 BRWD1 bromodomain and WD repeat domain containing 1 8 MIB1 mindbomb homolog 1 (Drosophila) 8 ANKRD52 ankyrin repeat domain 52 8 FOXP1 forkhead box P1 8 ITGB8 integrin, beta 8 8 CNOT6L CCR4-NOT transcription complex, subunit 6-like 8 PTP4A1 protein tyrosine phosphatase type IVA, member 1 7 PPP1R15B protein phosphatase 1, regulatory (inhibitor) subunit 15B 7 TET3 tet oncogene family member 3 7 GMFB glia maturation factor, beta 7 PRKAA2 protein kinase, AMP-activated, alpha 2 catalytic subunit 7 PTPRD protein tyrosine phosphatase, receptor type, D 7 TP53INP1 tumor protein p53 inducible nuclear protein 1 7 FNDC3B fibronectin type III domain containing 3B 7 FAT3 FAT tumor suppressor homolog 3 (Drosophila) 7 CCND2 cyclin D2 7 ONECUT2 one cut homeobox 2 7 RBM9 RNA binding motif protein 9 7 ERBB4 v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) 7 BACH2 BTB and CNC homology 1, basic leucine zipper transcription factor 2 7 SMAD4 SMAD family member 4 7 MECP2 methyl CpG binding protein 2 (Rett syndrome) 7 UBN2 ubinuclein 2 7 PTEN phosphatase and tensin homolog 7 RALGPS1 Ral GEF with PH domain and SH3 binding motif 1 7 DLC1 deleted in liver cancer 1 6 ENAH enabled homolog (Drosophila) 6 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 6 KCMF1 potassium channel modulatory factor 1 6 IGF1 insulin-like growth factor 1 (somatomedin C) 6 ZNF148 zinc finger protein 148 6 TIAM1 T-cell lymphoma invasion and metastasis 1 6 CDK6 cyclin-dependent kinase 6 6 RP5-1022P6.2 hypothetical protein KIAA1434 6 ACVR2B activin A receptor, type IIB 6 CLCN5 chloride channel 5 6 HLF hepatic leukemia factor 6 TBC1D12 TBC1 domain family, member 12 6 FRMD4A FERM domain containing 4A 6 NUS1 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 6 PHF21A PHD finger protein 21A 6 CAMTA1 calmodulin binding transcription activator 1 6 ELL2 elongation factor, RNA polymerase II, 2 6 PDIK1L PDLIM1 interacting kinase 1 like 6 NFIB nuclear factor I/B 6 CPEB1 cytoplasmic polyadenylation element binding protein 1 6 SLC6A6 solute carrier family 6 (neurotransmitter transporter, taurine), member 6 6 CSNK1G1 casein kinase 1, gamma 1 6 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 6 SNX30 sorting nexin family member 30 6 NCKAP5 NCK-associated protein 5 6 CHIC1 cysteine-rich hydrophobic domain 1 6 MAP4K4 mitogen-activated protein kinase kinase kinase kinase 4 6 ATXN1 ataxin 1 6 INO80D INO80 complex subunit D 6 SAMD12 sterile alpha motif domain containing 12 6 ARPP19 cAMP-regulated phosphoprotein, 19kDa 6 CUGBP2 CUG triplet repeat, RNA binding protein 2 6 CPEB4 cytoplasmic polyadenylation element binding protein 4 6 CPEB3 cytoplasmic polyadenylation element binding protein 3 6 MON2 MON2 homolog (S. cerevisiae) 6 DCX doublecortin 6 PLXNA4 plexin A4 6 FUT9 fucosyltransferase 9 (alpha (1,3) fucosyltransferase) 6 YAF2 YY1 associated factor 2 6 PCNX pecanex homolog (Drosophila) 6 CPEB2 cytoplasmic polyadenylation element binding protein 2 6 ARHGAP26 Rho GTPase activating protein 26 5 KIAA1462 KIAA1462 5 AAK1 AP2 associated kinase 1 5 FAM46C family with sequence similarity 46, member C 5 CCNJ cyclin J 5 ABL2 v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene) 5 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 5 JAZF1 JAZF zinc finger 1 5 ADAMTS18 ADAM metallopeptidase with thrombospondin type 1 motif, 18 5 BEND4 BEN domain containing 4 5 PCGF5 polycomb group ring finger 5 5 KLHL3 kelch-like 3 (Drosophila) 5 ACVR1C activin A receptor, type IC 5 VGLL3 vestigial like 3 (Drosophila) 5 ERP44 endoplasmic reticulum protein 44 5 LRCH2 leucine-rich repeats and calponin homology (CH) domain containing 2 5 MLL3 myeloid/lymphoid or mixed-lineage leukemia 3 5 ZFAND5 zinc finger, AN1-type domain 5 5 RNF44 ring finger protein 44 5 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 5 INSIG1 insulin induced gene 1 5 KLF12 Kruppel-like factor 12 5 C7orf60 chromosome 7 open reading frame 60 5 ZNF532 zinc finger protein 532 5 USP47 ubiquitin specific peptidase 47 5 BCL11B B-cell CLL/lymphoma 11B (zinc finger protein) 5 SULF1 sulfatase 1 5 DDX6 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 5 FOXN2 forkhead box N2 5 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 5 IGSF3 immunoglobulin superfamily, member 3 5 KPNA6 karyopherin alpha 6 (importin alpha 7) 5 GATAD2B GATA zinc finger domain containing 2B 5 LAMC1 laminin, gamma 1 (formerly LAMB2) 5 EPS15 epidermal growth factor receptor pathway substrate 15 5 EDEM3 ER degradation enhancer, mannosidase alpha-like 3 5 C5orf41 chromosome 5 open reading frame 41 5 CDC42BPA CDC42 binding protein kinase alpha (DMPK-like) 5 FXR1 fragile X mental retardation, autosomal homolog 1 5 EVI5 ecotropic viral integration site 5 5 SYT1 synaptotagmin I 5 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing APPL1 1 5 DCP2 DCP2 decapping enzyme homolog (S. cerevisiae) 5 DLGAP2 discs, large (Drosophila) homolog-associated protein 2 5 TSC1 tuberous sclerosis 1 5 KIAA0355 KIAA0355 5 CNOT6 CCR4-NOT transcription complex, subunit 6 5 HS2ST1 heparan sulfate 2-O-sulfotransferase 1 5 ETNK1 ethanolamine kinase 1 5 TMEM170B transmembrane protein 170B 5 EGR3 early growth response 3 5 BAHD1 bromo adjacent homology domain containing 1 5 MXD1 MAX dimerization protein 1 5 REEP1 receptor accessory protein 1 5 SOCS6 suppressor of cytokine signaling 6 5 DIXDC1 DIX domain containing 1 5 DOCK4 dedicator of cytokinesis 4 5 ZCCHC14 zinc finger, CCHC domain containing 14 5 UBFD1 ubiquitin family domain containing 1 5 MEF2D myocyte enhancer factor 2D 5 PDE7B phosphodiesterase 7B 5 HDAC4 histone deacetylase 4 5 LASS6 LAG1 homolog, ceramide synthase 6 5 HIPK2 homeodomain interacting protein kinase 2 5 HIF1AN hypoxia inducible factor 1, alpha subunit inhibitor 5 CLOCK clock homolog (mouse) 5 ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1 5 catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat CTNND2 protein) 5 DENND5B DENN/MADD domain containing 5B 5 MYT1L myelin transcription factor 1-like 5 FRMD6 FERM domain containing 6 5 PLAG1 pleiomorphic adenoma gene 1 5 CCNJL cyclin J-like 5 CREB5 cAMP responsive element binding protein 5 5 MBNL1 muscleblind-like (Drosophila) 5 DNAL1 dynein, axonemal, light chain 1 5 SLC1A2 solute carrier family 1 (glial high affinity glutamate transporter), member 2 5 SP1 Sp1 transcription factor 5 FOXN3 forkhead box N3 5 PPARA peroxisome proliferator-activated receptor alpha 5 ARHGEF12 Rho guanine nucleotide exchange factor (GEF) 12 5 ZNF609 zinc finger protein 609 5 CALCR calcitonin receptor 5 CCDC6 coiled-coil domain containing 6 5 LRRTM2 leucine rich repeat transmembrane neuronal 2 5 ZFYVE26 zinc finger, FYVE domain containing 26 5 DICER1 dicer 1, ribonuclease type III 5 JARID2 jumonji, AT rich interactive domain 2 5 .
Recommended publications
  • Comprehensive Molecular Characterization of Gastric Adenocarcinoma

    Comprehensive Molecular Characterization of Gastric Adenocarcinoma

    Comprehensive molecular characterization of gastric adenocarcinoma The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Bass, A. J., V. Thorsson, I. Shmulevich, S. M. Reynolds, M. Miller, B. Bernard, T. Hinoue, et al. 2014. “Comprehensive molecular characterization of gastric adenocarcinoma.” Nature 513 (7517): 202-209. doi:10.1038/nature13480. http://dx.doi.org/10.1038/ nature13480. Published Version doi:10.1038/nature13480 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:12987344 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA NIH Public Access Author Manuscript Nature. Author manuscript; available in PMC 2014 September 22. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Nature. 2014 September 11; 513(7517): 202–209. doi:10.1038/nature13480. Comprehensive molecular characterization of gastric adenocarcinoma A full list of authors and affiliations appears at the end of the article. Abstract Gastric cancer is a leading cause of cancer deaths, but analysis of its molecular and clinical characteristics has been complicated by histological and aetiological heterogeneity. Here we describe a comprehensive molecular evaluation of 295 primary gastric adenocarcinomas as part of The Cancer
  • Structure and Function of the Fgd Family of Divergent FYVE Domain Proteins

    Structure and Function of the Fgd Family of Divergent FYVE Domain Proteins

    Biochemistry and Cell Biology Structure and Function of the Fgd Family of Divergent FYVE Domain Proteins Journal: Biochemistry and Cell Biology Manuscript ID bcb-2018-0185.R1 Manuscript Type: Mini Review Date Submitted by the 03-Aug-2018 Author: Complete List of Authors: Eitzen, Gary; University of Alberta Faculty of Medicine and Dentistry Smithers, Cameron C.; University of Alberta, Biochemistry Murray, Allan; University of Alberta Faculty of Medicine and Dentistry Overduin, Michael; University of Alberta Faculty of Medicine and Dentistry Draft Fgd, Pleckstrin Homology domain, FYVE domain, Dbl Homology Domain, Keyword: Rho GEF Is the invited manuscript for consideration in a Special CSMB Special Issue Issue? : https://mc06.manuscriptcentral.com/bcb-pubs Page 1 of 37 Biochemistry and Cell Biology Title: Structure and Function of the Fgd Family of Divergent FYVE Domain Proteins Authors: Gary Eitzen1, Cameron C. Smithers2, Allan G Murray3 and Michael Overduin2* Draft 1Department of Cell Biology, 2Department of Biochemistry, 3Department of Medicine, University of Alberta, Edmonton, Alberta, Canada *Corresponding author. Michael Overduin Telephone: +1 780 492 3518 Fax: +1 780 492-0886 E-mail: [email protected] https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 2 of 37 Abstract FYVE domains are highly conserved protein modules that typically bind phosphatidylinositol 3-phosphate (PI3P) on the surface of early endosomes. Along with pleckstrin homology (PH) and phox homology (PX) domains, FYVE domains are the principal readers of the phosphoinositide (PI) code that mediate specific recognition of eukaryotic organelles. Of all the human FYVE domain-containing proteins, those within the Faciogenital dysplasia (Fgd) subfamily are particularly divergent, and couple with GTPases to exert unique cellular functions.
  • Functional Annotation of Exon Skipping Event in Human Pora Kim1,*,†, Mengyuan Yang1,†,Keyiya2, Weiling Zhao1 and Xiaobo Zhou1,3,4,*

    Functional Annotation of Exon Skipping Event in Human Pora Kim1,*,†, Mengyuan Yang1,†,Keyiya2, Weiling Zhao1 and Xiaobo Zhou1,3,4,*

    D896–D907 Nucleic Acids Research, 2020, Vol. 48, Database issue Published online 23 October 2019 doi: 10.1093/nar/gkz917 ExonSkipDB: functional annotation of exon skipping event in human Pora Kim1,*,†, Mengyuan Yang1,†,KeYiya2, Weiling Zhao1 and Xiaobo Zhou1,3,4,* 1School of Biomedical Informatics, The University of Texas Health Science Center at Houston, Houston, TX 77030, USA, 2College of Electronics and Information Engineering, Tongji University, Shanghai, China, 3McGovern Medical School, The University of Texas Health Science Center at Houston, Houston, TX 77030, USA and 4School of Dentistry, The University of Texas Health Science Center at Houston, Houston, TX 77030, USA Received August 13, 2019; Revised September 21, 2019; Editorial Decision October 03, 2019; Accepted October 03, 2019 ABSTRACT been used as therapeutic targets (3–8). For example, MET has lost the binding site of E3 ubiquitin ligase CBL through Exon skipping (ES) is reported to be the most com- exon 14 skipping event (9), resulting in an enhanced expres- mon alternative splicing event due to loss of func- sion level of MET. MET amplification drives the prolifera- tional domains/sites or shifting of the open read- tion of tumor cells. Multiple tyrosine kinase inhibitors, such ing frame (ORF), leading to a variety of human dis- as crizotinib, cabozantinib and capmatinib, have been used eases and considered therapeutic targets. To date, to treat patients with MET exon 14 skipping (10). Another systematic and intensive annotations of ES events example is the dystrophin gene (DMD) in Duchenne mus- based on the skipped exon units in cancer and cular dystrophy (DMD), a progressive neuromuscular dis- normal tissues are not available.
  • Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer

    Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer

    Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks, … , Karine Lefort, G. Paolo Dotto J Clin Invest. 2014;124(5):2260-2276. https://doi.org/10.1172/JCI72718. Research Article Oncology Downmodulation or loss-of-function mutations of the gene encoding NOTCH1 are associated with dysfunctional squamous cell differentiation and development of squamous cell carcinoma (SCC) in skin and internal organs. While NOTCH1 receptor activation has been well characterized, little is known about how NOTCH1 gene transcription is regulated. Using bioinformatics and functional screening approaches, we identified several regulators of the NOTCH1 gene in keratinocytes, with the transcription factors DLX5 and EGR3 and estrogen receptor β (ERβ) directly controlling its expression in differentiation. DLX5 and ERG3 are required for RNA polymerase II (PolII) recruitment to the NOTCH1 locus, while ERβ controls NOTCH1 transcription through RNA PolII pause release. Expression of several identified NOTCH1 regulators, including ERβ, is frequently compromised in skin, head and neck, and lung SCCs and SCC-derived cell lines. Furthermore, a keratinocyte ERβ–dependent program of gene expression is subverted in SCCs from various body sites, and there are consistent differences in mutation and gene-expression signatures of head and neck and lung SCCs in female versus male patients. Experimentally increased ERβ expression or treatment with ERβ agonists inhibited proliferation of SCC cells and promoted NOTCH1 expression and squamous differentiation both in vitro and in mouse xenotransplants. Our data identify a link between transcriptional control of NOTCH1 expression and the estrogen response in keratinocytes, with implications for differentiation therapy of squamous cancer. Find the latest version: https://jci.me/72718/pdf Research article Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks,1,2 Paola Ostano,3 Seung-Hee Jo,1,2 Jun Dai,1,2 Spiro Getsios,4 Piotr Dziunycz,5 Günther F.L.
  • Supplementary Materials

    Supplementary Materials

    Supplementary Materials: Supplemental Table 1 Abbreviations FMDV Foot and Mouth Disease Virus FMD Foot and Mouth Disease NC Non-treated Control DEGs Differentially Expressed Genes RNA-seq High-throughput Sequencing of Mrna RT-qPCR Quantitative Real-time Reverse Transcriptase PCR TCID50 50% Tissue Culture Infective Doses CPE Cytopathic Effect MOI Multiplicity of Infection DMEM Dulbecco's Modified Eagle Medium FBS Fetal Bovine Serum PBS Phosphate Buffer Saline QC Quality Control FPKM Fragments per Kilo bases per Million fragments method GO Gene Ontology KEGG Kyoto Encyclopedia of Genes and Genomes R Pearson Correlation Coefficient NFKBIA NF-kappa-B Inhibitor alpha IL6 Interleukin 6 CCL4 C-C motif Chemokine 4 CXCL2 C-X-C motif Chemokine 2 TNF Tumor Necrosis Factor VEGFA Vascular Endothelial Growth Gactor A CCL20 C-C motif Chemokine 20 CSF2 Macrophage Colony-Stimulating Factor 2 GADD45B Growth Arrest and DNA Damage Inducible 45 beta MYC Myc proto-oncogene protein FOS Proto-oncogene c-Fos MCL1 Induced myeloid leukemia cell differentiation protein Mcl-1 MAP3K14 Mitogen-activated protein kinase kinase kinase 14 IRF1 Interferon regulatory factor 1 CCL5 C-C motif chemokine 5 ZBTB3 Zinc finger and BTB domain containing 3 OTX1 Orthodenticle homeobox 1 TXNIP Thioredoxin-interacting protein ZNF180 Znc Finger Protein 180 ZNF36 Znc Finger Protein 36 ZNF182 Zinc finger protein 182 GINS3 GINS complex subunit 3 KLF15 Kruppel-like factor 15 Supplemental Table 2 Primers for Verification of RNA-seq-detected DEGs with RT-qPCR TNF F: CGACTCAGTGCCGAGATCAA R:
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Primate Specific Retrotransposons, Svas, in the Evolution of Networks That Alter Brain Function

    Primate Specific Retrotransposons, Svas, in the Evolution of Networks That Alter Brain Function

    Title: Primate specific retrotransposons, SVAs, in the evolution of networks that alter brain function. Olga Vasieva1*, Sultan Cetiner1, Abigail Savage2, Gerald G. Schumann3, Vivien J Bubb2, John P Quinn2*, 1 Institute of Integrative Biology, University of Liverpool, Liverpool, L69 7ZB, U.K 2 Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK 3 Division of Medical Biotechnology, Paul-Ehrlich-Institut, Langen, D-63225 Germany *. Corresponding author Olga Vasieva: Institute of Integrative Biology, Department of Comparative genomics, University of Liverpool, Liverpool, L69 7ZB, [email protected] ; Tel: (+44) 151 795 4456; FAX:(+44) 151 795 4406 John Quinn: Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK, [email protected]; Tel: (+44) 151 794 5498. Key words: SVA, trans-mobilisation, behaviour, brain, evolution, psychiatric disorders 1 Abstract The hominid-specific non-LTR retrotransposon termed SINE–VNTR–Alu (SVA) is the youngest of the transposable elements in the human genome. The propagation of the most ancient SVA type A took place about 13.5 Myrs ago, and the youngest SVA types appeared in the human genome after the chimpanzee divergence. Functional enrichment analysis of genes associated with SVA insertions demonstrated their strong link to multiple ontological categories attributed to brain function and the disorders. SVA types that expanded their presence in the human genome at different stages of hominoid life history were also associated with progressively evolving behavioural features that indicated a potential impact of SVA propagation on a cognitive ability of a modern human.
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming

    Supplemental Materials ZNF281 Enhances Cardiac Reprogramming

    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
  • Towards a Molecular Understanding of Microrna-Mediated Gene Silencing

    Towards a Molecular Understanding of Microrna-Mediated Gene Silencing

    REVIEWS NON-CODING RNA Towards a molecular understanding of microRNA-mediated gene silencing Stefanie Jonas and Elisa Izaurralde Abstract | MicroRNAs (miRNAs)­ are a conserved class of small non-coding RNAs that assemble with Argonaute proteins into miRNA-induced silencing complexes (miRISCs) to direct post-transcriptional silencing of complementary mRNA targets. Silencing is accomplished through a combination of translational repression and mRNA destabilization, with the latter contributing to most of the steady-state repression in animal cell cultures. Degradation of the mRNA target is initiated by deadenylation, which is followed by decapping and 5ʹ‑to‑3ʹ exonucleolytic decay. Recent work has enhanced our understanding of the mechanisms of silencing, making it possible to describe in molecular terms a continuum of direct interactions from miRNA target recognition to mRNA deadenylation, decapping and 5ʹ‑to‑3ʹ degradation. Furthermore, an intricate interplay between translational repression and mRNA degradation is emerging. Deadenylation MicroRNAs (mi­RNAs) are conserved post-transcriptional recruit additional protein partners to mediate silenc- 5,6 Shortening of mRNA poly(A) regulators of gene expression that are integral to ing . Silencing occurs through a combination of tails. In eukaryotes, this almost all known biological processes, including translational repression, deadenylation, decapping and process is catalysed by the cell growth, proliferation and differentiation, as well 5ʹ‑to‑3ʹ mRNA degradation5,6 (FIG. 1). The GW182 pro- consecutive but partially as organismal metabolism and development1. The teins play a central part in this process and are among redundant action of two 5,6 cytoplasmic deadenylase number of mi­RNAs encoded within the genomes of the most extensively studied AGO partners .
  • Profiling Data

    Profiling Data

    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
  • Redefining the Specificity of Phosphoinositide-Binding by Human

    Redefining the Specificity of Phosphoinositide-Binding by Human

    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.20.163253; this version posted June 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Redefining the specificity of phosphoinositide-binding by human PH domain-containing proteins Nilmani Singh1†, Adriana Reyes-Ordoñez1†, Michael A. Compagnone1, Jesus F. Moreno Castillo1, Benjamin J. Leslie2, Taekjip Ha2,3,4,5, Jie Chen1* 1Department of Cell & Developmental Biology, University of Illinois at Urbana-Champaign, Urbana, IL 61801; 2Department of Biophysics and Biophysical Chemistry, Johns Hopkins University School of Medicine, Baltimore, MD 21205; 3Department of Biophysics, Johns Hopkins University, Baltimore, MD 21218; 4Department of Biomedical Engineering, Johns Hopkins University, Baltimore, MD 21205; 5Howard Hughes Medical Institute, Baltimore, MD 21205, USA †These authors contributed equally to this work. *Correspondence: [email protected]. bioRxiv preprint doi: https://doi.org/10.1101/2020.06.20.163253; this version posted June 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. ABSTRACT Pleckstrin homology (PH) domains are presumed to bind phosphoinositides (PIPs), but specific interaction with and regulation by PIPs for most PH domain-containing proteins are unclear. Here we employed a single-molecule pulldown assay to study interactions of lipid vesicles with full-length proteins in mammalian whole cell lysates.
  • CUSTOM KINASE SUBSTRATE PROFILING (CKSP) SERVICE List of Available Active Protein Kinases This List May Change with Respect to Availability and Pricing

    CUSTOM KINASE SUBSTRATE PROFILING (CKSP) SERVICE List of Available Active Protein Kinases This List May Change with Respect to Availability and Pricing

    CUSTOM KINASE SUBSTRATE PROFILING (CKSP) SERVICE List of Available Active Protein Kinases This list may change with respect to availability and pricing. Protein Kinase Name Code U.S. Protein Kinase Name Code U.S. Price Price Abl1 AB01 $200.00 BUBR1(BUB1B) BU01 $600.00 Abl1 [E255K] AB02 $400.00 CaMK1δ (CAMK1D) CA03 $200.00 Abl1 [G250E] AB03 $400.00 CAMK1γ CA04 $200.00 Abl1 [H369P] AB04 $600.00 CAMK2α (CAMK2B) CA05 $200.00 Abl1 [T315I] AB05 $400.00 CaMK2β (CAMK2B) CA06 $200.00 Abl1 [Y253F] AB06 $400.00 CaMK2δ (CAMK2D) CA07 $400.00 Abl1 [M351T] AB07 $600.00 CaMK2γ (CAMK2G) CA08 $600.00 Abl1 [Q252H] AB08 $600.00 CAMK3γ CA09 $200.00 Abl2 (Arg) AB09 $200.00 CAMK4 CA10 $200.00 ACK AC01 $200.00 CAMK4 (CaMKIV ) CA11 $400.00 ACVR1 (ALK2 ) AC02 $400.00 CAMKK1 (CAMKKA ) CA12 $200.00 ACVRL1 AC03 $400.00 CAMKK2 CA13 $200.00 ADRBK1 (GRK2) AD01 $200.00 CAMKK2 (CaMKK beta ) CA14 $400.00 ADRBK2 (GRK3) AD02 $400.00 CDC42 BPA (MRCKA ) CD01 $400.00 Akt1/PKBα AK01 $200.00 CDC42 BPB (MRCKB ) CD02 $400.00 Akt1/PKBα [δPH, S473D] AK02 $600.00 CDC7/ASK CD03 $600.00 Akt1/PKBα [δPH] AK03 $600.00 CDK1/cyclin B1 CD04 $400.00 Akt2/PKBβ AK04 $200.00 CDK1/CyclinA2 CD05 $200.00 Akt2/PKBβ [δPH, S474D] AK05 $600.00 CDK2/cyclin A CD06 $400.00 Akt3/PKBγ AK06 $200.00 CDK2/Cyclin E1 CD07 $600.00 Akt3/PKBγ [S472D] AK07 $600.00 CDK2/CyclinA2 CD08 $200.00 ALK1 AL01 $200.00 CDK3/Cyclin E1 CD09 $600.00 ALK4 (ACVR1B) AL02 $200.00 CDK4//Cyclin D3 CD10 $600.00 AMPKα1/β1/γ1 (PRKAA1/B1/G1) AM01 $200.00 CDK4/Cyclin D1 CD11 $200.00 AMPKα1/β1/γ2 (PRKAA1/B1/G2) AM02 $200.00 CDK5 CD12 $600.00