THE ISOLATION AND BIOLOGICAL EVALUATION OF ANTI-INFLAMMATORY

AND CHEMOPREVENTIVE TRITERPENOID NATURAL PRODUCTS

By

EMILY CLEGG BARKER

Submitted in partial fulfillment of the requirements

For the degree of Doctor of Philosophy

Thesis Advisors: Gregory P. Tochtrop, Ph.D. and John J. Letterio, M.D.

Department of Chemistry

CASE WESTERN RESERVE UNIVERSITY

May, 2015 CASE WESTERN RESERVE UNIVERSITY

SCHOOL OF GRADUATE STUDIES

We hereby approve the thesis/dissertation of

Emily C. Barker

Candidate for the Doctor of Philosophy degree*

(signed) ______Dr. Michael G. Zagorski

(Committee Chair)

______Dr. Rajesh Viswanathan

______Dr. John J. Mieyal

______Dr. John J. Letterio

______Dr. Gregory P. Tochtrop

(date) ______May 20, 2014

*We also certify that written approval has been obtained

for any proprietary material contained therein I dedicate this work to my Parents.

Thank you for teaching by word and by example what it means to

“Stick to your task ‘til it sticks to you.” Table of Contents

Table of Contents ...... i

List of Tables ...... iv

List of Figures ...... v

Acknowledgements ...... viii

List of Abbreviations ...... x

Abstract ...... xvi

Chapter 1: Introduction ...... 1

1.1 Natural products in medicine ...... 1

1.1.1 History of natural products in medicine through the 19th century ...... 1

1.1.2 Natural products in medicine during the recent century ...... 3

1.2 Triterpenoids ...... 5

1.2.1 Natural triterpenoid, bryonolic acid ...... 8

1.2.2 Natural triterpenoid, celastrol ...... 9

1.2.3 Potential of triterpenoids in cancer chemoprevention ...... 10

1.3 Cancer chemoprevention ...... 13

1.3.1 The cancer burden ...... 14

1.3.2 Chemoprevention background ...... 15

1.3.3 Progress and success in cancer chemoprevention ...... 17

1.4 Carcinogenesis ...... 18

1.4.1 Inflammation in carcinogenesis ...... 19

1.4.2 Colorectal cancer: a model example for inflammation-driven carcinogenesis .23

i 1.5 Cellular pathways as targets for chemoprevention ...... 25

1.5.1 NF-κB and pro-inflammatory signaling ...... 26

1.5.2 Nrf2 and cytoprotective signaling ...... 27

1.5.3 Nrf2 historical background ...... 28

1.5.4 Nrf2 as a target for chemoprevention ...... 33

1.6 Scope of this work ...... 39

1.7 References ...... 41

Chapter 2: Bryonolic Acid: A Large-Scale Isolation and Evaluation of Heme Oxygenase

1 expression in Activated Macrophages ...... 64

2.1 Introduction ...... 64

2.2 Results and discussion ...... 65

2.3 Experimental methods ...... 73

2.4 Acknowledgement ...... 77

2.5 Bryonolic acid NMR spectra ...... 79

2.6 References ...... 82

Chapter 3: Selection and Screening of Anti-inflammatory Herbal Extracts ...... 86

3.1 Introduction ...... 86

3.2 Results and discussion ...... 87

3.3 Conclusions ...... 95

3.4 Experimental methods ...... 96

3.5 Acknowledgements ...... 99

3.6 References ...... 100

ii Chapter 4: Natural Triterpenoid, Celastrol, as an Anti-inflammatory, Inducer of

Cytoprotective Gene Expression and Chemopreventive in Colon Cancer ...... 104

4.1 Introduction ...... 104

4.2 Results and Discussion ...... 107

4.3 Conclusion ...... 123

4.4 Experimental methods ...... 126

4.5 Acknowledgements ...... 132

4.6 References ...... 133

Chapter 5: Future Directions and Project Summary ...... 141

5.1 Validation of celastrol as chemopreventive in colitis-associated colon cancer ....141

5.2 Further exploration of the active natural triterpenoids ...... 144

5.3 Identification of Keap1 as a cellular target of celastrol ...... 147

5.4 Project summary and impact ...... 149

5.5 Acknowledgements ...... 151

5.6 References ...... 152

Appendix ...... 155

A.1 Cell viability in RAW 264.7 cells treated with celastrol ...... 155

A.2 Cell viability in RAW 264.7 cells treated with celastrol and LPS ...... 156

A.3 Cell viability in Peritoneal Macrophages treated with celastrol ...... 157

A.4 Cell viability in Peritoneal Macrophages treated with celastrol and LPS ...... 158

A.5 Gross necropsy statistics for in vivo study in Smad4co/co;Lck-crep27Kip1-/- (DKO) mice

...... 159

Bibliography ...... 160

iii List of Tables

Table 3.1: Concentrations of Extracts Resuspended in DMSO ...... 98

Table 4.1: Primer sequences used for probes in qRT-PCR ...... 131

iv List of Figures

Figure 1.1: Triterpenoid Biosynthesis ...... 7

Figure 1.2: Pentacyclic Triterpenoids Relevant to this Thesis ...... 10

Figure 1.3: Carcinogenesis and Inflammation in Carcinogenesis ...... 22

Figure 1.4: Pro-inflammatory NFκB Pathway ...... 27

Figure 1.5: Cytoprotective and Antioxidant Signaling Pathway ARE/Nrf2/Keap1 ...... 33

Figure 1.6: Nrf2-inducing Molecules Showing Clinical Potential ...... 35

Figure 2.1: Bryonolic Acid Structure and Numbering ...... 64

Figure 2.2: HO-1 Induction by Bryonolic Acid ...... 66

Figure 2.3: HPLC Traces for Extracts from the Fine Hairy Root, Stemroot, and

Dicotyledon Leaf Body of 14 Day-old Germinations ...... 68

Figure 2.4: Bryonolic Acid Production in Cucurbita pepo L. under Two Growth

Conditions ...... 70

Figure 2.5: Comparing Maximum Bryonolic Acid Production under Two Growth

Conditions ...... 72

Figure 2.6: 1H NMR Spectra of Bryonolic Acid ...... 79

Figure 2.7: 13C NMR Spectra of Bryonolic Acid, 15-55 ppm ...... 80

Figure 2.8: 13C NMR Spectra of Bryonolic Acid, 80-180 ppm ...... 81

Figure 3.1: Schematic for Herbal Extract Screen ...... 88

Figure 3.2: Griess Assay for G. max root extract and A. vera leaf extract ...... 89

Figure 3.3: Griess Assay for T. wilfordii root extract, R. coptidis, R. gentianae, and B. chinense dry plant extract and G. max dry root extract ...... 90

v Figure 3.4: Known Active Constituents of Tripterygium wilfordii ...... 91

Figure 3.5: Griess Assay for T. wilfordii root extract, R. gentianae, and B. chinense dry plant extract, C. unshiu dry peel extract and A. euchroma dry plant extract ...... 92

Figure 3.6: Griess Assay for A. annua plant extract, G. biloba nut fruit extract and G. max dry root extract ...... 94

Figure 3.7: Griess Assay for P. ginseng root extract, Andrographitis supplement extract

(A. paniculata) and A. annua plant extract ...... 94

Figure 3.8: Extract Summary as Percent of Control ...... 96

Figure 4.1: Structure of Celastrol ...... 107

Figure 4.2: Celastrol Inhibits Nitric Oxide in Activated RAW 264.7 Cells ...... 108

Figure 4.3: Celastrol Inhibits iNOS Expression and Induces HO-1 Expression in

Activated RAW 264.7 Cells ...... 109

Figure 4.4 Time Course Inhibition of iNOS and Induction of HO-1 by Celastrol in RAW

264.7 Cells ...... 109

Figure 4.5: Celastrol Inhibits Expression of iNOS and COX-2 in Primary Macrophages

Activated with LPS ...... 110

Figure 4.6: Time Course Induction of HO-1 by Celastrol in RAW 264.7 Cells without

LPS ...... 111

Figure 4.7: Time course induction of multiple Nrf2 targets by celastrol in RAW 264.7 cells as shown by qRT-PCR ...... 112

Figure 4.8: Celastrol Shows Partial Dependence on Nrf2 in Induction of Multiple

Cytoprotective Genes as Shown by qRT-PCR ...... 114

Figure 4.9: Celastrol Induction of HO-1 is Nrf2-dependent as Shown by Western ...... 115

vi Figure 4.10: Experimental Scheme in vivo ...... 116

Figure 4.11: Celastrol Increases Survival and Weight Maintenance in DKO Mice Over

Time ...... 118

Figure 4.12: Celastrol Inhibits Disease Progression in DKO Mice ...... 118

Figure 4.13: Celastrol Inhibits Colon Thickening and Disease in DKO Mice Shown

Histologically ...... 119

Figure 4.14: Celastrol Suppresses iNOS and Nitric Oxide in DKO Tissues ...... 121

Figure 4.15: Effect of Celastrol on COX-2 and Cytokines in DKO Colon Epithelia ....121

Figure 4.16: Celastrol Induces Cytoprotective Phase 2 Genes in DKO Colon Epithelia

...... 123

Figure 5.1: Weight Change and Survival in Acute Inflammation Study in vivo ...... 143

Figure 5.2: Histology for Acute Inflammation Study in vivo ...... 143

Figure 5.3: Quinone Methide Triterpenoids in Tripterygium wilfordii ...... 146

Figure 5.4: Monitoring Celastrol Reaction with Amino Acids by UV ...... 148

vii Acknowledgements

I would like to first acknowledge the mentorship of Dr. Greg Tochtrop and Dr.

John Letterio. I thank them for giving me the freedom to work independently and to think critically about my work, while always making themselves available to offer necessary input and advice. They have been tremendously supportive and have helped me to grow as a scientist and as a professional. I especially appreciate their taking a personal interest in helping me to achieve my career goals. I also thank my committee members Dr.

Michael Zagorski, Dr. Rajesh Viswanathan and Dr. John Mieyal for help and advice over the years. I acknowledge the office staff in the Department of Chemistry for taking care of all administrative tasks with regard to my progress and support in the program. I received financial support through a predoctoral fellowship from the National Institutes of Health. I also appreciate The Reuter Foundation for their generous contributions.

I greatly appreciate all those who inspired me to pursue the sciences and mentored me along the way. Principal among these are Rebecca Jensen and Dwight Brown of

Bountiful High School whose enthusiasm for chemistry and biology were sufficiently contagious to inspire my path into the sciences. I am also indebted to Drs. Katie Ullman,

Amy Prunuske and Diana Stafforini whose tremendous research mentorship at the

University of Utah helped to foster my ability to think critically and draw scientific conclusions.

I would like to express my great appreciation to colleagues, past and present, from both the Tochtrop and Letterio labs. Particularly, I thank Drs. Sung Hee Choi and Byung-

Gyu Kim for laboratory mentorship and critical scientific feedback in the biological

viii aspects of my work. I also express my gratitude for the companionship of dear friends from both lab groups for providing opinions and lively conversation on all aspects of science and life. Particular thanks go to Tonibelle Gatbonton-Schwager and Eric Lam who shared and empathized through the ups and downs of graduate student life.

On a more personal note, I express deep thanks to my parents, Daniel and Laurie

Clegg, for their ceaseless confidence in my abilities. I thank them for their support in every season of life and for their belief in my capacity to achieve. I also express gratitude to my dear siblings and to all of my in-laws for their encouragement throughout this venture.

Lastly, I acknowledge my two patient toddlers, William and Paul, and my incredibly supportive husband, Sam Barker. Sam has far exceeded all expectations of a devoted and encouraging spouse. I thank him for his cheerful disposition and characteristic optimism, which helped to make this journey the positive and nurturing experience that it has been.

ix List of Abbreviations

°C Degrees Celsius

A. annua Artemisia annua

A. euchroma Arnebia euchroma

A. paniculata Andrographis paniculata

A. vera Aloe vera

Abs Absorbance

ADT Anethole dithiolethione

AOM Azoxymethane

ARE Antioxidant response element

B. chinense Bupleurum chinense

BA Bryonolic acid

C. Pepo L. Curcubita pepo L.

C. unshiu Citri unshiu pericarpium

C. roseus Catharanthus roseus

C151 Cysteine residue 151 in Keap1

C179 Cysteine residue 179 in IKKβ

C57Bl/6J Black 6 wild type mouse strain

CAC Colitis-associated colorectal cancer

CD Crohn’s disease

Cdc37 Cell cycle division control protein 37

CDDO 2-cyano-3,12-dioxolean-1,9-dien-28-oic acid

x CDDO-Me 2-cyano-3,12-dioxolean-1,9-dien-28-methyl ester cDNA Complementary DNA

CHCl3 Dichloromethane

CO2 Carbon dioxide

COX-2 Cyclooxygenase-2

CRC Colorectal cancer

DKO Double knockout

DMAPP Dimethylallyl pyrophosphate

DMEM Dulbecco’s modified eagle’s medium

DMSO Dimethyl sulfoxide

DNA Deoxyribonucleic acid

DSS Dextran sulfate sodium salt

E. coli Escherichia coli

ECL Enhanced chemiluminescence

EtOAc Ethyl acetate

FAP Familial adenomatous polyposis

FBS Fetal bovine serum

FDA Food & Drug Administration

FPP Farnesyl pyrophosphate g Gram

G. biloba Ginkgo biloba

G. max Glycine max

GCLC Glutamate cysteine ligase catalytic subunit

xi GR Glutathione disulfide reductase

GST Glutathione-S transferase

H2O Water

Hmox Gene encoding hemeoxygenase-1

HO-1 Hemeoxygenase-1

HOAc Acetic acid

HPLC High performance liquid chromatography

HSP90 Heatshock protein 90

HTS High Throughput Screening

IBD Inflammatory bowel disease

IFNγ Interferon gamma

IκB Inhibitor of kappa B

IKKα IκB kinase alpha

IKKβ IκB kinase beta

IL-6 Interleukin 6 iNOS Inducible nitric oxide synthase

INrf2 Inhibitor of Nrf2 (also known as Keap1)

IPP Isopentenyl pyrophosphate

Keap1 Kelch-like ECH-associated protein 1 kg Kilogram

LPS Lipopolysaccharide

M-CSF Macrophage colony stimulating factor

MeCN Acetonitrile

xii MeOH Methanol mg Milligram

MHz Megahertz ml Milliliter mM Millimolar mRNA Messenger RNA

MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium

bromide

NADP+ Nicotinamide adenine dinucleotide phosphate (oxidized)

NADPH Nicotinamide adenine dinucleotide phosphate (reduced)

Neh2 Nrf2-ECH homology 2

NF-E2 Nuclear factor-erythroid 2

NFκB Nuclear Factor kappa B ng Nanogram nM Nanomolar nm Nanometers

NMR Nuclear magnetic resonance

NO Nitric oxide

NQO1 NAD(P)H:quinone oxidoreductase 1

Nrf2 Nuclear factor-erythroid 2 (NF-E2)-related factor 2

Nrf2-/- Nrf2 null

Nrf2+/+ Nrf2 wild type

NSAID Non-steroidal anti-inflammatory drug

xiii O2 Molecular oxygen

OSU Ohio State University p Probability (p) value

P. ginseng Panax ginseng p23 Prostaglandin E synthase 3 p27Kip1 Cyclin-dependent kinase inhibitor 1B p27Kip1-/- p27Kip1 germline deletion in mouse

PBS Phosphate buffered saline

PCR Polymerase chain reaction

PGE2 Prostaglandin E2

PPi Inorganic pyrophosphate ppm Parts per million

PTC1 Papillary thyroid carcinoma oncogene 1 qRT-PCR Quantitative real-time polymerase chain reaction

R. coptidis Rhizoma coptidis

R. gentianae Radix gentianae macrophyllae

RET Ret proto-oncogene

RIPA Radioimmunoprecipitation assay

RNA Ribonucleic acid

RNS Reactive nitrogen species

ROS Reactive oxygen species

RT-PCR Reverse transcriptase polymerase chain reaction siRNA Small interfering ribonucleic acid

xiv SMAD4 Mad homologue 4

Smad4co/co;Lck-cre Mouse model with Smad4 deletion in T cells

Smad4co/co;Lck-crep27Kip1-/- Dual deletion of Smad4 in T cells and p27Kip1 in germline

STAT Signal transducers and activators of transcription

STAT1 Signal transducer and activator of transcription 1

STAT3 Signal transducer and activator of transcription 3 t-BHQ Tert-butyl hydroquinone

T. wilfordii Tripterygium wilfordii Hook F.

TCM Traditional Chinese medicine

TFA Trifluoroacetic acid

THF Tetrahydrofuran

TLC Thin layer plate chromatography

TNFα Tumor necrosis factor alpha

TW Tripterygium wilfordii Hook F.

UC Ulcerative colitis

US United States

UV Ultraviolet

XRE Xenobiotic response element

Yap1 Yeast AP-1 transcription factor

μg Microgram

μl Microliter

μM Micromolar

μm Micron

xv The Isolation and Biological Evaluation of Anti-Inflammatory and Chemopreventive

Triterpenoid Natural Products

Abstract

By

Emily Clegg Barker

Natural products represent a major portion of society’s pharmacopeia throughout recorded history. Compounds derived from nature have a richness of chemical diversity and bioactivity that supersedes modern chemical synthesis, and have inspired a majority of marketed drugs. In the field of chemoprevention, natural products have proven a promising starting point when searching for molecules or extracts that can be tolerated long-term and might be added to the diet in populations at risk for developing certain cancers. Triterpenoids are a class of biologically active plant metabolites biosynthesized from six isoprene units and cyclized into a variety of skeletal scaffolds. Recently, the triterpenoid oleanolic acid has been demonstrated to be an effective platform for synthetic derivitization to generate chemopreventive agents that target the antioxidant and cytoprotective nuclear factor-erythroid-2 (NF-E2)-related factor 2 (Nrf2) transcriptional pathway among other pathways involved in inflammation and cancer. This thesis details the optimization for large-scale isolation of the triterpenoid bryonolic acid to be used by others as a platform for diversity-oriented synthesis in developing chemopreventive agents targeting Nrf2 transcription. This thesis also contains a biological characterization

xvi of celastrol, a quinone methide triterpenoid component of a biologically active extract

Tripteryrgium wilfordii Hook F. In an in vitro model we show down-regulation of inflammatory mediator production in activated macrophages treated with celastrol. We also demonstrate that this anti-inflammatory activity can be harnessed in a unique mouse model for colitis-associated colon cancer involving the deletion in T cells of Smad4 and the germ-line deletion of p27Kip1. Disruption of these genes in mouse results in early onset inflammation-driven carcinogenesis of the colon epithelia. Chemopreventive administration of 2 mg/kg per day celastrol in diet delays on-set of malignancy and down-regulates inflammatory mediators in the colon and circulating serum while showing modest induction of cytoprotective genes. In vitro, potent induction of cytoprotective genes by celastrol is shown to be Nrf2-dependent. These data provide additional insight on the potent anti-inflammatory activity of celastrol and present a rationale to further explore the capacity of dietary celastrol to suppress carcinogenesis in classical models of colon carcinogenesis with an emphasis on future potential for clinical translation.

xvii Chapter 1: Introduction

1.1 Natural Products in medicine

1.1.1 History of natural products in medicine through the 19th century

Use of natural products in medicine is as old as human civilization and continues to the present day. In the earliest identifiable records, dating back to 2600 B.C., clay tablets written in cuneiform document approximately 1000 plant derived substances used by the Mesopotamians to treat various ailments. Such herbs included Cedrus species

(cedar), Cupressus sempevirens (cypress), Glycyrrhiza glabra (licorice), and Papaver somniferum (poppy juice), all of which are still in use today for treating mild and severe ailments from cough and cold to infection and inflammation1. Predating these records, indication of the use of herbs to treat medical conditions is implied in the recovered personal effects of the Val Senales mummy or the ‘Ice Man,’ preserved by the Alpine elements 5300 years ago and uncovered in 1991 by the receding of the Val Senales

Glacier. Hanging from leather straps on his person were found two “cork-like lumps” identified as woody fruit of Piptoporus betulinus, a fungus with known laxative activity.

Analysis of the Ice Man’s rectum also identified former infection by an intestinal parasite that would have resulted in abdominal pain and cyclic anemia. The woody fruit of

Piptoporus betulinus was likely self-administered to fight the effects of the parasitic infection2.

Continuing through the ages, extensive documentation identifies hundreds of drugs of a natural form used among the Egyptian, Chinese and Ayruvedic cultures around

1500, 1100 and 1000 B.C., respectively. Sophistication in the use of medicinal herbs continued to grow as evidenced in the ancient western world (300 B.C. – 200 A.D.)

1 where dozens of texts by Greco-Roman philosophers and physicians deal with medicinal qualities of herbs and the ability to alter characteristics through cultivation, and enhance potency by making complex prescriptions and compounding drugs. These practices were preserved among European nations through the Dark and the Middle Ages and expanded by the Arabs who were the first to establish privately owned drug stores in the eighth century1. In many of these cultures, use of traditional herbal remedies has persisted as a primary form of medicine. The most impressive implementation may be by the Chinese.

Traditional Chinese medicine has been practiced for approximately 3000 years and has even been recognized in modern times for its superior efficacy in treatment of the viral outbreak SARS as well as liver fibrosis and cirrhosis3, 4. Recent decades have seen multiple programs built around discovery of the compounds that arm traditional Chinese remedies with such biological potencies5.

In continuing to highlight historical landmarks in drug discovery, the use of pure compounds as drugs came about with the technical development to isolate such active principles in the early 19th century. Earliest examples include strychnine, morphine, atropine and colchicine1. E. Merck was the first to commercialize a pure natural product, morphine, in 1826 (isolated by German chemist Friedrich Sertürner in 1805)1, 6. Soon after that time, natural products were serving as lead compounds for synthetic derivatives.

In 1897, the first natural product-based semi-synthetic pure drug came from the dye firm

Friedrich Bayer & Company in Germany to be marketed as Aspirin two years later7.

2 1.1.2 Natural products in medicine during the recent century

Perhaps some of the most lauded cancer drugs of the 20th century, Taxol and the vinca alkaloids, were isolated from natural sources during the latter portion of the recent century. In 1971, Monroe E. Wall and Mansukh C. Wani reported the structure and anti- leukemic/anti-tumor properties of Taxol (generic name paclitaxel, trade name Taxol) on the heels of their seminal discovery of anticancer natural product camptothecin only five years prior8, 9. In connection with the efforts of the National Cancer Institute to test compounds, including those of natural origins, for anticancer activity, Wall became involved in the testing of extracts of Taxus brevifolia, also known as the Pacific yew tree.

Following its structural elucidation, it took several years of in vitro and in vivo work to justify clinical investigations. In 1992, Taxol was at last approved for treatment of refractory ovarian cancer and since then has been approved for treatment of breast and colon cancers and Kaposi’s sarcoma10. Scarcity of resources for supplying what would become a multi-billion dollar drug necessitated the development of the total synthesis of

Taxol, completed by Holton and colleagues in 199411, 12. As Taxol has persisted as a leading cancer drug for refractory disease, it is certain that countless lives have been touched since the emergence of this natural product as a potent anticancer. The work of

Wall and Wani was deservedly memorialized in the recent decade by the naming of the

Research Triangle Institute (where Taxol was first isolated) as a National Historic

Chemical Landmark by the American Chemical Society13.

The circumstances surrounding the isolation of the vinca alkaloids and subsequent discovery as anticancer agents have been described as serendipitous. In the 1950s,

Catharanthus roseus (formerly Vinca rosea Linn.) or Madagascar periwinkle was being

3 investigated on multiple continents for an array of biological activities14. Two independent teams in North America stumbled upon the anticancer activity of extracts from the leaves of C. roseus, one in Canada and one in the United States. Those teams subsequently isolated and identified the active principles15. In the US, it was work led by

Drs. Irving Johnson, Norman Farnsworth, Norbert Neuss and Gordon Svoboda at Eli

Lilly Research Laboratories that led to the identification and structural elucidation of vincristine and vinblastine, which compounds ended up entering clinical development to be registered for the treatment of lymphoma and leukemia16, 17. Discovery of the anticancer activity of the vinca alkaloids marked a major milestone in the development of cancer chemotherapy. Even half a century after their discovery, vincristine, vinblastine and synthetic derivatives of the vinca alkaloids are still widely used anticancer agents in treatment of leukemia and lymphoma, bladder and breast cancer, and Hodgkin’s disease to name a few15.

The impact of natural products on drug discovery cannot be disputed18, 19. Since the turn of the 20th century to the present, natural products continue to have a strong presence in our pharmaceutical industry. Indeed, prior to the advent of high-throughput screening (HTS), more than 80% of drug substances were natural products or inspired by natural products20. In the 1993 prescription drug audit, 56% of the top 150 prescription drugs were natural-product-related18. One decade ago, it was around half of the drugs in clinical use that were of natural product origin21. An analysis of drug origins introduced between the years 1981 and 2002 showed that 52% of all new chemical entities were either natural products, derived from natural products or synthetics mimicking natural product pharmacophores22.

4 In the 1990s, the natural products field experienced a lull in excitement for natural product research. This resulted from the advent of HTS, development of combinatorial chemistry and screening libraries, discoveries of additional molecular targets and a decreased emphasis on drug discovery for infectious disease. The rapid-screening, rapid hit identification was not conducive to the kind of labor-intensive, bio-assay guided, structural determination-heavy natural product programs23. However, the recent decade has seen a shift from combinatorial chemistry and searching libraries of 10,000+ compounds in drug discovery. Some are of the opinion that the anticipated success and efficiency of such an approach has not materialized24-26. As evidence, a study by

Newman and Cragg, covering the years 1981 until 2010, identified only one de novo new chemical entity reported in the public domain and resulting from combinatorial chemistry. It was sorafenib or Nexavar from Bayer, approved by the FDA for treatment of renal cell carcinoma in 200527. The present trend in drug discovery appears to be moving toward a combination of recent advances where small libraries (~100-3000 compounds) with natural products or “natural-product like” compounds favor a more focused screening approach. Thus, research in the area of natural products is again (and justifiably) on the rise27, 28.

1.2 Triterpenoids

Triterpenoids are a class of natural products ubiquitous in the plant kingdom produced biosynthetically by the polymerization of six isoprene units to form squalene followed by oxidation to form oxidosqualene or bis-oxidosqualene and subsequent cyclization by specific oxidosqualene cyclases resulting in one of a myriad of skeletal

5 structures (nearly 200 types have been documented). Refer to Figure 1.1 (page 7) for a schematic of the biosynthesis of triterpenoids. The variety of skeletal scaffolds arises from the multiple pathways of cyclization of squalene introduced by plant oxidosqualene cyclases. Most triterpenoids are either 6-6-6-5 tetracycles, 6-6-6-6-5 pentacycles, or 6-6-

6-6-6 pentacycles (the numbering system refers to the number of carbon atoms in each ring of the carbocyclic skeleton). Acyclic, monocyclic, bicyclic, tricyclic and hexacyclic triterpenoids have also been isolated29, 30. Many natural triterpenoids have been found to exhibit compelling biological activities. Triterpenoids are used widely in Asian medicine and are continually isolated and studied for anti-inflammatory, hepatoprotective, analgesic, antimicrobial, antimycotic, virostatic, immunomodulatory and tonic effects.

They are used for their cytostatic effects and to treat hepatitis and parasitic and protozoal infections31.

There remains much to be understood about the contextual significance of the immense diversity to the triterpenoids. Antibacterial and antifungal activities are suggestive of direct survival benefit to the plant and fruits. Less is understood about benefit to animals or humans that feed on triterpenoid-containing plants. Because many of the plants containing triterpenoids are readily edible by wild animals and humans, it could be expected that the plant contents are relatively nontoxic and could serve as safe platforms for drug discovery32.

A major thrust of the research in the Tochtrop lab is the exploration of structurally diverse natural and synthetic triterpenoids and evaluation of their potential as anti- inflammatories and chemopreventives. These ends are achieved by evaluation of the biological potencies of natural extracts and isolation of triterpenoids followed by

6 investigation of these compounds in assays of inflammation and models of inflammatory disease and cancer. Natural triterpenoids also serve as chemical substrates for skeletal diversification and generation of unique triterpene scaffolds, which are further optimized synthetically to generate novel and biologically active triterpenoids with potential as chemopreventives. This thesis details the development of a large-scale isolation of one natural triterpenoid, bryonolic acid, and the extensive biological characterization of another natural triterpenoid, celastrol.

OPP OPP PPi IPP PPi DMAPP OPP

Geranyl pyrophosphate (C10) Farnesyl pyrophosphate (C15) OPP (FPP)

IPP FPP

PPi

+ NADP H2O O2 NADPH

O Oxidosqualene Squalene (C30)

H H H HO H H Cycloartenol HO H H Lanosterol H HO HO H H Amyrin Lupeol

Figure 1.1 Triterpenoid Biosynthesis. Isopentenyl pyrophosphate (IPP) is an end product of the mevalonate pathway in higher eukaryotes. IPP isomerase catalyzes the interconversion to produce dimethylallyl pyrophosphate (DMAPP) and head-to-tail condensations catalyzed by prenyl transferase produce the growing isoprenoid chain including monoterpenoid precursor geranyl pyrophosphate and sesquiterpenoid precursor farnesyl pyrophosphate (FPP). Condensation of two FPP units produces squalene, which is oxidized to oxidosqualene. Oxidosqualene can be cyclized by a number of oxidosqualene cyclases to produce a variety of skeletons. Shown here is a lanostane, lupane, oleanane and cycloartane (from left to right). Lanosterol is produced in animals and is the principal precursor to cholesterol.

7 1.2.1 Natural triterpenoid, bryonolic acid

Bryonolic acid (3β-hydroxy-D:C-friedoolean-8-en-29-oic acid, BA) is a naturally occurring triterpenoid that has been identified in multiple species in the Cucurbitaceae family and in dispersed species of other reported plant families (Meliaceae,

Tetramelaceae, and Anisophylleaceae)33-35. It was first isolated in 1960 from roots of

Bryonia dioica Jacq. (Cucurbitaceae). Initial structure determination attempts33 were found to be in error and the final reported structure36 is shown in Figure 1.2 (page 10).

Bryonolic acid possesses a 6-6-6-6-6 pentacyclic skeletal structure and a unique ring fusion unsaturation. Some biological activities have been previously reported for bryonolic acid, including anti-allergic properties in rodents37 and a variety of cytotoxic and anti-tumor activities in multiple cancer cell lines38-40.

Bryonolic acid is of interest because, structurally, the unsaturation at the B-C ring fusion endows bryonolic acid with vast functional utility for application of a form of diversity-oriented synthesis which could produce a variety of new triterpenoid scaffolds with potentially altered biological activities. As bryonolic acid is not commercially available, development of a large-scale isolation procedure was requisite for exploration of this molecule as both a chemical substrate and chemopreventive. Chapter 2 of this thesis details the effort toward design of a method for obtaining gram-scale quantities of bryonolic acid41. Work detailing bryonolic acid characterization as a substrate for diversity oriented synthesis and the biological evaluation of both bryonolic acid and its chemical derivatives can be found in the theses and corresponding publications of Vasily

A. Ignatenko42-45 and Tonibelle N. Gatbonton-Schwager41, 46, 47.

8 1.2.2 Natural triterpenoid, celastrol

Celastrol (3-Hydroxy-9β, 13α-dimethyl-2-oxo-24,25,26-trinoroleana-1(10),3,5,7- tetraen-29-oic acid) is a quinone methide triterpenoid first isolated as a red pigment from the Thunder God Vine, Tripterygium wilfordii Hook F. in 1936 and given the name tripterine48. Tripterygium wilfordii is a perennial twining vine from the family

Celastraceae similar to the North American bittersweet, Celastrus scandens L.

Tripterygium wilfordii has been used as an insecticide as well as in traditional medicine since ancient times for the treatment of fever, chills, edema and inflammation49. Gisvold isolated celastrol from Celastrus scandens in 193950 and eventually its structure was determined to be identical to that of tripterine51. Both names have been used, but celastrol has stuck most predominantly for works published on the compound in the English language. The decade of structural work on the compound48, 50-54 determined the chemical structure known today and shown in Figure 1.2 (page 10). Considered to be one of the major active components of this medicinal vine, celastrol has been explored for efficacy in multiple animal models including arthritis55-57, Alzheimer’s disease58, Parkinson’s disease59, amyotrophic lateral sclerosis60, asthma61, hypertension62, systemic lupus erythematosus63, 64, skin inflammation disorders65 and multiple tumor models66, 67.

Celastrol suppresses the inflammatory response65, 68 and shows anticancer activity66, 67.

Cellular mechanisms for its activity are best documented for induction of heat shock signaling and inhibition of nuclear factor kappa B (NFκB) inflammatory pathway59, 69-78.

Other studies have suggested inhibition of topoisomerase79, the proteasome67, 80 or potassium channel trafficking81 and induction of antioxidant response76. Celastrol has a potent Michael acceptor functionality (highlighted in Figure 1.2 on page 10), which

9 characteristic has been suggested to be the basis of cellular reactivity76, 82, 83. Chapter 4 of this thesis details the characterization of celastrol as a potent anti-inflammatory in vitro and chemopreventive in a unique mouse model of colitis associated colon cancer (CAC).

Figure 1.2 Pentacyclic Triterpenoids Relevant to this Thesis. Bryonolic Acid (large-scale isolation documented in chapter 2), Celastrol, (characterized as anti-inflammatory and chemopreventive in colitis associated colon cancer in chapter 4) Oleanolic Acid is the natural product precursor to semisynthetic triterpenoids 2-cyano-3,12-dioxoolean-1,9-dien-28-oic acid (CDDO) and CDDO-Me. CDDO-Me or Bardoxolone Methyl is presently under rigorous clinical evaluation. Sites of extended conjugation (yellow) and most likely sites for Michael addition (red arrows) are indicated.

1.2.3 Potential of triterpenoids in cancer chemoprevention

Perhaps the family of triterpenoids drawing the most attention in the field of biomedicine in recent years is the synthetic oleanane triterpenoid family derived from the fairly abundant pentacyclic triterpenoid, oleanolic acid. Oleanolic acid has been identified as an active component in many plants used in traditional folk medicine in the countries

10 of Eastern Asia. It has been isolated from over 120 species and displays a spectrum of biological activities while remaining relatively non-toxic84, 85. In the late 1990s, Michael

Sporn and Gordon Gribble led a program at Dartmouth designed to capitalize on the abundance and biological activity of oleanolic acid by employing medicinal chemistry techniques, altering the functional profile of oleanolic acid and producing a number of synthetic derivatives exceeding the potency of their parent molecule as anti- inflammatories in an in vitro system. The ultimate goal of the work was the identification of a molecule that could be safely administered as a chemopreventive. Earliest screens focused on optimizing anti-inflammatory activity of synthetic derivatives. Some of the earliest derivatives produced by these efforts were shown to inhibit nitric oxide production and expression of inducible nitric oxide synthase (iNOS) and inducible cyclooxygenase (COX-2) in activated macrophages with IC50 values at low micromolar and sub-micromolar ranges compared to the mild potency of oleanolic acid, testing at 40

μM86, 87.

The major success emerging from the program initiated at Dartmouth was the synthetic oleanane triterpenoid, 2-cyano-3,12-dioxoolean-1,9-dien-28-oic acid (CDDO), which was shown in initial assays to inhibit nitric oxide production and expression of iNOS and COX-2 at 0.4 nM in activated macrophages, 400 times the potency of active compounds in the initial group of derivatives88. Structure-activity relationships indicated that activity is most enhanced by the presence of a nitrile group at the C-2 position and that the combination of a 9-en-12-one functionality with the C-2 nitrile group provides for particular potency in suppression of nitric oxide88 (Figure 1.2, page 10). The

Michael-accepting moiety created by an electron-withdrawing substituent alpha to an

11 unsaturation has proven to be a predictive feature for imparting potency to this class of molecules. Significantly, upon further in vitro characterization, CDDO and functional

CDDO derivatives maintaining the Michael-accepting moiety were shown to be potent inducers of the Phase 2 cytoprotective enzymes89, 90 in addition to the anti-inflammatory, differentiating and anti-proliferative activity observed in the initial biological assays91.

The significance that this chemical feature played in the subsequent elucidation of cellular cytoprotective and antioxidant pathways cannot be overstated and will be further detailed in its own section of this introductory chapter (see section 1.5).

In a clinical context, CDDO experienced a success story on its own completing first-in-man trials for the treatment of leukemia and solid tumors92 and phase I dose escalation trials32. Because of the need to administer CDDO intravenously, development efforts focused on finding a more potent molecule with better oral availability32. The molecule showing the most promise was the methyl ester derivative of CDDO, CDDO-

Me (Bardoxolone methyl, Figure 1.2, page 10), which entered phase I clinical trials with

CDDO for treatment of leukemia and solid tumors92 and successfully completed phase II clinical trials for treatment of chronic kidney disease93. In 2012, CDDO-Me began its international phase III clinical trial evaluation involving a large number of patients with advanced stage chronic kidney disease. It was gravely unfortunate when the trial was halted due to an excess of serious adverse events and mortality in patients receiving

CDDO-Me94. While details of the study are forthcoming, it is suspect that adverse effects could have been related to faulty trial design involving formulation and the late-stage nature of the patients94, 95. Sporn and colleagues had emphasized in reviews and manuscripts on the synthetic oleananes the importance of enhancing efficacy by using as

12 early as possible in disease pathogenesis32. In January 2014, patient recruitment for a trial evaluating CDDO-Me in patients with pulmonary arterial hypertension was opened96. It is not unlikely that this semi-synthetic oleanane triterpenoid will one day find its way into the clinic, increasing the likelihood for its application in chemoprevention.

The past two decades surrounding the development of the synthetic oleanane triterpenoids has resulted in an enriched appreciation for triterpenoid chemical biology.

We have a refined appreciation for the vast potential of triterpenoids as chemopreventives in multiple cancer models and as protective agents in models of inflammatory disease32.

Triterpenoids target multiple cellular signaling pathways involved in inflammation and cancer and these have been further elucidated as a consequence of this research effort32.

The field should maintain enthusiasm for therapies based around the mechanisms of the triterpenoids. The critical findings enabled by the research programs built around the synthetic oleananes provide a basis for continued exploration of the potential for triterpenoids in treatment and prevention of human disease95.

1.3 Cancer chemoprevention

Central to this thesis is the concept of chemoprevention. Chemoprevention refers to a delay or prevention of the pathogeneses that lead to cancer by administration of natural or synthetic compounds to individuals or populations at risk for development of a certain malignancy. This section will give background and information in support of this approach to the cancer problem in our society, finishing with information on some of the inroads made in pre-clinical and clinical implementation of chemoprevention.

13 1.3.1 The cancer burden

Since Richard Nixon declared a “War on Cancer” in 1971, strides made in improving outcomes for many cancer diagnoses cannot be disputed. Perhaps one of the most striking is the success rate in treating childhood leukemia. In 1963, five-year survival rate for children diagnosed with acute lymphocytic leukemia was around 14 percent. By 2004, 87% survived 5 years with the majority continuing in remission for life97. This was due, in large part, to the highly collaborative efforts resulting in effective chemotherapeutic treatment regimens that persist in the clinic today98. A 55% drop in male smokers in the United Kingdom has been accompanied by a nearly matching cut in lung cancer deaths in middle aged men of that nation, a trend also observed in other nations where smoking has declined, including the US99. Also on the lung cancer front, the National Lung Screening Trial recently found that tomography scans of heavy smokers could cut lung cancer deaths by as much as 20%100. Since the ability to detect precancerous cells in the cervix via the pap smear, US cervical cancer mortality rates have dropped from 5.5 per 100,000 in 1975 to 2.4 in 200799. Arguably, screening has been one of the most effective weapons in the war on cancer with the US National Cancer

Institute which also estimates that colonoscopies can lower mortality from colorectal cancer by at least 60%100.

In spite of these successes (successes that ought to be celebrated for the lives they have saved and the families they have touched), cancer still exists as a major burden on our society with 12.7 million new cancer cases and 7.6 million deaths in 2008, costing the global economy nearly 900 billion US dollars99. Even with effective screening, improved public awareness of the carcinogenic nature of smoking, and major breakthroughs in

14 cancer treatment, the past 40 years have seen crude deaths of US citizens from cancer rise by 14% while deaths due to other killer diseases (such as heart disease, stroke, influenza, pneumonia and liver disease) have all declined. Furthermore, deaths not due to chronic illness, such as fire and car-related fatalities, accidental drownings and deadly strikes of lightning, have also decreased over that time97. For cancer, the World Health

Organization is predicting that we will face more than 21 million new cases and 13 million deaths each year by the year 203099. It has been suggested that the only way to conquer this malady is by an altered approach to addressing the problem. The approach is to address the problem before it starts or as it is starting rather than when full-fledged and invasive cancer abounds97, 98, 101-104.

1.3.2 Chemoprevention background

Within the realm of prevention, there is a school of thought that suggests taking a combined therapeutic and preventive strategy to the cancer problem, meaning taking drugs to prevent cancer, rather than to treat it105. It is based on the idea that cancer could be stopped, slowed, or reversed chemically in its earliest and pre-invasive stages97.

Michael Sporn who coined the term “Chemoprevention” to describe this notion in 1976 has largely pioneered the field that has grown around this philosophy. Fundamental to the idea is our perception of wellness. Sporn points out that the latency period for the common epithelial cancers is often 20 years or more, by which time cells in those carcinomas may harbor hundreds of mutations in different genes. Although an individual may remain symptom-free during much of that latency time characterized by faulty cell division, gene mutation and other factors unseen; he or she could hardly be considered

15 ‘healthy.’ It is contended that the time prior to development of invasive and metastatic disease is the time to intervene with multi-targeted, multi-functional drugs that prevent advancement of cells from pre-malignancy to malignancy98. Sporn creates a compelling image in this statement: “Saying it’s not cancer until the cells are through the basement membrane [invasion] is like saying the barn isn’t on fire until there are bright red flames coming out of the roof.”97

Perhaps the most effective implementation of chemoprevention in medicine today is in cardiology. Just as cancer development is a drawn-out process with a series of compounding events leading up to its manifestation, so is heart disease which is understood to be preceded often by years or even decades of arterial plaque buildup accompanied by complex cellular-level pathogeneses106, 107. Indeed, doctors have become extremely well-versed in the prescribing of statins, Beta-blockers, blood thinners and anticoagulants for the management of symptoms like high cholesterol, high blood pressure and clotting which point to the mere risk of heart disease. Risky surgeries stabilize irregular heart rhythms and install stents to prevent further damage to the heart muscle. But the apparent risk is paying for itself. Targeting the biology that has been identified to potentially lead to heart disease has resulted in a phenomenally better controlled burden of this disease on society and a decline in crude deaths over the last 40 years. In 2010, there were 138,000 fewer US deaths from heart disease than in 1970, even when the nation’s population had swelled by more than 100 million. That equates to a crude death rate decrease of 47%. For cancer, that figure has increased by 14% over that same time period97. A preventive culture is so engrained in cardiovascular research and medicine that National Task Forces organize regular updates in preventive cardiology,

16 documenting the expansion of basic research in the field, and outlining appropriate clinical implementation108. With added support and global enthusiasm for research in its realm, this represents a potential vision for chemoprevention in cancer.

1.3.3 Progress and success in cancer chemoprevention

In the opening section of 1.3 were listed some of the more noteworthy advances on cancer in the last half century. Notably, many were due to measures taken on a preventive front. This is worth mention in making a case for chemoprevention. Thanks to

British epidemiologist Richard Doll who proved smoking causes cancer in the 1950s99, we understand that in many cases, lung cancer can be prevented by not smoking and thanks to screening tests such as pap smears and colonoscopies, invasive colon and cervical cancers can often be preempted. Prevention-based findings hold convincing promise in a more effective fight against cancer. Particularly encouraging are the in-roads already made in the field of chemoprevention.

Today, it is possible to prevent cancer in all of the major organs in preclinical animal models and there is progress towards chemoprevention in the clinic98. FDA- approved chemopreventive drugs on the market today are for treatment of individuals at high risk for certain cancers. Women who are at high risk for breast cancer have the option to take tamoxifen, raloxifene or lasofoxifene daily for multiple years which will decrease a woman’s risk for estrogen-receptor positive breast cancer by as much as 50%, with the added benefit of suppressing osteoporosis98, 105. Clinical trials have shown potential for breast cancer prevention in premenopausal women with fenretinide109 as well as reduction of prostate cancer incidence by anti-androgenic agents98. There are also

17 multiple creams and ointments approved to prevent skin lesions from developing into skin cancers105.

Consequent to epidemiological studies and secondary analyses of multiple clinical trials indicating that long-term use of NSAIDs reduce risk for colorectal and other cancers110, many clinical trials have affirmed the chemopreventive effects of aspirin and

COX-2 inhibitors in patients at risk for development of colorectal cancer111. Celecoxib was at one time approved for reducing colon cancer risk in people with familial adenomatous polyposis (FAP), a genetic disorder that predisposes individuals to colorectal cancer. However, labeling for this use was discontinued in 2011 due to increased risk for serious cardiovascular events105. In spite of such limitations, there is progress towards effective chemoprevention with the NSAIDs in colorectal cancer, with a focus on populations at decreased risk for cardiovascular disease111. Data has shown, however, that a portion of the patient population does not respond to NSAID therapy in the prevention of colorectal cancer112 and so it is requisite to explore or develop other classes of well-tolerated anti-inflammatories as potential chemopreventives for this malignancy.

1.4 Carcinogenesis

MedlinePlus, a service of the U.S. National Library of Medicine of the National

Institutes of Health defines cancer as “a malignant tumor of potentially unlimited growth that expands locally by invasion and systemically by metastasis.” It may be true that it is not termed cancer until it is an entity capable of invasion and metastasis, however in reality cancer is a process, often transpiring over many years98. The process that leads to the presentation of cancer is termed carcinogenesis. Fundamental to the implementation

18 of chemoprevention is recognizing that carcinogenesis can progress over years to decades offering ample time for pharmacological intervention. Carcinogenesis can be divided into

3 mechanistic phases113: initiation, promotion and progression (Figure 1.3, page 22). The molecular biology taking place at each of these stages offers multiple potential targets in chemoprevention. Initiation is characterized by stable genomic alterations, which result in

DNA mutation leading to activation of oncogenes and/or inactivation of tumor suppressor genes. Promotion involves the clonal expansion of initiated cells due to increased cell proliferation and/or reduced cell death. Tumor progression involves increase in tumor size, invasion and metastasis, accompanied by additional mutation. The molecular unfolding of carcinogenesis offers ample opportunity, by way of targets as well as time, to intervene therapeutically in an effort to reverse or abate this process before malignancy is apparent114.

1.4.1 Inflammation in Carcinogenesis

Inflammation is one contributing factor to carcinogenesis that has been identified as a potentially treatable cause to cancer115. The innate immune response is a wonderfully orchestrated series of events for ridding the body of microbial invasion and responding to trauma, injury or chemical stimuli. Generally, the response is temporary and sufficient for recovery from these common insults. It is when the response continues, unabated, that inflammation becomes problematic. This occurs frequently enough in human disease that chronic inflammation continues to receive the attention of the medical and pharmaceutical communities in addressing its vast implications.

19 During acute inflammation, activated endothelial cells play a role in the recruitment of circulating cells to inflammatory sites. Leukocyte adhesion is facilitated by recognition of newly expressed adhesion molecules on resident cells116. Monocytes, macrophages, adipocytes and other cells localized to the site of stimulus release small molecules which signal the recruitment of inflammatory cells by inducing vasodilation and vascular permeability116, 117. Inflammatory cells produce cytokines and reactive species which induce gene expression and synthesis of pro-inflammatory enzymes such as iNOS and COX-2 in a variety of localized and inflammatory cells117. It is when acute inflammation of the immune response goes unchecked, that it leads to chronic inflammation, which lies at the root of a number of diseases including arthritis, myocardial infarction, Alzheimer’s disease and cancer118.

Rudolf Virchow first noted a connection between inflammation and cancer in

1863 upon his observation of leucocyte infiltration into neoplastic tissue. Perhaps ahead of his time, he suggested that this could indicate cancer origin at sites of chronic inflammation119. Today, an abundance of evidence supports Virchow’s hypothesis. In essence, while genetic damage resulting in oncogenesis is often the “match that lights the fire,” an inflammatory environment can serve as the “fuel that feeds the flame.”119 In this way, inflammation can be found to contribute to the promotion and progression phases of carcinogenesis initiated by some kind of oncogenic event. It is understood that the interruption in tissue homeostasis caused by clonal expansion of initiated cells

(promotion phase) can be sufficient to turn on an inflammatory response, resulting in immune cell recruitment and promotion of angiogenesis in an effort to promote wound healing, but instead fueling tumor growth (Figure 1.3, page 22)114. Inflammation also

20 plays a major role in the continued disease progression and survival of cancer cells

(promotion/progression phases). Sometimes it is due to production of cytokines by inflammatory cells, which contribute as growth signals to tumor cells. Inflammatory cells also produce reactive oxygen and reactive nitrogen species (ROS/RNS) that can incite further DNA mutation. Examples in the literature also demonstrate how genetic changes resulting in neoplasia are also responsible for generating an inflammatory environment120. The first report of such an activity was shown in the generation of oncogene RET/PTC1 (a rearrangement sufficient for development of human papillary thyroid carcinoma) and its ability to activate transcription of inflammatory mediators in normal cells and a consequent association with metastatic behavior120, 121.

In addition to taking part in driving the process of carcinogenesis initiated by an oncogenic event, inflammation can also be a bed for eventual development of cancer, inducing the oncogenic changes that ultimately result in malignancy120. An inflammatory environment can lead to genetic instability by production of ROS by inflammatory cells which can themselves react directly with DNA. More likely, however, is the production of cytokines by inflammatory cells that signal expression of inflammatory mediators and over-abundant ROS accumulation in resident cells, leading to genetic mutation and oncogenic initiation. Aberrant inflammation can also lead to oxidative damage to mis- match repair enzymes creating an environment for more frequent genetic mutation122.

Thus, inflammation not only contributes to the progression and promotion of carcinogenesis, but, in the case of chronic inflammation, it can also drive the initiation phase of carcinogenesis (Figure 1.3, page 22)120.

21

Figure 1.3 Carcinogenesis and Inflammation in Carcinogenesis. Carcinogenesis can be divided into 3 mechanistic phases, shown in bold black: initiation, promotion and progression. Initiation involves stable genomic alteration. Promotion is characterized by clonal expansion of initiated cells. Progression involves tumor growth and additional mutation. Shown in red are the ways that inflammation contributes to the process of carcinogenesis. Clonal expansion of cells can induce an inflammatory response, which contributes to carcinogenesis initiated by an oncogenic event. However, a chronically inflamed environment can also provide the impetus for initiation, principally by an overabundance of reactive species. Thus inflammation can be both a contributing and causal factor in carcinogenesis. Figure is based loosely on that presented by Sporn and Albini114, Elements were re-drawn by Greg Tochtrop and used with permission.

In support of the association of inflammation and cancer development, epidemiological evidence shows increased susceptibility to cancer when tissues are chronically inflamed123. Examples include pelvic inflammatory disease and development of ovarian cancer, papillomavirus infection and cervical cancer, Helicobacter pylori

22 infection and gastric cancer, and inflammatory bowel disease and colorectal cancer119. As already discussed, population studies and follow-up trials have also indicated that long- term use of non-steroidal anti-inflammatory drugs (NSAIDs) reduces the risk of several cancers, also pointing to a role of inflammation in cancer development123. The last two decades have been characterized by an enhanced understanding of the molecular-level events accompanying inflammation in carcinogenesis and cancer. The knowledge base of both the pathogeneses and molecular mechanisms of carcinogenesis has opened doors for the identification of appropriate phenotypical and molecular targets of chemoprevention.

With the extensive understanding of the role inflammation plays in carcinogenesis it is a logical target for application of chemoprevention in multiple malignancies. A major focus of this thesis is targeting inflammation in the chemoprevention of colorectal cancer.

1.4.2 Colorectal Cancer: a model example for inflammation-driven carcinogenesis

Inflammation is known to play a role in a myriad of diseases and its function in various cancers including bladder, cervical, gastric, intestinal, esophageal, ovarian, prostate and thyroid, is widely appreciated120. A most striking example is the role of inflammation in the development of colorectal cancer (CRC). With 160,000 new diagnoses per year and 57,000 deaths, this disease is the second leading cause of cancer deaths among adults124. In spite of decreased mortality due to colonoscopy screening, over 50% of patients still present to their physician with advanced cancer, indicating the need for more effective early detection and prevention111. Chronic inflammation, diet and lifestyle behaviors have all been shown to be risks for developing CRC and preventive measures addressing dietary patterns and exercise have been suggested to decrease

23 risk125. Inflammatory bowel disease (IBD) includes Crohn’s disease (CD) and ulcerative colitis (UC) and is characterized by chronic inflammation of the gut, restricted to gastrointestinal tract in the case of UC, while CD can present in any digestive organ.

Both have demonstrated an increased risk for CRC, however better understood is the association between UC and CRC or colitis-associated colon cancer (CAC). The risk of developing CAC in UC patients is 2% after 10 years, 8% after 20 years and 18% after 30 years of active disease126. CAC is a prime example of inflammation-driven carcinogenesis, having a pre-malignant latency period of multiple decades in many cases affording ample time for chemopreventive intervention. Other major forms of colorectal cancer are hereditary and sporadic colon cancer and are also driven in large part by inflammation. As the carcinogenesis of all three forms of colorectal malignancies (colitis- associated, hereditary and sporadic) is driven by inflammation, treatment with anti- inflammatory agents is a logical strategy for chemoprevention in this disease111.

Consistent with such a notion, there is abundant clinical evidence for decreased incidence and risk for development of colorectal cancer when treated with traditional

NSAIDs. The first clinical evidence for a protective effect of this class of anti- inflammatories came from studies showing that administration of sulindac to four patients with familial adenomatous polyposis (FAP, a predisposing genetic condition for hereditary CRC) resulted in remarkable regression of polyps. Multiple follow-up controlled trials have confirmed this effect. Similarly, there is a good deal of evidence indicating a reduction of risk for CRC in patients with UC treated long-term with anti- inflammatory drug 5-aminosalicylate and also in patients taking NSAIDs long-term for treatment of inflammatory bowel disease (IBD)111. There is ample opportunity in the field

24 for exploration of other classes of anti-inflammatory small molecules such as natural products as chemopreventives in CRC as there is continual question over the long-term tolerability of the NSAIDs, including the selective COX-2 inhibitors. Further, many in the patient population do not respond to the NSAID therapy in reducing cancer risk112.

1.5 Cellular pathways as targets for chemoprevention

This thesis focuses on inflammation as a target for chemoprevention. As presented in Section 1.4, inflammation can play a major role in the process of carcinogenesis and it has been proposed that targeting the pathogeneses of inflammation as it contributes to the tumor microenvironment is a viable approach to chemoprevention114. In this thesis, the identification of potential chemopreventive extracts and triterpenoids is based around the effect of these agents in altering expression profiles of two major transcription pathways with implications in inflammation and which have both been identified as promising targets for chemoprevention. These pathways are the pro-inflammatory Nuclear Factor-κB (NF-κB) and cytoprotective nuclear factor-erythroid 2 (NF-E2)-related factor 2 (Nrf2) transcription pathways. For research presented herein, NF-κB was of interest because it is a major driver of pro- inflammatory enzymes including inducible nitric oxide synthase (iNOS) and cyclooxygenase (COX)-2, whose expression and metabolic products during an inflammatory response can be monitored with and without the administration of therapeutic compounds to evaluate the anti-inflammatory activity of those molecules.

Nrf2 was of interest because it was identified as a major target of the synthetic triterpenoids whose activation often results in suppression of inflammatory response90. In

25 this thesis, triterpenoid-induced expression of cytoprotective targets led to mechanistic evaluation of Nrf2-dependence in such activity (Chapter 4). The content of this section involves a brief description of the fairly well elucidated NF-κB pathway as a driver of transcription of pro-inflammatory genes as well as a more detailed description of the more recently elucidated Nrf2 cytoprotective signaling pathway and its emergence as a target with great potential in the field of chemoprevention.

1.5.1 NF-κB and pro-inflammatory signaling

NF-κB activation has implications in acute inflammation as well as cell-survival mechanisms and multiple malignancies127. The principal relevance in this work is activation and induction of inflammatory gene transcription. Figure 1.4 (page 27) shows a schematic for classical activation of pro-inflammatory NF-κB activity, which happens in response to bacterial or viral infections and pro-inflammatory cytokines. Extra-cellular signaling through cellular receptors triggers activation of the IκB Kinase (IKK) complex.

This complex phosphorylates IκB proteins bound to the NF-κB heterodimer.

Phosphorylated IκB’s are subsequently targeted for proteasomal degradation and NF-κB

(composed of p50 and REL-A) is liberated for translocation to the nucleus where it binds to NF-κB elements to drive transcription of mediators of inflammation such as iNOS and

COX-2, cytokines such as TNF and IL-6, chemokines, proteases and inhibitors of apoptosis113.

NF-κB is a major driver of these and other pro-inflammatory mediators and it is the presumed pathway to be up regulated in the in vitro system utilized in Chapters 3 and

4 of this work. This brief discussion has been intended to show the major pathway for the

26 up regulation of target enzymes whose expression is examined within the pages of this thesis.

Figure 1.4 Pro-inflammatory NF-κB pathway. NF-κB is activated by cytokines, viruses or bacterial cell wall components and results in release of heterodimer NF-κB (composed of p50/REL-A) for translocation to the nucleus where it up-regulates genes involved in inflammation, apoptosis and proliferation.

1.5.2 Nrf2 and cytoprotective signaling

Prior to 1990, there was abundant evidence for the ability of certain agents to induce phase I and phase II enzymes of the detoxification response, offering protection in rodents against neoplastic, mutagenic and other toxic effects of carcinogens. It was in the

27 early 1970s that Wattenberg and colleagues demonstrated this capacity for phenolic antioxidants widely used in food additives in the US128. Others included polycyclic aromatic hydrocarbons such as β-naphthoflavone and phenolic antioxidant tert-butyl hydroquinone (t-BHQ). In 1988, Talalay and colleagues established a connection between Michael-accepting moieties and similar functionalities and induction of the enzymes involved in the phase II immune response in xenobiotic metabolism, i.e. enzymes responsible for the inactivation of the reactive electrophilic forms of carcinogens, enzymes such as quinone reductase NQO1 (NAD(P)H:quinone- oxidoreductase 1) and glutathione S-transferases (GSTs)129. The potency of these inducers was matched with their strength as electrophiles. The finding opened a field for parallel discovery of both new and potent inducers with chemoprotective activity as well as the intricacies of a major signaling pathway that drives expression of enzymes to combat xenobiotic and oxidative stress. That signaling pathway has since been identified as the ARE/Nrf2/Keap1 pathway and the last 20 years have been characterized by a rich unfolding of our appreciation for Nrf2 transcription as a potential molecular target of chemoprevention.

1.5.3 Nrf2 historical background

1.5.3.1 Discovery of the Antioxidant Response Element (ARE)

It was determined that induction by such compounds listed above took place through the xenobiotic response element (XRE)130, however in 1990, Pickett and colleagues discovered that β-naphthoflavone and t-BHQ interacted with another regulatory element found in the promoter region of rat glutathione-S transferase (GST)-

28 Ya. This response element was termed the antioxidant response element (ARE) and characterization of the element identified a core sequence of RGTGACNNNGC where R represents a purine and N represents any base131, 132. Further work throughout the 1990s demonstrated that the ARE drives expression of antioxidant enzymes when induced by electrophiles or reactive oxygen species (ROS), regulating a wide-ranging metabolic response to oxidative stress133.

Proteins induced by the ARE are termed phase 2 proteins or enzymes and are involved in cytoprotective activity. For clarity, it is important to decouple the phase 2 response from the phase I and phase II reactions involved in xenobiotic detoxification.

Cellular detoxification reactions are a subset of cytoprotective responses and are traditionally divided into two phases; phase I and phase II. Phase I reactions functionalize xenobiotic compounds by oxidation, reduction and hydrolysis. Phase II reactions conjugate phase I metabolites with endogenous ligands, making them more water-soluble and amenable to excretion. Phase I enzymes are increased via the aryl hydrocarbon receptor and induction of the XRE while phase II enzymes are driven by induction of the

ARE. However, it has been discovered that not all ARE-driven genes are phase II response enzymes, but they are all involved in cytoprotective activity. To eliminate confusion, the battery of genes driven by the ARE have been termed cytoprotective and their expression has been referred to as the phase 2 response as opposed to the phase II response, associated strictly with detoxification. Itoh et al. make this differentiation clear in their historical overview on Nrf2/Keap1130.

29 1.5.3.2 Discovery of Nrf2 as inducer of ARE

In 1994, nuclear factor-erythroid 2 (NF-E2)-related factor 2 (Nrf2) was first identified in humans as a protein that recognizes the NF-E2 binding site of human β- globin genes134. The Jaiswal group was the first to indicate the involvement of Nrf2 in the

ARE response in 1996, noting its positive involvement in ARE-mediated expression of

NQO1135. Suggestive of cytoprotective activity, Nrf2 was found to have particularly high expression levels in the detoxification organs and tissues facing the environment136, 137.

These combined observations were highly suggestive of a role for Nrf2 in phase 2 enzyme induction.

In 1997, Itoh et al. published their findings in Nrf2 null mice that explored this connection between Nrf2 and phase 2 enzyme induction138. This critical body of work showed that pharmacologic induction of phase 2 enzymes such as GSTs and NQO1 was attenuated in Nrf2-KO mice. Further, it was shown by electrophoretic mobility shift assays that the Nrf2-small Maf heterodimer binds directly to AREs to activate transcription of phase 2 genes in vivo. Development of the Nrf2 null mouse has also informed the field as to the effect of suppressed Nrf2 expression on phenotype. These mice develop normally and are fertile136, 138. Depending on the background, Nrf2-KO mice may develop lupus-like nephritis139, multi-organ autoimmune inflammation or vacuolar leukoencephalopathy140, 141. They are also susceptible to oxidative stress-related diseases such as hyperoxia-induced acute lung injury142 and cigarette smoke-induced emphysema 143, as well as drug-induced neurodegenerative disorders144, 145 or inflammation such as endotoxin-induced septic shock146 and dextran sulfate sodium- induced colitis147, 148. Nrf2-KO mice are susceptible to chemical-induced carcinogenesis

30 and the efficacy of phase 2 inducer oltipraz for prevention of chemical-induced tumors is abrogated in Nrf2-KO mice149, 150.

1.5.3.3 Discovery of Keap1

The discovery that Nrf2 mRNA levels are unaffected by treatment with electrophiles indicated that activation of Nrf2 in driving ARE expression was a post- translational effect151. Further, domain structure-function analysis of Nrf2 revealed a negative regulatory domain (Neh2 domain) implying that Nrf2 regulation was controlled by interaction with an unknown repressor protein152. Using the Neh2 domain as bait in a yeast two-hybrid screen, Keap1 (Kelch-like ECH-associated protein 1) was identified as the interacting protein partner and cytoplasmic repressor of Nrf2152. It was determined that a Keap1 homodimer recognizes two sites on Nrf2, sequestering Nrf2 to a cytoplasmic locale153, 154. With 25 and 27 surface cysteine residues in human and mouse130, there was high likelihood that Keap1 was serving as a direct sensor molecule for electrophiles. Consistent with this notion, Talalay and colleagues demonstrated that potencies of agents to induce phase 2 enzyme expression correlated with their rates of reactivity with thiol groups155.

The combined decade of discovery spanning the 1990s and an additional 13 years spent refining the complexities of the cell’s intricate response to oxidative and xenobiotic stress has brought us to our present and fairly detailed understanding of the

ARE/Nrf2/Keap1 signaling cascade. Under unstressed conditions, Nrf2, complexed with cytoskeleton-bound Keap1, is sequestered to the cytoplasm and targeted for degradation by constant ubiquitination by the E3 ligase complex. When Keap1 is directly modified by

31 electrophilic stress, Nrf2 becomes stabilized and de novo Nrf2 translocates to the nucleus, associating with small Maf proteins and directly recognizing the ARE to drive transcription of a battery of cytoprotective genes (Figure 1.5, page 33) including genes involved in antioxidant activity, glutathione homeostasis, regulation of proteasome and molecular chaperones, DNA damage recognition, inhibition of inflammation, elimination of ROS, detoxification of xenobiotics and drug transport32, 154, 156. A few of the prototypic genes up regulated by this pathway include Quinone reductase 1, gamma-

Glutamylcysteine synthetase, Thioredoxin, Thioredoxin and Glutathione reductases,

Glutathione and UDP-glucuronyl transferases, Epoxide hydrolase, Superoxide dismutase,

Catalase, and Heme oxygenase 132.

32

Figure 1.5 Cytoprotective and Antioxidant Signaling Pathway ARE/Nrf2/Keap1. Under unstressed conditions, Nrf2 is sequestered to cytoskeleton-bound Keap1 homodimer and targeted for proteasomal degradation. The Pathway is activated by introduction of oxidative or electrophilic stress or by exogenous electrophilic agents. Electrophiles conjugate to surface cysteines on Keap1 and Nrf2 is stabilized and no longer targeted for degradation. De novo Nrf2 translocates to the nucleus, associates with small Maf proteins, and recognizes the antioxidant response element (ARE) to drive transcription of target genes.

1.5.4 Nrf2 as a target for chemoprevention

Today, there is ample evidence to justify induction of cytoprotective genes of the

ARE/Nrf2/Keap1 pathway to protect against imminent carcinogenesis157. It has been observed that compounds of many chemical classes can both confer a chemopreventive effect and also induce enzymes of this pathway, at similar doses and with similar tissue specificities157. Sensitivity or resistance to carcinogens has been seen to correlate with expression of detoxification enzymes158. When detoxification enzymes such as GSTs are overexpressed, cells can be protected from carcinogen-induced cytotoxicity. Similarly,

33 when there is a loss of detoxification genes or Nrf2 as a regulatory transcription factor, there is enhanced sensitivity to DNA damage and carcinogenesis150, 159, 160. Further, deficiencies in expression of carcinogen metabolizing enzymes, such as GSTs, caused by genetic polymorphism create susceptibility to cancer in humans161. Significantly, genetic disruption of the Nrf2 pathway can abrogate the chemopreventive efficacy of inducers of this pathway149, 150, 162.

Quite convincing has also been the development of chemopreventive agents based upon ability of these agents to Induce Nrf2 target enzymes, or Phase 2 genes 90, 163-165.

Expansive classification of Nrf2-inducing agents has identified nearly a dozen classes of inducers129, 157. A commonality shared amongst these classes is an ability to react with sylfhydryl groups. Most relevant to applied chemoprevention are the classes that have shown the most potency as Nrf2-inducing molecules coupled with clinical potential. Such classes include the synthetic triterpenoids, isothiocyanates and dithiolethiones, specific examples and structures are shown in Figure 1.6 (page 35). The model example for an

Nrf2-inducing molecule showing true clinical potential as a chemopreventive is the isothiocyanate, sulforaphane. The synthetic triterpenoids are the most potent Nrf2- inducing molecules and have made strides towards use in the clinic with the hopeful future application as chemopreventives. The following sections will detail the respective potentials of sulforaphane and the synthetic oleananes in Nrf2-targeted chemoprevention.

34

Figure 1.6 Nrf2-inducing Molecules Showing Clinical Potential. The validity of Nrf2 as a target for chemoprevention is demonstrated by the number of Nrf2-inducing agents showing chemopreventive properties in preclinical models and success in clinical evaluations. Bardoxolone methyl successfully completed phase IIb trials for chronic kidney disease. Multiple chemoprevention trials have tested sulforaphane as a component of broccoli sprout water and oltipraz and ADT are dithiolethiones (parent molecule shown bottom left) that have also showed promise in the clinic, particularly ADT for reducing preexisting dysplastic lesions in the lungs of smokers.

1.5.4.1 Natural isothiocyanate, sulforaphane, as chemopreventive

A major concern in the development of chemopreventive agents is the tolerability in humans and so natural sources have been a most logical starting point. Consumption of cruciferous vegetables such as broccoli, cabbage, kale and Brussels sprouts has shown epidemiological evidence for reducing the risk of several types of cancer166, 167. Such vegetables fed to rodents were shown, even in the 1980s, to induce phase II

(detoxification) enzymes in many tissues and to protect against chemical carcinogenesis164. Upon this premise, Talalay and colleagues used bioassay-guided fractionation to identify isothiocyanate, sulforaphane (Figure 1.6), as a major and very potent phase II enzyme inducer in Brassica oleracea italica or broccoli164. Other

35 cruciferous vegetables are also primary sources of sulforaphane and are widely consumed in many parts of the world. Bioactive isothiocyanates are produced in plants by enzymatic hydrolysis of glucosinolates by myrosinase, which is released from intracellular vesicles following crushing of plant cells by chewing, food preparation, or damage by insects. This hydrolysis can also be mediated by beta-thioglucosidases in the microflora of the human gut. Evidence is accumulating to suggest that protective effects of crucifers against disease may be due in large part to their content of glucosinolates168.

The principal glucosinolate in broccoli is glucoraphanin, which is hydrolyzed by myrosinase to sulforaphane167.

Sulforaphane is perhaps the most potent natural exogenous inducer of Nrf2, known to date, showing induction in the high nanomolar ranges in cell cultures167. It has been shown that cysteine residues on Keap1 are direct targets for sulforaphane, reacting by thiol addition to the isothiocyanate carbon of sulforaphane to yield thioacyl adducts.

Multiple studies have indicated that C151 in Keap1 is preferentially modified by sulforaphane and when C151 is mutated to serine, nuclear accumulation of Nrf2 and induction of Nrf2 target genes is severely inhibited167, 169, 170. Sulforaphane induces a battery of Nrf2-regulated genes which induction is abrogated in Nrf2-null mice171.

Patterns of up-regulated gene expression reflect those seen with genetic up-regulation via hepatic-specific disruption of Keap1 (causing constitutive activation of Nrf2) in the liver172. Recently, up-regulation of Nrf2-regulated target genes in animal models was validated in human breast epithelial cells where sulforaphane treatment induced a highly similar transcriptomic and proteomic profile to that of cells with Keap1 silenced by siRNA173.

36 Extensive evidence for the chemopreventive effect of sulforaphane and other isothiocyanates in animal models174 has justified the many clinical trials that are ongoing for this agent as a chemopreventive in humans. One major hurdle to the practical implementation of chemoprevention is the identification of populations who are most likely to benefit from chemopreventive intervention. To that end, clinical trials led by

Kensler, Talalay and colleagues have been undertaken in Qidong, China167 where food- borne and air-borne toxins and carcinogens such as aflatoxins are prevalent and where carcinogen exposure combined with chronic infection with hepatitis B virus contribute to high rates of mortality due to heptatocellular carcinoma167, 175. These clinical trials have tested the administration of sulforaphane-rich or glucoraphanin-rich hot water extracts prepared from broccoli sprouts and have characterized the pharmacokinetics and safety of sulforaphane in humans176-178. They have explored dosing regimens and formulation types and overall have illustrated the potential use of an inexpensive, easily implemented and food-based method for secondary prevention in a population at high risk for aflatoxin exposures167, 178-180.

1.5.4.2 Synthetic oleanane triterpenoids as chemopreventives

It is significant that the discoveries elucidating the complexities of the

ARE/Nrf2/Keap1 pathway for cytoprotection preceded and slightly overlapped the discovery and development of the synthetic oleanane triterpenoids (reviewed in section

1.2), pursued as potential chemopreventives and whose potencies as Michael-acceptors paralleled their activity in repressing expression of inflammatory mediators in activated macrophages86-88. Timing was near perfect for exploring the newly elucidated Nrf2 pathway as a target for chemoprevention and a dense and growing body of research now

37 supports the notion that the potent bioactivity of these electrophilic triterpenoids is based largely on their ability to induce Nrf2 transcriptional activity.

A series of microarray studies showed that the same concentrations of synthetic oleanane triterpenoids that inhibit iNOS and other inflammatory cytokines also up- regulate cytoprotective genes regulated by transcription factor Nrf232, 89. Indeed, these semisynthetic derivatives are some of the most potent activators of the Nrf2 pathway in vitro and in vivo32. Additionally, the synthetic oleananes were the original compounds used to shed light on the lesser-understood mechanistic link between protection against oxidative stress and anti-inflammatory effects of the Nrf2 pathway, both critical aspects of carcinogenesis and chemoprevention. Eighteen different synthetic oleanane triterpenoids showed correlating potency over six orders of magnitude for both induction of NQO1 and suppression of iNOS90. Additionally, decreased mRNA expression of multiple cytokines and chemokines resulting from treatment with the synthetic oleananes has been shown to also require expression of Nrf2181.

The synthetic oleananes show chemopreventive activity in multiple models for carcinogen or radiation-induced cancers, where in some cases Nrf2/ARE signaling is shown to be important for preventive effect. However, clinical chemoprevention has yet to be tested for these molecules. As was detailed in section 1.2, the synthetic triterpenoids show continued promise in clinical trials and presumably, once approved for one indication, initiation of trials in chemoprevention and ultimate application as a chemopreventive will be much more achievable. The expansion of knowledge that has come through the synthetic oleananes as both anti-inflammatories and inducers of Nrf2 is

38 a fundamental basis for justifying the further exploration of other natural, synthetic and semi-synthetic triterpenoid interaction with this pathway as potential chemopreventives.

1.6 Scope of this work

The overarching goal of the work presented in the following chapters is the exploration of natural triterpenoids as chemopreventives. We hypothesized that natural triterpenoids showing anti-inflammatory activity and ability to induce Nrf2 target genes may serve as effective chemopreventives. We aimed to identify naturally potent triterpenoids (as opposed to synthetically optimized triterpenoids) in an effort to further understand the triterpenoid class of molecules as potential anti-inflammatories and chemopreventives. Chapter 2 deviates somewhat from the main thrust of this work as it details development of a large-scale isolation of natural triterpenoid bryonolic acid, which has served as a platform for generating a diverse skeletal library of potential chemopreventive triterpenoids. Generation of this library and biological evaluation of these compounds is ongoing in the Tochtrop and Letterio laboratories. Details on these projects are found in the theses and publications of Dr. Vasily A. Ignatenko, Ph.D.42-45

(synthetic work) and Tonibelle N. Gatbonton-Schwager, Ph.D.41, 46, 47 (biological characterization of synthetic library). As the potential for bryonolic acid lie largely in its application as a synthetic substrate, other sources began to be explored in an effort to identify triterpenoids with natural potencies, which would prove effective as anti- inflammatories and chemopreventives. Chapter 3 documents an exploration of natural product plant extracts examined in a screening assay for ability to inhibit production of inflammatory mediators in activated immune cells. Species chosen for this screen were

39 hypothesized to contain natural triterpenoids that could be analyzed as inhibitors of inflammation, inducers of cytoprotective gene expression and chemopreventives. Chapter

4 investigates the chemopreventive potential of one natural product, celastrol, a known triterpenoid found in one of the more potent extracts examined in Chapter 3,

Tripterygium wilfordii Hook F. In vitro, this compound shows potent anti-inflammatory activity and induction of cytoprotective gene expression with demonstrated dependence on Nrf2. In vivo, celastrol exhibits profound ability to delay onset of colon carcinogenesis in a unique genetic model for colitis-associated colon cancer. Suppression of inflammatory mediators in the colon epithelia and serum is observed with modest induction of cytoprotective genes. These collective evidences support the further exploration of celastrol as a chemopreventive in preclinical models and eventually in human studies. Chapter 5 summarizes opportunities for continued work on these studies and concludes with a statement of the impact of the research and results presented herein.

40 1.7 References

1. Newman, D.J., Cragg, G.M. & Snader, K.M. The influence of natural products

upon drug discovery. Natural product reports 17, 215-234 (2000).

2. Capasso, L. 5300 years ago, the Ice Man used natural laxatives and antibiotics.

Lancet 352, 1864 (1998).

3. Xutian, S., Cao, D., Wozniak, J., Junion, J. & Boisvert, J. Comprehension of the

unique characteristics of traditional Chinese medicine. The American journal of

Chinese medicine 40, 231-244 (2012).

4. Kang, Y.J. Herbogenomics: from traditional Chinese medicine to novel

therapeutics. Exp Biol Med (Maywood) 233, 1059-1065 (2008).

5. Jiang, Y., David, B., Tu, P. & Barbin, Y. Recent analytical approaches in quality

control of traditional Chinese medicines--a review. Analytica chimica acta 657, 9-

18 (2010).

6. Lockemann, G. Friedrich Wilhelm Serturner, the discoverer of morphine. Journal

of Chemical Education 28, 277-279 (1951).

7. Sneader, W. The discovery of aspirin: a reappraisal. BMJ 321, 1591-1594 (2000).

8. Wall, M.E. et al. Plant Antitumor Agents .I. Isolation and Structure of

Camptothecin a Novel Alkaloidal Leukemia and Tumor Inhibitor from

Camptotheca Acuminata. Journal of the American Chemical Society 88, 3888-

3890 (1966).

9. Wani, M.C., Taylor, H.L., Wall, M.E., Coggon, P. & Mcphail, A.T. Plant

Antitumor Agents .6. Isolation and Structure of Taxol, a Novel Antileukemic and

41 Antitumor Agent from Taxus-Brevifolia. Journal of the American Chemical

Society 93, 2325-& (1971).

10. Oberlies, N.H. & Kroll, D.J. Camptothecin and Taxol: Historic Achievements in

Natural Products Research. J. Nat. Prod. 67, 129-135 (2004).

11. Holton, R.A. et al. First total synthesis of taxol. 2. Completion of the C and D

rings. Journal of the American Chemical Society 116, 1599-1600 (1994).

12. Holton, R.A. et al. First total synthesis of taxol. 1. Functionalization of the B ring.

Journal of the American Chemical Society 116, 1597-1598 (1994).

13. Raber, L.R. Anticancer research honored at RTI. Chem Eng News 81, 58-58

(2003).

14. Duffin, J. Poisoning the spindle: serendipity and discovery of the anti-tumor

properties of the Vinca alkaloids. Pharmacy in history 44, 64-76 (2002).

15. Gueritte, F. & Fahy, J. The Vinca Alkaloids. In: Anticancer Agents from Natural

Products, Edn. 2005. (CRC Press LLC, Boca Raton, FL; 2005).

16. Pearce Homer, L. & Alice Miller, M. The evolution of cancer research and drug

discovery at Lilly Research Laboratories. Advances in enzyme regulation 45, 229-

255 (2005).

17. Johnson, I.S., Armstrong, J.G., Gorman, M. & Burnett, J.P., Jr. The Vinca

Alkaloids: A New Class of Oncolytic Agents. Cancer research 23, 1390-1427

(1963).

18. Jones, W.P., Chin, Y.W. & Kinghorn, A.D. The role of pharmacognosy in modern

medicine and pharmacy. Current drug targets 7, 247-264 (2006).

42 19. Balunas, M.J. & Kinghorn, A.D. Drug discovery from medicinal plants. Life

sciences 78, 431-441 (2005).

20. Harvey, A.L. Natural products in drug discovery. Drug discovery today 13, 894-

901 (2008).

21. Paterson, I. & Anderson, E.A. Chemistry. The renaissance of natural products as

drug candidates. Science 310, 451-453 (2005).

22. Chin, Y.W., Balunas, M.J., Chai, H.B. & Kinghorn, A.D. Drug discovery from

natural sources. The AAPS journal 8, E239-253 (2006).

23. Koehn, F.E. & Carter, G.T. The evolving role of natural products in drug

discovery. Nature reviews. Drug discovery 4, 206-220 (2005).

24. Gross, M. Combinatorial chemistry with biological help. Chem World-Uk 2, 50-

53 (2005).

25. Lahana, R. How many leads from HTS? Drug discovery today 4, 447-448 (1999).

26. Scannell, J.W., Blanckley, A., Boldon, H. & Warrington, B. Diagnosing the

decline in pharmaceutical R&D efficiency. Nature reviews. Drug discovery 11,

191-200 (2012).

27. Newman, D.J. & Cragg, G.M. Natural products as sources of new drugs over the

30 years from 1981 to 2010. Journal of natural products 75, 311-335 (2012).

28. Cordell, G.A. & Colvard, M.D. Natural products and traditional medicine: turning

on a paradigm. Journal of natural products 75, 514-525 (2012).

29. Xu, R., Fazio, G.C. & Matsuda, S.P. On the origins of triterpenoid skeletal

diversity. Phytochemistry 65, 261-291 (2004).

43 30. Phillips, D.R., Rasbery, J.M., Bartel, B. & Matsuda, S.P. Biosynthetic diversity in

plant triterpene cyclization. Current opinion in plant biology 9, 305-314 (2006).

31. Dzubak, P. et al. Pharmacological activities of natural triterpenoids and their

therapeutic implications. Natural product reports 23, 394-411 (2006).

32. Liby, K.T. & Sporn, M.B. Synthetic oleanane triterpenoids: multifunctional drugs

with a broad range of applications for prevention and treatment of chronic

disease. Pharmacological reviews 64, 972-1003 (2012).

33. Biglino, G. Constituents of the root of Bryonia dioica. Ann. Chim. 49, 782-792

(1959).

34. Sim, K.Y. & Lee, H.T. Triterpenoid and other constituents from Sandoricum

indicum. Phytochemistry 11, 3341-3343 (1972).

35. Dayal, R. & Dobhal, P.C. Tetrameles nudiflora-a new potential source of

bryonolic acid. J. Med. Aromat. Plant Sci. 23, 660-661 (2001).

36. Biglino, G., Cattel, L. & Caputo, O. Structure of bryonolic acid. Ricerca

Scientifica 39, 207-209 (1969).

37. Tanaka, S. et al. Anti-allergic effect of bryonolic acid from Luffa cylindrica cell

suspension cultures. Planta Med. 57, 527-530 (1991).

38. Takeda, T., Kondo, T., Mizukami, H. & Ogihara, Y. Bryonolic acid production in

hairy roots of Trichosanthes kirilowii Max. var. japonica Kitam. transformed with

Agrobacterium rhizogenes and its cytotoxic activity. Chem. Pharm. Bull. 42, 730-

732 (1994).

44 39. Kondo, T., Inoue, M., Mizukami, H. & Ogihara, Y. Cytotoxic activity of

bryonolic acid isolated from transformed hairy roots of Trichosanthes kirilowii

var. japonica. Biological & pharmaceutical bulletin 18, 726-729 (1995).

40. Akihisa, T. et al. Anti-tumor promoting effects of multiflorane-type triterpenoids

and cytotoxic activity of karounidiol against human cancer cell lines. Cancer Lett.

(Shannon, Irel.) 173, 9-14 (2001).

41. Barker, E.C. & Gatbonton-Schwager, T.N. et al. Bryonolic acid: a large-scale

isolation and evaluation of heme oxygenase 1 expression in activated

macrophages. Journal of Natural Products 73, 1064-1068 (2010).

42. Ignatenko, V.A., Han, Y. & Tochtrop, G.P. Molecular library synthesis using

complex substrates: expanding the framework of triterpenoids. J Org Chem 78,

410-418 (2013).

43. Ignatenko, V.A., Han, Y. & Tochtrop, G.P. Direct Access to 6/5/7/5-and 6/7/5/5-

Fused Tetracyclic Triterpenoids via Divergent Transannular Aldol Reaction of

Lanosterol-Derived Diketone. J Org Chem 78, 12229-12235 (2013).

44. Ignatenko, V.A. & Tochtrop, G.P. Approach for expanding triterpenoid

complexity via divergent Norrish-Yang photocyclization. J Org Chem 78, 3821-

3831 (2013).

45. Ignatenko, V.A., Department of Chemistry, Dissertation, Doctor of Philosophy

(Case Western Reserve University, 2013).

46. Gatbonton-Schwager, T.N., Department of Pharmacology, Dissertation, Doctor of

Philosophy (Case Western Reserve University, 2014).

45 47. Gatbonton-Schwager, T.N., Letterio, J.J. & Tochtrop, G.P. Bryonolic acid

transcriptional control of anti-inflammatory and antioxidant genes in macrophages

in vitro and in vivo. Journal of natural products 75, 591-598 (2012).

48. Chou, T.Q. & Mei, P.F. The principle of the Chinese drug Lei-Kung-Teng,

Tripterygium wilfordii, Hook. I. The coloring subtance and the sugars. Zhongguo

Shenglixue Zazhi 10, 529-534 (1936).

49. Ma, J.S., Brach, A.R. & Liu, Q. A Revision of the Genus Tripterygium

(Celastraceae). Edinburgh Journal of Botany 56, 33-46 (1999).

50. Gisvold, O. The pigments contained in the bark of the root of Celastrus scandens.

Journal of the American Pharmaceutical Association 28, 440-443 (1939).

51. Schechter, M.S. & Haller, H.L. Identity of the red pigment in the roots of

Tripterygium wilfordii and Celastrus scandens. Journal of the American Chemical

Society 64, 182-183 (1942).

52. Gisvold, O. The constitution of celastrol. II. Journal of the American

Pharmaceutical Association 29, 12-14 (1940).

53. Gisvold, O. Constitution of celastrol. III. Journal of the American Pharmaceutical

Association 29, 432-434 (1940).

54. Kulkarni, A.B. & Shah, R.C. Structure of pristimerin. Nature (London, United

Kingdom) 173, 1237-1238 (1954).

55. Li, H. et al. Effect of tripterin on collagen-induced arthritis in rats. Zhongguo

Yaoli Xuebao 18, 270-273 (1997).

46 56. Li, H., Zhang, Y.-Y., Tan, H.-W., Jia, Y.-F. & Li, D. Therapeutic effect of

tripterine on adjuvant arthritis in rats. Journal of Ethnopharmacology 118, 479-

484 (2008).

57. Venkatesha, S.H., Yu, H., Rajaiah, R., Tong, L. & Moudgil, K.D. Celastrus-

derived Celastrol Suppresses Autoimmune Arthritis by Modulating Antigen-

induced Cellular and Humoral Effector Responses. Journal of Biological

Chemistry 286, 15138-15146 (2011).

58. Paris, D. et al. Reduction of beta-amyloid pathology by celastrol in a transgenic

mouse model of Alzheimer's disease. Journal of Neuroinflammation 7, 17 (2010).

59. Cleren, C., Calingasan, N.Y., Chen, J. & Beal, M.F. Celastrol protects against

MPTP- and 3-nitropropionic acid-induced neurotoxicity. Journal of

Neurochemistry 94, 995-1004 (2005).

60. Kiaei, M. et al. Celastrol blocks neuronal cell death and extends life in transgenic

mouse model of amyotrophic lateral sclerosis. Neurodegenerative Diseases 2,

246-254 (2005).

61. Kim, D.Y., Park, J.W., Jeoung, D. & Ro, J.Y. Celastrol suppresses allergen-

induced airway inflammation in a mouse allergic asthma model. Eur J Pharmacol

612, 98-105 (2009).

62. Yu, X. et al. Celastrol Attenuates Hypertension-Induced Inflammation and

Oxidative Stress in Vascular Smooth Muscle Cells via Induction of Heme

Oxygenase-1. American Journal of Hypertension 23, 895-903 (2010).

47 63. Xu, X., Wu, Z., Xu, C., Ren, Y. & Ge, Y. Observation on serum anti-double

stranded DNA antibodies of tripterine in systematic lupus erythematosus of (NZB

x W) F1 mice. Annals of the Rheumatic Diseases 62, 377-378 (2003).

64. Li, H. et al. Beneficial effect of tripterine on systemic lupus erythematosus

induced by active chromatin in BALB/c mice. European Journal of

Pharmacology 512, 231-237 (2005).

65. Kim, Y. et al. Celastrol binds to ERK and inhibits FcεRI signaling to exert an

anti-allergic effect. European Journal of Pharmacology 612, 131-142 (2009).

66. Kannaiyan, R. et al. Celastrol inhibits tumor cell proliferation and promotes

apoptosis through the activation of c-Jun N-terminal kinase and suppression of

PI3 K/Akt signaling pathways. Apoptosis 16, 1028-1041 (2011).

67. Yang, H., Chen, D., Cui, Q.C., Yuan, X. & Dou, Q.P. Celastrol, a Triterpene

Extracted from the Chinese "Thunder of God Vine," Is a Potent Proteasome

Inhibitor and Suppresses Human Prostate Cancer Growth in Nude Mice. Cancer

Research 66, 4758-4765 (2006).

68. Allison, A.C., Cacabelos, R., Lombardi, V.R.M., Alvarez, X.A. & Vigo, C.

Celastrol, a potent antioxidant and anti-inflammatory drug, as a possible treatment

for Alzheimer's disease. Progress in Neuro-Psychopharmacology & Biological

Psychiatry 25, 1341-1357 (2001).

69. Jin, H.Z. et al. Antiinflammatory Constituents of Celastrus orbiculatus Inhibit the

NF-κB Activation and NO Production. Journal of Natural Products 65, 89-91

(2002).

48 70. Westerheide, S.D. et al. Celastrols as Inducers of the Heat Shock Response and

Cytoprotection. Journal of Biological Chemistry 279, 56053-56060 (2004).

71. Lee, J.-H. et al. Inhibition of NF-κB activation through targeting IκB kinase by

celastrol, a quinone methide triterpenoid. Biochemical Pharmacology 72, 1311-

1321 (2006).

72. Chow, A.M. & Brown, I.R. Induction of heat shock proteins in differentiated

human and rodent neurons by celastrol. Cell Stress & Chaperones 12, 237-244

(2007).

73. Sethi, G., Ahn, K.S., Pandey, M.K. & Aggarwal, B.B. Celastrol, a novel

triterpene, potentiates TNF-induced apoptosis and suppresses invasion of tumor

cells by inhibiting NF-κB-regulated gene products and TAK1-mediated NF-κB

activation. Blood 109, 2727-2735 (2007).

74. Jung, H.W., Chung, Y.S., Kim, Y.S. & Park, Y.-K. Celastrol inhibits production

of nitric oxide and proinflammatory cytokines through MAPK signal transduction

and NF-κB in LPS-stimulated BV-2 microglial cells. Experimental and Molecular

Medicine 39, 715-721 (2007).

75. Zhang, Y.-Q. & Sarge, K.D. Celastrol inhibits polyglutamine aggregation and

toxicity though induction of the heat shock response. Journal of Molecular

Medicine (Heidelberg, Germany) 85, 1421-1428 (2007).

76. Trott, A. et al. Activation of heat shock and antioxidant responses by the natural

product celastrol: transcriptional signatures of a thiol-targeted molecule.

Molecular Biology of the Cell 19, 1104-1112 (2008).

49 77. Zhang, T. et al. A novel Hsp90 inhibitor to disrupt Hsp90/Cdc37 complex against

pancreatic cancer cells. Molecular Cancer Therapeutics 7, 162-170 (2008).

78. Zhang, T. et al. Characterization of Celastrol to Inhibit Hsp90 and Cdc37

Interaction. Journal of Biological Chemistry 284, 35381-35389 (2009).

79. Nagase, M. et al. Apoptosis induction in HL-60 cells and inhibition of

topoisomerase II by triterpene Celastrol. Bioscience, Biotechnology, and

Biochemistry 67, 1883-1887 (2003).

80. Chapelsky, S., Batty, S., Frost, M. & Mogridge, J. Inhibition of anthrax lethal

toxin-induced cytolysis of RAW264.7 cells by celastrol. PloS one 3, e1421

(2008).

81. Sun, H., Liu, X., Xiong, Q., Shikano, S. & Li, M. Chronic Inhibition of Cardiac

Kir2.1 and hERG Potassium Channels by Celastrol with Dual Effects on Both Ion

Conductivity and Protein Trafficking. Journal of Biological Chemistry 281, 5877-

5884 (2006).

82. Sreeramulu, S., Gande Santosh, L., Gobel, M. & Schwalbe, H. Molecular

mechanism of inhibition of the human protein complex Hsp90-Cdc37, a kinome

chaperone-cochaperone, by triterpene celastrol. Angewandte Chemie

(International ed. in English) 48, 5853-5855 (2009).

83. Zhang, Y. et al. HSF1-Dependent Upregulation of Hsp70 by Sulfhydryl-Reactive

Inducers of the KEAP1/NRF2/ARE Pathway. Chemistry & Biology (Cambridge,

MA, United States) 18, 1355-1361 (2011).

84. Liu, J. Pharmacology of oleanolic acid and ursolic acid. Journal of

Ethnopharmacology 49, 57-68 (1995).

50 85. Liu, J. Oleanolic acid and ursolic acid: research perspectives. Journal of

Ethnopharmacology 100, 92-94 (2005).

86. Honda, T., Finlay, H.J., Gribble, G.W., Suh, N. & Sporn, M.B. New enone

derivatives of oleanolic acid and ursolic acid as inhibitors of nitric oxide

production in mouse macrophages. Bioorg. Med. Chem. Lett. 7, 1623-1628

(1997).

87. Suh, N. et al. Novel triterpenoids suppress inducible nitric oxide synthase (iNOS)

and inducible cyclooxygenase (COX-2) in mouse macrophages. Cancer Research

58, 717-723 (1998).

88. Honda, T. et al. Design and synthesis of 2-cyano-3,12-dioxoolean-1,9-dien-28-oic

acid, a novel and highly active inhibitor of nitric oxide production in mouse

macrophages. Bioorganic & Medicinal Chemistry Letters 8, 2711-2714 (1998).

89. Liby, K. et al. The synthetic triterpenoids, CDDO and CDDO-imidazolide, are

potent inducers of heme oxygenase-1 and Nrf2/ARE signaling. Cancer Research

65, 4789-4798 (2005).

90. Dinkova-Kostova, A.T. et al. Extremely potent triterpenoid inducers of the phase

2 response: Correlations of protection against oxidant and inflammatory stress.

Proceedings of the National Academy of Sciences of the United States of America

102, 4584-4589 (2005).

91. Suh, N.J. et al. A novel synthetic oleanane triterpenoid, 2-cyano-3,12-dioxoolean-

1,9-dien-28-oic acid, with potent differentiating, antiproliferative, and anti-

inflammatory activity. Cancer Research 59, 336-341 (1999).

51 92. Liby, K.T., Yore, M.M. & Sporn, M.B. Triterpenoids and rexinoids as

multifunctional agents for the prevention and treatment of cancer. Nature reviews.

Cancer 7, 357-369 (2007).

93. Pergola, P.E. et al. Bardoxolone methyl and kidney function in CKD with type 2

diabetes. The New England Journal of Medicine 365, 327-336 (2011).

94. Abboud, H.E. Synthetic oleanane triterpenoids: magic bullets or not? Kidney

International 83, 785-787 (2013).

95. Zhang, D.D. Bardoxolone brings Nrf2-based therapies to light. Antioxidants &

Redox Signaling 19, 517-518 (2013).

96. Reata Pharmaceuticals, I. (U.S. National Institutes of Health, clinicaltrials.gov.

97. Leaf, C. The Truth in Small Doses. Why We're Losing the War on Cancer and

How to Win it. (Simon and Schuster, New York, NY; 2013).

98. Sporn, M.B. Perspective: The big C - for Chemoprevention. Nature 471, S10-11

(2011).

99. O'Callaghan, T. Introduction: The prevention agenda. Nature 471, S2-4 (2011).

100. Savage, N. Early detection: Spotting the first signs. Nature 471, S14-15 (2011).

101. Leaf, C. Why we're losing the war on cancer (and how to win it). Fortune 149,

76-82, 84-76, 88 passim (2004).

102. Sporn, M.B. & Liby, K.T. Cancer chemoprevention: scientific promise, clinical

uncertainty. Nature Clinical Practice. Oncology 2, 518-525 (2005).

103. Bailar, J.C., 3rd & Smith, E.M. Progress against cancer? The New England

Journal of Medicine 314, 1226-1232 (1986).

104. Wattenberg, L.W. Chemoprevention of cancer. Cancer research 45, 1-8 (1985).

52 105. Gravitz, L. Chemoprevention: First line of defence. Nature 471, S5-7 (2011).

106. Maskrey, B.H., Megson, I.L., Whitfield, P.D. & Rossi, A.G. Mechanisms of

resolution of inflammation: a focus on cardiovascular disease. Arteriosclerosis,

Thrombosis, and Vascular Biology 31, 1001-1006 (2011).

107. Dhalla, N.S., Temsah, R.M. & Netticadan, T. Role of oxidative stress in

cardiovascular diseases. Journal of Hypertension 18, 655-673 (2000).

108. Perk, J. et al. European Guidelines on cardiovascular disease prevention in

clinical practice (version 2012). The Fifth Joint Task Force of the European

Society of Cardiology and Other Societies on Cardiovascular Disease Prevention

in Clinical Practice (constituted by representatives of nine societies and by invited

experts). European heart journal 33, 1635-1701 (2012).

109. Veronesi, U. et al. Fifteen-year results of a randomized phase III trial of

fenretinide to prevent second breast cancer. Annals of oncology : official journal

of the European Society for Medical Oncology / ESMO 17, 1065-1071 (2006).

110. Steward, W.P. & Brown, K. Cancer chemoprevention: a rapidly evolving field.

British Journal of Cancer 109, 1-7 (2013).

111. Wang, D. & DuBois, R.N. The role of anti-inflammatory drugs in colorectal

cancer. Annual review of medicine 64, 131-144 (2013).

112. Fink, S.P. et al. Aspirin and the risk of colorectal cancer in relation to the

expression of 15-hydroxyprostaglandin dehydrogenase (HPGD). Science

Translational Medicine 6, 233re232 (2014).

53 113. Karin, M. & Greten, F.R. NF-kappaB: linking inflammation and immunity to

cancer development and progression. Nature reviews. Immunology 5, 749-759

(2005).

114. Albini, A. & Sporn, M.B. The tumour microenvironment as a target for

chemoprevention. Nature reviews. Cancer 7, 139-147 (2007).

115. Kwak, M.K. & Kensler, T.W. Targeting NRF2 signaling for cancer

chemoprevention. Toxicology and Applied Pharmacology 244, 66-76 (2010).

116. Burke, A., Smyth, E. & FigzGerald, G.A. Chapter 26. Analgesic-Antipyretic and

Antiinflammatory Agents; Pharmacotherapy of Gout, Edn. 11.

117. Furst, D.E., Ulrich, R.W. & Varkey-Altamirano, C. Chapter 36. Nonsteroidal

Anti-Inflammatory Drugs, Disease-Modifying Antirheumatic Drugs, Nonopioid

Alalgesics, & Drugs Used in Gout, Edn. 11.

118. Balkwill, F. & Coussens, L.M. Cancer: An inflammatory link. Nature (London,

United Kingdom) 431, 405-406 (2004).

119. Balkwill, F. & Mantovani, A. Inflammation and cancer: back to Virchow? Lancet

357, 539-545 (2001).

120. Mantovani, A., Allavena, P., Sica, A. & Balkwill, F. Cancer-related inflammation.

Nature 454, 436-444 (2008).

121. Borrello, M.G. et al. Induction of a proinflammatory program in normal human

thyrocytes by the RET/PTC1 oncogene. Proceedings of the National Academy of

Sciences of the United States of America 102, 14825-14830 (2005).

54 122. Colotta, F., Allavena, P., Sica, A., Garlanda, C. & Mantovani, A. Cancer-related

inflammation, the seventh hallmark of cancer: links to genetic instability.

Carcinogenesis 30, 1073-1081 (2009).

123. Balkwill, F. & Coussens, L.M. Cancer: an inflammatory link. Nature 431, 405-

406 (2004).

124. Markowitz, S.D. & Bertagnolli, M.M. Molecular origins of cancer: Molecular

basis of colorectal cancer. The New England Journal of Medicine 361, 2449-2460

(2009).

125. Chan, A.T. & Giovannucci, E.L. Primary prevention of colorectal cancer.

Gastroenterology 138, 2029-2043 e2010 (2010).

126. Rizzo, A., Pallone, F., Monteleone, G. & Fantini, M.C. Intestinal inflammation

and colorectal cancer: a double-edged sword? World journal of Gastroenterology:

WJG 17, 3092-3100 (2011).

127. Karin, M., Cao, Y., Greten, F.R. & Li, Z.W. NF-kappaB in cancer: from innocent

bystander to major culprit. Nature reviews. Cancer 2, 301-310 (2002).

128. Wattenberg, L.W. Inhibitors of chemical carcinogenesis. Advances in Cancer

Research 26, 197-226 (1978).

129. Talalay, P., De Long, M.J. & Prochaska, H.J. Identification of a common

chemical signal regulating the induction of enzymes that protect against chemical

carcinogenesis. Proceedings of the National Academy of Sciences of the United

States of America 85, 8261-8265 (1988).

55 130. Itoh, K., Mimura, J. & Yamamoto, M. Discovery of the negative regulator of

Nrf2, Keap1: a historical overview. Antioxidants & Redox Signaling 13, 1665-

1678 (2010).

131. Rushmore, T.H. & Pickett, C.B. Transcriptional regulation of the rat glutathione

S-transferase Ya subunit gene. Characterization of a xenobiotic-responsive

element controlling inducible expression by phenolic antioxidants. J Biol Chem

265, 14648-14653 (1990).

132. Rushmore, T.H., Morton, M.R. & Pickett, C.B. The antioxidant responsive

element. Activation by oxidative stress and identification of the DNA consensus

sequence required for functional activity. J Biol Chem 266, 11632-11639 (1991).

133. Prestera, T. et al. Parallel induction of heme oxygenase-1 and chemoprotective

phase 2 enzymes by electrophiles and antioxidants: regulation by upstream

antioxidant-responsive elements (ARE). Mol Med 1, 827-837 (1995).

134. Moi, P., Chan, K., Asunis, I., Cao, A. & Kan, Y.W. Isolation of NF-E2-related

factor 2 (Nrf2), a NF-E2-like basic leucine zipper transcriptional activator that

binds to the tandem NF-E2/AP1 repeat of the beta-globin locus control region.

Proceedings of the National Academy of Sciences of the United States of America

91, 9926-9930 (1994).

135. Venugopal, R. & Jaiswal, A.K. Nrf1 and Nrf2 positively and c-Fos and Fra1

negatively regulate the human antioxidant response element-mediated expression

of NAD(P)H:quinone oxidoreductase1 gene. Proceedings of the National

Academy of Sciences of the United States of America 93, 14960-14965 (1996).

56 136. Chan, K., Lu, R., Chang, J.C. & Kan, Y.W. NRF2, a member of the NFE2 family

of transcription factors, is not essential for murine erythropoiesis, growth, and

development. Proceedings of the National Academy of Sciences of the United

States of America 93, 13943-13948 (1996).

137. Itoh, K., Igarashi, K., Hayashi, N., Nishizawa, M. & Yamamoto, M. Cloning and

characterization of a novel erythroid cell-derived CNC family transcription factor

heterodimerizing with the small Maf family proteins. Molecular and cellular

biology 15, 4184-4193 (1995).

138. Itoh, K. et al. An Nrf2/small Maf heterodimer mediates the induction of phase II

detoxifying enzyme genes through antioxidant response elements. Biochemical

and Biophysical Research Communications 236, 313-322 (1997).

139. Yoh, K. et al. Nrf2-deficient female mice develop lupus-like autoimmune

nephritis. Kidney Int 60, 1343-1353 (2001).

140. Hubbs, A.F. et al. Vacuolar leukoencephalopathy with widespread astrogliosis in

mice lacking transcription factor Nrf2. The American Journal of Pathology 170,

2068-2076 (2007).

141. Ma, Q., Battelli, L. & Hubbs, A.F. Multiorgan autoimmune inflammation,

enhanced lymphoproliferation, and impaired homeostasis of reactive oxygen

species in mice lacking the antioxidant-activated transcription factor Nrf2. The

American Journal of Pathology 168, 1960-1974 (2006).

142. Cho, H.Y. et al. Role of NRF2 in protection against hyperoxic lung injury in

mice. American Journal of Respiratory Cell and Molecular Biology 26, 175-182

(2002).

57 143. Iizuka, T. et al. Nrf2-deficient mice are highly susceptible to cigarette smoke-

induced emphysema. Genes to Cells : devoted to molecular & cellular

mechanisms 10, 1113-1125 (2005).

144. Shih, A.Y. et al. Induction of the Nrf2-driven antioxidant response confers

neuroprotection during mitochondrial stress in vivo. J Biol Chem 280, 22925-

22936 (2005).

145. Calkins, M.J. et al. Protection from mitochondrial complex II inhibition in vitro

and in vivo by Nrf2-mediated transcription. Proceedings of the National Academy

of Sciences of the United States of America 102, 244-249 (2005).

146. Thimmulappa, R.K. et al. Nrf2 is a critical regulator of the innate immune

response and survival during experimental sepsis. The Journal of clinical

investigation 116, 984-995 (2006).

147. Khor, T.O. et al. Nrf2-deficient mice have an increased susceptibility to dextran

sulfate sodium-induced colitis. Cancer Research 66, 11580-11584 (2006).

148. Khor, T.O. et al. Increased susceptibility of Nrf2 knockout mice to colitis-

associated colorectal cancer. Cancer Prev Res (Phila) 1, 187-191 (2008).

149. Iida, K. et al. Nrf2 is essential for the chemopreventive efficacy of oltipraz against

urinary bladder carcinogenesis. Cancer Research 64, 6424-6431 (2004).

150. Ramos-Gomez, M. et al. Sensitivity to carcinogenesis is increased and

chemoprotective efficacy of enzyme inducers is lost in nrf2 transcription factor-

deficient mice. Proceedings of the National Academy of Sciences of the United

States of America 98, 3410-3415 (2001).

58 151. Ishii, T. et al. Transcription factor Nrf2 coordinately regulates a group of

oxidative stress-inducible genes in macrophages. J Biol Chem 275, 16023-16029

(2000).

152. Itoh, K. et al. Keap1 represses nuclear activation of antioxidant responsive

elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes &

Development 13, 76-86 (1999).

153. Tong, K.I. et al. Keap1 recruits Neh2 through binding to ETGE and DLG motifs:

characterization of the two-site molecular recognition model. Molecular and

Cellular Biology 26, 2887-2900 (2006).

154. Kang, M.I., Kobayashi, A., Wakabayashi, N., Kim, S.G. & Yamamoto, M.

Scaffolding of Keap1 to the actin cytoskeleton controls the function of Nrf2 as

key regulator of cytoprotective phase 2 genes. Proceedings of the National

Academy of Sciences of the United States of America 101, 2046-2051 (2004).

155. Dinkova-Kostova, A.T. et al. Direct evidence that sulfhydryl groups of Keap1 are

the sensors regulating induction of phase 2 enzymes that protect against

carcinogens and oxidants. Proceedings of the National Academy of Sciences of the

United States of America 99, 11908-11913 (2002).

156. Taguchi, K., Motohashi, H. & Yamamoto, M. Molecular mechanisms of the

Keap1-Nrf2 pathway in stress response and cancer evolution. Genes to Cells :

devoted to molecular & cellular mechanisms 16, 123-140 (2011).

157. Kensler, T.W. & Wakabayashi, N. Nrf2: friend or foe for chemoprevention?

Carcinogenesis 31, 90-99 (2010).

59 158. Eaton, D.L. & Gallagher, E.P. Mechanisms of aflatoxin carcinogenesis. Annual

Review of Pharmacology and Toxicology 34, 135-172 (1994).

159. Henderson, C.J. et al. Increased skin tumorigenesis in mice lacking pi class

glutathione S-transferases. Proceedings of the National Academy of Sciences of

the United States of America 95, 5275-5280 (1998).

160. Ramos-Gomez, M., Dolan, P.M., Itoh, K., Yamamoto, M. & Kensler, T.W.

Interactive effects of nrf2 genotype and oltipraz on benzo[a]pyrene-DNA adducts

and tumor yield in mice. Carcinogenesis 24, 461-467 (2003).

161. Palli, D. et al. Diet, metabolic polymorphisms and dna adducts: the EPIC-Italy

cross-sectional study. International Journal of Cancer. Journal international du

cancer 87, 444-451 (2000).

162. Fahey, J.W. et al. Sulforaphane inhibits extracellular, intracellular, and antibiotic-

resistant strains of Helicobacter pylori and prevents benzo[a]pyrene-induced

stomach tumors. Proceedings of the National Academy of Sciences of the United

States of America 99, 7610-7615 (2002).

163. Zhang, Y. & Munday, R. Dithiolethiones for cancer chemoprevention: where do

we stand? Mol Cancer Ther 7, 3470-3479 (2008).

164. Zhang, Y., Talalay, P., Cho, C.G. & Posner, G.H. A major inducer of

anticarcinogenic protective enzymes from broccoli: isolation and elucidation of

structure. Proceedings of the National Academy of Sciences of the United States

of America 89, 2399-2403 (1992).

60 165. Spencer, S.R., Wilczak, C.A. & Talalay, P. Induction of glutathione transferases

and NAD(P)H:quinone reductase by fumaric acid derivatives in rodent cells and

tissues. Cancer Research 50, 7871-7875 (1990).

166. Riboli, E. & Norat, T. Epidemiologic evidence of the protective effect of fruit and

vegetables on cancer risk. The American Journal of Clinical Nutrition 78, 559S-

569S (2003).

167. Kensler, T.W. et al. Keap1-Nrf2 signaling: a target for cancer prevention by

sulforaphane. Topics in Current Chemistry 329, 163-178 (2013).

168. Fahey, J.W., Zalcmann, A.T. & Talalay, P. The chemical diversity and

distribution of glucosinolates and isothiocyanates among plants. Phytochemistry

56, 5-51 (2001).

169. Hu, C., Eggler, A.L., Mesecar, A.D. & van Breemen, R.B. Modification of keap1

cysteine residues by sulforaphane. Chemical Research in Toxicology 24, 515-521

(2011).

170. Kobayashi, M. et al. The antioxidant defense system Keap1-Nrf2 comprises a

multiple sensing mechanism for responding to a wide range of chemical

compounds. Molecular and Cellular Biology 29, 493-502 (2009).

171. Thimmulappa, R.K. et al. Identification of Nrf2-regulated genes induced by the

chemopreventive agent sulforaphane by oligonucleotide microarray. Cancer

Research 62, 5196-5203 (2002).

172. Yates, M.S. et al. Genetic versus chemoprotective activation of Nrf2 signaling:

overlapping yet distinct gene expression profiles between Keap1 knockout and

triterpenoid-treated mice. Carcinogenesis 30, 1024-1031 (2009).

61 173. Agyeman, A.S. et al. Transcriptomic and proteomic profiling of KEAP1 disrupted

and sulforaphane-treated human breast epithelial cells reveals common expression

profiles. Breast Cancer Research and Treatment 132, 175-187 (2012).

174. Dinkova-Kostova, A.T. Chemoprotection against cancer by isothiocyanates: a

focus on the animal models and the protective mechanisms. Top Curr Chem 329,

179-201 (2013).

175. Kensler, T.W., Roebuck, B.D., Wogan, G.N. & Groopman, J.D. Aflatoxin: a 50-

year odyssey of mechanistic and translational toxicology. Toxicological sciences:

an official journal of the Society of Toxicology 120 Suppl 1, S28-48 (2011).

176. Shapiro, T.A. et al. Safety, tolerance, and metabolism of broccoli sprout

glucosinolates and isothiocyanates: a clinical phase I study. Nutrition and Cancer

55, 53-62 (2006).

177. Shapiro, T.A., Fahey, J.W., Wade, K.L., Stephenson, K.K. & Talalay, P. Human

metabolism and excretion of cancer chemoprotective glucosinolates and

isothiocyanates of cruciferous vegetables. Cancer Epidemiology, Biomarkers &

Prevention : a publication of the American Association for Cancer Research,

cosponsored by the American Society of Preventive Oncology 7, 1091-1100

(1998).

178. Ye, L. et al. Quantitative determination of dithiocarbamates in human plasma,

serum, erythrocytes and urine: pharmacokinetics of broccoli sprout

isothiocyanates in humans. Clinica chimica acta; international journal of clinical

chemistry 316, 43-53 (2002).

62 179. Egner, P.A. et al. Bioavailability of Sulforaphane from two broccoli sprout

beverages: results of a short-term, cross-over clinical trial in Qidong, China.

Cancer Prev Res (Phila) 4, 384-395 (2011).

180. Kensler, T.W. et al. Effects of glucosinolate-rich broccoli sprouts on urinary

levels of aflatoxin-DNA adducts and phenanthrene tetraols in a randomized

clinical trial in He Zuo township, Qidong, People's Republic of China. Cancer

Epidemiology, Biomarkers & Prevention : a publication of the American

Association for Cancer Research, cosponsored by the American Society of

Preventive Oncology 14, 2605-2613 (2005).

181. Thimmulappa, R.K. et al. Nrf2-dependent protection from LPS induced

inflammatory response and mortality by CDDO-Imidazolide. Biochemical and

Biophysical Research Communications 351, 883-889 (2006).

63 Chapter 2: Bryonolic Acid: A Large-Scale Isolation and Evaluation of Heme

Oxygenase 1 Expression in Activated Macrophagesa

2.1 Introduction

Bryonolic acid (3β-hydroxy-D:C-friedoolean-8-en-29-oic acid, BA) is a naturally occurring triterpenoid that has been identified in multiple species of the Cucurbitaceae family and in dispersed species of other reported plant families (Meliaceae,

Tetramelaceae, and Anisophylleaceae)1-4. It was first isolated in 1960 from roots of

Bryonia dioica Jacq. (Cucurbitaceae), with an initial structure reporting a carboxylic acid moiety at C–19, and unsaturation at C–12/C–131. A revised structure was subsequently published assigning unsaturation to the C–8/C–9 B–C ring fusion and the carboxylic acid moiety at C–20 (Figure 2.1)5.

Figure 2.1 Bryonolic Acid Structure and Numbering.

a Reproduced with permission from Journal of Natural Products 2010 73 (6) pp 1064-1068. Copyright ©

2010 The American Chemical Society and the American Society of Pharmacognosy

64 Several biological activities have been reported for BA, including anti-allergic properties in rodents6 and a panel of cytotoxic and anti-tumor activities in various cancer cell lines7-9. Despite these reports, there has never been an investigation into the molecular underpinnings of these phenotypes. Our laboratory has central interests in how triterpenoid natural products signal through the phase 2 response, an activity that is best represented by the semi-synthetic oleanane triterpenoids, which have been implicated in induction of the phase 2 response through the Nrf2:INrf2 (Keap1) signaling pathway10, 11.

In accordance with these interests, we investigated whether the molecular basis of BA’s reported activities could be related to induction of expression through the phase 2 response.

2.2 Results and Discussion

The broad attention garnered by the oleanane triterpenoids is related to their potent anti-inflammatory activities which are mechanistically linked to the inhibition of expression of key inflammatory mediators, namely inducible nitric oxide synthase

(iNOS) and cyclooxygenase-2 (COX-2)12, 13. When we investigated BA in this context, we were surprised that the expression profiles were markedly different (as compared to the oleanane triterpenoids), in that iNOS and COX-2 expression levels were only moderately perturbed (this data is presented in the thesis of Tonibelle Gatbonton-

Schwager14). The most striking phenotype was a robust induction of heme oxygenase 1

(HO-1) levels. As seen in Figure 2.2 (page 66), BA elicits robust HO-1 expression in

RAW 264.7 treated cells in a dose dependent manner after a 24 h treatment. HO-1 expression is induced by 3.3 fold and 14 fold compared to LPS control in the presence of

65 50 µM and 100 µM BA, respectively. In comparison to untreated cells, treatment with 50

µM and 100 µM BA increases HO-1 by 13 fold and 55 fold, respectively.

Figure 2.2 HO-1 Induction by Bryonolic Acid. Western blot analysis and quantification of LPS induced RAW 264.7 cells treated with increasing concentrations of bryonolic acid for 24 h. This data was generated in collaboration. Please refer to acknowledgement section of this chapter.

The implications of this observed phenotype have direct relevance to human disease. Plasmodium is a genus of parasites that cause malaria, resulting in more than 500 million infections and one million deaths per year15. Recent studies have implicated HO-

1 expression as a key therapeutic target in treating malaria. This connection has been rationalized by the enzymatic activity of HO-1 (converting heme to biliverdin)16-18, in conjunction with the clinical manifestations of malaria being linked to the hemolysis of red blood cells, and subsequent deposition of free heme to the vasculature19, 20. In addition to this rationalized connection, in vivo studies comparing wild type and Hmox-/-

(Hmox is the gene encoding HO-1) mice have demonstrated that HO-1 expression

66 protects against the development of the cerebral form of malaria in Plasmodium infected mice16.

To facilitate further studies of the in vitro and in vivo activity of BA, a protocol for robust isolation of BA was needed. To this end we have developed a reliable and scalable method for isolating gram quantities of BA from the roots of Cucurbita pepo L.

(C. pepo L.), which was chosen based on literature precedence in addition to its ready commercial availability. Although BA has been isolated using alternate methods including callus cell culture21, 22. these methods are most appropriate for analytical scale isolation and biosynthetic studies. The key to our approach is a scalable method for obtaining biomass that is rich in BA content. Our initial step in defining our strategy was to determine if BA production was dispersed throughout C. pepo L. or limited to specific plant tissues. HPLC traces demonstrate that BA production is confined to the fine hairy root structure of C. pepo L. (2.3, page 68), which is consistent with previous BA isolation from the root (or radicle) portion of plants and seedlings in Cucurbitaceae1, 7, 22-27.

67

Figure 2.3 HPLC Traces for Extracts from the Fine Hairy Root, Stemroot, and Dicotyledon Leaf Body of 14 Day-old Germinations. Bryonolic acid is detected only in the root portion of Cucurbita pepo L.

To address scalability in biomass accumulation we compared two germination methods, which are standard in the field: moist blotting paper and peat-based growth media. In both cases, seeds and germinations of C. pepo L. were maintained in a medium that retained a moist environment, but did not contribute any level of nutrients to the germinations. For both approaches, roots were isolated every two days and evaluated for

BA content by HPLC. For germinations grown in a peat-based media, root isolation was continued for 40 days. The time-course and HPLC trace overlay show increasing production of BA from day 2 to day 16, peaking at 1.26 mg g-1 dry weight (Figure 2.4A,

C, page 70). BA content subsequently decreased from day 16 to day 40, suggesting that

68 BA presence in the roots is most prevalent during the early germination stage. Decreased

BA content after day 16 may also be suggestive of further localization of BA to the fine hairs and extremities of the root system; these grew increasingly delicate with age and became more difficult to recover during the washing process.

In a parallel experiment, germinations were grown between moist blotting paper for 36 days. Germinations were not continued to day 40 as in the peat-based media method due to overgrowth and initial signs of morbidity by day 26. Under these growth conditions, BA content increased from day 2 to day 24 and plateaued thereafter, leveling at approximately 15 mg g-1 dry weight (Figure 2.4B, page 70). Presumably, BA content changed little after germinations no longer maintained vitality. The increased BA content can be observed by HPLC peak height on select days between day 2 and day 24 (Figure

2.4D, page 70), and reached a maximum of 16.1 mg g-1 dry weight.

69

Figure 2.4 Bryonolic Acid Production in Cucurbita pepo L. Roots under Two Growth Conditions. Time-course production of bryonolic acid in C. pepo germinated in peat-based media (A) and moist blotting paper (B). Bryonolic acid content is observed to increase in peat-based media and moist blotting paper, as observed by growing HPLC peak areas from spectra on select days (C and D). At its maximum, BA content in roots from moist blotting paper is roughly tenfold greater than that detected in roots from peat-based media as is apparent in the respective scales.

Taken together, BA content in roots from moist blotting paper is roughly tenfold that detected in roots from peat-based media. Maximum and total BA production per unit mass in roots from blotting paper germinations far outweighed the total amount produced in the peat-based growth media (Figure 2.5A, page 72). On those days resulting in maximum BA content (day 16 for peat-based, day 24 for blotting paper) the magnitude of

70 BA production in germinations grown in blotting paper is apparent in the HPLC trace overlays for these respective days (Figure 2.5B, page 72). In germinations grown in blotting paper, we do not observe a decrease in BA content following achievement of maximum content. This may be due to the capability of retaining 100% of root material when isolated from the blotting paper as opposed to the unavoidable root loss experienced when isolating root material from the peat-based germination media as discussed above.

To translate the above analytical scale observations to a large-scale isolation of

BA we began scaling our blotting paper germinations of C. pepo L. Based on the data above, roots were collected from germinations grown between moist blotting paper for 18 days. At this time, germinations remained healthy and we anticipated that BA content was approaching its maximum (Figure 2.4, page 70). Lyophilized and powdered roots were combined in a Soxhlet extractor, and subjected to a three day extraction using a solvent mixture of CHCl3 and MeOH to afford a BA rich extract. Subsequent column purification and recrystallization resulted in the isolation of 200 mg BA from 14.9 g dry roots (1.34%). The process proved to be further scalable, as the same procedure resulted in isolation of 949 mg BA from 80.5 g roots (1.18%). Our results indicate that the method is scalable and multiple gram quantities BA can be isolated proportionally from increased root masses.

71

Figure 2.5 Comparing Maximum Bryonolic Acid Production under Two Growth Conditions. Comparison of maximum and total BA production in roots from peat-based media versus roots from moist blotting paper (A). Comparison of HPLC peak area for maximum BA production under both conditions (B).

Taken together, this is the first report to show that BA bioactivity is potentially due to induction of expression via the phase 2 response, as illustrated by the robust induction of HO-1 expression. This phenotype is of clear translational significance, and given the clear importance of malaria, it is axiomatic that future studies of malaria will necessarily include BA. Because plants from the Cucurbitaceae family are grown

72 throughout the world and could serve as an abundant source of the natural product in developing countries where malaria is widespread, BA is likely to become the target of many future biological studies. With the purification strategy reported here, the therapeutic value of this compound can now be carefully explored.

2.3 Experimental methods

General Experimental Procedures. Melting points were measured on an

Electrothermal melting point apparatus (Barnstead/Thermolyne) and are uncorrected.

Optical rotation was determined using a Perkin-Elmer 241 polarimeter. NMR spectra were recorded on a Varian AS400 spectrometer operating at 400/100 MHz (1H/13C).

1 Chemical shifts are reported in ppm using residual pyridine-d5 (δ 8.74 for H and 150.4 for 13C) as internal reference. HPLC separation was performed on an Agilent 1200 HPLC system and ZORBAX Eclipse XDB-C18 column (5 µm particle size, 80 Å pore size, 4.6 mm ID x 250 mm) fitted with a guard column. HPLC operation and data analysis was performed using Agilent ChemStation for LC 3D systems software, Rev. B.04.01.

Reagents and Chemicals. Cucurbita pepo L. seeds (Spineless Beauty hybrid) were purchased from Siegers Seed Co (Holland, MI). The peat-based medium, a mixture of peat, vermiculite, and perlite (Pro-Mix BX, Premier Horticulture), was purchased from a local distributor. All solvents were purchased from Fisher Scientific (Pittsburgh, PA).

Pyridine-d5 was purchased from Cambridge Isotope Laboratories (Andover, MA). The leukemic mouse macrophage cells (RAW 264.7) were obtained as a gift from Dr.

Michael Sporn from Dartmouth College. The DMEM medium and PBS were obtained from ATCC (Manassas, VA), and were supplemented with heat inactivated fetal bovine

73 serum (FBS) with low endotoxin (≤0.06 EU/mL) from Thermo Fisher Scientific

(Waltham, MA). The penicillin- streptomycin, RIPA buffer, Novex 4-20% Tris-Glycine gel, and 0.2 µm PVDF membrane were from Invitrogen (Carlsbad, CA). The cells were induced with LPS from Escherichia coli purchased from Sigma Aldrich (St. Louis, MO) and dissolved in PBS (ATCC). The Complete Protease Inhibitor cocktail tablet was purchased from Roche (Indianapolis, IN). The heme oxygenase 1 (HO-1) primary rabbit polyclonal antibody was from Santa Cruz Biotechnology (Santa Cruz, CA) while the secondary donkey anti-rabbit IgG (H+L)-HRP was from Southern Biotech (Birmingham,

AL). The ECL Plus™ Western Blot Detection Reagent was purchased from GE

Biosciences (Piscataway, NJ).

Germination. Twenty planters (14 × 7 × 4 in3) were filled to 3.5 inches with moistened growing medium. Ninety-six seeds were planted under 1.5 inches moistened growing medium. Planters were watered from the bottom for 15 min. Planters were covered until seedlings began to break through the media (Day 4). Following sprouting, planters were watered from the bottom for 20 min daily until plants were strong enough to be watered from the top (Day 8). Plants were subsequently watered with 500 mL water every other day for the 40 day growth duration.

Forty seeds were folded between a stack of moist blotting paper. Stacks were paired in a 9 × 12 in2 zip-seal bag, partially unsealed to allow for airflow. Twenty bags were placed in a dark incubator at 25.0 ºC for 3 days. Upon germination, the bags were transported to a university greenhouse where the temperature ranged from 20-29 ºC over the course of the 40 d growth duration. The bags were rotated each day and kept moist as needed to maintain 100% humidity.

74 Germination Harvest Procedure. Roots from germinations grown in peat-based media were clipped from the stems and cleared of residual peat-mixture in a water bath.

Roots were blotted dry and frozen at -80 ºC. Roots from germinations grown in moist blotting paper were clipped from stems and frozen at -80 ºC. Stems and leaves from 14 day-old germinations were also separated for verification of anatomical localization of

BA.

Calibration for Bryonolic Acid Content. Eight standard BA solutions were made to give concentrations ranging from 25-400 µg/ml. Forty µl of each solution was injected into the HPLC in triplicate. A linear gradient elution was applied at a flow rate of

1.0 ml/min for 20 minutes from 85% to 100% MeCN in H2O. Both solvents contained

0.02% TFA (v/v). Elution was monitored at 205 nm. The calibration curve for BA content was constructed by plotting the average peak area as a function of the analyte concentration.

Analytical Extraction and HPLC Procedure. Roots, stems, and leaves were dried by lyophilization and ground to a fine powder. The powder (200 mg) was extracted in 10 ml MeOH at reflux for 3 h. The filtered extract was brought to a volume of 10 ml with fresh MeOH and analyzed by HPLC, using 40 µl injections repeated in triplicate.

For root extracts and evaluation of BA content, a linear gradient elution was applied at a flow rate of 1.0 mL/min for 20 min from 85% to 100% MeCN in H2O. For root, stem, and leaf extracts and evaluation of anatomical localization of BA, a linear gradient was applied at a flow rate of 1.0 ml/min for 60 min from 85% to 100% MeCN in H2O. Both solvents contained 0.02% TFA (v/v). The system was run at ambient temperature. Elution

75 was monitored at 205 nm. BA was quantified by referencing peak area to the linear calibration generated with standard BA solutions.

Preparative Extraction and Purification Approach. Powdered roots of C. pepo

L. germinations (14.9 g lyophilized) were extracted for 3 d by Soxhlet using 700 mL 2:1

CHCl3-MeOH heated to reflux with stirring. The extract was immobilized on silica gel

(1:1) and evaporated to dryness. The crude extract was subjected to a short (2.5 in) silica gel column (I.D. 1.5 in) and the column was eluted with 80:20:1 hexanes-EtOAc-HOAc followed by 50:50:1 hexanes-EtOAc-HOAc followed by 85:15:1 EtOAc-hexanes-HOAc to yield fractions containing BA and two impurities as observed by TLC. BA-containing fractions were combined and repeated recrystallization in 40:1 CHCl3-THF resulted in the isolation of 200 mg BA (1.34%). BA purification from 80.5 g root extraction was executed similarly, only requiring 5 days for extraction and a larger chromatography column (I.D. 2.5 in).

4, 26, 28, 29 Bryonolic Acid : white powder (CHCl3-THF); mp 274-278 °C

25 1 (discoloration prior to melting began at 246-248 °C); [α D] +18 (c 15, pyridine); H

NMR (pyridine-d5, 400 MHz) δ 1.02 (3H, s), 1.06 (3H, s), 1.08 (3H, s), 1.11 (3H, s), 1.23

(3H, s), 1.30 (3H, s), 1.44 (3H, s), 2.50 (1H, m), 2.60 (1H, d, J = 13.6) 2.78 (1H, d

13 J=15.6), 3.39 (1H, t, J = 8.0); C NMR (pyridine-d5, 100 MHz) δ 17.1 (CH3), 18.5

(CH3), 20.1(CH2), 20.7(CH3), 21.6 (CH2), 22.9(CH3), 26.0 (CH2), 28.5 (CH2), 29.1

(CH3), 29.2 (CH2), 31.0 (CH2), 31.2 (CH2), 31.7 (CH2), 31.8 (C), 32.0 (CH3), 33.9 (CH3),

35.6 (CH2), 36.0 (CH2), 38.0 (CH2), 38.2 (C), 38.3 (C), 39.9 (C), 41.1 (C), 42.7 (C), 45.7

(CH), 51.4 (CH), 78.5 (CH), 134.7 (C), 135.1 (C), 181.8 (C). NMR spectra are shown in

Figures 2.6 (page 79), 2.7 (page 80) and 2.8 (page 81) following acknowledgement and

76 are consistent with published spectroscopic data for BA. Treatment of the isolated compound with diazomethane yields the expected methyl ester by comparison with reported 13C NMR data.30

Biological Data of Bryonolic Acid in RAW 264.7 Cells. RAW 264.7 cells were grown in DMEM medium with 10% FBS and 100 U/ml penicillin-100 µg/ml streptomycin. Cells were cultured in a 37 °C incubator with 5% CO2. The cells were plated at 2x106 cells/well in 6-well plates and allowed to attach for 2 hours. Cells were then induced with 5 ng/mL LPS from E. coli and treated with BA dissolved in DMSO at increasing concentrations (5, 10, 50, 100 µM) for 24 hours with a final concentration of

0.25% DMSO in the cells. Cells were lysed using RIPA lysing buffer with a Complete

Protease Inhibitor tablet per 10 mL lysing buffer. The lysates were loaded on a Novex 4-

20% Tris-Glycine gel, transferred into 0.2 µm PVDF membrane and blocked with 5% milk for 1 h at room temperature. The membrane was probed for HO-1 (1:1000 dilution) for 1 h at room temperature and with a secondary donkey anti-rabbit antibody (1:5000 dilution) under the same conditions as the primary antibody. For detection of the bands, the blot was incubated with ECL Plus™ Western Blot Detection Reagent for 5 min at room temperature and quantified using GE Healthcare Typhoon 9400 Imager with the

Image Quant software for band intensity calculation.

2.4 Acknowledgements

This work would not have been possible without the efforts of Tonibelle N.

Gatbonton-Schwager. The re-produced manuscript was published in the Journal of

Natural Products31 with shared first authorship between Dr. Gatbonton-Schwager and myself. Other contributing authors include my mentors Dr. Gregory P. Tochtrop and Dr.

77 John J. Letterio as well as Dr. Yong Han and Jennifer E. Clay Much of the figures and text were formerly published in the thesis of TNGS14 and are reproduced here with her permission. To make specific acknowledgement; with the help of Dr. Yong Han, TNGS performed the very initial isolations of bryonolic acid from roots of sprouting zucchini germinations accompanied by confirmation of structure. The experiments for generating the biological data presented in this chapter (Figure 2.2, page 64) were also performed by her sole effort.

78 2.5 Bryonolic acid NMR spectra 1.00 1.25 1.50 1.75 2.00 2.25 2.50 2.75 ) of bryonolic acid. 5 d 3.00 3.25 H NMR (400 MHz, pyridine- 1 3.50 S1:

1 Figure 2.6 H NMR (400 MHz, pyridine-d5) of bryonolic acid.

79 15.0 20.0 25.0 30.0 35.0 40.0 ) of bryonolic acid, 15-55 ppm. 5 d 45.0 50.0 C NMR (100 MHz, pyridine- 13 S3:

13 Figure 2.7 C NMR (100 MHz, pyridine-d5) of bryonolic acid, 15-55 ppm.

80 80 90 100 110 120 130 pyridine 140 150 ) of bryonolic acid, 80-180 ppm. 5 d 160 170 180 C NMR (100 MHz, pyridine- 13 S2:

13 Figure 2.8 C NMR (100 MHz, pyridine-d5) of bryonolic acid, 80-180 ppm.

81 2.6 References

1. Biglino, G. Constituents of the root of Bryonia dioica. Ann. Chim. 49, 782-792

(1959).

2. Sim, K.Y. & Lee, H.T. Triterpenoid and other constituents from Sandoricum

indicum. Phytochemistry 11, 3341-3343 (1972).

3. Dayal, R. & Dobhal, P.C. Tetrameles nudiflora-a new potential source of

bryonolic acid. J. Med. Aromat. Plant Sci. 23, 660-661 (2001).

4. Khallouki, F., Hull, W.E. & Owen, R.W. Characterization of a rare triterpenoid

and minor phenolic compounds in the root bark of Anisophyllea dichostyla R. Br.

Food Chem. Toxicol. 47, 2007-2012 (2009).

5. Biglino, G., Cattel, L. & Caputo, O. Structure of bryonolic acid. Ricerca

Scientifica 39, 207-209 (1969).

6. Tanaka, S. et al. Anti-allergic effect of bryonolic acid from Luffa cylindrica cell

suspension cultures. Planta Med. 57, 527-530 (1991).

7. Takeda, T., Kondo, T., Mizukami, H. & Ogihara, Y. Bryonolic acid production in

hairy roots of Trichosanthes kirilowii Max. var. japonica Kitam. transformed with

Agrobacterium rhizogenes and its cytotoxic activity. Chem. Pharm. Bull. 42, 730-

732 (1994).

8. Kondo, T., Inoue, M., Mizukami, H. & Ogihara, Y. Cytotoxic activity of

bryonolic acid isolated from transformed hairy roots of Trichosanthes kirilowii

var. japonica. Biological & pharmaceutical bulletin 18, 726-729 (1995).

82 9. Akihisa, T. et al. Anti-tumor promoting effects of multiflorane-type triterpenoids

and cytotoxic activity of karounidiol against human cancer cell lines. Cancer Lett.

(Shannon, Irel.) 173, 9-14 (2001).

10. Dinkova-Kostova, A.T. et al. Extremely potent triterpenoid inducers of the phase

2 response: correlations of protection against oxidant and inflammatory stress.

Proceedings of the National Academy of Sciences of the United States of America

102, 4584-4589 (2005).

11. Liby, K. et al. The synthetic triterpenoids, CDDO and CDDO-imidazolide, are

potent inducers of heme oxygenase-1 and Nrf2/ARE signaling. Cancer research

65, 4789-4798 (2005).

12. Suh, N. et al. A novel synthetic oleanane triterpenoid, 2-cyano-3,12-dioxoolean-

1,9-dien-28-oic acid, with potent differentiating, antiproliferative, and anti-

inflammatory activity. Cancer research 59, 336-341 (1999).

13. Suh, N. et al. Novel triterpenoids suppress inducible nitric oxide synthase (iNOS)

and inducible cyclooxygenase (COX-2) in mouse macrophages. Cancer research

58, 717-723 (1998).

14. Gatbonton-Schwager, T.N. in Department of Pharmacology, Dissertation, Doctor

of Philosophy (Case Western Reserve University, 2014).

15. Greenwood, B.M. et al. Malaria: progress, perils, and prospects for eradication. J

Clin Invest 118, 1266-1276 (2008).

16. Seixas, E. et al. Heme oxygenase-1 affords protection against noncerebral forms

of severe malaria. Proceedings of the National Academy of Sciences of the United

States of America 106, 15837-15842 (2009).

83 17. Pamplona, A. et al. Heme oxygenase-1 and carbon monoxide suppress the

pathogenesis of experimental cerebral malaria. Nature medicine 13, 703-710

(2007).

18. Cuadrado, A. & Rojo, A.I. Heme oxygenase-1 as a therapeutic target in

neurodegenerative diseases and brain infections. Curr Pharm Des 14, 429-442

(2008).

19. Ferreira, A., Balla, J., Jeney, V., Balla, G. & Soares, M.P. A central role for free

heme in the pathogenesis of severe malaria: the missing link? J Mol Med 86,

1097-1111 (2008).

20. Droge, W. Free radicals in the physiological control of cell function.

Physiological reviews 82, 47-95 (2002).

21. Kamisako, W., Morimoto, K., Makino, I. & Isoi, K. Changes in triterpenoid

content during the growth cycle of cultured plant cells. Plant Cell Physiol. 25,

1571-1574 (1984).

22. Tabata, M. et al. Production of an anti-allergic triterpene, bryonolic acid, by plant

cell cultures. Journal of natural products 56, 165-174 (1993).

23. Saltykova, I.A., Matyukhina, L.G. & Shavva, A.G. Bryonolic acid of the roots of

Bryonia alba. Khim. Prir. Soedin. 4, 324 (1968).

24. Cho, H.J., Tanaka, S., Fukui, H. & Tabata, M. Formation of bryonolic acid in

cucurbitaceous plants and their cell cultures. Phytochemistry 31, 3893-3896

(1992).

25. Isaev, M.I. Isoprenoids of Bryonia. I. Pentacyclic triterpenes and sterol of Bryonia

melanocarpa. Chemistry of Natural Compounds 31, 336-341 (1995).

84 26. Akiyama, K. & Hayashi, H. Arbuscular mycorrhizal fungus-promoted

accumulation of two new triterpenoids in cucumber roots. Biosci., Biotechnol.,

Biochem. 66, 762-769 (2002).

27. Kongtun, S. et al. Cytotoxic properties of root extract and fruit juice of

Trichosanthes cucumerina. Planta medica 75, 839-842 (2009).

28. Honda, C., Suwa, K., Takeyama, S. & Kamisako, W. Relative population of S-

form and F-form conformers of bryonolic acid and its derivatives in equilibrium

in CDCl3 solutions. Chemical & Pharmaceutical Bulletin 50, 467-474 (2002).

29. Kamisako, W. et al. Conformations of bryonolic acid and its derivatives in

deuterochloroform solution by proton and carbon-13 NMR spectroscopy. Magn.

Reson. Chem. 25, 848-855 (1987).

30. Kamisako, W., Suwa, K., Morimoto, K. & Isoi, K. Application of biosynthetic

carbon-13 enrichment using [1-13C]-, [2-13C]- and [1,2-13C2]-acetate as

precursor for carbon-13 NMR spectral assignment of higher plant metabolites.

The assignments of some bryonolic acid derivatives. Org. Magn. Reson. 22, 93-

100 (1984).

31. Barker, E.C.*, Gatbonton-Schwager, T.N.* Han, Y., Clay, J.E., Letterio, J.J. &

Tochtrop, G.P. Bryonolic acid: a large-scale isolation and evaluation of heme

oxygenase 1 expression in activated macrophages. Journal of Natural Products

73, 1064-1068 (2010). (*Authors contributed equally to this work)

85 Chapter 3: Selection and Screening of Anti-inflammatory Herbal Extracts

3.1 Introduction

Herbal medicine has a strong global presence in the treatment of many health maladies. In complimentary and alternative medicine, the most commonly used discipline is traditional Chinese medicine (TCM). The focus of this practice is to address the harmony with which the body’s organ systems are working and how blood and energy are circulating between them. Contrary to Western medicine, TCM practitioners make diagnoses of a whole individual rather than a specific symptom, identifying a ‘syndrome’ and prescribing the herbal remedy and other traditional therapies to restore total harmony1, 2. The successes and limitations of such a holistic approach in medicine have been explored. A great limitation and common criticism of TCM is the impossibility of standardization that would ensure consistent product composition in the treatments administered3, 4. An approach to deriving some benefit from traditional medicine while maintaining a standard in administration is to identify active constituents of these remedies and work toward preclinical and clinical testing of purified compounds derived from effective herbal extracts5.

The traditional approach to identifying and isolating the active constituent in an extract of plant material is by bioassay-guided fractionation to separate constituents of an extract and analyze the active fraction(s) for its most potent metabolites. Once a pure compound is isolated and determined effective, classic methods for structural elucidation are used to identify the structure of the active constituent. A model example of this method that has already been discussed in this thesis was in the identification of

86 sulforaphane as the active constituent of broccoli sprouts6. Other examples of drugs that have made it to the market by the reductive analysis of active herbal remedies include cardiac glycoside digoxin4 from Digitalis (foxglove), originally used to treat edema, and anti-malarial ‘miracle drug’ artemisinin7 from Artemisia annua (sweet wormwood or qinghao), used for centuries in TCM for treatment of fever.

A panel of medicinal herbs was selected and screened for anti-inflammatory activity. Owing to the literature precedence for biological activities of the triterpenoids, we were interested in identifying whether active extracts might be sources for potent anti- inflammatory triterpenoids. In choosing which plants to evaluate, we relied heavily on studied species and various activities for secondary metabolites reported in the literature.

Three major principles were considered in selecting herbs to evaluate with an overriding theme that the materials were readily available at the time of procurement. 1) Known triterpenoid content displaying some biological activity: Glycine max8, 9, Panax ginseng10, 2) Domestic plants used to treat inflammation: Aloe vera11, and Ginkgo biloba.12 3) Chinese herbs used to treat inflammation: Tripterygium wilfordii Hook

F13, 14, Radix gentianae macrophyllae15, Rhizoma coptidis15, Citri Unshiu Pericarpium15,

Artemisia annua16, Bupleurum chinense17, Arnebia euchroma18, and Andrographis paniculata19.

3.2 Results and Discussion

Dried herbs were subjected to soxhlet extraction at boiling temperature in methanol and dried extract was resuspended in dimethyl sulfoxide (DMSO) for cellular treatment. Our assay system for evaluating anti-inflammatory activity uses the mouse

87 leukemic monocyte macrophage cell line, RAW 264.7 cells. These cells can be induced by cytokine or endotoxin to mount an inflammatory response20, 21. For this screen, cells were induced with endotoxin lipopolysaccharide (LPS) and inflammatory activity was evaluated by indirect measurement of nitric oxide production using the Griess assay.

Nitric oxide is a cytokine produced in abundance during an inflammatory response by the inducible form of nitric oxide synthase (iNOS) and is a standard marker for evaluating inflammatory response in this cell line21. Figure 3.1 is a schematic of the experimental design.

Figure 3.1. Schematic for Herbal Extract Screen.

Twelve total extracts were screened in a series of experiments, as each extract or set of extracts was prepared. The first extractions performed were on G. max (soybean) rootlets and A. vera leaf. Figure 3.2 (page 89) shows their respective activities in this anti-inflammatory screening assay. G. max root extract showed modest activity and A. vera appeared inactive in this assay. In all experiments, the “control” bar represents nitrite detection in cells treated with LPS and an equal concentration of DMSO (0.25%) as extract-treated cells.

88

Figure 3.2. Griess assay results for RAW264.7 cells activated with 5 ng/ml LPS and treated with increasing concentrations of G. max root extract and A. vera leaf extract. Control sample is cells treated with 5 ng/ml LPS and 0.25% DMSO. DMSO concentration is 0.25% in all samples.

G. Max or soybean have known medicinal effects and have been reported to be protective in cancer, heart disease and osteoporosis. Biological activity of G. max has been attributed to saponins and isoflavones and recently, triterpenoids isolated from the roots of G. max were shown to have potent cytotoxic and antibacterial activities9.

In another experiment, G. max was re-screened among four herbs used as anti- inflammatories in TCM (Figure 3.3, page 90). In this experiment, cellular activation in response to LPS was less robust and the assay more sensitive to treatment. Thus, the most potent herb, T. wilfordii showed particularly marked inhibition even at very low concentration. The increased production of nitric oxide at highest concentration is possibly related to toxicity at increased doses, which trend has been observed with treatment of pure compounds at toxic doses. A more dramatic response to G. max was observed at this level of stringency and B. Chinense and R. gentianae showed a

89 significant dose response. The result for R. coptidus was disregarded as the extract had a strong yellow color, which is expected to have interfered with the absorbance readings for the Griess colorimetric assay.

Figure 3.3. Griess assay results for RAW264.7 cells activated with 5 ng/ml LPS and treated with increasing concentrations of T. wilfordii root extract, R. coptidis, R. gentianae, and B. chinense dried plant extract and G. max dry root extract. Control sample is cells treated with 5 ng/ml LPS and 0.25% DMSO. DMSO concentration is 0.25% in all samples.

T. Wilfordii, or lei gong teng or Thunder God Vine is a woody vine indigenous to

China, Korea, Japan and Taiwan, but is similar to Celastrus scandens or the North

American bittersweet. Its plant is poisonous, but the root extract has been used in TCM for the treatment of rheumatoid arthritis, spondylitis and systemic lupus erythematosus and has many active constituents. Its most-studied active constituents include a diterpenoid epoxide triptolide and the quinone methide triterpenoid celastrol (Figure

90 3.4)22-24. Celastrol was a particularly interesting triterpenoid for the presence of a Michael acceptor and likely inducer of antioxidant Nrf2 signaling. An extensive characterization of this molecule as an anti-inflammatory and chemopreventive in vivo is included in

Chapter 4 of this work.

Figure 3.4. Known active constituents of Tripterygium wilfordii.

B. Chinense, known as Chai-Hu, is one of the most frequently prescribed crude herbs for treatment of inflammatory disease in TCM and multiple polysaccharides have been identified as active constituents of this herb17. R. gentianae extract has been used in

TCM to treat inflammatory disorders such as osteoarthritis and rheumatoid arthritis and an alkaloid, gentianine, is a known active constituent with reported anti-ulcerogenic and anti-inflammatory activities25.

T. Wilfordii, R. gentianae, and B. Chinense were re-screened with two additional

TCM herbs, C. unshiu and A. euchroma (Figure 3.5, page 92). Similar trends, but not flat-lined inhibition of nitric oxide production were observed for T. wilfordii and B.

Chinense. This is predicted to be due to the increased activation response of the cells to

LPS. In spite of this, T. Wilfordii still showed most potent inhibition of nitric oxide. It could also be for the increased activation that a less potent herb such as R. gentianae

91 shows little activity in this repeat screen. With inhibition levels similar to B. Chinense, C. unshiu may merit future examination. C. unshiu has been used in TCM to treat bronchial and asthmatic conditions as well as for blood circulation26. Flavonoids hesperidin and nobiletin are two of its active constituents which both have known anti-inflammatory activity15. The induced nitric oxide production at high doses of A.euchroma in this experiment was unexplained. It could be an artifact of toxicity and possible testing of lower doses would produce a more discernible dose response. This herb is used mainly as an anti-HIV, but has been described as an anti-inflammatory18.

Figure 3.5. Griess assay results for RAW264.7 cells activated with 5 ng/ml LPS and treated with increasing concentrations of T. wilfordii root extract, R. gentianae, and B. chinense dried plant extract, C. unshiu dry peel extract and A. euchroma dry plant extract. Control sample is cells treated with 5 ng/ml LPS and 0.25% DMSO. DMSO concentration is 0.25% in all samples.

A. annua plant and G. biloba nut fruit were tested and showed moderate dose responses (Figure 3.6, page 94). G. biloba has a breadth of applications in herbal medicine and perhaps its mild anti-inflammatory activity contributes to its overall

92 efficacy in various ailments. A. annua, also known as qinghao or sweet wormwood has mainly been used for maintenance of fever and was the source of anti-malarial artemisinin7. The extraction for A. annua was allowed to proceed two additional days and was re-tested in a separate experiment. The dose response for the second A. annua extract was more pronounced. It should be noted that the cells in this experiment also responded less-robustly to LPS (Figure 3.7, page 94). In the same figure, a moderate dose response was also observed for A. paniculata, an herb used for inflammatory and infectious disease in TCM27, 28. A particularly potent dose response was observed for an extract of

P. Ginseng. P. Ginseng is an herb celebrated in Asian cultures for its beneficial effects on stamina, vitality and longevity and it is the most widely taken herbal product in the world. It is also touted for a plethora of other biological activities29. Its constituents have been researched extensively and activities observed are attributed in large part to steryl glycosides and steroidal saponins, also called ginsenosides30, 31. Indeed, P. Ginseng is a viable candidate for future fractionation and isolation of possible anti-inflammatory and chemopreventive triterpenoid-like compounds.

93

Figure 3.6. Griess assay results for RAW264.7 cells activated with 5 ng/ml LPS and treated with increasing concentrations of A. annua plant extract, G. biloba nut fruit extract and G. max dry root extract. Control sample is cells treated with 5 ng/ml LPS and 0.25% DMSO. DMSO concentration is 0.25% in all samples.

Figure 3.7. Griess assay results for RAW264.7 cells activated with 5 ng/ml LPS and treated with increasing concentrations of P. ginseng root extract, Andrographitis supplement extract (A. paniculata) and A. annua plant extract. A. annua shown here was extracted for 2 additional days in comparison to that shown in Figure 3.6. Control sample is cells treated with 5 ng/ml LPS and 0.25% DMSO. DMSO concentration is 0.25% in all samples.

94

3.3 Conclusions

This anti-inflammatory screen identified multiple herbal extracts with moderate to potent activity in the inhibition of nitric oxide production in activated macrophages. The breadth of dose responses observed is summarized in Figure 3.8 (page 96), which presents data from multiple experiments as percentage inhibition compared to RAW

264.7 cells induced with LPS and treated with DMSO vehicle. The potent inhibition by T. wilfordii was of immediate interest because of the known electrophilic quinone methide triterpenoid celastrol as a constituent of this extract. Commercial availability of this natural product enabled the extensive in vitro and in vivo characterization of this molecule presented in Chapter 4 of this thesis. Other active extracts, such as P. Ginseng and B. chinense, could serve as future leads in the Tochtrop lab for bioassay-guided fractionation and identification of active triterpenoid constituents and biological characterization as anti-inflammatory and chemopreventive compounds.

95

Figure 3.8. Extract Summary as Percent of Control. Griess assay results for RAW264.7 cells activated with 5 ng/ml LPS and treated with increasing concentrations select herbs from this chapter. Presented as percent nitrite production compared to cells treated with 5 ng/ml LPS and 0.25% DMSO. DMSO concentration is 0.25% in all samples. Extract concentrations are as follows: T. wilfordii: 69, 139, 278 μg/ml, B. chinense: 71, 141, 283 μg/ml, P. ginseng: 62.5, 125, 250 μg/ml, A. annua: 62.5, 125, 250 μg/ml, G. max: 2.2, 22, 220 μg/ml, A. paniculata: 62.5, 125, 250 μg/ml, A. vera: 66, 132, 264 μg/ml.

3.4 Experimental methods

Purchases and procurement of herbs. G. max roots were procured manually on an Ohio State University farm, compliments of Professor Anne Dorrance, Ph.D. from the department of Plant Pathology at OSU. A. vera was purchased locally (history on the

Aloe vera plant). T. wilfrodii, R gentianae, R. coptidis, C. unshiu, A. annua, B. chinense,

G. biloba and A. euchroma were purchased from a local herbalist (St. Clair Ave.,

Cleveland, OH). A. paniculata was purchased as an herbal supplement made from the concentrated extract of Herba Andrographitis and called Chuan Xin Lian (Yang Cheng

Brand, Guangdong, China).

96 Soxhlet extraction and resuspension and dilution for treatment. Dried plant material was crumbled manually and where possible ground using mortar and pestle.

Extraction was performed with a mini Soxhlet extractor using methanol as solvent for multiple days. Most extractions proceeded for 4 days except A. annua proceeded for 5 days and 7 days and G. max proceeded for 20 days. At the end of the extraction period, 5-

7 ml were removed from extraction, solvent was evaporated and extract weighed. Dried extraction was resuspended in 1 ml DMSO or at a volume that would render a concentration of roughly 100 mg/ml. Exact resuspension concentrations are given in

Table 3.1 (page 98). 5 μl of this suspension was diluted into 995 μl culture media and 1:1 or 1:10 serial dilutions were generated for cell treatment. 100 μl diluted extract was used to treat 1 x 105 RAW 264.7 cells in 96-well plate format in 200 μl total volume. Exact doses are indicated in figures, and ranges for treatment are fairly similar from species to species.

97

Concentration in Extract DMSO, mg/ml

G. max 44.0 A. vera 52.7 T. wilfordii 111 R. coptidis 103 R. gentianae 141 B. chinense 113 A. eurhoma 84.3 C. unshiu 107 G. biloba 136 A. annua 1 62.2 A. annua 2 100 P. ginseng 100 A. paniculata 100

Table 3.1. Concentrations of extracts resuspended in DMSO prior to cell treatment.

Tissue culture. RAW 264.7 cells were provided by the Michael Sporn group at

Dartmouth. RAW 264.7 cells were cultured in DMEM (Invitrogen) supplemented with

10% low endotoxin and heat inactivated fetal bovine serum (Thermoscientific). For experiments, cells were plated at 1x105 per well in 96-well format. To activate inflammatory response, cells were treated with 5 ng/ml lipopolysaccharide (Sigma).

Following LPS addition, cells were treated with increasing concentration of extract or

DMSO alone. All treatments were performed in triplicate. After 16 hours treatment, 100

μl media was used for nitric oxide detection by Griess assay.

98 Nitric oxide detection by the Griess assay. Nitrite detection kit was purchased from Invitrogen. Standard curve for nitrite detection was established on a per experiment basis using the provided sodium nitrite and diluting standards from 1.5 to 100 μM in media. 100 μl sample or standard was subjected to 100 μl 1:1 mixture of griess assay substrate (0.1% sulfanilamide in 5% phosphoric acid + 1% 1-naphthylethylenediamene).

Absorbance was read at 570 nm and standard curve generated. Nitrite concentration in treated samples was determined from the standard curve and triplicate treatments were averaged to give concentrations shown with error bars representing standard error of the mean. For nitrite concentration in extract-treated samples compared on a per-experiment basis as a percent of control (Figure 3.8, page 96) with control sample (LPS-treated cells treated with DMSO only) being 100%, triplicate treatments were averaged from selected individual experiments to give data shown with error bars representing standard error of the mean.

3.5 Acknowledgements

We acknowledge Professor Anne Dorrance, Ph.D. in Plant Pathology at Ohio

State University for donating G. max roots for our evaluation. Brian Werry, Ph.D. helped with this procurement. Also, we acknowledge Professor Michael Sporn, Ph.D. at

Dartmouth University for sharing his RAW 264.7 cell line. Qingjiang Li, Ph.D. aided in translation for purchasing of the herbs from the local herbalist. Elements for Figure 3.1

(page 88) were originally produced by Katherine Ignatenko and Greg Tochtrop, Ph.D. and were used with permission.

99 3.6 References

1. Tsang, I.K. Establishing the efficacy of traditional Chinese medicine. Nature

clinical practice. Rheumatology 3, 60-61 (2007).

2. Cheung, F. Tcm Made in China. Nature 480, S82-S83 (2011).

3. Cordell, G.A. & Colvard, M.D. Natural products and traditional medicine: turning

on a paradigm. Journal of natural products 75, 514-525 (2012).

4. Goldman, P. Herbal medicines today and the roots of modern pharmacology.

Annals of internal medicine 135, 594-600 (2001).

5. Corson, T.W. & Crews, C.M. Molecular understanding and modern application of

traditional medicines: triumphs and trials. Cell 130, 769-774 (2007).

6. Zhang, Y., Talalay, P., Cho, C.G. & Posner, G.H. A major inducer of

anticarcinogenic protective enzymes from broccoli: isolation and elucidation of

structure. Proceedings of the National Academy of Sciences of the United States

of America 89, 2399-2403 (1992).

7. Hsu, E. Reflections on the 'discovery' of the antimalarial qinghao. British journal

of clinical pharmacology 61, 666-670 (2006).

8. Lee, J.H. et al. Human acyl-CoA:cholesterol acyltransferase (hACAT) inhibitory

activities of triterpenoids from roots of Glycine max (L.) merr. Bull. Korean

Chem. Soc. 29, 615-619 (2008).

9. Lee, J.H., Seo, K.I., Kang, N.S., Yang, M.S. & Park, K.H. Triterpenoids from

roots of Glycine max (L.) Merr. Agric. Chem. Biotechnol. (Engl. Ed.) 49, 51-56

(2006).

100 10. Wei, Y., Ma, C.-M. & Hattori, M. Anti-HIV protease triterpenoids from the acid

hydrolysate of Panax ginseng. Phytochem. Lett. 2, 63-66 (2009).

11. Lone, M.A., Malviya, D., Mishra, P., Dubey, A. & Saxena, R.C.

Antiinflammatory and antimicrobial activity of anthraquinone isolated from Aloe

vera (Liliaceae). Asian J. Chem. 21, 1807-1811 (2009).

12. Kotakadi, V.S. et al. Ginkgo biloba extract EGb 761 has anti-inflammatory

properties and ameliorates colitis in mice by driving effector T cell apoptosis.

Carcinogenesis 29, 1799-1806 (2008).

13. Goldbach-Mansky, R. et al. Comparison of Tripterygium wilfordii Hook F versus

sulfasalazine in the treatment of rheumatoid arthritis: a randomized trial. Ann

Intern Med 151, 229-240, W249-251 (2009).

14. Petronelli, A., Pannitteri, G. & Testa, U. Triterpenoids as new promising

anticancer drugs. Anticancer Drugs 20, 880-892 (2009).

15. Kim, K.S. et al. Anti-inflammatory effects of Radix Gentianae Macrophyllae

(Qinjiao), Rhizoma Coptidis (Huanglian) and Citri Unshiu Pericarpium (Wenzhou

migan) in animal models. Chinese medicine 3, 10 (2008).

16. Krebs, S., Omer, T.N. & Omer, B. Wormwood (Artemisia absinthium) suppresses

tumour necrosis factor alpha and accelerates healing in patients with Crohn's

disease - A controlled clinical trial. Phytomedicine : international journal of

phytotherapy and phytopharmacology 17, 305-309 (2010).

17. Wang, Z. et al. Beneficial effect of Bupleurum polysaccharides on autoimmune

disease induced by Campylobacter jejuni in BALB/c mice. Journal of

ethnopharmacology 124, 481-487 (2009).

101 18. Chen, X. et al. Shikonin, a component of chinese herbal medicine, inhibits

chemokine receptor function and suppresses human immunodeficiency virus type

1. Antimicrobial agents and chemotherapy 47, 2810-2816 (2003).

19. Li, J., Luo, L., Wang, X., Liao, B. & Li, G. Inhibition of NF-kappaB expression

and allergen-induced airway inflammation in a mouse allergic asthma model by

andrographolide. Cellular & molecular immunology 6, 381-385 (2009).

20. Raschke, W.C., Baird, S., Ralph, P. & Nakoinz, I. Functional macrophage cell

lines transformed by Abelson leukemia virus. Cell 15, 261-267 (1978).

21. Denlinger, L.C. et al. Regulation of inducible nitric oxide synthase expression by

macrophage purinoreceptors and calcium. J Biol Chem 271, 337-342 (1996).

22. Schechter, M.S. & Haller, H.L. Identity of the red pigment in the roots of

Tripterygium wilfordii and Celastrus scandens. Journal of the American Chemical

Society 64, 182-183 (1942).

23. Salminen, A., Lehtonen, M., Paimela, T. & Kaarniranta, K. Celastrol: Molecular

targets of Thunder God Vine. Biochemical and Biophysical Research

Communications 394, 439-442 (2010).

24. Brinker, A.M., Ma, J., Lipsky, P.E. & Raskin, I. Medicinal chemistry and

pharmacology of genus Tripterygium (Celastraceae). Phytochemistry 68, 732-766

(2007).

25. Kwak, W.J. et al. Effects of gentianine on the production of pro-inflammatory

cytokines in male Sprague-Dawley rats treated with lipopolysaccharide (LPS).

Biological & pharmaceutical bulletin 28, 750-753 (2005).

102 26. Higashi-Okai, K., Kamimoto, K., Yoshioka, A. & Okai, Y. Potent suppressive

activity of fresh and dried peels from Satsuma mandarin Citrus unshiu (Marcorv.)

on hydroperoxide generation from oxidized linoleic acid. Phytotherapy research :

PTR 16, 781-784 (2002).

27. Abu-Ghefreh, A.A., Canatan, H. & Ezeamuzie, C.I. In vitro and in vivo anti-

inflammatory effects of andrographolide. International immunopharmacology 9,

313-318 (2009).

28. Coon, J.T. & Ernst, E. Andrographis paniculata in the treatment of upper

respiratory tract infections: a systematic review of safety and efficacy. Planta

medica 70, 293-298 (2004).

29. Jia, L., Zhao, Y. & Liang, X.J. Current evaluation of the millennium

phytomedicine- ginseng (II): Collected chemical entities, modern pharmacology,

and clinical applications emanated from traditional Chinese medicine. Current

medicinal chemistry 16, 2924-2942 (2009).

30. Attele, A.S., Wu, J.A. & Yuan, C.S. Ginseng pharmacology: multiple constituents

and multiple actions. Biochemical pharmacology 58, 1685-1693 (1999).

31. Ng, T.B. Pharmacological activity of sanchi ginseng (Panax notoginseng). The

Journal of pharmacy and pharmacology 58, 1007-1019 (2006).

103 Chapter 4: Natural Triterpenoid, Celastrol, as an Anti-inflammatory, Inducer of

Cytoprotective Gene Expression and Chemopreventive in Colon Cancer

4.1 Introduction

Natural products and natural product derivatives have unique potential as pharmaceuticals due in large part to their innate chemical diversity1, 2. Further, it is suggested that natural products are a class of compounds with particular promise in the field of chemoprevention, attributable to their favorable safety profile, tolerability and increased acceptance among the patient population3, 4. Many natural products as well as synthetically modified natural products showing chemopreventive activity have been discovered to target cellular pathways known to be critical in the progression of carcinogenesis. Some of the better studied examples include curcumin5, resveratrol6, epigallocatechin gallate7 and the synthetic oleanane triterpenoids3, whose targeted pathways have come to be regarded as viable targets for chemoprevention8.

Implementation of cancer chemoprevention could increase quality of life in at risk populations and decrease morbidity and mortality rates presently resulting from this scourge on our society9-12. Cancer, as a state of disease, has a latency period during which early malfunction of cellular behavior leads to pathogeneses which, left unchecked, result in the presentation of overt disease. However, as has been shown in animals, if reversed early by chemopreventive treatment, malignancy may be delayed or symptoms maintained at subclinical levels10. In humans this would mean improving quality of life and extending disease-free lifespan. The most notable implementation of disease prevention by intervening therapy has been in the prevention of cardiovascular disease by

104 routine pharmaceutical treatment of predisposing conditions such as high blood pressure, indications for diabetes and an unhealthy ratio of high and low density lipoproteins13, 14.

Since such preventive measures have been put into practice, the US has seen a marked decrease in death rate due to heart disease over the past four decades15.

Among candidate diseases for cancer chemoprevention research, colorectal cancer is one of the most logical. Inflammation, identified as one of the potentially treatable events contributing to carcinogenesis16, is at the core of the pathogeneses preceding development of colorectal cancer. Patients who suffer from inflammatory bowel disease

(IBD) for 30+ years have a significantly increased risk for detection of colitis-associated colon cancer17. Supportive of the potential for chemoprevention by treatment of the inflammatory component of colorectal cancer, secondary analyses of clinical trials for

Aspirin and trials for preventive potential of COX-2 inhibitors have shown that colorectal cancer can be attenuated by use of non-steroidal anti-inflammatory drugs (NSAIDs).

However, adverse side effects including gastrointestinal bleeding and cardiovascular events have given cause for discontinuation of the use of such compounds for chemoprevention of colorectal cancer18-21. Aside from that, there are many patients who do not respond to this type of preventive therapy22.

Predisposition to colorectal cancer can be dictated by environmental factors and lifestyle as well as genetics23, aspects which also give opportunity for intervention by preventive measures. Germline mutations in SMAD4 are found in over 50% of patients with familial juvenile polyposis, a predisposing condition to gastrointestinal cancer24, 25.

Work done in the Letterio lab has shown that mutation of Smad4 in T-cells has been shown to lead to severe colonic inflammation and cancer development in the colon

105 epithelia in mice26. In the present study, this conditional deletion of Smad4

(Smad4co/co;Lck-cre) combined with germline deletion of p27 (p27Kip1-/-), a tumor suppressor also aberrantly regulated in most human cancers27 and degraded in colon carcinomas28, results in an even more aggressive and early carcinogenesis in mice than the conditional deletion alone published by Kim et al26. In the study presented here, the dual genetic knockout, Smad4co/co;Lck-crep27Kip1-/- (DKO) proves to be an effective platform for administration of chemopreventive celastrol beginning during the early latency period of carcinogenesis.

After an initial screening of multiple herbal extracts for anti-inflammatory activity

(Chapter 3 of this work), we explored the in vitro and in vivo activity of celastrol, a quinone methide triterpenoid from Tripterygium wilfordii or “Thunder God Vine,” an herb whose root has been used for ages in Asian medicine to treat autoimmune and inflammatory disorders 29. Active component, celastrol (Figure 4.1, page 107), has known anti-inflammatory activity and multiple cellular targets, owing to its potent reactivity30. Only recently has celastrol been implicated in antioxidant signaling as an inducer of HO1 and NQO1, presumably targeting Nrf2 transcription31, 32, one potential target for chemoprevention16. Herein, in vitro inhibition of nitric oxide and inflammatory mediators is shown, in addition to Nrf2-dependent induction of genes involved in cytoprotection and antioxidant activity. Celastrol has shown potential in preclinical models for inflammatory and neuro-inflammatory disease including asthma33, arthritis34,

Parkinson’s disease35 and Alzheimer’s disease36 and most recently, IBD37. Celastrol has yet to be tested as a chemopreventive in inflammatory carcinogenesis. Considering its potent anti-inflammatory activity and ability to induce antioxidant signaling, we

106 hypothesized that celastrol would serve as an effective preventive in a preclinical model for inflammation-driven colon cancer. We have shown that celastrol, administered in the diet at 2 mg/kg body weight per day of young DKO mice predisposed to develop colorectal cancer, improves survival and significantly delays the onset of disease while down-regulating inflammatory markers, most principally iNOS and COX-2. Taken together, our data suggest that celastrol, as a potent anti-inflammatory and inducer of antioxidant and cytoprotective signaling, is a candidate for chemoprevention in cancers driven by inflammation, such as colitis-associated colon cancer. These studies support the continued preclinical and clinical validation of celastrol as a natural product chemopreventive.

Figure 4.1. Structure of Celastrol

4.2 Results and Discussion

Celastrol down-regulates mediators of inflammation and inflammatory enzymes and induces antioxidant genes in vitro. Celastrol was tested in the same assay as was used for the screening of herbal extracts performed in Chapter 3. RAW 264.7 cells were induced by lipopolysaccharide (LPS) to mount an inflammatory response, the

107 robustness of which was measured by nitric oxide production by the Griess nitrite detection assay. With increasing concentrations of celastrol, NO production is abrogated to baseline values by 500 nM (Figure 4.2). Lysates from RAW 264.7 cells treated with increasing dose celastrol were also evaluated for production of inducible nitric oxide synthase (iNOS). Diminution of LPS-induced iNOS upregulation by celastrol, as seen by western, further demonstrates NO attenuation to be due to reduced production of this NO- synthesizing enzyme (Figure 4.3, page 109). Further, cells were shown by MTT assay to be viable at tested concentrations (Appendix A.1 and A.2, pages 155-156), indicating that reduced nitric oxide detection and iNOS expression is not due to compound toxicity.

Time course evaluation at 500 nM celastrol shows increasing iNOS production over the

24-hour time course and continuous inhibition by celastrol (Figure 4.4, page 109).

Figure 4.2. Celastrol Inhibits Nitric Oxide in Activated RAW 264.7 Cells.1.0 x 105 cells were treated in triplicate in 96 well plate format. Cells were activated with 5.0 ng/ml LPS and immediately treated with increasing concentrations of celastrol in media. After 16 hours, media was evaluated for nitric oxide production by Griess assay. Triplicate treatments were averaged and graphed as mean +/- SEM.

108

Figure 4.3. Celastrol Inhibits iNOS Expression and Induces HO-1 Expression in Activated RAW 264.7 Cells. 2.5 x 106 cells were treated in 60 mm plates. Cells were activated with 5.0 ng/ml LPS and simultaneously treated with increasing concentrations of celastrol or DMSO vehicle. After 16 hours, cells were harvested. 25 μg lysates were evaluated. This blot is representative of two replicate experiments.

Figure 4.4. Time Course Inhibition of iNOS and Induction of HO-1 by Celastrol in RAW 264.7 Cells. 2.5 x 106 cells were treated in 60 mm plates. Cells were activated with 5.0 ng/ml LPS and simultaneously treated with 500 nM celastrol or DMSO vehicle. At the indicated time point, cells were harvested. 25 μg lysates were evaluated.

iNOS is a downstream target of multiple signaling pathways, one of the more principal being the NFκB signaling pathway which also drives transcription of other genes expressing inflammatory mediators COX-2 and TNFα and IL-638. To confirm the anti-inflammatory effect observed in RAW 264.7 cells, we tested celastrol inhibition of inflammatory enzymes iNOS and COX-2 in an intact population of live cells extracted

109 from the peritoneal cavity of freshly euthanized mice. These experiments demonstrated inhibition of both enzymes COX-2 and iNOS with increasing doses of celastrol (Figure

4.5). Macrophages from the mouse peritoneum required a much higher dose of LPS to induce expression of inflammatory mediators and dose range for inhibition by celastrol was observed at a much lower threshold in comparison to RAW 264.7 cells. Cellular viability was also assessed under these conditions by MTT assay and satisfactory viability was demonstrated at the concentrations shown (Appendix A.3 and A.4, page

157-158).

Figure 4.5. Celastrol Inhibits Expression of iNOS and COX-2 in Primary Macrophages Activated with LPS. Primary mouse macrophages were isolated from the peritoneal cavity of mice 5 days following intraperitoneal injection with 3% thioglycollate. 9.0 x 106 cells were plated in 60 mm plates. Cells were activated with 0.5 μg/ml LPS and treated simultaneously with increasing doses of celastrol. Treatments were performed in quadruplicate and combined at harvest after 24 hours. 50 μg lysates were evaluated. This blot is representative of two replicate experiments.

RAW 264.7 cells treated with LPS and celastrol were also probed by western for production of heme oxygenase-1 (HO-1). Interestingly, HO-1 induction was observed alongside inhibited production of iNOS (Figures 4.3 and 4.4, page 109). HO-1 production was particularly robust at the highest concentrations of celastrol tested

110 (Figure 4.3, page 109). HO-1 catalyzes the first and rate-limiting step in heme degradation and produces carbon monoxide, iron and biliverdin. Recently, it has been characterized as an anti-inflammatory due to the anti-inflammatory properties of its enzymatic byproducts, carbon monoxide and bilirubin, as well as its degradation of pro- inflammatory free heme39. HO-1 is a target of multiple transcription pathways, the most predominant being Nrf239. These initial results generated interest in celastrol induction of

HO-1 and the possibility of induction of other prototypical enzymes of the Nrf2 pathway.

First, however, we were interested to know whether induction of HO-1 in RAW 264.7 cells was dependent upon activation of those cells by LPS. Western evaluation showed time-course induction of HO-1 by celastrol even in the absence of LPS (Figure 4.6).

Figure 4.6. Time Course Induction of HO-1 by Celastrol in RAW 264.7 Cells without LPS. 4.0 x 106 cells were treated in 60 mm plates. Cells were treated with 500 nM celastrol or DMSO vehicle. At the indicated time point, cells were harvested. 50 μg lysates were evaluated. This blot is representative of two replicate experiments.

Celastrol would be a likely candidate inducer of Nrf2 transcription, owing to its electrophilic centers for potential Michael addition. This functional characteristic has been found to be predictive in inducing cytoprotection40, a presumable mechanism thought to be via covalent modification of the surface cysteine residues on Keap1, the cytoplasmic inhibitor of Nrf241 (see Chapter 1, Section 1.5). We were thus interested in

111 exploring the induction of other cytoprotective targets of the Nrf2 pathway by celastrol.

In RAW 264.7 cells, 500 nM celastrol was observed by quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) to induce mRNA production of multiple Nrf2 targets in a time-dependent manner (Figure 4.7).

Figure 4.7. Time course induction of multiple Nrf2 targets by celastrol in RAW 264.7 cells as shown by qRT-PCR. 3.0 x 106 cells were treated in 60 mm plates. Cells were treated with 500 nM celastrol or DMSO vehicle. At the indicated time point, cells were harvested. RNA was isolated and converted to cDNA prior to quantitative evaluation of mRNA transcripts by qRT-PCR. All genes were normalized to beta actin and fold expression is in comparison to untreated cells. HO-1 and NQO1 are graphed on the left y-axis and GR, GCLC and Catalase are graphed on the right y-axis.

All of these targets are involved in different aspects of cytoprotectivity and are up regulated by exposure of mammalian cells to electrophilic stress. HO-1, as mentioned above, promotes anti-inflammatory activity due to its heme degradation and production of anti-inflammatory byproducts. NAD(P)H:quinone oxidoreductase 1 (NQO1) is involved in both antioxidant activity by reduction of endogenous quinones as well as

112 detoxification by catalyzing two electron reduction of redox-cycling quinones to form stable hydroquinones which can be conjugated and excreted42. Glutamate cysteine ligase catalytic subunit (GCLC) and glutathione disulfide reductase (GR) are both involved in glutathione synthesis and glutathione plays a principal role in cellular detoxification of xenobiotics. GCLC is the first rate-limiting enzyme in glutathione synthesis and GR catalyzes reduction of glutathione disulfide to the sulfhydryl compound glutathione43, 44.

Catalase is an enzyme responsible for decomposition of hydrogen peroxide to water and oxygen, thereby playing a major role in protecting cellular components from oxidative damage due to increased production of reactive oxygen species (ROS)45.

Robust Induction of cytoprotective genes by celastrol is dependent on Nrf2.

To explore whether the observed induction of cytoprotective genes by celastrol had any dependence on Nrf2, an experiment comparing gene target induction in mouse macrophages taken from wild type (Nrf2+/+) and Nrf2-null (Nrf2-/-) mice was executed.

After multiple pilot experiments establishing an ideal dose and time point for robust induction of cytoprotective target genes in primary macrophages, celastrol induction of cytoprotective genes and possible dependence upon Nrf2 was evaluated using peritoneal macrophages from Nrf2+/+ and Nrf2-/- mice. It was observed that celastrol induces up- regulation of multiple cytoprotective target mRNA transcripts in Nrf2+/+ peritoneal macrophages while for multiple genes, that induction is largely compromised in peritoneal macrophages Nrf2-/- mice (Figure 4.8, page 114). The limited induction of cytoprotective genes in Nrf2-/- macrophages is indicative of other pathways, aside from

Nrf2, being activated by celastrol in the induction of these genes. On a protein level, the same dose also induces expression of hallmark Nrf2 target HO-1 in bone marrow-derived

113 macrophages from Nrf2+/+ mice while HO-1 protein expression in Nrf2-/- macrophages could not be detected by western (Figure 4.9, page 115). These results are supportive of the mechanistic role of celastrol in the induction of these genes to be dependent upon

Nrf2.

Figure 4.8. Celastrol Shows Partial Dependence on Nrf2 in Induction of Multiple Cytoprotective Genes as Shown by qRT-PCR. 5.0 x 106 cells were treated in 60 mm plates. Cells were treated with 750 nM celastrol or DMSO vehicle. After 16 hours, cells were harvested. RNA was isolated and converted to cDNA prior to quantitative evaluation of mRNA transcripts by qRT-PCR. All genes were normalized to beta actin and fold expression is in comparison to Nrf2+/+ or Nrf2-/- macrophages treated with DMSO vehicle. Bars represent averages from 5 separate experiments and error bars indicate SEM. Statistical significance was calculated using two-tailed students’ t-test. **p < 0.005, *p < 0.05.

114

Figure 4.9. Celastrol Induction of HO-1 is Nrf2-dependent as Shown by Western. Primary mouse macrophages were derived from bone marrow isolated from femur and tibia of 7-week-old Nrf2+/+ and Nrf2-/- mice by 7 day culture in macrophage colony-stimulating factor. 3.5 x 106 cells were plated in 35 mm plates. Cells were treated with media alone, or media with DMSO or celastrol at indicated doses. Cells were harvested after 24 hours. 20 μg lysates were evaluated. This blot is representative of two replicate experiments.

Celastrol delays the onset and inhibits progression of inflammation-driven colon cancer in mice. A number of in vivo models for inflammatory disease have tested the efficacy of celastrol in treatment of symptoms46, but celastrol has not been tested to date in models for colorectal cancer, much less, as a chemopreventive in a model for inflammation-driven colitis-associated colon carcinogenesis. The T cell specific Smad4 and germline p27Kip1 dual genetic knockout mouse (Smad4co/co;Lck-crep27Kip1-/-, DKO) develops colitis-associated colon cancer on a rapid time-scale and is thus a reliable and innovative platform for investigation of chemopreventive potential of compounds administered beginning during the cancer-free latency period of carcinogenesis. These mice often develop duodenal tumors by 3 months of age and exhibit gross enlargement of the large intestine by 4 to 5 months of age caused by a thickened mucosal surface of the intestine with visible polyps in the intestinal lumen. These symptoms are commonly

115 accompanied by near occlusion of the bowel and rectal prolapse. Life expectancy does not extend beyond 6 to 8 months.

Figure 4.10. Experimental scheme for testing celastrol as a chemopreventive for inflammation-driven carcinogenesis in the colon in DKO mice. DKO mice were maintained on control diet until 6 weeks of age when experimental groups were started on celastrol-supplemented diet resulting in an apparent dose of 2 mg/kg celastrol per day. Mice were weighed 2-3 times per week and were sacrificed at indicated time- points and evaluated for disease progression by gross necropsy, histology and biochemical markers of inflammation.

Celastrol was incorporated into the diet of 6 week-old DKO mice at an apparent dose of 2 mg/kg body weight per day (based upon assumed daily consumption and average body weight). Cohorts of mice on control diet and celastrol diet were sacrificed at 3, 4 and 6 months and evaluated for gross and histological progression of disease and inflammatory biochemical markers in serum and colon epithelia. A schematic for the experimental timeline is shown in Figure 4.10. As a depiction of overall health, celastrol- treated DKO mice demonstrated increased ability to maintain their weight and had increased survival over time (Figure 4.11, page 118). In the short-term, celastrol had a marked effect in delaying disease onset as seen in the gross necropsy of both the colon as

116 well as the proximal small intestine (Figure 4.12, page 118). As early as 3 months of age, some of the untreated mice began to have thickened mucosal surface of the colon and compromised ability to form stool. Presentation of symptoms is clearly delayed in those mice consuming a celastrol-supplemented diet as observed by maintenance of healthy intestinal function and formation of stool (Figure 4.12 A, page 118). Similarly, an early hallmark of disease progression in this model is the formation of duodenal tumors which formation is impressively attenuated by administration of celastrol (Figure 4.12 B, page

118). Quantitative indication of the effect of celastrol in attenuating thickening of the intestinal mucosa was assessed by measurement of colon length to colon weight ratio over time. Healthy colon thickness is maintained in DKO mice on celastrol-supplemented diet and the difference in mice on control diet is statistically significant at the latest time point of 6 months (Figure 4.13 A, page 119). Histological analysis of cross sections of the 4 month large and small intestine shows the gross enlargement and interruption of tissue architecture in these organs in DKO mice on control diet. In age matches receiving celastrol-supplemented diet, inhibited disease progression is demonstrated by the maintenance of healthy villus architecture (Figure 4.13 B, page 119).

117

Figure 4.11. Celastrol Increases Survival and Weight Maintenance in DKO Mice Over Time. A, Survival of DKO mice on control diet vs. 2 mg/kg celastrol per day. Sample sizes are n=13 for DKO mice on celastrol diet and n=15 for control. B, Percent weight change over time of DKO mice on control diet vs. 2 mg/kg celastrol per day. Significance was calculated using two-tailed Students’ t-test, un-paired. *p < 0.05.

Figure 4.12. Celastrol Inhibits Disease Progression in DKO Mice. DKO mice on control diet or 2 mg/kg per day celastrol were sacrificed at indicated time-points and colons (A) and stomachs (B) evaluated for progression of disease. Comprehensive necropsy statistics can be found in Appendix A.5 (page 159).

118

Figure 4.13. Celastrol Inhibits Colon Thickening and Disease in DKO Mice Shown Histologically. A, DKO mice on control diet or 2 mg/kg per day celastrol were sacrificed at indicated time-points and colons emptied and measured for weight and length. Ratio shows average for mice in each cohort +/- SEM. Significance was calculated using two-tailed Students’ t-test. *p < 0.05. B, Hematoxylin and eosin staining for colon and duodenal cross sections. Scale bar refers to non-zoomed panels.

Celastrol suppresses iNOS and COX-2 expression and induces cytoprotective genes in colon epithelia of DKO mice. For evaluation of the biochemical effect celastrol had on mediators of inflammation in this disease model, portions of the excised DKO colons that were not used for histological analysis were cleaned and epithelial surfaces scraped and homogenized for isolation of protein and RNA. Western blot and qRT-PCR indicated that iNOS and COX-2 were two of the main mediators of inflammation up- regulated in this disease model and suppressed by administration of celastrol in diet

(Figures 4.14 and 4.15, page 121). In this experiment, iNOS began to be detected in

119 roughly half of the mice on control diet by 3 months of age by western. By 4 and 6 months there was more comprehensive detectability of iNOS in colon scrapings, with 4 out of 6 and 7 out of 8 mice having detectable iNOS in colon scrapings by western, respectively. At each time-point there was significant and comprehensive reduction in iNOS detected in colon scrapings from DKO mice treated with celastrol-supplemented diet. The same trend is observed by qRT-PCR, showing normalized fold expression iNOS in colon epithelial scrapings from DKO mice on celastrol-supplemented diet significantly reduced from expression observed in colon scrapings from mice on control diet (Figure

4.14, page 121). The difference becomes pronounced and shows statistical significance at

4 and 6 months. Upon sacrifice, DKO mice were also bled by cardiac puncture and isolated serum was evaluated for nitric oxide production by Griess assay. Enough serum was recovered for evaluation at 4 and 6 months. A trend for down-regulated nitric oxide in serum is indicative of a systemic and not only localized effect of celastrol on inhibition of inflammation (Figure 4.14, page 121). This model also showed significant up- regulation of COX-2 expression in colon epithelial scrapings, which average was also reduced in the colon scrapings from mice on celastrol-supplemented diet (Figure 4.15, page 121). Further histological studies evaluating iNOS and COX-2 expression in tissues will determine whether expression is isolated to infiltrating immune cells in colon tissue or whether expression of these mediators of inflammation and down-regulation by celastrol is also observed in epithelial cells.

120

Figure 4.14. Celastrol Suppresses iNOS and Nitric Oxide in DKO Tissues. A, Colon scrapings of DKO mice on control diet or 2 mg/kg per day celastrol probed for iNOS by Western. B, RNA from colon scraping of DKO mice on control diet or 2 mg/kg per day celastrol was converted to cDNA and probed with iNOS primers by qRT-PCR. Genes are normalized to β-actin expression and fold expression is in comparison to samples taken from wild type mice. C, Nitric oxide in serum of DKO mice on control diet or 2 mg/g per day celastrol as determined by Griess assay. Bars show average for mice in each cohort +/- SEM. Significance was calculated using two-tailed Students’ t-test, un-paired. *p < 0.05.

Figure 4.15. Effect of Celastrol on COX-2 and Cytokines in DKO Colon Epithelia. RNA from colon scraping of DKO mice on control diet or 2 mg/kg per day celastrol was converted to cDNA and probed by qRT-PCR for COX-2 (A), IL-6 (B), TNFα (C), and IFNγ (D). Genes are normalized to β-actin expression and fold expression is in comparison to samples taken from wild type mice. Bars show average for mice in each cohort +/-SEM. Significance was calculated using two-tailed Students’ t-test, un-paired. *p < 0.05.

iNOS and COX-2 expression is down-stream of multiple inflammatory signaling pathways. Three principal pathways are the nuclear factor κB (NF-κB), signal transducer

121 and activator of transcription 1 (STAT1), and signal transducer and activator of transcription 3 (STAT3) cascades47, 48. Cytokines that activate these signaling pathways are, TNFα, IFNγ, and IL-6 respectively. Evaluating cytokine expression by qRT-PCR showed significant differences for only IL-6 in tissues from DKO mice treated with control or celastrol-supplemented diets (Figure 4.15, page 121). This result is suggestive of the mechanistic importance of STAT3 as a possible target for celastrol in this model.

Interpretation of these data will be aided by further studies characterizing the mouse model to identify the major pathways affected by the genetic alterations in Smad4 and p27Kip1 in comparison to wild type mice of identical strain.

Having evaluated celastrol as an inducer of cytoprotective and antioxidant activity, we were interested in whether celastrol had an effect on expression of these genes in the DKO mouse model. Although a connection between inflammation and induction of the phase 2 immune response has yet to be fully elucidated, it has been commonly observed that small molecules that induce phase 2 cytoprotective enzymes also down regulate mediators of inflammation49-51, a phenomena which we have observed for celastrol in vitro as presented earlier in this chapter. In colon epithelial scrapings from the 4 month cohort, we observed that a number of cytoprotective enzymes, down regulated in the DKO model (in comparison to un-diseased wild type mouse tissue), can be modestly induced by administration of celastrol in diet (Figure 4.16, page 123). Nrf2 has been suggested to have implications in colorectal cancer pathogenesis as Nrf2-null mice have increased susceptibility to colonic inflammation and to colitis-associated colotrectal cancer52, 53. Further work in the DKO model will be necessary for identifying whether the Nrf2 targets are important in the progression of disease in this model and to

122 establish whether there is indeed a correlation between increased cytoprotectivity by celastrol and delayed onset of disease.

Figure 4.16. Celastrol Induces Cytoprotective Cytoprotective Phase 2 Genes in DKO Colon Epithelia. RNA from colon scraping of 4 month old DKO mice on control diet or 2 mg/kg per day celastrol was converted to cDNA and probed by qRT-PCR for genes activated by phase 2 immune response. Genes are normalized to β-actin expression and fold expression is in comparison to samples taken from wild type mice. Bars show average +/- SEM.

4.3 Conclusion

In addition to the preventive phenotype of celastrol in DKO mice demonstrated here, ancient and recent history on the biological activities of Tripterygium wilfordii

Hook F (TW) and celastrol also point to the potential for this quinone methide triterpenoid as a chemopreventive. TW has been used for centuries in traditional medicine for treatment of fever, chills, edema and inflammation54. Interestingly, the often-cited disorders for which TW has been effectively applied for relief of symptoms are mediated by inflammation and include rheumatoid arthritis, systemic lupus erythematosus, chronic nephritis and spondylitis29. It is further significant that celastrol

123 has been effective in other in vivo models for inflammatory-mediated disease30, 46 as inflammation is included among those features of carcinogenesis predicted to be the most treatable by preventive intervention16.

Our results showing delayed onset in cancer and suppressed inflammation in

DKO mice treated with 2 mg/kg celastrol per day, demonstrate how the anti- inflammatory activity of celastrol can be effectively applied in a preventive manner in colitis-associated colon cancer where overt disease is both preceded by and exacerbated by an inflammatory environment. The model used in this study has direct relevance to human cancer as Germline mutations in SMAD4 can indicate a predisposition to gastrointestinal cancer24, 25 and p27 is dysregulated in many human cancers and degraded in colon carcinomas27, 28. The T cell conditional deletion of Smad4 coupled with the conditional deletion of p27Kip1 results in early on-set inflammation-driven colon carcinogenesis. We utilized the cancer-free latency period as a time to begin administration of celastrol as a chemopreventive in this model and observed marked delay in disease state and suppression of inflammation in diseased tissues.

Main targets in suppression of inflammation by celastrol in this model for inflammation-driven colon carcinogenesis were iNOS, COX-2 and IL-6. All of these mediators have marked relevance in the inflammatory environment of the colon and pathogenesis of colorectal cancer. The presence of iNOS has been shown to be critical for the development of colonic inflammation55 and the angiogenic and invasive nature of tumor cells, which leads to tumor growth and metastasis, is augmented by NO-mediated signaling56. COX-2 is aberrantly expressed in the majority of colorectal tumors and presumed to take a major part in development of colon cancer. This is mainly through the

124 abundant production of metabolite PGE2 and consequent effects on regulation of cell cycling, growth and interaction with other cells57. In addition, colorectal cancer is one of the malignancies where COX-2 inhibitors have shown some of the greatest promise as a preventive option, but use as primary chemopreventives is not likely due to unfavorable tolerability of such compounds taken long-term20. Lastly, IL-6 has been identified as a key regulator for colorectal cancer development with increased expression being connected to advanced disease stage and increased mortality. The correlation is presumably connected to IL-6 signaling through STAT3 and therapeutics targeting IL-

6/STAT3 have been thought to have particular promise in treatment of colorectal cancer58. Down regulation of any of these mediators of inflammation would be a promising approach for chemoprevention in colorectal cancer. The effect observed by celastrol is likely due to its affecting multiple targets involved in the regulation of enzymes iNOS and COX-2 as well as signaling molecule, IL-6.

The potential of celastrol as a chemopreventive is further bolstered by our mechanistic work showing Nrf2 as a molecular target of celastrol. We observed Nrf2 dependence in the induction of cytoprotective genes by celastrol in vitro as well as modest induction of these genes in vivo. Clear implications between Nrf2 and cancer59 illustrate the potential utility of an Nrf2/Keap1-targeting compound as a chemopreventive16. Chemopreventive compounds have a greater positive effect in carcinogen-induced cancers in Nrf2 wild type mice than in Nrf2 null mice and absence of

Nrf2 increases sensitivity to chemical carcinogenesis60. Of particular relevance is the observed role of Nrf2 in development of carcinogen-induced colon cancer where loss of

Nrf2 is seen to facilitate carcinogenesis52, 53. Compounds, such as celastrol, which

125 augment Nrf2 transcriptional activity should thus be seriously considered as chemopreventive candidates.

Indeed, approaches to treatment and prevention of cancer are as welcome as they have ever been61. The alarming rate of cancer development in our society calls for reconsideration of our approach to combating this disease and its far-reaching effects10.

Increasing amounts of evidence, underlined by findings documented here make a case for the practicality of chemoprevention in cancer. We have uncovered previously unexplored applications of celastrol, first as a chemopreventive and second as a chemopreventive in a unique model for Inflammation-driven colon carcinogenesis. Most significant, celastrol inhibited inflammatory mediators with strong implications in pathogeneses of colorectal carcinogenesis and induced recovery of the expression of Nrf2-regulated genes. Our findings point to the translational potential of celastrol as a chemopreventive in inflammatory driven disease, particularly in colitis-associated colon cancer.

4.4 Experimental Methods

Chemical compounds and Reagents. Celastrol was purchased from Ontario

Chemical Inc. (Ontario, Canada). Lipopolysaccharide was purchased from Sigma

Aldrich. RAW 264.7 cells were generously provided by the Michael Sporn group

(Dartmouth). DMEM, PureLink, RNA Mini extraction kit and TRIzol were purchased from Invitrogen. Fetal Bovine Serum (FBS) was purchased from HyClone

Thermoscientific and always represented the lowest endotoxin-containing lot available

(<0.125 endotoxin unit). RIPA cell lysis buffer was purchased from Thermoscientific.

Protease inhibitor cocktail tablets were purchased from Roche. Kits for Griess assay were

126 purchased from Invitrogen and Cayman Chemical. MTT kit was purchased from ATCC.

All antibodies were purchased from Santa Cruz. High Capacity cDNA Synthesis Kit was purchased from Applied biosystems. DMEM was purchased from Invitrogen. M-CSF was from Peprotech. Primer probes for quantitative RT-PCR were purchased from

Integrated DNA Technologies except for iNOS, COX-2 and β-actin, which were purchased from Applied Biosystems.

RAW 264.7 cells and celastrol treatment. RAW 264.7 cells were cultured in

DMEM containing 10% low endotoxin FBS, 100 units/ml penicillin and 100 μg/ml streptomycin. For nitric oxide detection, cells were plated at 1 x 105 cells per well in 96- well format. Celastrol was dissolved in DMSO at 4 mM and 10 μl was diluted into 1 ml media. Serial diluting produced concentrations ranging from 20 μM to 2 nM. 100 ul of each dilution was added to 100 ul cell suspension containing 10 ng/ml LPS. After 16 hours, 100 ul media was used for nitric oxide detection by Griess assay. For western blot, cells were plated at 4 x 106 in 60 mm plates and treated with media containing LPS

(where applicable) and celastrol at indicated concentrations. At indicated time points, cells were harvested by scraping and were subsequently pelleted and frozen prior to lysis for western and qRT-PCR.

Nitric oxide detection and MTT assays. For cell culture experiments, Griess kit from Invitrogen was used. Standard curve for nitric oxide detection was established on a per experiment basis using the provided sodium nitrite and diluting standards from 100 to

1.5 μM in media. 100 μl sample was subjected to 100 μl 1:1 mixture of Griess assay substrate. Absorbance was read at 570 nm and nitrite concentration determined from the standard curve. Data was corrected to the baseline value by adjusting standard curve y-

127 intercept to reflect the average absorbance for untreated cells. Griess kit from Cayman chemical was used for nitric oxide detection in serum samples. Serum was filtered through a centrifugal filter device, then evaluated according to kit directions for combined concentrations of both nitrite and nitrate ions. MTT assay was performed according to ATCC kit directions and absorbance was measured at 570 nm. MTT results are shown in Appendices 1-4 (pages 155-158).

Primary mouse macrophages. Peritoneal macrophage recruitment to abdomen was elicited with 3% thioglycollate intraperitoneal injection. 7 days prior to collection.

Mice were euthanized and macrophages collected by peritoneal lavage with 1x phosphate buffered saline (PBS). Cells were pelleted and re-suspended in DMEM supplemented with 10% low endotoxin FBS, 100 units/ml penicillin and 100 μg/ml streptomycin. Cells were plated overnight and washed twice with warm 1x PBS prior to treatments. Cells were treated with LPS and celastrol simultaneously (where applicable) or with celastrol diluted in media. Cells were harvested by scraping at indicated time-points and pelleted and frozen prior to processing for western blot or RT-PCR. Bone marrow macrophages were derived from mouse bone marrow collected from femur and tibia and cultured in media containing 0.02 μg/ml macrophage colony stimulating factor (M-CSF) for 7 days.

Cells were plated and incubated overnight prior to treatment. On the day of treatment, media was aspirated and replaced with media containing celastrol or vehicle, as indicated in figures. Cells were harvested by scraping after 24 hours and pelleted and frozen prior to processing for western blot. Celastrol was diluted from 100 mM stock in DMSO, stored at -80°C.

128 Animals and custom diet. C57Bl/6J (wild type) mice were purchased from

Jackson Labs and bred in house. Smad4co/co;Lck-crep27Kip1-/- mouse strain was developed and bred in the Letterio lab. Nrf2-/- mice on C57Bl/6J background were purchased from

RIKEN BioResource center (Tsukuba, Japan) and bred in house. All experiments were performed with age-match controls.

For long-term in vivo study in Smad4co/co;Lck-crep27Kip1-/- mice, celastrol- supplemented diet was custom mixed and pelleted by Land O’Lakes Purina Feed in the

LabDiets/TestDiets division (Richmond, IN). Celastrol was mixed into IsoPro RMH 3000

5P76 diet in powder form at a concentration of 12.5 ppm. This concentration was calculated to be the equivalent of 2 mg/kg per day celastrol based on the assumptions that average diet intake for mice is 5.0 g per day and average mouse weight is 30.0 g

(assumptions recommended by experts at Purina LabDiets/Test/Diets). Both Purina animal chow or celastrol-supplemented chow and water was available ad libitum.

Average chow consumption per mouse was monitored from week to week to ensure mice were not showing an unanticipated preference for either diet.

Animal tissue processing and staining. Smad4co/co;Lck-crep27Kip1-/- mice were euthanized by CO2 asphyxiation followed by plasma collection by cardiac puncture.

Isolated serum was evaluated for combined nitrite and nitrate concentration using the

Griess assay kit from Cayman Chemical according to kit protocol. Colon was excised and cleaned with 1x PBS with protease inhibitor on ice. Colon length and weight were measured and the distal portion was fixed in 10% buffered formalin for histology. The remaining portion was opened and epithelia surface scraped. Scrapings were placed immediately on dry ice and frozen at -80 °C. Stomach and proximal small intestine were

129 excised and fixed in 10% buffered formalin for histology. Sample mounting and staining for histology was performed by Histoserv Inc. (Germantown, MD).

Quantitative RT-PCR. Total RNA was isolated from tissues using TRIzol reagent and from cells using PureLink RNA mini kit. cDNA was synthesized from 250 to

1000 ng RNA using High Capacity cDNA synthesis Kit from Applied Biosystems.

Primers for quantitative RT-PCR had the sequences shown in Table 4.1 (page 131).

Primers with sequences shown were purchased from Integrated DNA Technologies in assays including a fluorescent probe. Primer probes for β-actin, iNOS and COX-2 were purchased from Applied Biosystems and had accession numbers Mm00607939_s1,

Mm00440502_m1 and Mm00478374_m1, respectively. Quantitative RT-PCR was performed on BioRad CFX96 Real-Time System C1000 Thermal Cycler. After 3 minutes melt step at 90° C, samples cycled for 40 repetitions of 10 seconds at 90° C and 30 seconds at 60° C. ΔΔCT was calculated using β-actin as control gene and were normalized to wild type expression or vehicle treated control. Specifically, for DKO mice

3 and 4 months of age, normalization was relative to expression in RNA extracted from colon tissue of 3 month-old C57 Black 6 mice obtained from Jackson Labs and bred in house. Gene expression in 6 month-old DKO mice was normalized relative to RNA extracted from tissues of mice having a genetic background matching the DKO mice.

This difference was due to availability of age match controls. Quantification was performed using instrument software.

130 NQO1 Forward: GTACTCGAATCTGACCTCTATGC Reverse: AGATGACTCGGAAGGATACTGA HO1 Forward: AACTTTCAGAAGGGTCAGGTG Reverse: GTTGCGCTCTATCTCCTCTTC Nrf2 Forward: CTTGTACTTTGAAGACTGTATGC Reverse: TGAACTTTCAGCGTGGCT Catalase Forward: CTATTGCCGTTCGATTCTCCA Reverse: ATCCCAGTTACCATCTTCAGTG GCLC Forward: ACATCTACCACGCAGTCAAG Reverse: ACATCTCCTCCATTCAGTAAC GR Forward: CTTGCGTGAATGTTGGATGTG Reverse: GACATGCCAACTGAATTTACCC Table 4.1. Primer sequences for probes used in qRT-PCR

Western Blots. Washed and pelleted cells and frozen mouse tissues were lysed using RIPA buffer with mini complete protease inhibitor tablet added. 10-50 μg denatured proteins were separated on 4-20% tris-glycine gels and transferred to PVDF membrane. Blots were blocked in 5% milk made in TBS containing 0.05% tween-20.

Antibodies were used at 1:1000 except for β-actin, which was used at 1:25,000.

Statistics. For inclusion in the 3 time cohorts in the in vivo study and calculation of statistics, some mice required euthanasia between time points and so not all mice in each cohort were of uniform age. For clarity, mice in the 3 month time point were those sacrificed between 12 and 16 weeks of age; mice in the 4 month time point were those sacrificed between 16 and 21 weeks of age; and mice in the 6 month time point were those sacrificed between 21 and 25 weeks of age. Statistics were performed in Prism

GraphPad and statistical differences were calculated using un-paired two-tailed Students’

131 t-test as indicated in figure legends. Statistical significance was accepted to be a p-value of less than or equal to 0.05.

4.5 Acknowledgements

The mouse work presented in this study would not have been possible without devoted personnel in the Letterio laboratory. Research Associate, Dr. Byung-Gyu Kim, and colleagues generated the DKO mouse model. Former lab manager, Janet Robinson, maintained the colony and genotyped the mice for use in testing celastrol as a chemopreventive in the DKO model. Also, faculty of the Case Comprehensive Cancer

Center should be acknowledged for making equipment available; Dr. Mark Jackson for the qRT-PCR thermocycler and Dr. David Danielpour and Dr. Clark Distelhorst for the microplate readers.

132 4.6 References

1. Lewis, K. Platforms for antibiotic discovery. Nature reviews. Drug discovery 12,

371-387 (2013).

2. Demain, A.L. Prescription for an ailing pharmaceutical industry. Nature

biotechnology 20, 331 (2002).

3. Sporn, M.B. & Liby, K.T. NRF2 and cancer: the good, the bad and the

importance of context. Nature reviews. Cancer 12, 564-571 (2012).

4. Mehta, R.G., Murillo, G., Naithani, R. & Peng, X. Cancer chemoprevention by

natural products: how far have we come? Pharmaceutical research 27, 950-961

(2010).

5. Thangapazham, R.L., Sharma, A. & Maheshwari, R.K. Multiple molecular targets

in cancer chemoprevention by curcumin. The AAPS journal 8, E443-449 (2006).

6. Kundu, J.K. & Surh, Y.J. Molecular basis of chemoprevention by resveratrol: NF-

kappaB and AP-1 as potential targets. Mutation research 555, 65-80 (2004).

7. Na, H.K. & Surh, Y.J. Intracellular signaling network as a prime chemopreventive

target of (-)-epigallocatechin gallate. Molecular nutrition & food research 50,

152-159 (2006).

8. Liby, K.T. & Sporn, M.B. Synthetic oleanane triterpenoids: multifunctional drugs

with a broad range of applications for prevention and treatment of chronic

disease. Pharmacological reviews 64, 972-1003 (2012).

9. Sporn, M.B. & Suh, N. Chemoprevention: an essential approach to controlling

cancer. Nature reviews. Cancer 2, 537-543 (2002).

133 10. Sporn, M.B. Perspective: The big C - for Chemoprevention. Nature 471, S10-11

(2011).

11. Leaf, C. Why we're losing the war on cancer (and how to win it). Fortune 149,

76-82, 84-76, 88 passim (2004).

12. Leaf, C. The Truth in Small Doses. Why We're Losing the War on Cancer and

How to Win it. (Simon and Schuster, New York, NY; 2013).

13. Albini, A. & Sporn, M.B. The tumour microenvironment as a target for

chemoprevention. Nature reviews. Cancer 7, 139-147 (2007).

14. Perk, J. et al. European Guidelines on cardiovascular disease prevention in

clinical practice (version 2012). The Fifth Joint Task Force of the European

Society of Cardiology and Other Societies on Cardiovascular Disease Prevention

in Clinical Practice (constituted by representatives of nine societies and by invited

experts). European heart journal 33, 1635-1701 (2012).

15. Sporn, M.B. & Liby, K.T. Cancer chemoprevention: scientific promise, clinical

uncertainty. Nature clinical practice. Oncology 2, 518-525 (2005).

16. Kwak, M.K. & Kensler, T.W. Targeting NRF2 signaling for cancer

chemoprevention. Toxicology and applied pharmacology 244, 66-76 (2010).

17. Waldner, M.J. & Neurath, M.F. Colitis-associated cancer: the role of T cells in

tumor development. Seminars in immunopathology 31, 249-256 (2009).

18. Reddy, B.S. et al. Chemoprevention of colon cancer by specific cyclooxygenase-2

inhibitor, celecoxib, administered during different stages of carcinogenesis.

Cancer research 60, 293-297 (2000).

134 19. Gupta, R.A. & Dubois, R.N. Colorectal cancer prevention and treatment by

inhibition of cyclooxygenase-2. Nature reviews. Cancer 1, 11-21 (2001).

20. Steward, W.P. & Brown, K. Cancer chemoprevention: a rapidly evolving field.

British journal of cancer 109, 1-7 (2013).

21. Wang, D. & DuBois, R.N. The role of anti-inflammatory drugs in colorectal

cancer. Annual review of medicine 64, 131-144 (2013).

22. Fink, S.P. et al. Aspirin and the risk of colorectal cancer in relation to the

expression of 15-hydroxyprostaglandin dehydrogenase (HPGD). Science

translational medicine 6, 233re232 (2014).

23. Markowitz, S.D., Dawson, D.M., Willis, J. & Willson, J.K. Focus on colon

cancer. Cancer cell 1, 233-236 (2002).

24. Howe, J.R. et al. Mutations in the SMAD4/DPC4 gene in juvenile polyposis.

Science 280, 1086-1088 (1998).

25. Howe, J.R. et al. Common deletion of SMAD4 in juvenile polyposis is a

mutational hotspot. American journal of human genetics 70, 1357-1362 (2002).

26. Kim, B.G. et al. Smad4 signalling in T cells is required for suppression of

gastrointestinal cancer. Nature 441, 1015-1019 (2006).

27. Chu, I.M., Hengst, L. & Slingerland, J.M. The Cdk inhibitor p27 in human

cancer: prognostic potential and relevance to anticancer therapy. Nature reviews.

Cancer 8, 253-267 (2008).

28. Loda, M. et al. Increased proteasome-dependent degradation of the cyclin-

dependent kinase inhibitor p27 in aggressive colorectal carcinomas. Nature

medicine 3, 231-234 (1997).

135 29. Brinker, A.M., Ma, J., Lipsky, P.E. & Raskin, I. Medicinal chemistry and

pharmacology of genus Tripterygium (Celastraceae). Phytochemistry 68, 732-766

(2007).

30. Salminen, A., Lehtonen, M., Paimela, T. & Kaarniranta, K. Celastrol: Molecular

targets of Thunder God Vine. Biochemical and Biophysical Research

Communications 394, 439-442 (2010).

31. Zhang, Y. et al. HSF1-Dependent Upregulation of Hsp70 by Sulfhydryl-Reactive

Inducers of the KEAP1/NRF2/ARE Pathway. Chemistry & Biology (Cambridge,

MA, United States) 18, 1355-1361 (2011).

32. Seo, W.Y. et al. Celastrol induces expression of heme oxygenase-1 through

ROS/Nrf2/ARE signaling in the HaCaT cells. Biochemical and Biophysical

Research Communications 407, 535-540 (2011).

33. Kim, D.Y., Park, J.W., Jeoung, D. & Ro, J.Y. Celastrol suppresses allergen-

induced airway inflammation in a mouse allergic asthma model. European

journal of pharmacology 612, 98-105 (2009).

34. Venkatesha, S.H., Yu, H., Rajaiah, R., Tong, L. & Moudgil, K.D. Celastrus-

derived Celastrol Suppresses Autoimmune Arthritis by Modulating Antigen-

induced Cellular and Humoral Effector Responses. Journal of Biological

Chemistry 286, 15138-15146 (2011).

35. Cleren, C., Calingasan, N.Y., Chen, J. & Beal, M.F. Celastrol protects against

MPTP- and 3-nitropropionic acid-induced neurotoxicity. Journal of

Neurochemistry 94, 995-1004 (2005).

136 36. Paris, D. et al. Reduction of beta-amyloid pathology by celastrol in a transgenic

mouse model of Alzheimer's disease. Journal of neuroinflammation 7, 17 (2010).

37. Shaker, M.E., Ashamallah, S.A. & Houssen, M.E. Celastrol ameliorates murine

colitis via modulating oxidative stress, inflammatory cytokines and intestinal

homeostasis. Chemico-biological interactions 210, 26-33 (2014).

38. Karin, M. & Greten, F.R. NF-kappaB: linking inflammation and immunity to

cancer development and progression. Nature reviews. Immunology 5, 749-759

(2005).

39. Paine, A., Eiz-Vesper, B., Blasczyk, R. & Immenschuh, S. Signaling to heme

oxygenase-1 and its anti-inflammatory therapeutic potential. Biochemical

pharmacology 80, 1895-1903 (2010).

40. Talalay, P., De Long, M.J. & Prochaska, H.J. Identification of a common

chemical signal regulating the induction of enzymes that protect against chemical

carcinogenesis. Proceedings of the National Academy of Sciences of the United

States of America 85, 8261-8265 (1988).

41. Dinkova-Kostova, A.T. et al. Direct evidence that sulfhydryl groups of Keap1 are

the sensors regulating induction of phase 2 enzymes that protect against

carcinogens and oxidants. Proceedings of the National Academy of Sciences of the

United States of America 99, 11908-11913 (2002).

42. Ross, D. et al. NAD(P)H:quinone oxidoreductase 1 (NQO1): chemoprotection,

bioactivation, gene regulation and genetic polymorphisms. Chemico-biological

interactions 129, 77-97 (2000).

137 43. Wang, D., Curtis, A., Papp, A.C., Koletar, S.L. & Para, M.F. Polymorphism in

glutamate cysteine ligase catalytic subunit (GCLC) is associated with

sulfamethoxazole-induced hypersensitivity in HIV/AIDS patients. BMC medical

genomics 5, 32 (2012).

44. Deponte, M. Glutathione catalysis and the reaction mechanisms of glutathione-

dependent enzymes. Biochimica et biophysica acta 1830, 3217-3266 (2013).

45. Chelikani, P., Fita, I. & Loewen, P.C. Diversity of structures and properties

among catalases. Cellular and molecular life sciences : CMLS 61, 192-208

(2004).

46. Kannaiyan, R., Shanmugam, M.K. & Sethi, G. Molecular targets of celastrol

derived from Thunder of God Vine: Potential role in the treatment of

inflammatory disorders and cancer. Cancer Letters (New York, NY, United States)

303, 9-20 (2011).

47. Taylor, B.S. et al. Multiple NF-kappaB enhancer elements regulate cytokine

induction of the human inducible nitric oxide synthase gene. J Biol Chem 273,

15148-15156 (1998).

48. Ganster, R.W., Taylor, B.S., Shao, L. & Geller, D.A. Complex regulation of

human inducible nitric oxide synthase gene transcription by Stat 1 and NF-kappa

B. Proceedings of the National Academy of Sciences of the United States of

America 98, 8638-8643 (2001).

49. Dinkova-Kostova, A.T. et al. Extremely potent triterpenoid inducers of the phase

2 response: correlations of protection against oxidant and inflammatory stress.

138 Proceedings of the National Academy of Sciences of the United States of America

102, 4584-4589 (2005).

50. Liby, K. et al. The synthetic triterpenoids, CDDO and CDDO-imidazolide, are

potent inducers of heme oxygenase-1 and Nrf2/ARE signaling. Cancer research

65, 4789-4798 (2005).

51. Suh, N. et al. Novel triterpenoids suppress inducible nitric oxide synthase (iNOS)

and inducible cyclooxygenase (COX-2) in mouse macrophages. Cancer research

58, 717-723 (1998).

52. Khor, T.O. et al. Increased susceptibility of Nrf2 knockout mice to colitis-

associated colorectal cancer. Cancer Prev Res (Phila) 1, 187-191 (2008).

53. Osburn, W.O. et al. Increased colonic inflammatory injury and formation of

aberrant crypt foci in Nrf2-deficient mice upon dextran sulfate treatment.

International journal of cancer. Journal international du cancer 121, 1883-1891

(2007).

54. Ma, J.S., Brach, A.R. & Liu, Q. A Revision of the Genus Tripterygium

(Celastraceae). Edinburgh Journal of Botany 56, 33-46 (1999).

55. Beck, P.L. et al. Inducible nitric oxide synthase from bone marrow-derived cells

plays a critical role in regulating colonic inflammation. Gastroenterology 132,

1778-1790 (2007).

56. Rao, C.V. Nitric oxide signaling in colon cancer chemoprevention. Mutation

research 555, 107-119 (2004).

139 57. Greenhough, A. et al. The COX-2/PGE2 pathway: key roles in the hallmarks of

cancer and adaptation to the tumour microenvironment. Carcinogenesis 30, 377-

386 (2009).

58. Waldner, M.J., Foersch, S. & Neurath, M.F. Interleukin-6--a key regulator of

colorectal cancer development. International journal of biological sciences 8,

1248-1253 (2012).

59. Zhang, D.D. The Nrf2-Keap1-ARE signaling pathway: The regulation and dual

function of Nrf2 in cancer. Antioxidants & redox signaling 13, 1623-1626 (2010).

60. Ramos-Gomez, M. et al. Sensitivity to carcinogenesis is increased and

chemoprotective efficacy of enzyme inducers is lost in nrf2 transcription factor-

deficient mice. Proceedings of the National Academy of Sciences of the United

States of America 98, 3410-3415 (2001).

61. Saporito, B. The conspiracy to end cancer. Time 181, 30-36, 38 (2013).

140 Chapter 5: Future Directions and Project Summary

5.1 Validation of celastrol as chemopreventive in colitis-associated colon cancer

The data in Chapter 4 presents compelling evidence for celastrol as an anti- inflammatory and chemopreventive natural triterpenoid. The genetic mouse model involving a lineage-specific deletion of Smad4 in T cells combined with germline deletion of p27Kip1 has tremendous relevance to human cancer. As has been mentioned, germline deletions of SMAD4 are found in over 50% of patients with familial juvenile polyposis, a genetic disorder with predispositions to gastrointestinal cancer1. In addition, deregulation of p27Kip1 is also known to have major implications in multiple epithelial cancers2, 3. The cancer development in this model is characterized by inflammation of the gastrointestinal tract, leading to presentation of aggressive disease and tumorigenesis.

Other models for colitis-associated colon cancer exist, one of the most common being the carcinogen-induced azoxymethane (AOM) combined with dextran sodium sulfate (DSS) to illicit gastrointestinal tumors after single injection carcinogen and three to five cycles of DSS in water4, 5. AOM is a genotoxic colon carcinogen and DSS is toxic to the gut epithelia and affects the integrity of the mucosal barrier, resulting in ulceration and acute colitis evidenced by bloody diarrhea and weight-loss5. Since it is carcinogen-induced, it does not have as much direct relevance to human colorectal cancer, but it is an acceptable model for inflammation-driven carcinogenesis with predictable outcome. Thus, validation of the chemopreventive effect of celastrol could be confirmed in a model such as this.

A preliminary experiment for the effect of celastrol on acute inflammation utilizing AOM/DSS was undertaken prior to pursuing long-term administration. Mice

141 were treated with one seven-day cycle of 2% DSS in water after initial single administration of 10 mg/kg AOM by intraperitoneal injection. DSS treatment was followed by 8 days recovery on regular drinking water. Through the duration of the experiment, one cohort of mice was fed celastrol-supplemented diet equating to 5 mg/kg per day. This dose was increased from 2 mg/kg per day as was used in the DKO experiment. It was reasoned that a more dramatic anti-inflammatory effect might be observed by testing an increased dose. Throughout the experiment, mice were weighed every-other-day and data is shown as percent weight change in Figure 5.1A (page 143).

The weight-loss resulting from DSS treatment is evident in both the cohort treated with control diet as well as the cohort treated with celastrol-supplemented diet, however the loss is much less severe in mice on celastrol-supplemented diet. For this preliminary experiment, we also observed increased mortality in mice on control diet. It is presumed that the treatment was too rigorous for the age of mice selected. In spite of this technicality, it was encouraging to see significantly improved survival in the mice on celastrol-supplemented diet (Figure 5.1B, page 143). Upon sacrifice, there was little observable difference in colon tissues from the two separate treatments, however histological analysis showed disruption in mucosal architecture and loss of crypt structure in mice on control diet while mice on celastrol-supplemented diet showed better maintenance of mucosal architecture. Both cohorts showed similar infiltration of inflammatory cells (Figure 5.2, page 143).

142

Figure 5.1. Weight Change and Survival in Acute Inflammation Study in vivo. C57Bl6 mice were treated with single dose AOM followed by 7 days DSS administration in drinking water. After 7 additional days on regular water, mice were sacrificed. Weight change (A) and survival (B) of mice on control diet vs.

5 mg/kg celastrol per day in diet.

Figure 5.2. Histology for Acute Inflammation Study in vivo. C57Bl6 mice were treated with single dose

AOM followed by 7 days DSS administration in drinking water. After 7 additional days on regular water, mice were sacrificed. Colon cross sections stained with hematoxylin and eosin. Scale bar represents 500

μm.

143 The natural follow-up experiment to this preliminary study on acute inflammation is to perform long-term analysis of the effect of celastrol in the AOM/DSS model for colitis-associated colon cancer. At present, this experiment is under-way, testing celastrol administered in diet at both 2 and 5 mg/kg per day. From our preliminary work and recent positive evidence in the literature for celastrol in inflammatory bowel disease

(IBD)6, we anticipate that celastrol will have a marked effect on cancer development, infiltrating inflammatory cells and tumor burden in the colon. We are also very encouraged by the recently accepted manuscript in the Letterio lab which details the chemopreventive effect of CDDO-Me, a synthetic anti-inflammatory triterpenoid, in colitis-associated colon cancer as shown in a genetic model where Smad4 is conditionally deleted in T cells as well as in the AOM/DSS model for carcinogen-induced colitis- associated colon cancer7. In the follow-up experiment testing celastrol in the AOM/DSS model, there will also be opportunity to further explore the effect of celastrol on targets involved in inflammation and cancer. In both this model, as well as the DKO model, it would be most exciting to identify which cellular pathway(s) is/are being targeted for the down regulation of inflammation as observed by suppressed expression of inflammatory enzymes and cytokines.

5.2 Further exploration of the active natural triterpenoids

Identification of active metabolites in anti-inflammatory herbal extracts.

There is abundant untapped opportunity in the extract screens presented in Chapter 3 of this work. We anticipated great potential for celastrol as a chemopreventive, due to its precedence in the literature as an anti-inflammatory as well as the broad use of

144 Tripterygium wilfordii for treatment of inflammatory diseases, however, we were always encouraged by and curious about the potencies observed for B. Chinense, P. Ginseng, and

A. annua. Owing to the many known anti-inflammatory activities of multiple natural triterpenoids, the original hypothesis was that triterpenoids within these extracts would be major contributors to the observed activities. Thus, reductive analysis could be focused on identification and isolation of known or novel natural triterpenoids from these extracts. Such analysis could utilize fractionation by HPLC followed by detection by mass spectroscopy, knowing that triterpenoids would have an anticipated mass and fragmentation pattern. This type of analysis of extract composition has precedence and similar approaches have been discussed and termed “chemometric profiling” or chemical

“fingerprinting.” Such methods attempt to use a defined procedure for generating a spectrum or chromatogram for identifying the unique chemical features of a given herb8,

9. Researching such approaches could aid in designing a method for efficient identification of triterpenoids from a crude extract preparation, followed by isolation and biological evaluation. A limitation to such an approach would be the risk for inaccuracy in the presumption that triterpenoids present in an extract will unequivocally be the active components. A more controlled approach may be combined reductive analysis by bioassay-guided fractionation combined with chemometric analysis for triterpenoid content. Active components may or may not be identified to be of triterpenoid structure.

Isolation and exploration of other quinone methide triterpenoids. The appearance of the quinone methide functionality in nature has been noted in diterpenoids and triterpenoids isolated from the root portion of many plants. In biological studies, quinone methide terpenoids have often been identified to have antimicrobial and

145 antifungal activities, indicating that their purpose in plants is likely involvement in chemowarfare to protect the plant from possible infective agents within the soil10.

Celastrol is in fact only one of five identified quinone methide triterpenoids in

Tripterygium wilfordii (Figure 5.3)11. Quinone methides would be predicted to be active inducers of Nrf2 transcription due to the electrophilic Michael accepting functionality on rings A and B and predictable thiol reactivity. Celastrol is by far the most extensively studied of these triterpenoids, but others have been evaluated for anti-inflammatory, cytotoxic and insecticidal activities11 and it would be interesting to compare the potencies and chemopreventive potential of other quinone methides to celastrol.

Figure 5.3. Quinone Methide Triterpenoids in Tripterygium wilfordii.

146 5.3 Identification of Keap1 as a cellular target of celastrol

Although there is not strong evidence indicating that Nrf2 is a major target for celastrol in its chemopreventive effect in the DKO model for colitis-associated colon cancer, our in vitro data confirms induction of cytoprotective gene expression in response to celastrol to be dependent on Nrf2. Illustrating a mechanism for such activity would be a welcome addition to the field of triterpenoids and Nrf2/Keap1 signaling. The electrophilic nature of the compound points to the likelihood that celastrol up regulates these proteins and enzymes by targeting surface cysteine residues on Keap1, nonetheless, such an interaction has yet to be proven. The potency of celastrol in many in vitro and in vivo systems is presumed to be by targeting biological thiols and evidence exists for such an implication. Celastrol has been shown to inhibit IκB kinase β (IKK β) and IκB kinase

α (IKKα) activity and its suppression of NFκB activation is eliminated by mutation of

C179 in the activation loop of IKKβ12. As an inhibitor of heat shock protein 90 (HSP90), celastrol was shown to target multiple cysteine residues on co-chaperones Cdc3713 and p2314. Celastrol was also observed to modify cysteine residues in the carboxy-terminal redox center of Yap1, an oxidant defense transcription factor in yeast. By a simple preliminary experiment, we also confirmed a preference of celastrol for biological thiols over other biological nucleophiles by incubation of celastrol with amino acids cysteine, lysine and histidine, followed by evaluation of UV spectra in comparison to un-reacted celastrol UV spectra (Figure 5.4, page 148). Reaction of celastrol with cysteine results in loss of absorbance peak. Experimentally, celastrol at 12.5 μM concentration has a yellow color and the mixture becomes colorless upon addition of cysteine which suggests the loss of its chromophore, as is quantified by UV. The covalent interaction between

147 celastrol and cysteine residues on Keap1 has been hypothesized15 and uncomplicated in vitro experiments utilizing recombinant Keap1 could offer multiple methods to verify this interaction.

Figure 5.4. Monitoring Celastrol Reaction with Amino Acids by UV. 12.5 μM celastrol was reacted with 125 μM lysine, histidine or celastrol. UV absorbance was recorded and compared to unreacted celastrol.

148 5.4 Project summary and impact

The thrust of this thesis has been evaluation of anti-inflammatory natural triterpenoids as potential chemopreventives. Chapter 2 detailed the development of a protocol for gram-scale isolation of natural triterpenoid, bryonolic acid that showed potential as an anti-inflammatory and inducer of anti-oxidant activity as seen by its robust induction of Heme oxygenase-1 expression. The possibilities for bryonolic acid lie largely in its potential as a substrate for application of a form of diversity oriented synthesis utilizing the B/C ring fusion unsaturation to generate novel triterpene skeletal structures for evaluation in biological studies. Following the necessary development of a large-scale isolation of bryonolic acid, colleagues in the Tochtrop/Letterio labs, Tonibelle

Gatbonton-Schwager, Ph.D. and Vasily Ignatenko, Ph.D, worked jointly on the generation and evaluation of the semi-synthetic derivatives of bryonolic acid16-21.

Thereafter, this thesis work remained focused on the potential of the natural triterpenoids as anti-inflammatory and chemopreventive agents. Chapter 3 detailed a biological screen of multiple herbal extracts purportedly used as anti-inflammatory regimens in traditional medicine. This was designed as a stepping-stone toward identifying lead triterpenoids with natural potencies as anti-inflammatories. Many of the tested extracts had known triterpenoids and one of the more active extracts, Tripterygium wilfordii, had a known active triterpenoid, celastrol, which had shown multiple anti- inflammatory and anti-cancer activities with multiple cellular targets, but much unknown regarding cellular mechanism of action. We decided to explore the potential of celastrol as a chemopreventive. Chapter 4 details the extensive in vitro confirmation of the anti-

149 inflammatory activities of this natural quinone methide triterpenoid and exploration of

Nrf2 dependence in its up-regulation of cytoprotective protein and enzyme expression.

Sufficiently convinced of its impressive profile in vitro, celastrol was carried into an in vivo model of inflammatory carcinogenesis for examination as a chemopreventive and anti-inflammatory. The unique genetic mouse model for inflammation-driven colon carcinogenesis harbored deficiencies in two major tumor suppressors. Smad4 deficiency was restricted to T cells and p27Kip1 was deleted throughout the germline. The resulting phenotype is characterized by aggressive inflammation and tumorigenesis in the gastrointestinal tract beginning at 3 months of age. Administration of celastrol in the diets of these mice at 2 mg/kg body weight per day resulted in impressive attenuation of cancer development and down regulation of mediators of inflammation in the colon epithelia tissue and circulating serum. Preliminary results in a model for carcinogen-induced inflammation-driven colorectal cancer are also very promising in displaying a marked chemopreventive effect of celastrol.

Our work has identified one naturally potent anti-inflammatory triterpenoid showing tremendous potential as a chemopreventive. Celastrol showed effect at relatively modest doses and was well tolerated by the animals, even when administered daily in the diet for up to 19 weeks. In the field of IBD-associated colorectal cancer, new classes of agents showing potent anti-inflammatory activities and chemopreventive ability are viewed with particular favor as most compounds showing any promise in the chemoprevention of colorectal cancer have been NSAIDs which have unfavorable safety and tolerability profiles when administered chronically22. It is also exciting to identify a naturally occurring triterpenoid having potent activities without necessitating synthetic

150 optimization. A natural product chemopreventive will presumably have fewer hurdles in becoming accessible to the patient population as it could potentially be marketed as a supplement. Still, rigorous safety and tolerability trials should be performed, but in general, the public is often more receptive to a regimen taken from a natural source as opposed to a synthetic agent. As an aside – This does not eliminate the potential for celastrol in synthetic optimization which could be particularly successful as a starting material with an original potency like that of celastrol could result in optimized analogues with even higher potency than the synthetic triterpenoids derived from oleanolic acid.

Overall, this work validates the continued preclinical and ultimately clinical evaluation of celastrol as a chemopreventive, particularly in cancers where inflammation plays a central role to cancer development.

5.5 Acknowledgements

The acute inflammation study presented in this chapter would not have been possible without the help of Byung-Gyu Kim and Sung Hee Choi in the Letterio Lab. We performed the experiment jointly.

151 5.6 References

1. Kim, B.G. et al. Smad4 signalling in T cells is required for suppression of

gastrointestinal cancer. Nature 441, 1015-1019 (2006).

2. Chu, I.M., Hengst, L. & Slingerland, J.M. The Cdk inhibitor p27 in human

cancer: prognostic potential and relevance to anticancer therapy. Nature reviews.

Cancer 8, 253-267 (2008).

3. Loda, M. et al. Increased proteasome-dependent degradation of the cyclin-

dependent kinase inhibitor p27 in aggressive colorectal carcinomas. Nature

medicine 3, 231-234 (1997).

4. Thaker, A.I., Shaker, A., Rao, M.S. & Ciorba, M.A. Modeling colitis-associated

cancer with azoxymethane (AOM) and dextran sulfate sodium (DSS). Journal of

visualized experiments : JoVE (2012).

5. Wirtz, S., Neufert, C., Weigmann, B. & Neurath, M.F. Chemically induced mouse

models of intestinal inflammation. Nature protocols 2, 541-546 (2007).

6. Shaker, M.E., Ashamallah, S.A. & Houssen, M.E. Celastrol ameliorates murine

colitis via modulating oxidative stress, inflammatory cytokines and intestinal

homeostasis. Chemico-biological interactions 210, 26-33 (2014).

7. Choi, S.H. et al. CDDO-Me induces Smad-dependent expression of 15-PGDH

and suppresses inflammation-driven colon carcinogenesis. The Journal of clinical

investigation Manuscript accepted for publication (2014).

8. Mok, D.K.W. & Chau, F.-T. Chemical information of Chinese medicines: A

challenge to chemist. Chemometrics and Intelligent Laboratory Systems 82, 210-

217 (2006).

152 9. Liu, E.H., Qi, L.W., Li, K., Chu, C. & Li, P. Recent advances in quality control of

traditional Chinese medicines. Combinatorial chemistry & high throughput

screening 13, 869-884 (2010).

10. Zhou, Q. Natural Diterpene and Triterpene Quinone Methides: Structures,

Synthesis, and Biological Potentials, in Quinone Methides, Vol. 1. (ed. S.E.

Rokita) (John Wiley & Sons, Hoboken, New Jersey; 2009).

11. Brinker, A.M., Ma, J., Lipsky, P.E. & Raskin, I. Medicinal chemistry and

pharmacology of genus Tripterygium (Celastraceae). Phytochemistry 68, 732-766

(2007).

12. Lee, J.-H. et al. Inhibition of NF-κB activation through targeting IκB kinase by

celastrol, a quinone methide triterpenoid. Biochemical Pharmacology 72, 1311-

1321 (2006).

13. Sreeramulu, S., Gande Santosh, L., Gobel, M. & Schwalbe, H. Molecular

mechanism of inhibition of the human protein complex Hsp90-Cdc37, a kinome

chaperone-cochaperone, by triterpene celastrol. Angewandte Chemie

(International ed. in English) 48, 5853-5855 (2009).

14. Chadli, A. et al. Celastrol Inhibits Hsp90 Chaperoning of Steroid Receptors by

Inducing Fibrillization of the Co-chaperone p23. Journal of Biological Chemistry

285, 4224-4231 (2010).

15. Zhang, Y. et al. HSF1-Dependent Upregulation of Hsp70 by Sulfhydryl-Reactive

Inducers of the KEAP1/NRF2/ARE Pathway. Chemistry & Biology (Cambridge,

MA, United States) 18, 1355-1361 (2011).

153 16. Ignatenko, V.A. Department of Chemistry, Dissertation, Doctor of Philosophy

(Case Western Reserve University, 2013).

17. Ignatenko, V.A., Han, Y. & Tochtrop, G.P. Molecular library synthesis using

complex substrates: expanding the framework of triterpenoids. J Org Chem 78,

410-418 (2013).

18. Ignatenko, V.A. & Tochtrop, G.P. Approach for expanding triterpenoid

complexity via divergent Norrish-Yang photocyclization. J Org Chem 78, 3821-

3831 (2013).

19. Barker, E.C. & Gatbonton-Schwager, T.N. et al. Bryonolic acid: a large-scale

isolation and evaluation of heme oxygenase 1 expression in activated

macrophages. Journal of natural products 73, 1064-1068 (2010).

20. Gatbonton-Schwager, T.N., Department of Pharmacology, Dissertation, Doctor of

Philosophy (Case Western Reserve University, 2014).

21. Gatbonton-Schwager, T.N., Letterio, J.J. & Tochtrop, G.P. Bryonolic acid

transcriptional control of anti-inflammatory and antioxidant genes in macrophages

in vitro and in vivo. Journal of natural products 75, 591-598 (2012).

22. Steward, W.P. & Brown, K. Cancer chemoprevention: a rapidly evolving field.

British journal of cancer 109, 1-7 (2013).

154 Appendix

A.1 Cell viability in RAW 264.7 cells treated with celastrol: 1x105 RAW 264.7 cells were treated with increasing concentrations celastrol for 16 hours in triplicate in 96-well format and MTT assay was used to evaluate cell viability (see Section 4.4). Absorbance readings are given as average of triplicate treatments +/- SEM, normalized to blank wells.

155

A.2 Cell viability in RAW 264.7 cells treated with celastrol and LPS. 1x105 RAW

264.7 cells were treated with increasing concentrations celastrol and 5 ng/ml LPS for 16 hours in triplicate in 96-well format. Following evaluation of 100 μl media for Griess assay (Result in Figure 4.2), MTT assay was performed on remaining media (100 μl) in cells. Absorbance readings are given as average of triplicate treatments +/- SEM, normalized to blank wells.

156

A.3 Cell viability in Peritoneal Macrophages treated with celastrol. 2x105 peritoneal macrophages were treated with increasing concentrations celastrol for 24 hours in triplicate in 96-well format and MTT assay was used to evaluate cell viability.

Absorbance readings are given as average of triplicate treatments +/- SEM, normalized to blank wells.

157

A.4 Cell viability in Peritoneal Macrophages treated with celastrol and LPS. 1.5x105 peritoneal macrophages were treated with increasing concentrations celastrol and 0.5

μg/ml LPS for 22 hours in triplicate in 96-well format and MTT assay was used to evaluate cell viability. Absorbance readings are given as average of triplicate treatments

+/- SEM, normalized to blank wells.

158 A.5 Gross necropsy statistics for in vivo study in Smad4co/co;Lck-crep27Kip1-/- (DKO) mice. Necropsy was analyzed upon sacrifice. Colon morbidity refers to whether the colon was severely thickened to the point of stiffness, usually indicating presence of tumors on the epithelial surface. Chronic diarrhea was assessed by an observed compromise in ability to form stool, as seen by the absence of formed stool pellets in colon. Grossly enlarged duodenums were such as those shown in Figure 4.12 (page 118).

159 Bibliography

1. Abboud, H.E., Synthetic oleanane triterpenoids: magic bullets or not? Kidney

Int., 2013. 83(5): p. 785-787.

2. Abu-Ghefreh, A.A., H. Canatan, and C.I. Ezeamuzie, In vitro and in vivo anti-

inflammatory effects of andrographolide. Int Immunopharmacol, 2009. 9(3): p.

313-8.

3. Agyeman, A.S., et al., Transcriptomic and proteomic profiling of KEAP1

disrupted and sulforaphane-treated human breast epithelial cells reveals common

expression profiles. Breast Cancer Res Treat, 2012. 132(1): p. 175-87.

4. Akihisa, T., et al., Anti-tumor promoting effects of multiflorane-type triterpenoids

and cytotoxic activity of karounidiol against human cancer cell lines. Cancer

Letters, 2001. 173(1): p. 9-14.

5. Akiyama, K. and H. Hayashi, Arbuscular mycorrhizal fungus-promoted

accumulation of two new triterpenoids in cucumber roots. Biosci., Biotechnol.,

Biochem., 2002. 66(4): p. 762-769.

6. Albini, A. and M.B. Sporn, The tumour microenvironment as a target for

chemoprevention. Nat Rev Cancer, 2007. 7(2): p. 139-47.

7. Allison, A.C., et al., Celastrol, a potent antioxidant and anti-inflammatory drug,

as a possible treatment for Alzheimer's disease. Prog. Neuro-Psychopharmacol.

Biol. Psychiatry, 2001. 25(7): p. 1341-1357.

8. Attele, A.S., J.A. Wu, and C.S. Yuan, Ginseng pharmacology: multiple

constituents and multiple actions. Biochem Pharmacol, 1999. 58(11): p. 1685-93.

160 9. Bailar, J.C., 3rd and E.M. Smith, Progress against cancer? N Engl J Med, 1986.

314(19): p. 1226-32.

10. Balkwill, F. and L.M. Coussens, Cancer: An inflammatory link. Nature (London,

U. K.), 2004. 431(7007): p. 405-406.

11. Balkwill, F. and A. Mantovani, Inflammation and cancer: back to Virchow?

Lancet, 2001. 357(9255): p. 539-45.

12. Balunas, M.J. and A.D. Kinghorn, Drug discovery from medicinal plants. Life

Sci, 2005. 78(5): p. 431-41.

13. Barker, E.C.*, Gatbonton-Schwager, T.N.*, Han, Y., Clay, J.E., Letterio, J.J. and

Tochtrop, G.P. Bryonolic acid: a large-scale isolation and evaluation of heme

oxygenase 1 expression in activated macrophages. J Nat Prod, 2010. 73(6): p.

1064-8. (*Authors contributed equally to this work)

14. Beck, P.L., et al., Inducible nitric oxide synthase from bone marrow-derived cells

plays a critical role in regulating colonic inflammation. Gastroenterology, 2007.

132(5): p. 1778-90.

15. Biglino, G., Constituents of the root of Bryonia dioica. Ann. Chim., 1959. 49: p.

782-92.

16. Biglino, G., L. Cattel, and O. Caputo, Structure of bryonolic acid. Ricerca

Scientifica, 1969. 39(3): p. 207-9.

17. Borrello, M.G., et al., Induction of a proinflammatory program in normal human

thyrocytes by the RET/PTC1 oncogene. Proc Natl Acad Sci U S A, 2005. 102(41):

p. 14825-30.

18. Brinker, A.M., et al., Medicinal chemistry and pharmacology of genus

161 Tripterygium (Celastraceae). Phytochemistry, 2007. 68(6): p. 732-66.

19. Burke, A., E. Smyth, and G.A. FigzGerald, Chapter 26. Analgesic-Antipyretic

and Antiinflammatory Agents; Pharmacotherapy of Gout. 11 ed. Goodman &

Gilman's The Pharmacological Basis of Therapeutics, ed. L.L. Brunton, J.S. Lazo,

and K.L. Parker.

20. Calkins, M.J., et al., Protection from mitochondrial complex II inhibition in vitro

and in vivo by Nrf2-mediated transcription. Proc Natl Acad Sci U S A, 2005.

102(1): p. 244-9.

21. Capasso, L., 5300 years ago, the Ice Man used natural laxatives and antibiotics.

Lancet, 1998. 352(9143): p. 1864.

22. Chadli, A., et al., Celastrol Inhibits Hsp90 Chaperoning of Steroid Receptors by

Inducing Fibrillization of the Co-chaperone p23. J. Biol. Chem., 2010. 285(6): p.

4224-4231.

23. Chan, A.T. and E.L. Giovannucci, Primary prevention of colorectal cancer.

Gastroenterology, 2010. 138(6): p. 2029-2043 e10.

24. Chan, K., et al., NRF2, a member of the NFE2 family of transcription factors, is

not essential for murine erythropoiesis, growth, and development. Proc Natl Acad

Sci U S A, 1996. 93(24): p. 13943-8.

25. Chapelsky, S., et al., Inhibition of anthrax lethal toxin-induced cytolysis of

RAW264.7 cells by celastrol. PLoS One, 2008. 3(1): p. e1421.

26. Chelikani, P., I. Fita, and P.C. Loewen, Diversity of structures and properties

among catalases. Cell Mol Life Sci, 2004. 61(2): p. 192-208.

27. Chen, X., et al., Shikonin, a component of chinese herbal medicine, inhibits

162 chemokine receptor function and suppresses human immunodeficiency virus type

1. Antimicrob Agents Chemother, 2003. 47(9): p. 2810-6.

28. Cheung, F., Tcm Made in China. Nature, 2011. 480(7378): p. S82-S83.

29. Chin, Y.W., et al., Drug discovery from natural sources. AAPS J, 2006. 8(2): p.

E239-53.

30. Cho, H.J., et al., Formation of bryonolic acid in cucurbitaceous plants and their

cell cultures. Phytochemistry, 1992. 31(11): p. 3893-6.

31. Cho, H.Y., et al., Role of NRF2 in protection against hyperoxic lung injury in

mice. Am J Respir Cell Mol Biol, 2002. 26(2): p. 175-82.

32. Choi, S.H., et al., CDDO-Me induces Smad-dependent expression of 15-PGDH

and suppresses inflammation-driven colon carcinogenesis. J Clin Invest, 2014.

Manuscript accepted for publication.

33. Chou, T.Q. and P.F. Mei, The principle of the Chinese drug Lei-Kung-Teng,

Tripterygium wilfordii, Hook. I. The coloring subtance and the sugars. Zhongguo

Shenglixue Zazhi, 1936. 10: p. 529-534.

34. Chow, A.M. and I.R. Brown, Induction of heat shock proteins in differentiated

human and rodent neurons by celastrol. Cell Stress Chaperones, 2007. 12(3): p.

237-244.

35. Chu, I.M., L. Hengst, and J.M. Slingerland, The Cdk inhibitor p27 in human

cancer: prognostic potential and relevance to anticancer therapy. Nat Rev

Cancer, 2008. 8(4): p. 253-67.

36. Cleren, C., et al., Celastrol protects against MPTP- and 3-nitropropionic acid-

induced neurotoxicity. J. Neurochem., 2005. 94(4): p. 995-1004.

163 37. Colotta, F., et al., Cancer-related inflammation, the seventh hallmark of cancer:

links to genetic instability. Carcinogenesis, 2009. 30(7): p. 1073-81.

38. Coon, J.T. and E. Ernst, Andrographis paniculata in the treatment of upper

respiratory tract infections: a systematic review of safety and efficacy. Planta

Med, 2004. 70(4): p. 293-8.

39. Cordell, G.A. and M.D. Colvard, Natural products and traditional medicine:

turning on a paradigm. J Nat Prod, 2012. 75(3): p. 514-25.

40. Corson, T.W. and C.M. Crews, Molecular understanding and modern application

of traditional medicines: triumphs and trials. Cell, 2007. 130(5): p. 769-74.

41. Cuadrado, A. and A.I. Rojo, Heme oxygenase-1 as a therapeutic target in

neurodegenerative diseases and brain infections. Curr Pharm Des, 2008. 14(5): p.

429-42.

42. Dayal, R. and P.C. Dobhal, Tetrameles nudiflora-a new potential source of

bryonolic acid. Journal of Medicinal and Aromatic Plant Sciences, 2001. 23(4): p.

660-661.

43. Demain, A.L., Prescription for an ailing pharmaceutical industry. Nat

Biotechnol, 2002. 20(4): p. 331.

44. Denlinger, L.C., et al., Regulation of inducible nitric oxide synthase expression by

macrophage purinoreceptors and calcium. Journal of Biological Chemistry, 1996.

271(1): p. 337-42.

45. Deponte, M., Glutathione catalysis and the reaction mechanisms of glutathione-

dependent enzymes. Biochim Biophys Acta, 2013. 1830(5): p. 3217-66.

46. Dhalla, N.S., R.M. Temsah, and T. Netticadan, Role of oxidative stress in

164 cardiovascular diseases. J Hypertens, 2000. 18(6): p. 655-73.

47. Dinkova-Kostova, A.T., Chemoprotection against cancer by isothiocyanates: a

focus on the animal models and the protective mechanisms. Top Curr Chem,

2013. 329: p. 179-201.

48. Dinkova-Kostova, A.T., et al., Direct evidence that sulfhydryl groups of Keap1

are the sensors regulating induction of phase 2 enzymes that protect against

carcinogens and oxidants. Proc Natl Acad Sci U S A, 2002. 99(18): p. 11908-13.

49. Dinkova-Kostova, A.T., et al., Extremely potent triterpenoid inducers of the phase

2 response: correlations of protection against oxidant and inflammatory stress.

Proc Natl Acad Sci U S A, 2005. 102(12): p. 4584-9.

50. Dinkova-Kostova, A.T., et al., Extremely potent triterpenoid inducers of the phase

2 response: Correlations of protection against oxidant and inflammatory stress.

Proc Natl Acad Sci U S A, 2005. 102(12): p. 4584-4589.

51. Droge, W., Free radicals in the physiological control of cell function. Physiol

Rev, 2002. 82(1): p. 47-95.

52. Duffin, J., Poisoning the spindle: serendipity and discovery of the anti-tumor

properties of the Vinca alkaloids. Pharm Hist, 2002. 44(2): p. 64-76.

53. Dzubak, P., et al., Pharmacological activities of natural triterpenoids and their

therapeutic implications. Nat Prod Rep, 2006. 23(3): p. 394-411.

54. Eaton, D.L. and E.P. Gallagher, Mechanisms of aflatoxin carcinogenesis. Annu

Rev Pharmacol Toxicol, 1994. 34: p. 135-72.

55. Egner, P.A., et al., Bioavailability of Sulforaphane from two broccoli sprout

beverages: results of a short-term, cross-over clinical trial in Qidong, China.

165 Cancer Prev Res (Phila), 2011. 4(3): p. 384-95.

56. Fahey, J.W., et al., Sulforaphane inhibits extracellular, intracellular, and

antibiotic-resistant strains of Helicobacter pylori and prevents benzo[a]pyrene-

induced stomach tumors. Proc Natl Acad Sci U S A, 2002. 99(11): p. 7610-5.

57. Fahey, J.W., A.T. Zalcmann, and P. Talalay, The chemical diversity and

distribution of glucosinolates and isothiocyanates among plants. Phytochemistry,

2001. 56(1): p. 5-51.

58. Ferreira, A., et al., A central role for free heme in the pathogenesis of severe

malaria: the missing link? J Mol Med, 2008. 86(10): p. 1097-111.

59. Fink, S.P., et al., Aspirin and the risk of colorectal cancer in relation to the

expression of 15-hydroxyprostaglandin dehydrogenase (HPGD). Sci Transl Med,

2014. 6(233): p. 233re2.

60. Furst, D.E., R.W. Ulrich, and C. Varkey-Altamirano, Chapter 36. Nonsteroidal

Anti-Inflammatory Drugs, Disease-Modifying Antirheumatic Drugs, Nonopioid

Alalgesics, & Drugs Used in Gout. 11 ed. Basic & Clinical Pharmacology, ed.

B.G. Katzung.

61. Ganster, R.W., et al., Complex regulation of human inducible nitric oxide

synthase gene transcription by Stat 1 and NF-kappa B. Proc Natl Acad Sci U S A,

2001. 98(15): p. 8638-43.

62. Gatbonton-Schwager, T.N., Biological and Chemical Analysis of Small Molecule

Activators of Anti-inflammatory and Antioxidant Nrf2-Keap1 Signaling,

Department of Pharmacology, Doctoral Dissertation, 2014, Case Western

Reserve University.

166 63. Gatbonton-Schwager, T.N., J.J. Letterio, and G.P. Tochtrop, Bryonolic acid

transcriptional control of anti-inflammatory and antioxidant genes in

macrophages in vitro and in vivo. J Nat Prod, 2012. 75(4): p. 591-8.

64. Gisvold, O., The pigments contained in the bark of the root of Celastrus scandens.

Journal of the American Pharmaceutical Association, 1939. 28: p. 440-443.

65. Gisvold, O., The constitution of celastrol. II. Journal of the American

Pharmaceutical Association, 1940. 29: p. 12-14.

66. Gisvold, O., Constitution of celastrol. III. Journal of the American Pharmaceutical

Association, 1940. 29: p. 432-434.

67. Goldbach-Mansky, R., et al., Comparison of Tripterygium wilfordii Hook F

versus sulfasalazine in the treatment of rheumatoid arthritis: a randomized trial.

Ann Intern Med, 2009. 151(4): p. 229-40, W49-51.

68. Goldman, P., Herbal medicines today and the roots of modern pharmacology.

Ann Intern Med, 2001. 135(8 Pt 1): p. 594-600.

69. Gravitz, L., Chemoprevention: First line of defence. Nature, 2011. 471(7339): p.

S5-7.

70. Greenhough, A., et al., The COX-2/PGE2 pathway: key roles in the hallmarks of

cancer and adaptation to the tumour microenvironment. Carcinogenesis, 2009.

30(3): p. 377-86.

71. Greenwood, B.M., et al., Malaria: progress, perils, and prospects for eradication.

J Clin Invest, 2008. 118(4): p. 1266-76.

72. Gross, M., Combinatorial chemistry with biological help. Chemistry World, 2005.

2(5): p. 50-53.

167 73. Gueritte, F. and J. Fahy, The Vinca Alkaloids. In: Anticancer Agents from Natural

Products. 2005 ed. Anticancer Agents from Natural Products, ed. G.M. Cragg,

D.G.I. Kingston, and D.J. Newman2005, Boca Raton, FL: CRC Press LLC. 577.

74. Gupta, R.A. and R.N. Dubois, Colorectal cancer prevention and treatment by

inhibition of cyclooxygenase-2. Nat Rev Cancer, 2001. 1(1): p. 11-21.

75. Harvey, A.L., Natural products in drug discovery. Drug Discov Today, 2008.

13(19-20): p. 894-901.

76. Henderson, C.J., et al., Increased skin tumorigenesis in mice lacking pi class

glutathione S-transferases. Proc Natl Acad Sci U S A, 1998. 95(9): p. 5275-80.

77. Higashi-Okai, K., et al., Potent suppressive activity of fresh and dried peels from

Satsuma mandarin Citrus unshiu (Marcorv.) on hydroperoxide generation from

oxidized linoleic acid. Phytother Res, 2002. 16(8): p. 781-4.

78. Holton, R.A., et al., First total synthesis of taxol. 2. Completion of the C and D

rings. J. Am. Chem. Soc., 1994. 116(4): p. 1599-1600.

79. Holton, R.A., et al., First total synthesis of taxol. 1. Functionalization of the B

ring. J. Am. Chem. Soc., 1994. 116(4): p. 1597-8.

80. Honda, C., et al., Relative population of S-form and F-form conformers of

bryonolic acid and its derivatives in equilibrium in CDCl3 solutions. Chemical &

Pharmaceutical Bulletin, 2002. 50(4): p. 467-474.

81. Honda, T., et al., New enone derivatives of oleanolic acid and ursolic acid as

inhibitors of nitric oxide production in mouse macrophages. Bioorg. Med. Chem.

Lett., 1997. 7(13): p. 1623-1628.

82. Honda, T., et al., Design and synthesis of 2-cyano-3,12-dioxoolean-1,9-dien-28-

168 oic acid, a novel and highly active inhibitor of nitric oxide production in mouse

macrophages. Bioorg Med Chem Lett, 1998. 8(19): p. 2711-4.

83. Howe, J.R., et al., Mutations in the SMAD4/DPC4 gene in juvenile polyposis.

Science, 1998. 280(5366): p. 1086-8.

84. Howe, J.R., et al., Common deletion of SMAD4 in juvenile polyposis is a

mutational hotspot. Am J Hum Genet, 2002. 70(5): p. 1357-62.

85. Hsu, E., Reflections on the 'discovery' of the antimalarial qinghao. Br J Clin

Pharmacol, 2006. 61(6): p. 666-70.

86. Hu, C., et al., Modification of keap1 cysteine residues by sulforaphane. Chem Res

Toxicol, 2011. 24(4): p. 515-21.

87. Hubbs, A.F., et al., Vacuolar leukoencephalopathy with widespread astrogliosis

in mice lacking transcription factor Nrf2. Am J Pathol, 2007. 170(6): p. 2068-76.

88. Ignatenko, V.A., Molecular library synthesis using natural products: expanding

the framework of steroids and pentacyclic triterpenoids, Department of

Chemistry, Doctoral Dissertation, 2013, Case Western Reserve University.

89. Ignatenko, V.A., Y. Han, and G.P. Tochtrop, Molecular library synthesis using

complex substrates: expanding the framework of triterpenoids. Journal of Organic

Chemistry, 2013. 78(2): p. 410-8.

90. Ignatenko, V.A., Y. Han, and G.P. Tochtrop, Direct Access to 6/5/7/5-and

6/7/5/5-Fused Tetracyclic Triterpenoids via Divergent Transannular Aldol

Reaction of Lanosterol-Derived Diketone. Journal of Organic Chemistry, 2013.

78(23): p. 12229-12235.

91. Ignatenko, V.A. and G.P. Tochtrop, Approach for expanding triterpenoid

169 complexity via divergent Norrish-Yang photocyclization. Journal of Organic

Chemistry, 2013. 78(8): p. 3821-31.

92. Iida, K., et al., Nrf2 is essential for the chemopreventive efficacy of oltipraz

against urinary bladder carcinogenesis. Cancer Res, 2004. 64(18): p. 6424-31.

93. Iizuka, T., et al., Nrf2-deficient mice are highly susceptible to cigarette smoke-

induced emphysema. Genes Cells, 2005. 10(12): p. 1113-25.

94. Isaev, M.I., Isoprenoids of Bryonia. I. Pentacyclic triterpenes and sterol of

Bryonia melanocarpa. Chemistry of Natural Compounds, 1995. 31(3): p. 336-41.

95. Ishii, T., et al., Transcription factor Nrf2 coordinately regulates a group of

oxidative stress-inducible genes in macrophages. Journal of Biological

Chemistry, 2000. 275(21): p. 16023-9.

96. Itoh, K., et al., An Nrf2/small Maf heterodimer mediates the induction of phase II

detoxifying enzyme genes through antioxidant response elements. Biochem

Biophys Res Commun, 1997. 236(2): p. 313-22.

97. Itoh, K., et al., Cloning and characterization of a novel erythroid cell-derived

CNC family transcription factor heterodimerizing with the small Maf family

proteins. Mol Cell Biol, 1995. 15(8): p. 4184-93.

98. Itoh, K., J. Mimura, and M. Yamamoto, Discovery of the negative regulator of

Nrf2, Keap1: a historical overview. Antioxid Redox Signal, 2010. 13(11): p.

1665-78.

99. Itoh, K., et al., Keap1 represses nuclear activation of antioxidant responsive

elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes

Dev, 1999. 13(1): p. 76-86.

170 100. Jia, L., Y. Zhao, and X.J. Liang, Current evaluation of the millennium

phytomedicine- ginseng (II): Collected chemical entities, modern pharmacology,

and clinical applications emanated from traditional Chinese medicine. Curr Med

Chem, 2009. 16(22): p. 2924-42.

101. Jiang, Y., et al., Recent analytical approaches in quality control of traditional

Chinese medicines--a review. Anal Chim Acta, 2010. 657(1): p. 9-18.

102. Jin, H.Z., et al., Antiinflammatory Constituents of Celastrus orbiculatus Inhibit

the NF-κB Activation and NO Production. J. Nat. Prod., 2002. 65(1): p. 89-91.

103. Johnson, I.S., et al., The Vinca Alkaloids: A New Class of Oncolytic Agents.

Cancer Res, 1963. 23: p. 1390-427.

104. Jones, W.P., Y.W. Chin, and A.D. Kinghorn, The role of pharmacognosy in

modern medicine and pharmacy. Curr Drug Targets, 2006. 7(3): p. 247-64.

105. Jung, H.W., et al., Celastrol inhibits production of nitric oxide and

proinflammatory cytokines through MAPK signal transduction and NF-κB in

LPS-stimulated BV-2 microglial cells. Exp. Mol. Med., 2007. 39(6): p. 715-721.

106. Kamisako, W., et al., Changes in triterpenoid content during the growth cycle of

cultured plant cells. Plant and Cell Physiology, 1984. 25(8): p. 1571-4.

107. Kamisako, W., et al., Conformations of bryonolic acid and its derivatives in

deuterochloroform solution by proton and carbon-13 NMR spectroscopy.

Magnetic Resonance in Chemistry, 1987. 25(10): p. 848-55.

108. Kamisako, W., et al., Application of biosynthetic carbon-13 enrichment using [1-

13C]-, [2-13C]- and [1,2-13C2]-acetate as precursor for carbon-13 NMR

spectral assignment of higher plant metabolites. The assignments of some

171 bryonolic acid derivatives. Organic Magnetic Resonance, 1984. 22(2): p. 93-100.

109. Kang, M.I., et al., Scaffolding of Keap1 to the actin cytoskeleton controls the

function of Nrf2 as key regulator of cytoprotective phase 2 genes. Proc Natl Acad

Sci U S A, 2004. 101(7): p. 2046-51.

110. Kang, Y.J., Herbogenomics: from traditional Chinese medicine to novel

therapeutics. Exp Biol Med (Maywood), 2008. 233(9): p. 1059-65.

111. Kannaiyan, R., et al., Celastrol inhibits tumor cell proliferation and promotes

apoptosis through the activation of c-Jun N-terminal kinase and suppression of

PI3 K/Akt signaling pathways. Apoptosis, 2011. 16(10): p. 1028-1041.

112. Kannaiyan, R., M.K. Shanmugam, and G. Sethi, Molecular targets of celastrol

derived from Thunder of God Vine: Potential role in the treatment of

inflammatory disorders and cancer. Cancer Lett. (N. Y., NY, U. S.), 2011.

303(1): p. 9-20.

113. Karin, M., et al., NF-kappaB in cancer: from innocent bystander to major culprit.

Nat Rev Cancer, 2002. 2(4): p. 301-10.

114. Karin, M. and F.R. Greten, NF-kappaB: linking inflammation and immunity to

cancer development and progression. Nat Rev Immunol, 2005. 5(10): p. 749-59.

115. Kensler, T.W., et al., Effects of glucosinolate-rich broccoli sprouts on urinary

levels of aflatoxin-DNA adducts and phenanthrene tetraols in a randomized

clinical trial in He Zuo township, Qidong, People's Republic of China. Cancer

Epidemiol Biomarkers Prev, 2005. 14(11 Pt 1): p. 2605-13.

116. Kensler, T.W., et al., Keap1-Nrf2 signaling: a target for cancer prevention by

sulforaphane. Top. Curr. Chem., 2013. 329(Natural Products in Cancer

172 Prevention and Therapy): p. 163-178.

117. Kensler, T.W., et al., Aflatoxin: a 50-year odyssey of mechanistic and

translational toxicology. Toxicol Sci, 2011. 120 Suppl 1: p. S28-48.

118. Kensler, T.W. and N. Wakabayashi, Nrf2: friend or foe for chemoprevention?

Carcinogenesis, 2010. 31(1): p. 90-9.

119. Khallouki, F., W.E. Hull, and R.W. Owen, Characterization of a rare triterpenoid

and minor phenolic compounds in the root bark of Anisophyllea dichostyla R. Br.

Food and Chemical Toxicology, 2009. 47(8): p. 2007-2012.

120. Khor, T.O., et al., Nrf2-deficient mice have an increased susceptibility to dextran

sulfate sodium-induced colitis. Cancer Res, 2006. 66(24): p. 11580-4.

121. Khor, T.O., et al., Increased susceptibility of Nrf2 knockout mice to colitis-

associated colorectal cancer. Cancer Prev Res (Phila), 2008. 1(3): p. 187-91.

122. Kiaei, M., et al., Celastrol blocks neuronal cell death and extends life in

transgenic mouse model of amyotrophic lateral sclerosis. Neurodegener. Dis.,

2005. 2(5): p. 246-254.

123. Kim, B.G., et al., Smad4 signalling in T cells is required for suppression of

gastrointestinal cancer. Nature, 2006. 441(7096): p. 1015-9.

124. Kim, D.Y., et al., Celastrol suppresses allergen-induced airway inflammation in a

mouse allergic asthma model. Eur J Pharmacol, 2009. 612(1-3): p. 98-105.

125. Kim, K.S., et al., Anti-inflammatory effects of Radix Gentianae Macrophyllae

(Qinjiao), Rhizoma Coptidis (Huanglian) and Citri Unshiu Pericarpium

(Wenzhou migan) in animal models. Chin Med, 2008. 3: p. 10.

126. Kim, Y., et al., Celastrol binds to ERK and inhibits FcεRI signaling to exert an

173 anti-allergic effect. Eur. J. Pharmacol., 2009. 612(1-3): p. 131-142.

127. Kobayashi, M., et al., The antioxidant defense system Keap1-Nrf2 comprises a

multiple sensing mechanism for responding to a wide range of chemical

compounds. Mol Cell Biol, 2009. 29(2): p. 493-502.

128. Koehn, F.E. and G.T. Carter, The evolving role of natural products in drug

discovery. Nat Rev Drug Discov, 2005. 4(3): p. 206-20.

129. Kondo, T., et al., Cytotoxic activity of bryonolic acid isolated from transformed

hairy roots of Trichosanthes kirilowii var. japonica. Biol Pharm Bull, 1995.

18(5): p. 726-9.

130. Kongtun, S., et al., Cytotoxic properties of root extract and fruit juice of

Trichosanthes cucumerina. Planta medica, 2009. 75(8): p. 839-42.

131. Kotakadi, V.S., et al., Ginkgo biloba extract EGb 761 has anti-inflammatory

properties and ameliorates colitis in mice by driving effector T cell apoptosis.

Carcinogenesis, 2008. 29(9): p. 1799-1806.

132. Krebs, S., T.N. Omer, and B. Omer, Wormwood (Artemisia absinthium)

suppresses tumour necrosis factor alpha and accelerates healing in patients with

Crohn's disease - A controlled clinical trial. Phytomedicine, 2010. 17(5): p. 305-

9.

133. Kulkarni, A.B. and R.C. Shah, Structure of pristimerin. Nature (London, U. K.),

1954. 173: p. 1237-8.

134. Kundu, J.K. and Y.J. Surh, Molecular basis of chemoprevention by resveratrol:

NF-kappaB and AP-1 as potential targets. Mutat Res, 2004. 555(1-2): p. 65-80.

135. Kwak, M.K. and T.W. Kensler, Targeting NRF2 signaling for cancer

174 chemoprevention. Toxicol Appl Pharmacol, 2010. 244(1): p. 66-76.

136. Kwak, W.J., et al., Effects of gentianine on the production of pro-inflammatory

cytokines in male Sprague-Dawley rats treated with lipopolysaccharide (LPS).

Biol Pharm Bull, 2005. 28(4): p. 750-3.

137. Lahana, R., How many leads from HTS? Drug Discov Today, 1999. 4(10): p. 447-

448.

138. Leaf, C., Why we're losing the war on cancer (and how to win it). Fortune, 2004.

149(6): p. 76-82, 84-6, 88 passim.

139. Leaf, C., The Truth in Small Doses. Why We're Losing the War on Cancer and

How to Win it.2013, New York, NY: Simon and Schuster. 499.

140. Lee, J.-H., et al., Inhibition of NF-κB activation through targeting IκB kinase by

celastrol, a quinone methide triterpenoid. Biochem. Pharmacol., 2006. 72(10): p.

1311-1321.

141. Lee, J.H., et al., Human acyl-CoA:cholesterol acyltransferase (hACAT) inhibitory

activities of triterpenoids from roots of Glycine max (L.) merr. Bull. Korean

Chem. Soc., 2008. 29(3): p. 615-619.

142. Lee, J.H., et al., Triterpenoids from roots of Glycine max (L.) Merr. Agric. Chem.

Biotechnol. (Engl. Ed.), 2006. 49(2): p. 51-56.

143. Lewis, K., Platforms for antibiotic discovery. Nat Rev Drug Discov, 2013. 12(5):

p. 371-87.

144. Li, H., et al., Effect of tripterin on collagen-induced arthritis in rats. Zhongguo

Yaoli Xuebao, 1997. 18(3): p. 270-273.

145. Li, H., et al., Beneficial effect of tripterine on systemic lupus erythematosus

175 induced by active chromatin in BALB/c mice. Eur. J. Pharmacol., 2005. 512(2-3):

p. 231-237.

146. Li, H., et al., Therapeutic effect of tripterine on adjuvant arthritis in rats. J.

Ethnopharmacol., 2008. 118(3): p. 479-484.

147. Li, J., et al., Inhibition of NF-kappaB expression and allergen-induced airway

inflammation in a mouse allergic asthma model by andrographolide. Cell Mol

Immunol, 2009. 6(5): p. 381-5.

148. Liby, K., et al., The synthetic triterpenoids, CDDO and CDDO-imidazolide, are

potent inducers of heme oxygenase-1 and Nrf2/ARE signaling. Cancer Res, 2005.

65(11): p. 4789-98.

149. Liby, K.T. and M.B. Sporn, Synthetic oleanane triterpenoids: multifunctional

drugs with a broad range of applications for prevention and treatment of chronic

disease. Pharmacol Rev, 2012. 64(4): p. 972-1003.

150. Liby, K.T., M.M. Yore, and M.B. Sporn, Triterpenoids and rexinoids as

multifunctional agents for the prevention and treatment of cancer. Nat Rev

Cancer, 2007. 7(5): p. 357-69.

151. Liu, E.H., et al., Recent advances in quality control of traditional Chinese

medicines. Comb Chem High Throughput Screen, 2010. 13(10): p. 869-84.

152. Liu, J., Pharmacology of oleanolic acid and ursolic acid. J Ethnopharmacol,

1995. 49(2): p. 57-68.

153. Liu, J., Oleanolic acid and ursolic acid: research perspectives. J Ethnopharmacol,

2005. 100(1-2): p. 92-4.

154. Lockemann, G., Friedrich Wilhelm Serturner, the discoverer of morphine. J.

176 Chem. Educ., 1951. 28: p. 277-9.

155. Loda, M., et al., Increased proteasome-dependent degradation of the cyclin-

dependent kinase inhibitor p27 in aggressive colorectal carcinomas. Nat Med,

1997. 3(2): p. 231-4.

156. Lone, M.A., et al., Antiinflammatory and antimicrobial activity of anthraquinone

isolated from Aloe vera (Liliaceae). Asian J. Chem., 2009. 21(3): p. 1807-1811.

157. Ma, J.S., A.R. Brach, and Q. Liu, A Revision of the Genus Tripterygium

(Celastraceae). Edinburgh Journal of Botany, 1999. 56(1): p. 33-46.

158. Ma, Q., L. Battelli, and A.F. Hubbs, Multiorgan autoimmune inflammation,

enhanced lymphoproliferation, and impaired homeostasis of reactive oxygen

species in mice lacking the antioxidant-activated transcription factor Nrf2. Am J

Pathol, 2006. 168(6): p. 1960-74.

159. Mantovani, A., et al., Cancer-related inflammation. Nature, 2008. 454(7203): p.

436-44.

160. Markowitz, S.D. and M.M. Bertagnolli, Molecular origins of cancer: Molecular

basis of colorectal cancer. N Engl J Med, 2009. 361(25): p. 2449-60.

161. Markowitz, S.D., et al., Focus on colon cancer. Cancer Cell, 2002. 1(3): p. 233-6.

162. Maskrey, B.H., et al., Mechanisms of resolution of inflammation: a focus on

cardiovascular disease. Arterioscler Thromb Vasc Biol, 2011. 31(5): p. 1001-6.

163. Mehta, R.G., et al., Cancer chemoprevention by natural products: how far have

we come? Pharm Res, 2010. 27(6): p. 950-61.

164. Moi, P., et al., Isolation of NF-E2-related factor 2 (Nrf2), a NF-E2-like basic

leucine zipper transcriptional activator that binds to the tandem NF-E2/AP1

177 repeat of the beta-globin locus control region. Proc Natl Acad Sci U S A, 1994.

91(21): p. 9926-30.

165. Mok, D.K.W. and F.-T. Chau, Chemical information of Chinese medicines: A

challenge to chemist. Chemom. Intell. Lab. Syst., 2006. 82(1-2): p. 210-217.

166. Na, H.K. and Y.J. Surh, Intracellular signaling network as a prime

chemopreventive target of (-)-epigallocatechin gallate. Mol Nutr Food Res, 2006.

50(2): p. 152-9.

167. Nagase, M., et al., Apoptosis induction in HL-60 cells and inhibition of

topoisomerase II by triterpene Celastrol. Biosci., Biotechnol., Biochem., 2003.

67(9): p. 1883-1887.

168. Newman, D.J. and G.M. Cragg, Natural products as sources of new drugs over

the 30 years from 1981 to 2010. J Nat Prod, 2012. 75(3): p. 311-35.

169. Newman, D.J., G.M. Cragg, and K.M. Snader, The influence of natural products

upon drug discovery. Nat Prod Rep, 2000. 17(3): p. 215-34.

170. Ng, T.B., Pharmacological activity of sanchi ginseng (Panax notoginseng). J

Pharm Pharmacol, 2006. 58(8): p. 1007-19.

171. O'Callaghan, T., Introduction: The prevention agenda. Nature, 2011. 471(7339):

p. S2-4.

172. Oberlies, N.H. and D.J. Kroll, Camptothecin and Taxol: Historic Achievements in

Natural Products Research. J. Nat. Prod., 2004. 67(2): p. 129-135.

173. Osburn, W.O., et al., Increased colonic inflammatory injury and formation of

aberrant crypt foci in Nrf2-deficient mice upon dextran sulfate treatment. Int J

Cancer, 2007. 121(9): p. 1883-91.

178 174. Paine, A., et al., Signaling to heme oxygenase-1 and its anti-inflammatory

therapeutic potential. Biochem Pharmacol, 2010. 80(12): p. 1895-903.

175. Palli, D., et al., Diet, metabolic polymorphisms and dna adducts: the EPIC-Italy

cross-sectional study. Int J Cancer, 2000. 87(3): p. 444-51.

176. Pamplona, A., et al., Heme oxygenase-1 and carbon monoxide suppress the

pathogenesis of experimental cerebral malaria. Nat Med, 2007. 13(6): p. 703-10.

177. Paris, D., et al., Reduction of beta-amyloid pathology by celastrol in a transgenic

mouse model of Alzheimer's disease. J Neuroinflammation, 2010. 7: p. 17.

178. Paterson, I. and E.A. Anderson, Chemistry. The renaissance of natural products

as drug candidates. Science, 2005. 310(5747): p. 451-3.

179. Pearce Homer, L. and M. Alice Miller, The evolution of cancer research and drug

discovery at Lilly Research Laboratories. Adv Enzyme Regul, 2005. 45: p. 229-

55.

180. Pergola, P.E., et al., Bardoxolone methyl and kidney function in CKD with type 2

diabetes. N Engl J Med, 2011. 365(4): p. 327-36.

181. Perk, J., et al., European Guidelines on cardiovascular disease prevention in

clinical practice (version 2012). The Fifth Joint Task Force of the European

Society of Cardiology and Other Societies on Cardiovascular Disease Prevention

in Clinical Practice (constituted by representatives of nine societies and by

invited experts). Eur Heart J, 2012. 33(13): p. 1635-701.

182. Petronelli, A., G. Pannitteri, and U. Testa, Triterpenoids as new promising

anticancer drugs. Anticancer Drugs, 2009. 20(10): p. 880-92.

183. Phillips, D.R., et al., Biosynthetic diversity in plant triterpene cyclization. Curr

179 Opin Plant Biol, 2006. 9(3): p. 305-14.

184. Prestera, T., et al., Parallel induction of heme oxygenase-1 and chemoprotective

phase 2 enzymes by electrophiles and antioxidants: regulation by upstream

antioxidant-responsive elements (ARE). Mol Med, 1995. 1(7): p. 827-37.

185. Raber, L.R., Anticancer research honored at RTI. Chemical & Engineering News,

2003. 81(20): p. 58-58.

186. Ramos-Gomez, M., et al., Interactive effects of nrf2 genotype and oltipraz on

benzo[a]pyrene-DNA adducts and tumor yield in mice. Carcinogenesis, 2003.

24(3): p. 461-7.

187. Ramos-Gomez, M., et al., Sensitivity to carcinogenesis is increased and

chemoprotective efficacy of enzyme inducers is lost in nrf2 transcription factor-

deficient mice. Proc Natl Acad Sci U S A, 2001. 98(6): p. 3410-5.

188. Rao, C.V., Nitric oxide signaling in colon cancer chemoprevention. Mutat Res,

2004. 555(1-2): p. 107-19.

189. Raschke, W.C., et al., Functional macrophage cell lines transformed by Abelson

leukemia virus. Cell, 1978. 15(1): p. 261-7.

190. Reata Pharmaceuticals, I. Bardoxolone Methyl Evaluation in Patients With

Pulmonary Arterial Hypertension (PAH). 02/01/14].

191. Reddy, B.S., et al., Chemoprevention of colon cancer by specific cyclooxygenase-

2 inhibitor, celecoxib, administered during different stages of carcinogenesis.

Cancer Res, 2000. 60(2): p. 293-7.

192. Riboli, E. and T. Norat, Epidemiologic evidence of the protective effect of fruit

and vegetables on cancer risk. Am J Clin Nutr, 2003. 78(3 Suppl): p. 559S-569S.

180 193. Rizzo, A., et al., Intestinal inflammation and colorectal cancer: a double-edged

sword? World J Gastroenterol, 2011. 17(26): p. 3092-100.

194. Ross, D., et al., NAD(P)H:quinone oxidoreductase 1 (NQO1): chemoprotection,

bioactivation, gene regulation and genetic polymorphisms. Chem Biol Interact,

2000. 129(1-2): p. 77-97.

195. Rushmore, T.H., M.R. Morton, and C.B. Pickett, The antioxidant responsive

element. Activation by oxidative stress and identification of the DNA consensus

sequence required for functional activity. Journal of Biological Chemistry, 1991.

266(18): p. 11632-9.

196. Rushmore, T.H. and C.B. Pickett, Transcriptional regulation of the rat

glutathione S-transferase Ya subunit gene. Characterization of a xenobiotic-

responsive element controlling inducible expression by phenolic antioxidants.

Journal of Biological Chemistry, 1990. 265(24): p. 14648-53.

197. Salminen, A., et al., Celastrol: Molecular targets of Thunder God Vine. Biochem.

Biophys. Res. Commun., 2010. 394(3): p. 439-442.

198. Saltykova, I.A., L.G. Matyukhina, and A.G. Shavva, Bryonolic acid of the roots

of Bryonia alba. Khimiya Prirodnykh Soedinenii, 1968. 4(5): p. 324.

199. Saporito, B., The conspiracy to end cancer. Time, 2013. 181(12): p. 30-6, 38.

200. Savage, N., Early detection: Spotting the first signs. Nature, 2011. 471(7339): p.

S14-5.

201. Scannell, J.W., et al., Diagnosing the decline in pharmaceutical R&D efficiency.

Nat Rev Drug Discov, 2012. 11(3): p. 191-200.

202. Schechter, M.S. and H.L. Haller, Identity of the red pigment in the roots of

181 Tripterygium wilfordii and Celastrus scandens. J. Am. Chem. Soc., 1942. 64: p.

182-3.

203. Seixas, E., et al., Heme oxygenase-1 affords protection against noncerebral forms

of severe malaria. Proc Natl Acad Sci U S A, 2009. 106(37): p. 15837-42.

204. Seo, W.Y., et al., Celastrol induces expression of heme oxygenase-1 through

ROS/Nrf2/ARE signaling in the HaCaT cells. Biochem. Biophys. Res. Commun.,

2011. 407(3): p. 535-540.

205. Sethi, G., et al., Celastrol, a novel triterpene, potentiates TNF-induced apoptosis

and suppresses invasion of tumor cells by inhibiting NF-κB-regulated gene

products and TAK1-mediated NF-κB activation. Blood, 2007. 109(7): p. 2727-

2735.

206. Shaker, M.E., S.A. Ashamallah, and M.E. Houssen, Celastrol ameliorates murine

colitis via modulating oxidative stress, inflammatory cytokines and intestinal

homeostasis. Chem Biol Interact, 2014. 210: p. 26-33.

207. Shapiro, T.A., et al., Safety, tolerance, and metabolism of broccoli sprout

glucosinolates and isothiocyanates: a clinical phase I study. Nutr Cancer, 2006.

55(1): p. 53-62.

208. Shapiro, T.A., et al., Human metabolism and excretion of cancer chemoprotective

glucosinolates and isothiocyanates of cruciferous vegetables. Cancer Epidemiol

Biomarkers Prev, 1998. 7(12): p. 1091-100.

209. Shih, A.Y., et al., Induction of the Nrf2-driven antioxidant response confers

neuroprotection during mitochondrial stress in vivo. Journal of Biological

Chemistry, 2005. 280(24): p. 22925-36.

182 210. Sim, K.Y. and H.T. Lee, Triterpenoid and other constituents from Sandoricum

indicum. Phytochemistry, 1972. 11(11): p. 3341-3.

211. Sneader, W., The discovery of aspirin: a reappraisal. BMJ, 2000. 321(7276): p.

1591-4.

212. Spencer, S.R., C.A. Wilczak, and P. Talalay, Induction of glutathione transferases

and NAD(P)H:quinone reductase by fumaric acid derivatives in rodent cells and

tissues. Cancer Res, 1990. 50(24): p. 7871-5.

213. Sporn, M.B., Perspective: The big C - for Chemoprevention. Nature, 2011.

471(7339): p. S10-1.

214. Sporn, M.B. and K.T. Liby, Cancer chemoprevention: scientific promise, clinical

uncertainty. Nat Clin Pract Oncol, 2005. 2(10): p. 518-25.

215. Sporn, M.B. and K.T. Liby, NRF2 and cancer: the good, the bad and the

importance of context. Nat Rev Cancer, 2012. 12(8): p. 564-71.

216. Sporn, M.B. and N. Suh, Chemoprevention: an essential approach to controlling

cancer. Nat Rev Cancer, 2002. 2(7): p. 537-43.

217. Sreeramulu, S., et al., Molecular mechanism of inhibition of the human protein

complex Hsp90-Cdc37, a kinome chaperone-cochaperone, by triterpene celastrol.

Angew Chem Int Ed Engl, 2009. 48(32): p. 5853-5.

218. Steward, W.P. and K. Brown, Cancer chemoprevention: a rapidly evolving field.

Br J Cancer, 2013. 109(1): p. 1-7.

219. Suh, N., et al., Novel triterpenoids suppress inducible nitric oxide synthase

(iNOS) and inducible cyclooxygenase (COX-2) in mouse macrophages. Cancer

Res, 1998. 58(4): p. 717-23.

183 220. Suh, N., et al., A novel synthetic oleanane triterpenoid, 2-cyano-3,12-dioxoolean-

1,9-dien-28-oic acid, with potent differentiating, antiproliferative, and anti-

inflammatory activity. Cancer Res, 1999. 59(2): p. 336-41.

221. Suh, N.J., et al., A novel synthetic oleanane triterpenoid, 2-cyano-3,12-

dioxoolean-1,9-dien-28-oic acid, with potent differentiating, antiproliferative, and

anti-inflammatory activity. Cancer Res, 1999. 59(2): p. 336-341.

222. Sun, H., et al., Chronic Inhibition of Cardiac Kir2.1 and hERG Potassium

Channels by Celastrol with Dual Effects on Both Ion Conductivity and Protein

Trafficking. J. Biol. Chem., 2006. 281(9): p. 5877-5884.

223. Tabata, M., et al., Production of an anti-allergic triterpene, bryonolic acid, by

plant cell cultures. Journal of Natural Products, 1993. 56(2): p. 165-74.

224. Taguchi, K., H. Motohashi, and M. Yamamoto, Molecular mechanisms of the

Keap1-Nrf2 pathway in stress response and cancer evolution. Genes Cells, 2011.

16(2): p. 123-40.

225. Takeda, T., et al., Bryonolic acid production in hairy roots of Trichosanthes

kirilowii Max. var. japonica Kitam. transformed with Agrobacterium rhizogenes

and its cytotoxic activity. Chem. Pharm. Bull., 1994. 42(3): p. 730-2.

226. Talalay, P., M.J. De Long, and H.J. Prochaska, Identification of a common

chemical signal regulating the induction of enzymes that protect against chemical

carcinogenesis. Proc Natl Acad Sci U S A, 1988. 85(21): p. 8261-5.

227. Tanaka, S., et al., Anti-allergic effect of bryonolic acid from Luffa cylindrica cell

suspension cultures. Planta Med., 1991. 57(6): p. 527-30.

228. Taylor, B.S., et al., Multiple NF-kappaB enhancer elements regulate cytokine

184 induction of the human inducible nitric oxide synthase gene. J Biol Chem, 1998.

273(24): p. 15148-56.

229. Thaker, A.I., et al., Modeling colitis-associated cancer with azoxymethane (AOM)

and dextran sulfate sodium (DSS). J Vis Exp, 2012(67).

230. Thangapazham, R.L., A. Sharma, and R.K. Maheshwari, Multiple molecular

targets in cancer chemoprevention by curcumin. AAPS J, 2006. 8(3): p. E443-9.

231. Thimmulappa, R.K., et al., Nrf2 is a critical regulator of the innate immune

response and survival during experimental sepsis. J Clin Invest, 2006. 116(4): p.

984-95.

232. Thimmulappa, R.K., et al., Identification of Nrf2-regulated genes induced by the

chemopreventive agent sulforaphane by oligonucleotide microarray. Cancer Res,

2002. 62(18): p. 5196-203.

233. Thimmulappa, R.K., et al., Nrf2-dependent protection from LPS induced

inflammatory response and mortality by CDDO-Imidazolide. Biochem Biophys

Res Commun, 2006. 351(4): p. 883-9.

234. Tong, K.I., et al., Keap1 recruits Neh2 through binding to ETGE and DLG motifs:

characterization of the two-site molecular recognition model. Mol Cell Biol,

2006. 26(8): p. 2887-900.

235. Trott, A., et al., Activation of heat shock and antioxidant responses by the natural

product celastrol: transcriptional signatures of a thiol-targeted molecule. Mol.

Biol. Cell, 2008. 19(3): p. 1104-1112.

236. Tsang, I.K., Establishing the efficacy of traditional Chinese medicine. Nat Clin

Pract Rheumatol, 2007. 3(2): p. 60-1.

185 237. Venkatesha, S.H., et al., Celastrus-derived Celastrol Suppresses Autoimmune

Arthritis by Modulating Antigen-induced Cellular and Humoral Effector

Responses. J. Biol. Chem., 2011. 286(17): p. 15138-15146.

238. Venugopal, R. and A.K. Jaiswal, Nrf1 and Nrf2 positively and c-Fos and Fra1

negatively regulate the human antioxidant response element-mediated expression

of NAD(P)H:quinone oxidoreductase1 gene. Proc Natl Acad Sci U S A, 1996.

93(25): p. 14960-5.

239. Veronesi, U., et al., Fifteen-year results of a randomized phase III trial of

fenretinide to prevent second breast cancer. Ann Oncol, 2006. 17(7): p. 1065-71.

240. Waldner, M.J., S. Foersch, and M.F. Neurath, Interleukin-6--a key regulator of

colorectal cancer development. Int J Biol Sci, 2012. 8(9): p. 1248-53.

241. Waldner, M.J. and M.F. Neurath, Colitis-associated cancer: the role of T cells in

tumor development. Semin Immunopathol, 2009. 31(2): p. 249-56.

242. Wall, M.E., et al., Plant Antitumor Agents .I. Isolation and Structure of

Camptothecin a Novel Alkaloidal Leukemia and Tumor Inhibitor from

Camptotheca Acuminata. J. Am. Chem. Soc., 1966. 88(16): p. 3888-3890.

243. Wang, D., et al., Polymorphism in glutamate cysteine ligase catalytic subunit

(GCLC) is associated with sulfamethoxazole-induced hypersensitivity in

HIV/AIDS patients. BMC Med Genomics, 2012. 5: p. 32.

244. Wang, D. and R.N. DuBois, The role of anti-inflammatory drugs in colorectal

cancer. Annu Rev Med, 2013. 64: p. 131-44.

245. Wang, Z., et al., Beneficial effect of Bupleurum polysaccharides on autoimmune

disease induced by Campylobacter jejuni in BALB/c mice. J Ethnopharmacol,

186 2009. 124(3): p. 481-7.

246. Wani, M.C., et al., Plant Antitumor Agents .6. Isolation and Structure of Taxol, a

Novel Antileukemic and Antitumor Agent from Taxus-Brevifolia. J. Am. Chem.

Soc., 1971. 93(9): p. 2325-&.

247. Wattenberg, L.W., Inhibitors of chemical carcinogenesis. Adv Cancer Res, 1978.

26: p. 197-226.

248. Wattenberg, L.W., Chemoprevention of cancer. Cancer Res, 1985. 45(1): p. 1-8.

249. Wei, Y., C.-M. Ma, and M. Hattori, Anti-HIV protease triterpenoids from the acid

hydrolysate of Panax ginseng. Phytochem. Lett., 2009. 2(2): p. 63-66.

250. Westerheide, S.D., et al., Celastrols as Inducers of the Heat Shock Response and

Cytoprotection. J. Biol. Chem., 2004. 279(53): p. 56053-56060.

251. Wirtz, S., et al., Chemically induced mouse models of intestinal inflammation. Nat

Protoc, 2007. 2(3): p. 541-6.

252. Xu, R., G.C. Fazio, and S.P. Matsuda, On the origins of triterpenoid skeletal

diversity. Phytochemistry, 2004. 65(3): p. 261-91.

253. Xu, X., et al., Observation on serum anti-double stranded DNA antibodies of

tripterine in systematic lupus erythematosus of (NZB x W) F1 mice. Ann. Rheum.

Dis., 2003. 62(4): p. 377-378.

254. Xutian, S., et al., Comprehension of the unique characteristics of traditional

Chinese medicine. Am J Chin Med, 2012. 40(2): p. 231-44.

255. Yang, H., et al., Celastrol, a Triterpene Extracted from the Chinese "Thunder of

God Vine," Is a Potent Proteasome Inhibitor and Suppresses Human Prostate

Cancer Growth in Nude Mice. Cancer Res., 2006. 66(9): p. 4758-4765.

187 256. Yates, M.S., et al., Genetic versus chemoprotective activation of Nrf2 signaling:

overlapping yet distinct gene expression profiles between Keap1 knockout and

triterpenoid-treated mice. Carcinogenesis, 2009. 30(6): p. 1024-31.

257. Ye, L., et al., Quantitative determination of dithiocarbamates in human plasma,

serum, erythrocytes and urine: pharmacokinetics of broccoli sprout

isothiocyanates in humans. Clin Chim Acta, 2002. 316(1-2): p. 43-53.

258. Yoh, K., et al., Nrf2-deficient female mice develop lupus-like autoimmune

nephritis. Kidney Int, 2001. 60(4): p. 1343-53.

259. Yu, X., et al., Celastrol Attenuates Hypertension-Induced Inflammation and

Oxidative Stress in Vascular Smooth Muscle Cells via Induction of Heme

Oxygenase-1. Am. J. Hypertens., 2010. 23(8): p. 895-903.

260. Zhang, D.D., The Nrf2-Keap1-ARE signaling pathway: The regulation and dual

function of Nrf2 in cancer. Antioxid Redox Signal, 2010. 13(11): p. 1623-6.

261. Zhang, D.D., Bardoxolone brings Nrf2-based therapies to light. Antioxid Redox

Signal, 2013. 19(5): p. 517-8.

262. Zhang, T., et al., A novel Hsp90 inhibitor to disrupt Hsp90/Cdc37 complex

against pancreatic cancer cells. Mol. Cancer Ther., 2008. 7(1): p. 162-170.

263. Zhang, T., et al., Characterization of Celastrol to Inhibit Hsp90 and Cdc37

Interaction. J. Biol. Chem., 2009. 284(51): p. 35381-35389.

264. Zhang, Y., et al., HSF1-Dependent Upregulation of Hsp70 by Sulfhydryl-Reactive

Inducers of the KEAP1/NRF2/ARE Pathway. Chem. Biol. (Cambridge, MA, U.

S.), 2011. 18(11): p. 1355-1361.

265. Zhang, Y. and R. Munday, Dithiolethiones for cancer chemoprevention: where do

188 we stand? Molecular Cancer Therapeutics, 2008. 7(11): p. 3470-9.

266. Zhang, Y., et al., A major inducer of anticarcinogenic protective enzymes from

broccoli: isolation and elucidation of structure. Proc Natl Acad Sci U S A, 1992.

89(6): p. 2399-403.

267. Zhang, Y.-Q. and K.D. Sarge, Celastrol inhibits polyglutamine aggregation and

toxicity though induction of the heat shock response. J. Mol. Med. (Heidelberg,

Ger.), 2007. 85(12): p. 1421-1428.

268. Zhou, Q., Natural Diterpene and Triterpene Quinone Methides: Structures,

Synthesis, and Biological Potentials, in Quinone Methides, S.E. Rokita, Editor

2009, John Wiley & Sons: Hoboken, New Jersey.

189