ACAA1 (NM 001607) Human Tagged ORF Clone – RC200213L4 | Origene

Total Page:16

File Type:pdf, Size:1020Kb

Load more

OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC200213L4 ACAA1 (NM_001607) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ACAA1 (NM_001607) Human Tagged ORF Clone Tag: mGFP Symbol: ACAA1 Synonyms: ACAA; PTHIO; THIO Vector: pLenti-C-mGFP-P2A-Puro (PS100093) E. coli Selection: Chloramphenicol (34 ug/mL) Cell Selection: Puromycin ORF Nucleotide The ORF insert of this clone is exactly the same as(RC200213). Sequence: Restriction Sites: SgfI-MluI Cloning Scheme: ACCN: NM_001607 ORF Size: 1272 bp This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 ACAA1 (NM_001607) Human Tagged ORF Clone – RC200213L4 OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. RefSeq: NM_001607.2 RefSeq Size: 1840 bp RefSeq ORF: 1275 bp Locus ID: 30 UniProt ID: P09110, A0A024R2M6 Domains: thiolase Protein Pathways: Biosynthesis of unsaturated fatty acids, Fatty acid metabolism, Metabolic pathways, PPAR signaling pathway, Valine, leucine and isoleucine degradation MW: 44.3 kDa Gene Summary: This gene encodes an enzyme operative in the beta-oxidation system of the peroxisomes. Deficiency of this enzyme leads to pseudo-Zellweger syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008] This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.
Recommended publications
  • The Database of Chromosome Imbalance Regions and Genes

    The Database of Chromosome Imbalance Regions and Genes

    Lo et al. BMC Cancer 2012, 12:235 http://www.biomedcentral.com/1471-2407/12/235 RESEARCH ARTICLE Open Access The database of chromosome imbalance regions and genes resided in lung cancer from Asian and Caucasian identified by array-comparative genomic hybridization Fang-Yi Lo1, Jer-Wei Chang1, I-Shou Chang2, Yann-Jang Chen3, Han-Shui Hsu4, Shiu-Feng Kathy Huang5, Fang-Yu Tsai2, Shih Sheng Jiang2, Rajani Kanteti6, Suvobroto Nandi6, Ravi Salgia6 and Yi-Ching Wang1* Abstract Background: Cancer-related genes show racial differences. Therefore, identification and characterization of DNA copy number alteration regions in different racial groups helps to dissect the mechanism of tumorigenesis. Methods: Array-comparative genomic hybridization (array-CGH) was analyzed for DNA copy number profile in 40 Asian and 20 Caucasian lung cancer patients. Three methods including MetaCore analysis for disease and pathway correlations, concordance analysis between array-CGH database and the expression array database, and literature search for copy number variation genes were performed to select novel lung cancer candidate genes. Four candidate oncogenes were validated for DNA copy number and mRNA and protein expression by quantitative polymerase chain reaction (qPCR), chromogenic in situ hybridization (CISH), reverse transcriptase-qPCR (RT-qPCR), and immunohistochemistry (IHC) in more patients. Results: We identified 20 chromosomal imbalance regions harboring 459 genes for Caucasian and 17 regions containing 476 genes for Asian lung cancer patients. Seven common chromosomal imbalance regions harboring 117 genes, included gain on 3p13-14, 6p22.1, 9q21.13, 13q14.1, and 17p13.3; and loss on 3p22.2-22.3 and 13q13.3 were found both in Asian and Caucasian patients.
  • Downloaded Per Proteome Cohort Via the Web- Site Links of Table 1, Also Providing Information on the Deposited Spectral Datasets

    Downloaded Per Proteome Cohort Via the Web- Site Links of Table 1, Also Providing Information on the Deposited Spectral Datasets

    www.nature.com/scientificreports OPEN Assessment of a complete and classifed platelet proteome from genome‑wide transcripts of human platelets and megakaryocytes covering platelet functions Jingnan Huang1,2*, Frauke Swieringa1,2,9, Fiorella A. Solari2,9, Isabella Provenzale1, Luigi Grassi3, Ilaria De Simone1, Constance C. F. M. J. Baaten1,4, Rachel Cavill5, Albert Sickmann2,6,7,9, Mattia Frontini3,8,9 & Johan W. M. Heemskerk1,9* Novel platelet and megakaryocyte transcriptome analysis allows prediction of the full or theoretical proteome of a representative human platelet. Here, we integrated the established platelet proteomes from six cohorts of healthy subjects, encompassing 5.2 k proteins, with two novel genome‑wide transcriptomes (57.8 k mRNAs). For 14.8 k protein‑coding transcripts, we assigned the proteins to 21 UniProt‑based classes, based on their preferential intracellular localization and presumed function. This classifed transcriptome‑proteome profle of platelets revealed: (i) Absence of 37.2 k genome‑ wide transcripts. (ii) High quantitative similarity of platelet and megakaryocyte transcriptomes (R = 0.75) for 14.8 k protein‑coding genes, but not for 3.8 k RNA genes or 1.9 k pseudogenes (R = 0.43–0.54), suggesting redistribution of mRNAs upon platelet shedding from megakaryocytes. (iii) Copy numbers of 3.5 k proteins that were restricted in size by the corresponding transcript levels (iv) Near complete coverage of identifed proteins in the relevant transcriptome (log2fpkm > 0.20) except for plasma‑derived secretory proteins, pointing to adhesion and uptake of such proteins. (v) Underrepresentation in the identifed proteome of nuclear‑related, membrane and signaling proteins, as well proteins with low‑level transcripts.
  • Functional TLR5 Genetic Variants Affect Human Colorectal Cancer Survival

    Functional TLR5 Genetic Variants Affect Human Colorectal Cancer Survival

    Published OnlineFirst October 23, 2013; DOI: 10.1158/0008-5472.CAN-13-1746 Cancer Prevention and Epidemiology Research Functional TLR5 Genetic Variants Affect Human Colorectal Cancer Survival Sascha N. Klimosch1, Asta Forsti€ 4,9, Jana Eckert4, Jelena Knezevic5, Melanie Bevier4, Witigo von Schonfels€ 6, Nils Heits6, Jessica Walter6, Sebastian Hinz6, Jesus Lascorz4, Jochen Hampe7, Dominik Hartl2, Julia-Stefanie Frick3, Kari Hemminki4,9, Clemens Schafmayer6,8, and Alexander N.R. Weber1,5 Abstract Toll-like receptors (TLR) are overexpressed on many types of cancer cells, including colorectal cancer cells, but little is known about the functional relevance of these immune regulatory molecules in malignant settings. Here, we report frequent single-nucleotide polymorphisms (SNP) in the flagellin receptor TLR5 and the TLR downstream effector molecules MyD88 and TIRAP that are associated with altered survival in a large cohort of Caucasian patients with colorectal cancer (n ¼ 613). MYD88 rs4988453, a SNP that maps to a promoter region shared with the acetyl coenzyme-A acyl-transferase-1 (ACAA1), was associated with decreased survival of patients with colorectal cancer and altered transcriptional activity of the proximal genes. In the TLR5 gene, rs5744174/ F616L was associated with increased survival, whereas rs2072493/N592S was associated with decreased survival. Both rs2072493/N592S and rs5744174/F616L modulated TLR5 signaling in response to flagellin or to different commensal and pathogenic intestinal bacteria. Notably, we observed a reduction in flagellin-induced p38 phosphorylation, CD62L shedding, and elevated expression of interleukin (IL)-6 and IL-1b mRNA in human primary immune cells from TLR5 616LL homozygote carriers, as compared with 616FF carriers.
  • Restores the Expression of Down-Regulated Fatty Acid

    Restores the Expression of Down-Regulated Fatty Acid

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Springer - Publisher Connector Kumar et al. Nutrition & Metabolism (2015) 12:8 DOI 10.1186/s12986-015-0003-8 RESEARCH Open Access The beta-3 adrenergic agonist (CL-316,243) restores the expression of down-regulated fatty acid oxidation genes in type 2 diabetic mice Amit Kumar1,2, Joseph Shiloach1, Michael J Betenbaugh2 and Emily J Gallagher3* Abstract Background: The hallmark of Type 2 diabetes (T2D) is hyperglycemia, although there are multiple other metabolic abnormalities that occur with T2D, including insulin resistance and dyslipidemia. To advance T2D prevention and develop targeted therapies for its treatment, a greater understanding of the alterations in metabolic tissues associated with T2D is necessary. The aim of this study was to use microarray analysis of gene expression in metabolic tissues from a mouse model of pre-diabetes and T2D to further understand the metabolic abnormalities that may contribute to T2D. We also aimed to uncover the novel genes and pathways regulated by the insulin sensitizing agent (CL-316,243) to identify key pathways and target genes in metabolic tissues that can reverse the diabetic phenotype. Methods: Male MKR mice on an FVB/n background and age matched wild-type (WT) FVB/n mice were used in all experiments. Skeletal muscle, liver and fat were isolated from prediabetic (3 week old) and diabetic (8 week old) MKR mice. Male MKR mice were treated with CL-316,243. Skeletal muscle, liver and fat were isolated after the treatment period. RNA was isolated from the metabolic tissues and subjected to microarray and KEGG database analysis.
  • Comparative Transcriptome Profile Between Iberian Pig Varieties

    Comparative Transcriptome Profile Between Iberian Pig Varieties

    animals Article Comparative Transcriptome Profile between Iberian Pig Varieties Provides New Insights into Their Distinct Fat Deposition and Fatty Acids Content Ana Villaplana-Velasco 1,2, Jose Luis Noguera 3, Ramona Natacha Pena 4 , Maria Ballester 5, Lourdes Muñoz 6, Elena González 7 , Juan Florencio Tejeda 7 and Noelia Ibáñez-Escriche 8,* 1 Genetics and Genomics, The Roslin Institute, Royal (Dick) School of Veterinary Studies, The University of Edinburgh, Easter Bush Campus, Midlothian, Edinburgh EH25 9RG, UK; [email protected] 2 Centre for Medical Informatics, Usher Institute, The University of Edinburgh, 9 Little France Road, Edinburgh EH16 4UX, UK 3 Animal Breeding and Genetics Program, IRTA, 25198 Lleida, Spain; [email protected] 4 Departament de Ciència Animal, Universitat de Lleida-Agrotecnio Center, 25198 Lleida, Spain; [email protected] 5 Animal Breeding and Genetics Program, IRTA, Torre Marimon, 08140 Caldes de Montbui, Spain; [email protected] 6 INGA FOOD S.A, 06200 Almendralejo, Spain; [email protected] 7 Department of Animal Production and Food Science, Research University Institute of Agricultural Resources (INURA), Escuela de Ingenierías Agrarias, Universidad de Extremadura, 06007 Badajoz, Spain; [email protected] (E.G.); [email protected] (J.F.T.) 8 Department for Animal Science and Tecnology, Universistat Politécnica de València, 46022 Valencia, Spain * Correspondence: [email protected]; Tel.: +34-963-877-438 Citation: Villaplana-Velasco, A.; Noguera, J.L.; Pena, R.N.; Ballester, Simple Summary: Iberian pigs are meat quality models due to their high fat content, high intra- M.; Muñoz, L.; González, E.; Tejeda, J.F.; Ibáñez-Escriche, N.
  • Regional Copy Number–Independent Deregulation of Transcription in Cancer

    Regional Copy Number–Independent Deregulation of Transcription in Cancer

    A R T I C L E S Regional copy number–independent deregulation enetics of transcription in cancer Nicolas Stransky1,13, Ce´line Vallot1,13, Fabien Reyal1, Isabelle Bernard-Pierrot1, Sixtina Gil Diez de Medina1,2, 3 4 5 5 5 5 .com/natureg Rick Segraves , Yann de Rycke , Paul Elvin , Andrew Cassidy , Carolyn Spraggon , Alexander Graham , Jennifer Southgate6, Bernard Asselain4, Yves Allory2,7, Claude C Abbou2,8, Donna G Albertson3,9, Jean Paul Thiery1,10,11, Dominique K Chopin2,8,12, Daniel Pinkel3 & Franc¸ois Radvanyi1 .nature Genetic and epigenetic alterations have been identified that lead to transcriptional deregulation in cancers. Genetic mechanisms may affect single genes or regions containing several neighboring genes, as has been shown for DNA copy number changes. It http://www was recently reported that epigenetic suppression of gene expression can also extend to a whole region; this is known as long- range epigenetic silencing. Various techniques are available for identifying regional genetic alterations, but no large-scale analysis oup has yet been carried out to obtain an overview of regional epigenetic alterations. We carried out an exhaustive search for regions Gr susceptible to such mechanisms using a combination of transcriptome correlation map analysis and array CGH data for a series of bladder carcinomas. We validated one candidate region experimentally, demonstrating histone methylation leading to the loss of expression of neighboring genes without DNA methylation. lishing Pub Changes to gene expression patterns are an important feature of second approach involves trying to identify groups of neighboring cancer cells. These alterations are caused directly or indirectly by genes with correlated expression levels.
  • ACAA1 (NM 001607) Human Tagged ORF Clone Product Data

    ACAA1 (NM 001607) Human Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC200213 ACAA1 (NM_001607) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ACAA1 (NM_001607) Human Tagged ORF Clone Tag: Myc-DDK Symbol: ACAA1 Synonyms: ACAA; PTHIO; THIO Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC200213 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCAGAGGCTGCAGGTAGTGCTGGGCCACCTGAGGGGTCCGGCCGATTCCGGCTGGATGCCGCAGGCCG CGCCTTGCCTGAGCGGTGCCCCGCAGGCCTCGGCCGCGGACGTGGTGGTGGTGCACGGGCGGCGCACGGC CATCTGCCGGGCGGGCCGCGGCGGCTTCAAGGACACCACCCCCGACGAGCTTCTCTCGGCAGTCATGACC GCGGTTCTCAAGGACGTGAATCTGAGGCCGGAACAGCTGGGGGACATCTGTGTCGGAAATGTGCTGCAGC CTGGGGCCGGGGCAATCATGGCCCGAATCGCCCAGTTTCTGAGTGACATCCCGGAGACTGTGCCTTTGTC CACTGTCAATAGACAGTGTTCGTCGGGGCTACAGGCAGTGGCCAGCATAGCAGGTGGCATCAGAAATGGG TCTTATGACATTGGCATGGCCTGTGGGGTGGAGTCCATGTCCCTGGCTGACAGAGGGAACCCTGGAAATA TTACTTCGCGCTTGATGGAGAAGGAGAAGGCCAGAGATTGCCTGATTCCTATGGGGATAACCTCTGAGAA TGTGGCTGAGCGGTTTGGCATTTCACGGGAGAAGCAGGATACCTTTGCCCTGGCTTCCCAGCAGAAGGCA GCAAGAGCCCAGAGCAAGGGCTGTTTCCAAGCTGAGATTGTGCCTGTGACCACCACGGTCCATGATGACA AGGGCACCAAGAGGAGCATCACTGTGACCCAGGATGAGGGTATCCGCCCCAGCACCACCATGGAGGGCCT GGCCAAACTGAAGCCTGCCTTCAAGAAAGATGGTTCTACCACAGCTGGAAACTCTAGCCAGGTGAGTGAT GGGGCAGCTGCCATCCTGCTGGCCCGGAGGTCCAAGGCAGAAGAGTTGGGCCTTCCCATCCTTGGGGTCC
  • Table 10: H. Sapiens Recon 1 Network Confidence Scores and Citations

    Table 10: H. Sapiens Recon 1 Network Confidence Scores and Citations

    Table 10: H. sapiens Recon 1 network confidence scores and citations. Alphabetized list of reactions and their corresponding confidence scores, literature citations, and curator notes. Confidence scores (ranging from 0 to 3) are defined in the text. Reaction Abbreviation Score Authors Article or Book Title Journal Year PubMed ID Curation Notes This reaction takes place in kidney Human 25-hydroxyvitamin D 24-hydroxylase based on Vitamins, G.F.M. Ball,2004, Blackwell publishing, Labuda M, Lemieux N, Tihy cytochrome P450 subunit maps to a different 24,25VITD2Hm 3 J Bone Miner Res 1993 8266831 1st ed (book) pg.196 F, Prinster C, Glorieux FH. chromosomal location than that of pseudovitamin D- 1-4 ng/ml blood deficient rickets. is produced if neither ca2+ nor pi i needed (regulated by these compounds concentration) IT This reaction takes place in kidney Kusudo T, Sakaki T, Abe D, based on Vitamins, G.F.M. Ball,2004, Blackwell publishing, Fujishima T, Kittaka A, Metabolism of A-ring diastereomers of 1alpha,25- Biochem Biophys Res 24,25VITD2Hm 3 2004 15358094 1st ed (book) pg.196 Takayama H, Hatakeyama S, dihydroxyvitamin D3 by CYP24A1. Commun 1-4 ng/ml blood Ohta M, Inouye K. is produced if neither ca2+ nor pi i needed (regulated by these compounds concentration) IT This reaction takes place in kidney St-Arnaud R, Messerlian S, The 25-hydroxyvitamin D 1-alpha-hydroxylase gene based on Vitamins, G.F.M. Ball,2004, Blackwell publishing, 25VITD3Hm 3 Moir JM, Omdahl JL, Glorieux maps to the pseudovitamin D-deficiency rickets J Bone Miner Res 1997 9333115 1st ed (book) pg.196 FH.
  • A Novel Missense Variant in ACAA1 Contributes to Early-Onset

    A Novel Missense Variant in ACAA1 Contributes to Early-Onset

    Signal Transduction and Targeted Therapy www.nature.com/sigtrans ARTICLE OPEN A novel missense variant in ACAA1 contributes to early-onset Alzheimer’s disease, impairs lysosomal function, and facilitates amyloid-β pathology and cognitive decline ✉ Rongcan Luo1 ,YuFan1, Jing Yang1,2, Maosen Ye1,2, Deng-Feng Zhang1, Kun Guo3, Xiao Li1,2, Rui Bi1, Min Xu1, Lu-Xiu Yang1,YuLi1,2, ✉ Xiaoqian Ran1,2, Hong-Yan Jiang4, Chen Zhang5, Liwen Tan6, Nengyin Sheng3,7 and Yong-Gang Yao 1,2,8 Alzheimer’s disease (AD) is characterized by progressive synaptic dysfunction, neuronal death, and brain atrophy, with amyloid-β (Aβ) plaque deposits and hyperphosphorylated tau neurofibrillary tangle accumulation in the brain tissue, which all lead to loss of cognitive function. Pathogenic mutations in the well-known AD causal genes including APP, PSEN1, and PSEN2 impair a variety of pathways, including protein processing, axonal transport, and metabolic homeostasis. Here we identified a missense variant rs117916664 (c.896T>C, p.Asn299Ser [p.N299S]) of the acetyl-CoA acyltransferase 1 (ACAA1) gene in a Han Chinese AD family by whole-genome sequencing and validated its association with early-onset familial AD in an independent cohort. Further in vitro and in vivo evidence showed that ACAA1 p.N299S contributes to AD by disturbing its enzymatic activity, impairing lysosomal function, and aggravating the Aβ pathology and neuronal loss, which finally caused cognitive impairment in a murine model. Our findings reveal a fundamental role of peroxisome-mediated lysosomal dysfunction in AD pathogenesis. 1234567890();,: Signal Transduction and Targeted Therapy (2021) 6:325; https://doi.org/10.1038/s41392-021-00748-4 INTRODUCTION regions, with unknown function annotation and a small-to- Alzheimer’s disease (AD, MIM: 104300) is a devastating neurode- moderate effect sizes (odds ratio [OR] <1.2).
  • An Enhancer Cluster Controls Gene Activity and Topology of the SCN5A-SCN10A Locus in Vivo

    An Enhancer Cluster Controls Gene Activity and Topology of the SCN5A-SCN10A Locus in Vivo

    ARTICLE https://doi.org/10.1038/s41467-019-12856-5 OPEN An enhancer cluster controls gene activity and topology of the SCN5A-SCN10A locus in vivo Joyce C.K. Man1, Rajiv A. Mohan1,3, Malou van den Boogaard1,3, Catharina R.E. Hilvering2, Catherine Jenkins1, Vincent Wakker1, Valerio Bianchi 2, Wouter de Laat2, Phil Barnett1, Bastiaan J. Boukens1 & Vincent M. Christoffels1* Mutations and variations in and around SCN5A, encoding the major cardiac sodium channel, 1234567890():,; influence impulse conduction and are associated with a broad spectrum of arrhythmia dis- orders. Here, we identify an evolutionary conserved regulatory cluster with super enhancer characteristics downstream of SCN5A, which drives localized cardiac expression and contains conduction velocity-associated variants. We use genome editing to create a series of dele- tions in the mouse genome and show that the enhancer cluster controls the conformation of a >0.5 Mb genomic region harboring multiple interacting gene promoters and enhancers. We find that this cluster and its individual components are selectively required for cardiac Scn5a expression, normal cardiac conduction and normal embryonic development. Our studies reveal physiological roles of an enhancer cluster in the SCN5A-SCN10A locus, show that it controls the chromatin architecture of the locus and Scn5a expression, and suggest that genetic variants affecting its activity may influence cardiac function. 1 Department of Medical Biology, Amsterdam Cardiovascular Sciences, Academic Medical Center, Amsterdam, The Netherlands.
  • Viewed Hematoxylin and Eosin (HE) Slides of RCC and Ethical Approval Normal Kidney Tissue

    Viewed Hematoxylin and Eosin (HE) Slides of RCC and Ethical Approval Normal Kidney Tissue

    The Author(s) BMC Cancer 2016, 16(Suppl 2):741 DOI 10.1186/s12885-016-2775-2 RESEARCH ARTICLE Open Access Cyclin D1 as a therapeutic target of renal cell carcinoma- a combined transcriptomics, tissue microarray and molecular docking study from the Kingdom of Saudi Arabia Sajjad Karim1*, Jaudah A. Al-Maghrabi2,3, Hasan M. A. Farsi4, Ahmad J. Al-Sayyad4, Hans-Juergen Schulten1, Abdelbaset Buhmeida1, Zeenat Mirza5, Alaa A. Al-boogmi1, Fai T. Ashgan1, Manal M. Shabaad1, Hend F. NourEldin1, Khalid B. M. Al-Ghamdi6, Adel Abuzenadah1,7, Adeel G. A. Chaudhary1 and Mohammed H. Al-Qahtani1* From 3rd International Genomic Medicine Conference Jeddah, Saudi Arabia. 30 November - 3 December 2015 Abstract Background: Renal cell carcinoma (RCC) is a seventh ranked malignancy with poor prognosis. RCC is lethal at metastatic stage as it does not respond to conventional systemic treatments, and there is an urgent need to find out promising novel biomarkers for effective treatment. The goal of this study was to evaluate the biomarkers that can be potential therapeutic target and predict effective inhibitors to treat the metastatic stage of RCC. Methods: We conducted transcriptomic profiling to identify differentially expressed genes associated with RCC. Molecular pathway analysis was done to identify the canonical pathways and their role in RCC. Tissue microarrays (TMA) based immunohistochemical stains were used to validate the protein expression of cyclinD1 (CCND1) and were scored semi-quantitatively from 0 to 3+ on the basis of absence or presence of staining intensity in the tumor cell. Statistical analysis determined the association of CCND1 expression with RCC.
  • Fat Deposition in the Muscle of Female and Male Yak and the Correlation of Yak Meat Quality with Fat

    Fat Deposition in the Muscle of Female and Male Yak and the Correlation of Yak Meat Quality with Fat

    animals Article Fat Deposition in the Muscle of Female and Male Yak and the Correlation of Yak Meat Quality with Fat Lin Xiong 1,2, Jie Pei 1,2 , Min Chu 1,2, Xiaoyun Wu 1,2, Qudratullah Kalwar 3, Ping Yan 1,2,* and Xian Guo 1,2,* 1 Animal Science Department, Lanzhou Institute of Husbandry and Pharmaceutical Sciences, Chinese Academy of Agricultural Sciences, Lanzhou 730050, China; [email protected] (L.X.); [email protected] (J.P.); [email protected] (M.C.); [email protected] (X.W.) 2 Key Laboratory for Yak Genetics, Breeding, and Reproduction Engineering of Gansu Province, Lanzhou 730050, China 3 Department of Animal Reproduction, Shaheed Benazir Bhutto University of Veterinary and Animal Sciences, Sakrand 67210, Pakistan; [email protected] * Correspondence: [email protected] (P.Y.); [email protected] (X.G.); Tel.: +86-0931-2115288 (P.Y.); +86-0931-2115271 (X.G.) Simple Summary: The type and quantity of fat are among the key factors influencing the carcass and meat quality in yak. The effect of gender to fat in yak and the correlation of meat quality with fat were studied in this paper. The meat of male yaks (MYs) is healthier from the point of nutritional value, whereas the meat of female yaks (FYs) possesses better qualities in relation to the visual impact and mouthfeel. The below results can provide a theoretical basis for the deep processing of yak meat. Yak meat quality (especially tenderness) can be improved by increasing the content of fat, C18:0, cis-C18:2, and cis-C18:1 in muscle during yak production.