Clinical and Genetic Spectrum of Bartter Syndrome Type 3

CLINICAL RESEARCH www.jasn.org

† †‡ ǁ Elsa Seys,* Olga Andrini, § Mathilde Keck, Lamisse Mansour-Hendili,§ †† ǁ ‡‡ ‡‡ Pierre-Yves Courand,¶** Christophe Simian, Georges Deschenes, §§ Theresa Kwon, §§ ǁǁ Aurélia Bertholet-Thomas, Guillaume Bobrie,¶¶ Jean Sébastien Borde,*** ††† ‡‡‡ ǁǁǁ Guylhène Bourdat-Michel, Stéphane Decramer, Mathilde Cailliez,§§§ Pauline Krug,§§ †††† ‡‡‡‡ Paul Cozette,¶¶¶ Jean Daniel Delbet,**** Laurence Dubourg, Dominique Chaveau, ǁǁǁǁ Marc Fila,§§§§ Noémie Jourde-Chiche, ¶¶¶¶ Bertrand Knebelmann,§§***** ††††† †††† ‡‡‡‡‡ Marie-Pierre Lavocat, Sandrine Lemoine, Djamal Djeddi, Brigitte Llanas,§§§§§ ǁǁǁǁǁ †††††† Ferielle Louillet, Elodie Merieau,¶¶¶¶¶ Maria Mileva,****** Luisa Mota-Vieira, ‡‡‡‡‡‡ ǁǁǁǁǁǁ Christiane Mousson, François Nobili,§§§§§§ Robert Novo, ††††††† Gwenaëlle Roussey-Kesler,¶¶¶¶¶¶ Isabelle Vrillon,******* Stephen B. Walsh, †‡ ‡‡‡‡‡‡‡ ǁ ‡‡‡‡‡‡‡ Jacques Teulon, Anne Blanchard,§**§§ and Rosa Vargas-Poussou §§

Due to the number of contributing authors, the afﬁliations are listed at the end of this article.

ABSTRACT Bartter syndrome type 3 is a clinically heterogeneous hereditary salt-losing tubulopathy caused by mutations of the chloride voltage-gated channel Kb gene (CLCNKB), which encodes the ClC-Kb chloride channel involved in NaCl reabsorption in the renal tubule. To study phenotype/genotype correlations, we performed genetic analyses by direct sequencing and multiplex ligation-dependent probe ampliﬁcation and retrospectively analyzed medical charts for 115 patients with CLCNKB mutations. Functional analyses were performed in Xenopus laevis oocytes for eight missense and two nonsense mutations. We detected 60 mutations, including 27 previously unreported mutations. Among patients, 29.5% had a phenotype of ante/neonatal Bartter syndrome (polyhydramnios or diagnosis in the ﬁrst month of life), 44.5% had classic Bartter syndrome (diagnosis during childhood, hypercalciuria, and/or polyuria), and 26.0% had Gitelman-like syndrome (fortuitous discovery of hypokalemia with hypomagnesemia and/or hypocalciuria in childhood or adulthood). Nine of the ten mutations expressed in vitro decreased or abolished chloride conductance. Severe (large deletions, frameshift, nonsense, and essential splicing) and missense mutations resulting in poor residual conductance were associated with younger age at diagnosis. Electrolyte supplements and indomethacin were used frequently to induce catch-up growth, with few adverse effects. After a median follow-up of 8 (range, 1–41) years in 77 patients, chronic renal failure was detected in 19 patients (25%): one required hemodialysis and four underwent renal transplant. In summary, we report a genotype/phenotype correlation for Bartter syn- drometype3:completeloss-of-functionmutationsassociated with younger age at diagnosis, and CKD was observed in all phenotypes.

J Am Soc Nephrol 28: 2540–2552, 2017. doi: https://doi.org/10.1681/ASN.2016101057

Received October 3, 2016. Accepted February 27, 2017. Correspondence: Dr. Rosa Vargas-Poussou, Hôpital Européen George Pompidou, INSERM, UMR970, Paris-Cardiovascular Research Center, E.S. and O.A. contributed equally to this work. 20-40 rue Leblanc, 75015 Paris, France. Email: [email protected]

2540 ISSN : 1046-6673/2808-2540 JAmSocNephrol28: 2540–2552, 2017 www.jasn.org CLINICAL RESEARCH

Bartter syndromes (BS) and Gitelman syndrome (GS) are au- RESULTS tosomal recessive salt-losing tubulopathies caused by defective salt reabsorption. They are characterized by hypokalemia, met- Population abolic alkalosis, and secondary aldosteronism, with normal or We retrospectively analyzed results for 115 patients (56 men low BP.1,2 BS are classiﬁed by phenotype (antenatal or classic) and 59 women) from 111 families with CLCNKB mutations or genotype (types 1–5). Antenatal BS (ABS) is the most severe evaluated at the Genetics Department of Georges Pompidou form, characterized by polyhydramnios, premature birth, life- European Hospital over the last 15 years. A history of consan- threatening episodes of neonatal salt and water loss, hyper- guinity was recorded for 22 families; the geographic origin is calciuria, and early-onset nephrocalcinosis.3 Classic BS (CBS) shown in Supplemental Tables 1–3. occurs in infancy or early childhood and is characterized by marked salt wasting and hypokalemia, leading to polyuria, Initial Clinical Presentation polydipsia, volume contraction, muscle weakness, growth re- Thirty-four patients from 32 families (29.5%) presented with tardation and, sometimes, nephrocalcinosis.4 BS types 1, 2, ABS/NBS, 51 patients from 49 families (44.5%) presented and 3 are caused by mutations of genes expressed in the thick with CBS, and 30 patients from 30 families (26%) presented ascending limb (TAL) of the loop of Henle encoding the lu- with GLS. 2 minal Na+–K+–2Cl cotransporter (SLC12A1; OMIM #601678), the luminal K+ channel ROMK (KCNJ1;OMIM Mutations and Large Rearrangements #241200), and the basolateral chloride channel ClC-Kb Genetic status and mutation type were determined for each (CLCNKB; OMIM #607364), respectively.5–7 Loss-of- initial phenotype group (Table 1). The detailed genotypes of function mutations of BSND encoding barttin, an essential each patient are summarized in Supplemental Tables 1–3. The b subunit for chloride channels, cause BS type 4a with deletion of a single allele was excluded in patients with homo- sensorineural deafness (OMIM #602522).8 Simultaneous zygous point mutations and no consanguinity, and molecular mutations of CLCNKB and CLCNKA cause type 4b BS abnormalities of the other genes implicated in GS and BS were (OMIM #613090).9 Finally, severe gain-of-function muta- excluded in patients with only one heterozygous mutation. tions of the extracellular Ca2+-sensing receptor gene can The breakpoints of large rearrangements were not character- result in a Bartter-like syndrome (BS type 5, OMIM ized; in consequence, we cannot exclude the possibility that #601199).10,11 GS (OMIM #263800) is a milder disease fre- patients with homozygous deletions from nonconsanguine- quently associated with hypomagnesemia and hypocalciuria. ous families harbored two different deletions. Testing was car- GS is often asymptomatic or associated with mild symptoms, ried out for both parents in 22 families and only the mother in such as muscle weakness, salt craving, paresthesia, and tetany. seven families. In all cases, parents were heterozygous for GS is related to loss-of-function mutations of the SLC12A3 the homozygous mutation detected in the proband or for gene encoding the apically expressed thiazide-sensitive NaCl one of the two mutations detected in compound heterozygous cotransporter of the distal convoluted tubule (DCT).12 probands. The ﬁrst described patients with BS type 3 had a clinical Sixtydifferent mutations were detected: 55% missense, 13% phenotype corresponding to CBS.7 Considerable phenotypic frameshift, 12% nonsense, 10% large deletions, and 10% variability has since been described: CLCNKB mutations can splice-site mutations (Figure 1). Twenty-seven of these muta- also underlie the ABS, neonatal BS (NBS), and Gitelman-like tions were previously unknown (Figure 2, A and B, Supple- (GLS) phenotypes.13–15 This study aimed to shed light on the mental Tables 1–3).Twoofthethreesplice-sitemutations phenotypic heterogeneity of BS type 3 by investigating phe- disrupt the obligatory consensus donor or acceptor splice notype/genotype correlations in a very large French cohort, site and were considered pathogenic as likely to cause and by evaluation of published results and original data for exon skipping and frameshift. The variant at position 26 in vitro expression. intheacceptorsiteofexon14isaknownrarevariant

Table 1. Genetic status of patients according to initial phenotype, and percentages of mutated alleles by phenotype and mutation type Genetic Status, No. of Patients (%) Type Of Mutation: No. (%) of Mutated Alleles (N=216) Phenotype Compound Only One Heterozygous Large Splice-Site Frameshift/Nonsense Missense Homozygous Heterozygous Mutation Deletions Mutations Mutation Mutations ABS/NBS 22 (65) 10 (29) 2 (6)a 37 (56) 7 (11) 5 (7) 17 (26) CBS 20 (39) 27 (53) 4 (8)b 37 (38) 6 (6) 22 (22) 33 (34) GLS 14 (47) 8 (27) 8 (27)b 12 (23) 0 10 (19) 30 (58) ALL 56 (49) 45 (39) 14 (12) 86 (40) 13 (6) 37 (17) 80 (37) aMutations in SLC12A1, KCNJ1,andBSND were excluded. bMutations in SLC12A3 were excluded.

J Am Soc Nephrol 28: 2540–2552, 2017 Bartter Syndrome Type 3: Clinical and Genetics 2541 CLINICAL RESEARCH www.jasn.org

allele as the known mutation p.Pro124Leu in three patients (BR116–1, BR157–1, and GT657–1). Eight of the 13 missense variations affected conserved amino acids and were predicted by at least four out of five tools used for in silico analysis as potentially pathogenic. The remaining five missense changes (p.Ser218Asn, p.Ala254Val, p.Arg395Trp, p.Ile447Thr, and p.Ala469Pro) were classed as variations of unknown signifi- cance (VOUS) (Supplemental Table 4). Among these changes, Figure 1. Type of mutations of CLCNKB detected in patients only the p.Arg395Trp has been described in databases with BS type 3 (n=60). (rs34255952) with an allelic frequency of 2% in blacks and has not been detected in whites. Of the 33 missense mutations detected in our population, 13 were previously shown to result (rs369329893, allele frequency in black populations of 0.02%) in loss of function.16 In silico predictions are presented in Sup- for which MaxEntScan predicts a 100% decrease in splice-site plemental Table 5 for missense mutations for which in vitro score and SpliceSiteFinder predicts activation of an intronic analysis was not performed. cryptic acceptor site. Unfortunately, no mRNA from this patient was available for analysis. Functional Expression of ClC-Kb Mutants in Xenopus Two of the 13 previously unreported missense mutations Oocytes were present in the same allele in patient BR050 (p.Arg395Trp We investigated the effect of two new missense mutations pre- and p.Ala469Pro), and p.Gly465Arg was detected in the same dictedtobepathogenic(p.Gly345Ser and p.Ala510Thr), two new

Figure 2. Locations of novel CLCNKB mutations and of mutations expressed in vitro. (A) CLCNKB gene structure, showing the newly discovered large deletions and splicing mutations. (B) Schematic topological model of the ClC-Kb protein: the lower part of the model corresponds to the intracellular region, and the upper part is extracellular. Each rectangle represents one of the 18 a-helices and the two cystathionine-b-synthase (CBS) domains. The a-helices involved in the selectivity ﬁlter, those interacting with Barttin, and those located at the dimer interface are shown in blue, green, and pink, respectively. Previously unknown missense ( ) and nonsense ( ) mutations are shown in red; previously described mutations are shown in blue ( ); mutations expressed in vitro are underlined.

2542 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 2540–2552, 2017 www.jasn.org CLINICAL RESEARCH

VOUS (p.Arg395Trp and p.Ala469Pro), four previously By contrast, p.Ala510Thr had no influence on channel conduc- described missense mutations (p.Gly296Asp, p.Ser297Arg, tance. Finally, the p.Arg395Trp/p.Ala469Pro double mutation de- p.Gly424Arg, and p.Gly433Glu) and two nonsense mutations creased conductance to 37% of wild-type values. (p.Trp391Ter and p.Arg595Ter) on chloride conductance in Xenopus oocytes; p.Gly424Arg and p.Gly433Glu are located Clinical Data at Diagnosis in a-helix N of ClC-Kb, which is involved in the selectivity filter; Table 2 summarizes clinical and biochemical characteristics at p.Gly296Asp and p.Ser297Arg are located in the a-helix J, which birth and at diagnosis. As expected, gestational age (GA) at interacts with barttin; p.Ala510Thr is found in the a-helix Q, birth was significantly lower in the ABS/NBS group than in the involved in the dimer interface; and Arg595Ter is present in CBS and GLS groups, but similar between the CBS and GLS the CBS1 domain involved in channel common gating and traf- groups. Age at diagnosis was significantly lower in the ABS/ ficking. The p.Gly345Ser and p.Ala469Pro mutations affect NBS group than in the other two groups and in the CBS group a-helices K and O, respectively, and the p.Trp391Ter and than in the GLS group. Polyhydramnios was found in 29 pa- p.Arg395Trp mutants affect the L-M linker (Figure 2B). Nine tients with ABS/NBS (85%), at mean GA of 28 weeks, and of these ten mutations significantly decreased or abolished nor- amniotic fluid had to be drained in four patients. Ten patients malized conductance (Figure 3). The p.Trp391Ter, p.Gly296Asp, (five ABS/NBS and five CBS) had birth weights below the 10th p.Gly424Arg, p.Gly433Glu, p.Ala469Pro, and p.Arg595Ter muta- percentile, and four patients (two ABS/NBS and two CBS) had tions abolished conductance, whereas p.Ser297Arg, p.Gly345Ser, birth heights below the 10th percentile for GA at birth. and p.Arg395Trp decreased conductance to 61%, 57%, and 65% Plasma sodium and chloride concentrations were signifi- of wild-type values, respectively (significantly different from cantly lower and plasma renin and magnesium concentrations oocytes expressing wild-type ClC-Kb and noninjected oocytes). were significantly higher in CBS and ABS/NBS groups than in the GLS group; plasma potassium and total CO2 concentrations were similar in all groups. Strong hypochloremia is a known phenotypic hallmark of BS type 3.17–19 We therefore compared the relationship between plasma sodium and chloride concentrations between patients with BS types 1and2(n=21) and patients with BS type 3 (n=51). This curve was shifted downward in the BS type 3 group, indicating that plasma chloride depletion could not be ac- counted for by hyponatremia (Figure 4). No difference was observed in parameters at diagnosis when confirmed homozygous patients are compared with compound heterozygous patients (data not shown).

Clinical and Biologic Data during Follow-Up Clinical manifestations during follow-up and treatment were recorded for 77 patients (Table 3). Median follow-up was 8 years and was similar in the three groups. The Figure 3. Functional studies of selected ClC-Kb mutants (n=10). Conductance at +60 mV main treatments administered to these pa- for noninjected oocytes (NI) and for oocytes into which mutant ClC-Kb cRNA was tients were NaCl and KCl supplementation injected, normalized with respect to the mean value for wild-type (WT) ClC-Kb and and nonsteroidal anti-inﬂammatory drugs expressed as the mean6SEM. The mutants were exposed to a solution at pH 7.4 (mainly indomethacin). The main adverse containing 10 mM Ca2+ (A) or to a solution at pH 9.0 containing 20 mM Ca2+ (B). As n 2+ effects were abdominal pain ( =5), weight ClC-Kb current increases at high external Ca concentration or high pH, these so- gain (n=1), esophagitis (n=1), and diar- lutions were chosen to obtain a submaximal current. Number of measurements for rhea (n=1). One of the main criteria of a (A): NI (n=63), WT (n=109), p.Trp391Ter (n=12), p.Arg395Trp (n=16), p.Arg395Trp/p. Ala469Pro (n=20), p.Gly424Arg (n=16), and p.Ala469Pro (n=10). Number of mea- successful treatment is a normal growth; in surements for (B): NI (n=9), WT (n=16), p.Gly122Val (n=6), p.Gly296Asp (n=5), this cohort, 63 out of 77 patients (82%) p.Ser297arg (n=7), p.Gly345Ser (n=8), p.Gly433Glu (n=8), p.Ala510Thr (n=8), and had a height between 22SDand+1SD p.Arg595Ter (n=3). $P,0.05 for the difference between NI or mutant ClC-Kb and or a normal height as adults. Fourteen pa- WT; *P,0.05 for the difference between WT or mutant ClC-Kb and NI. tients had height below 22SD:ﬁve

J Am Soc Nephrol 28: 2540–2552, 2017 Bartter Syndrome Type 3: Clinical and Genetics 2543 2544 LNCLRESEARCH CLINICAL ora fteAeia oit fNephrology of Society American the of Journal www.jasn.org

Table 2. Clinical and biologic manifestations at diagnosis P Value Variable ABS/NBS (n=34) CBS (n=51) GLS (n=30) ABS/NBS ABS/NBS CBS All versus CBS versus GLS versus GLS Age at diagnosis, yr 0.1 (0.02–0.66) 1 (0.4–9.6)5 28 (18–42)2 ,0.001 ,0.001 ,0.001 ,0.001 GA at birth, wk 37 (36–40)6 40 (39–40)16 40 (40–40)12 0.001 0.002 0.001 ns GA at onset of polyhydramnios, wk 28.25 (22–33)22 Weight at birth, g 2790 (2470–3380)8 3200 (2850–3500)23 3100(2960–3335)27 nd ——— Plasma concentrations Sodium, 133–146 mmol/L 134 (131–136)12 133 (127–137)24 138 (136–140)17 nd ——— Potassium, 3.5–5 mmol/L 2.7 (2.4–3.1)5 2.6 (2.3–2.9)15 2.8 (2.5–3.0)5 0.21 ——— Chloride, 90–117 mmol/L 87 (82–95)11 87 (74–95)24 97 (94–99)12 0.002 ns 0.001 0.003 9 18 12 CO2t, 18–25 mmol/L 33 (28–37) 32 (28–36) 31 (30–33) 0.53 ——— Calcium, 2.2–2.6 mmol/L 2.67 (2.49–2.80)12 2.54 (2.38–2.64)25 2.39 (2.32–2.52)13 0.001 ns 0.001 0.01 Magnesium, 0.75–1 mmol/L 0.95 (0.87–1.00)17 0.91 (0.76–1.00)22 0.77 (0.69–0.81)14 0.001 ns 0.001 ns Renin, times the normal upper limit for age 11 (6–26)16 3(1–15)26 1(0–3)14 0.001 ns ,0.001 0.02 Aldosterone, times the normal upper limit 0.4 (0.3–2.0)15 2.0 (0.8–2.5)30 0.6 (0.2–1.3)16 nd ——— Urinary calcium-to-creatinine ratio, Z value 1.23 (0.27–2.13)13 0.70 (0.11–1.45)31 20.37 (22.77–0.62)21 nd Nephrocalcinosis, % 29.4 14 3 0.01 0.1 0.01 0.25 Main symptoms, % Failure-to-thrive 47 24 13 0.01 0.04 0.004 0.19 Polyuria 56 42 23 0.03 0.25 0.01 0.07 Asthenia/cramps 0 2 20 0.02 0.41 0.04 0.06 Fortuitous discovery of hypokalemia 0 0 40 ,0.001 1 ,0.001 ,0.001 mScNephrol Soc Am J Values are expressed as medians and interquartile intervals. Superscript values correspond to the number of missing data. Calcium-to-creatinine ratio is expressed as a Z value relative to the normal values for age; hypercalciuria is deﬁned by a Z value .2. nd, not done, .50% of the data missing in one or more groups; —, not done; CO2t, total carbon dioxide. 28: 2540 – 52 2017 2552, www.jasn.org CLINICAL RESEARCH

Abnormalities in psychomotor and neurologic development included psychomotor retardation in four patients with ABS/NBS and four patients with CBS (Table 3). Five patients with CBS required psychiatric follow-up (hyperactiv- ity, anorexia, or eating disorders). Irregular heart rate or ECG abnormalities were documented in six patients: one patient with ABS/NBS had premature ven- tricular beats with prolonged QT interval, three patients with CBS had a right bundle branch block or U wave, and one patients with GLS presented with torsade de pointe attacks. None of the patients in this cohort had high BP. Fourteen patients developed nephrolithiasis or nephrocalcinosis during follow-up. None of the patients required shock- wave lithotripsy. Other renal and urological abnormalities diagnosed in eight patients with ABS/NBS and nine patients with CBS are detailed in Table 3. Proteinuria data were available for 43 patients, nine of whom displayed glomerular proteinuria .50 mg/dl. Figure 4. Correlation between plasma sodium and plasma chloride Nineteen (ten women and nine men) of the 77 patients (25%) concentrations in patients with BS type 1 and 2 (black symbols, gray presented with CKD (Table 4). Ten patients presented with stage area) and in patients with BS type 3 (white symbols, orange area). 2 CKD: four patients with ABS/NBS, four patients with CBS, and two patients with GLS. Two patients reached stage 3 CKD (one patients with ABS/NBS, including one with a growth hormone patient with ABS/NBS and one patient with GLS). One patient (GH) deficiency (IGF1=38 ng/ml before GH initiation at 15 years with CBS reached stage 4 CKD. Six patients reached stage 5 CKD of age); eight patients with CBS, including two with GH de- (three patients with ABS/NBS and three patients with CBS), at a ficiency and two with CKD; and one patient with GLS with no mean age of 25 (6–49) years. Renal biopsies were performed in identified cause of failure-to-thrive. five out of 19 patients with CKD. Four patients with stage 5 CKD

Table 3. Associated clinical manifestations and treatment during follow-up, for 77 patients with CLCNKB mutations Variable ABS/NBS (n=26) CBS (n=35) GLS (n=16) Follow-up duration, median (range) 7.5 (1–36) 8 (1–41) 8 (1–28.5) Growth retardation (below 22 SD) 5 8 1 Neurologic Psychomotor retardation 4 4 — Psychiatric follow-up — 5 — Speech therapy 3 4 — Neurologic follow-up 2 2 1 Renal abnormalities Renal hypoplasia 2 —— Hyperechogenic kidney 2 4 — Cyst 2 3 — Urological abnormalities Hydroureteronephrosis 1 1 — Vesico-ureteral reﬂux — 1 — Anterior urethral valves 1 —— Proteinuria$50 mg/dl 4/17 4/17 1/8 Nephrolithiasis 2 5 — Nephrocalcinosisa 34— Cardiovascular manifestations irregular heart rate or 131 ECG abnormalities (details in the text) Treatment Continuous enteral nutrition 7 4 — NaCl supplementation 21 17 — KCl supplementation 24 27 6 —, None; ECG, Electrocardiogram; NaCl, Sodium Chloride; KCl, Potassium Chloride. aDetected during follow-up and reported in the medical chart.

J Am Soc Nephrol 28: 2540–2552, 2017 Bartter Syndrome Type 3: Clinical and Genetics 2545 2546 LNCLRESEARCH CLINICAL ora fteAeia oit fNephrology of Society American the of Journal

Table 4. Clinical characteristics of patients with BS type 3 and CKD Mutations Weight at Age at Age at eGFR,a ml/min Renal Biopsy Phenotype Sex PU NC (yr) Other (yr) Indomethacin (yr) Class Birth, kg Diagnosis Last Control per 1.73 m2 (age, yr) www.jasn.org CKD stage 2 ABS/NBS CL/PL F 3.13 2 yr 7.5 76 ND Yes (2) Hydroureteronephrosis, AP Yes (1.5) No ABS/NBS CL/CL F 2.86 1 17 85 Yes, ,2 g/L No Cortical cyst Yes (16) Yes (2) ABS/NBS CL/CL F 1.90 2 mo 11 65 No No No Yes (12) No ABS/NBS CL/CL M ND 1 mo 42 69 ND No Yes (ND) No CBS CL/CL F ND 7 yr 16 80 ND b Hypercalciuria, bone No No demineralization CBS PL/CL M ND 2 mo 33 81 Yes (26) Yes (30) No CBS CL/CL M 3.2 5 mo 6 82 No No No Yes (3) No GLS PL/PL F ND 43 yr 56 76 No No No No GLS ?/? M ND 46 yr 48 79 No ND No Yes (5) No GLS CL/CL F ND 30 yr 50 75 No No Psychiatric disorder No No CKD stage 3 ABS/NBS CL/CL M 3.45 0.019 19 45 Yes, .2 g/L No Osteopenia Yes (4) No GLS CL/CL F ND 30 39 31 No No Renal cysts No CKD stage 4 CBS CL/CL M 3.2 0.16 20 27 ND No Yes (15) No CKD stage 5 ABS/NBS CL/CL M 2.76 0.03 6.5 12 Yes, ,2 g/L No Griscelli syndrome + renal Yes (5) Bilateral hypoplasia nephrectomy transplantation (6.5) ABS/NBS ?/? F 3.45 0.25 26 ESRD at 23.4 Yes, .2 g/L No Hyperuricemia Yes (5.5) Yes (23) transplantation (26) ABS/NBS ?/? M ND 0.33 24 ESRD at 24 Yes, ,2 g/L Yes Maternal alcohol abuse, Yes (10) Yes (28) neonatal seizures

mScNephrol Soc Am J CBS PL/PL F ND 0.5 16 ESRD at 12 ND Yes Transplantation (13) Yes (ND) No CBS PL/PL M ND 8 49 13 Yes, .2 g/L Yes (41) Nephrolithiasis Yes (2) Yes (41) CBS CL/CL F 3.5 0.16 29 ESRD at 28 Yes, .2 g/L b Transplantation (29) Yes (ND) Yes (27.3) CL: large deletions, truncating (unless carboxy-terminal), essential splicing, missense nonconducting, and mutants with residual currents ,20%. PL: missense mutants with residual currents .21%. Detailed results of renal biopsies are described in Supplemental Table 6. PU, proteinuria; NC, nephrocalcinosis; F, female; ND, not done; AP, acute pyelonephritis; M, male; ?/?, Unknown; ESRD (end-stage renal disease). aeGFR was estimated from plasma creatinine using the Schwartz 2009 formula until 18 yr and the Modification of Diet in Renal Disease Study equation after this age. 28: bHyperechogenicity. 2540 – 52 2017 2552, www.jasn.org CLINICAL RESEARCH had diffuse glomerular and tubulointerstitial lesions with en- of clinical presentation, accounting for the diverse initial di- larged glomeruli presenting with FSGS. One patient with stage agnoses attributed (ABS/NBS, CBS, or GLS). We investigated 2 CKD had minimal glomerular and tubular alterations (Sup- the basis of this variability in a cohort of 115 patients harbor- plemental Table 6, Table 4). Patients with CKD were older than ing CLCNKB mutations, and studied the phenotype/genotype patients without CKD; they did not differ in terms of birth correlation on the basis of clinical presentation and follow-up weight, AINS treatment, urologic or renal abnormalities, or as well as on in vitro functional studies of missense mutants. hypokalemia severity (Table 5). More than 54 mutations of this gene have been reported in The last eGFR follow-up data for 30 patients with BS type 1, free access HGMD (www.hgmd.cf.ac.uk) and scientificpubli- 34 patients with BS type 2, and 11 patients with BS type 4a were cations.4,7,17,19,21–25 They include a high frequency of large compared with eGFR for the 77 patients with BS type 3. These rearrangements favored by the close location of the homolo- groups had similar age distribution, and eGFR decreased with gous CLCNKA. We detected 60 different mutations, 27 of age (Supplemental Figure 1). In patients with BS type 1 and BS which had not been previously reported (13 missense, five type 4, eGFR decrease was more severe and there were higher frameshift, three nonsense, three splice-site mutations, and proportions of patients with CKD 3–5 than in patients with BS three large deletions). Thirteen of these mutations (frameshift, type 2 and BS type 3 (Supplemental Figures 1 and 2). nonsense, splice-site mutations, and large deletions) were predicted to result in the production of unstable mRNAs or Genotype/Phenotype Correlation truncated or absent proteins. Eight of the 13 previously Large deletions were more frequent in patients with earlier unknown missense mutations were predicted to be pathogenic onset, and severe phenotypes and missense mutations were in silico (Supplemental Table 4). Three out of the other five, more common in the GLS phenotype (Table 1). Similar results classified as VOUS, were expressed in Xenopus laevis oocytes were obtained if other potentially severe mutations (frame- (p.Arg395Trp, p.Ala469Pro, and p.Gly345Ser) as were two pre- shift, nonsense, and essential splicing) were considered with viously described mutations (p.Gly424Arg and p.Gly433Glu) large deletions: severe mutated alleles were more frequent in detected as the only heterozygous mutation in two patients. patients with ABS/NBS and CBS (74 and 66% respectively) All of these mutations significantly decreased chloride conduc- than in patients with GLS (42%). Further, missense mutations tance. The p.Ala510Thr, predicted in silico as pathogenic, had a were more frequent in patients with less severe phenotypes: chloride conductance similar to that of the wild-type channel. 58% in patients with GLS versus 34% and 26% in patients with The molecular abnormality of patient heterozygous for this CBS and ABS/NBS, respectively. variant thus remains unidentified. We classified mutations into two groups: complete loss-of- In this large BS type 3 cohort, we confirmed the phenotypic function (CL) and partial loss-of-function (PL) groups (Table 6). variability, consisting of about 30% ABS/NBS, 45% CBS, and We included p.Trp610Ter, the only C-terminus–truncating 25% GLS (Table 2). In order to determine if the type of mu- mutation expressed in vitro and yielding a residual current.20 tation influences the phenotype, we first correlated them with Each mutated allele was classified separately, independently of initial clinical presentation. Large deletions and severe muta- the initial phenotype, and only patients for whom both alleles tions were associated with all clinical presentations, but were could be classified were analyzed (n=85) (Supplemental Tables more frequent in ABS/NBS and CBS. Next, 85 patients with 1–3). ClC-Kb functions as a homodimer. The residual activity two mutated alleles were analyzed for phenotype/genotype of the CL/PL genotypes may therefore correspond to homo- correlations, taking into account the type of mutation and in dimersofPLmutants,withsimilarconsequencestothePL/PL vitro expression results, regardless of initial clinical presenta- genotype. We therefore analyzed the CL/PL genotype together tion. Patients with complete loss-of-function (CL/CL) were with the PL/PL genotype. With this classification, 56 patients significantly younger at diagnosis than patients harboring hadaCL/CLgenotype,and29patientshadaCL/PLorPL/PL one or two alleles with a partial loss-of-function (CL/PL or genotype. CL/CL genotypes were associated with a signifi- PL/PL), suggesting that the type of mutation may influence the cantly younger age at diagnosis than CL/PL and PL/PL geno- clinical presentation of BS type 3. types. No difference was observed for the other biologic Surprisingly, the milder GLS phenotype did occur in pa- parameters analyzed (Table 6). tients harboring severe mutations or deletions, suggesting that the phenotype severity is not only driven by CLCNKB allelic variability. Phenotypic heterogeneity of BS type 3 has been DISCUSSION attributed to distribution of the ClC-Kb channel along the nephron and to possible compensatory function of the ClC- BS are phenotypically and genotypically heterogeneous. Phe- Ka channel. ClC-Kb channel is expressed in the TAL, DCT, 2 notype/genotype correlations highlighting the link between and collecting duct, where it transfers chloride (Cl )ionsto particular traits and genetic types (i.e., transitory hyperkale- the basolateral side.26 Impaired ClC-Kb function in the TAL 2 mia in BS type 2, severe hypochloremia in BS type 3, and results in lower levels of Cl exit, NaCl reabsorption through hearing loss in BS type 4) have been identified in previous the Na-K-2Cl cotransporter, and divalent cation reabsorption, studies.17–19 BS type 3 is particularly heterogeneous in terms accounting for the Bartter phenotype. Defective basolateral

J Am Soc Nephrol 28: 2540–2552, 2017 Bartter Syndrome Type 3: Clinical and Genetics 2547 CLINICAL RESEARCH www.jasn.org

Table 5. Patients with BS type 3: Comparison between patients with CKD and patients with normal GFR Variable CKD Stages 2–5, n=19 eGFR>90 ml/min per 1.73 m2, n=58 P Value Birth weight, g 3200 (2810–3450)10 2995 (2530–3380)24 0.50 Age at diagnosis, yr 0.41 (0.16–8.00) 1.45 (0.39–15.75) 0.18 Age at last follow-up, yr 20 (12–42) 13 (6–26) 0.02 NSAIDs, n (%) Yes 14 (79) 29 (50) 0.10 No 5 (21) 29 (59) Treatment duration, yr 5.2 (3.2–14.25)2 6(3.3–9.2)3 0.53 Other renal and urological Yes 5 4 0.24 abnormalities (excluding nephrocalcinosis) No 12 27 Hypokalemia ,3 with treatment Yes 8 20 1 No 8 21 Quantitative values are expressed as medians and interquartile intervals. Superscript values correspond to the number of missing data. NSAIDs, nonsteroidal anti- inﬂammatory drugs.

2 Cl exit in the DCT decreases NaCl reabsorption via the NaCl our knowledge of the natural history of these syndromes. cotransporter, accounting for the GLS phenotype in other pa- Therefore, we recommend the use of NGS panels to diagnosis tients. Two recent studies in which the mouse Clcnk2 gene (cor- confirmation. NGS could also be useful to determine whether responding to CLCNKB in humans) was disrupted confirmed additional genes are involved in the observed clinical variabil- that ClC-K2 is the principal chloride channel in all three neph- ity. In the future, in vitro studies of additional mutant proteins ron segments and that TAL impairment is not compensated by can contribute to improving our understanding of the pheno- ClC-K1 (corresponding to the human ClC-Ka channel, which is type/genotype correlation and of the precise pathogenic also expressed in the TAL).27,28 Nevertheless, it cannot be ex- mechanism of mutants. These studies have the potential included that allelic variants of genes encoding KCl cotransporters terest to define targeted therapeutic approaches, such as chan- or other chloride channels may also compensate for renal so- nel openers or pharmacologic chaperones.30,31 dium loss, accounting for phenotypic variability.27,29 Despite missing data for some phenotypic criteria because Next generation sequencing (NGS) approaches allow par- of the retrospective nature of this study, several patterns allel analysis of several genes, which is particularly useful in emerged from our analysis. First, growth retardation was com- diseases with genetic heterogeneity, such as ABS, or in diseases mon but frequently improved with treatment. Fourteen pa- with phenotypic variability such as BS type 3. A genetic con- tients presented with persistent growth retardation; two of firmation is important for the follow-up as well as to improve these patients had CKD, a common cause of growth retardation due to a combination of abnormalities of the growth hormone axis, vitamin D defi- Table 6. Characteristics of patients according to genotype severity ciency, hyperparathyroidism, inadequate PL/CL or PL/PL CL/CL P Value Variable nutrition, and drug toxicity; and three pa- n=29 n=56 tients presented with GH deficiency.32 BS Clinical presentation, % ,0.001 and potassium deficiency have already ABS/NBS 13.8 41.1 been reported to be associated with GH de- CBS 51.7 42.9 ficiency.33–35 One previous study showed GLS 34.5 16.1 that GH and IGF1 did not stimulate longi- Age at diagnosis, yr 7.5 (0.7–36)1 0.6 (0.1–6.2)4 ,0.001 tudinal growth unless hypokalemia was GA at birth, wk 40 (39.8–40)12 40 (37–40)11 0.42 36 Plasma, n values corrected. In two patients with hypoka- Sodium, 133–146 mmol/L 136 (129–140)15 134 (130–137)24 nd lemia (median, 2.5 mmol/L), growth Potassium, 3.5–5 mmol/L 2.8 (2.3–3.0)8 2.7 (2.3–3.0)8 0.94 improved after GH supplementation but Chloride, 90–117 mmol/L 94 (83–97)16 89 (75–95)20 nd remained below 22SD. 12 15 CO2t, 18–25 mmol/L 33 (30–35) 32 (28–37) 0.73 Second, hypochloremia is a hallmark of Calcemia, 2.2–2.6 mmol/L 2.5 (2.4–2.8)16 2.6 (2.4–2.7)21 nd BS type 3: an analysis of the data available at Magnesemia, 0.75–1 mmol/L 0.84 (0.77–1.00)11 0.91 (0.82–1.00)28 0.4 diagnosis showed that hypochloremia was a 15 24 Renin 3(2–24) 8(2–19) 0.43 more severe in patients with ABS/NBS and CL: large deletions, truncating (unless carboxy-terminal), essential splicing, missense nonconducting, CBS than in patients with GLS. ClC-Kb is and mutants with residual currents ,20%. PL: missense mutants with residual currents .21%. Values are expressed as medians and interquartile intervals. Superscript values correspond to the number of expressed not only in the diluting segment missing data. The P values for continuous variables are for comparisons of the two groups with the but also in the intercalated cells of the col- Mann–Whitney U test. The P values for dichotomous variables were determined in chi-squared tests or lecting duct. Defects in this segment may Fisher test as appropriate. nd, not done (.50% of the data missing in one or more groups), CO2t, total carbon dioxide. impair chloride exit and transepithelial aTimes the normal upper limit for age. chloride reabsorption through the pendrin

2548 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 2540–2552, 2017 www.jasn.org CLINICAL RESEARCH

CONCISE METHODS Cl/HCO3 exchanger, potentially accounting for the stronger chloride depletion in patients with BS type 3 than in patients with BS type 1 or BS type 2.19 We found a downward shift of Patients the relationship between plasma chloride and sodium concen- The study included 115 patients (from 111 families) with CLCNKB trations consistent with a defect in adaptation to chloride de- mutations referred to the Genetics Department of Georges Pompidou pletion in patients with BS type 3 as compared with patients European Hospital (Paris, France) from January of 2001 to December with BS type 1 and BS type 2 patients. These results are con- of 2014 for genetic analysis after the diagnosis of BS or GS. The study sistent with the phenotype of mice with Clcnk2 disruption,27 was approved by the Comité de Protection des Personnes, Paris-Île de and suggest that sodium and potassium supplementation France XI (reference no. 09069) and informed consent for genetic should be provided as chloride salts in patients with BS type 3. studies was obtained from each proband or from their parents (for Third, 19 patients presented with CKD, and seven of these minors). Genetic investigations were performed after the clinical and patients also had proteinuria (Table 4). Five patients under- biologic diagnosis of salt-losing tubulopathy. Patients with a history went renal biopsy, which revealed diffuse glomerular and of polyhydramnios or clinical manifestations in the first month of life tubulointerstitial lesions with enlarged glomeruli in four were considered to have ABS/NBS. Patients diagnosed during child- patients, suggesting compensatory hypertrophy to nephron hood, with hypercalciuria and/or polyuria, were considered to have reduction (Supplemental Table 6, Table 4). Six patients diag- CBS, and children, adolescents, or adults for whom hypokalemia and nosed before the age of 8 years displayed progression to ESRD hypomagnesemia and/or hypocalciuria were discovered fortuitously at a median age of 24 years, associated with FSGS in four were considered to have GLS. Genetic investigations were extended to patients. Proteinuria, a low GFR, and FSGS have been reported both parents in 22 families and to the mother only in another seven in patients with BS and GS.22,37–39 It has been suggested that families. Twenty-three patients from this cohort have been described FSGS is a secondary lesion because of adaptation to salt loss, before19,23,25 (Supplemental Tables 1–3). resulting in chronic stimulation of the renin-angiotensin sys- tem.37,39,40 In this study, FSGS occurred in late-stage CKD, Detection of Point Mutations suggesting a large contribution of nephron reduction. We DNAwas extracted with a salt-based method or with blood DNA midi failed to identify other risk factors of CKD progression, in- kits (Qiagen, Venlo, The Netherlands). CLCNKB exons and flanking cluding birth weight, age at diagnosis, long-term nonsteroidal intron sequences were amplified by PCR, sequenced with BigDye anti-inflammatory drug treatment, persistent hypokalemia, Terminator v3.1 cycle sequencing kits, and run on an ABI Prism and other renal abnormalities (Table 5). CKD has been de- 3730XL DNA Analyzer (Perkin ElmerAppliedBiosystems,Foster scribed in other types of BS.19,22 In our BS cohort, CKD was City, CA), as previously described.19,23 DNA mutations were identi- observed in all BS types but the proportion of patients with fied with Sequencher software, by comparison with the reference se- preserved renal function (i.e.,eGFR.90 ml/min per 1.73 m2) quence for CLCNKB: NM_000085.4. Each mutation was confirmed was higher in patients with BS types 2 and 3 and the propor- by sequencing a second independent PCR product. tion of patients with moderate to severe kidney disease (i.e., 2 eGFR,60 ml/min per 1.73 m )inpatientswithBStypes1and Detection of Large Rearrangements 4, suggesting that the later BS subtypes 1 and 4 are associated Large rearrangements were detected by quantitative multiplex PCR with more severe renal prognosis. The mechanism of CKD of short fluorescent fragments before June of 2010, and by multiplex development is probably multifactorial, and its elucidation ligation-dependent probe amplification (MLPA) thereafter. We adapted will require prospective studies. Case reports are rare for pa- the quantitative multiplex PCR of short fluorescent fragments method tients with BS undergoing renal transplantation. The post- for the detection of large deletions of CLCNKB.44 The procedure is transplantation period was uneventful in our four patients, described in detail in the Supplemental Material and the primers with the complete disappearance of BS and no recurrence of used, covering all exons, are listed in Supplemental Table 7. For MLPA, FSGS, as previously described.41–43 we used the SALSA MLPA P266-B1 CLCNKB Kit (MRC Holland, In conclusion, BS type 3 syndrome, which is caused by Amsterdam, The Netherlands). The P136 Kit contains 29 probes: CLCNKB mutations, is highly variable phenotypically. We probes for 14 of the 20 exons of CLCNKB (exons 4, 7, 9, 12, 16, and show, for the first time, that there is a correlation between 20 are not represented), four probes for upstream genes (PRM2, severe mutations and a significantly younger age at diagnosis, CASP9, and the homologous CLCNKA gene), and 11 reference probes. suggesting that milder defects of ClC-Kb function may ac- The procedure is described in detail in the Supplemental Material. count for some of this variability. We also confirm the severe chloride depletion previously observed in patients with BS Bioinformatic Analysis of Mutations type 3 and report that 25% of patients suffer from CKD. The software used to interpret variants is described in the Supple- Long-term prospective follow-up of this cohort will identify mental Material. other severity parameters involved in this genotype/phenotype correlation, and will allow us to evaluate whether early Functional Expression in X. laevis diagnosis and treatment have an influence on the evolution Voltage clamp experiments were performed as previously described in to CKD. X. laevis oocytes.23,25 We injected 10 ng ClC-Kb cRNA and 5 ng

J Am Soc Nephrol 28: 2540–2552, 2017 Bartter Syndrome Type 3: Clinical and Genetics 2549 CLINICAL RESEARCH www.jasn.org barttin cRNA into defolliculated oocytes, which were then incubated DISCLOSURES in modified Barth solution at 16°C. Two-electrode voltage clamp None. experiments were performed at room temperature with TURBO TEC-10CX (npi electronic GmbH, Tamm, Germany) and PClamp 8 software (Axon Instruments, Union City, CA), 2 to 3 days after REFERENCES injection. Conductance at +60 mV (G+60 mV) was calculated by di- viding the current at +60 mV by the difference in current between 1. Bartter FC, Pronove P, Gill JR Jr., MacCardle RC: Hyperplasia of the +60 mV and the reversal potential. juxtaglomerular complex with hyperaldosteronism and hypokalemic alkalosis. A new syndrome. Am J Med 33: 811–828, 1962 2. Rodríguez-Soriano J: Bartter and related syndromes: The puzzle is al- Statistical Analyses most solved. Pediatr Nephrol 12: 315–327, 1998 Clinical data were analyzed with GraphPad Prism Software (La 3. Seyberth HW, Schlingmann KP: Bartter- and Gitelman-like syndromes: Jolla, CA) and SPSS software, release 20.0.0 (SPSS, Chicago, IL). Salt-losing tubulopathies with loop or DCT defects. Pediatr Nephrol 26: – Kruskal–Wallis tests were used to compare the three groups 1789 1802, 2011 fi 4. Konrad M, Vollmer M, Lemmink HH, van den Heuvel LP, Jeck N, Vargas- (ABS/NBS, CBS, and GLS). In cases of statistical signi cance, Poussou R, Lakings A, Ruf R, Deschênes G, Antignac C, Guay-Woodford Mann–Whitney U tests were used to compare the groups in pairs. L, Knoers NV, Seyberth HW, Feldmann D, Hildebrandt F: Mutations in Dichotomous variables were compared using the chi-squared test the chloride channel gene CLCNKB as a cause of classic Bartter syn- – or Fisher exact test as appropriate. Variables for which .50% of drome. JAmSocNephrol11: 1449 1459, 2000 5. Simon DB, Karet FE, Hamdan JM, DiPietro A, Sanjad SA, Lifton RP: thedataweremissinginonegroupwereexcludedfromtheanal- Bartter’s syndrome, hypokalaemic alkalosis with hypercalciuria, is ysis. Clinical manifestations were analyzed by descriptive meth- caused by mutations in the Na-K-2Cl cotransporter NKCC2. Nat Genet ods, using the number of subjects for each group. Data for in vitro 13: 183–188, 1996 X. laevis studies were analyzed by ANOVA and Holm–Sidak tests, 6. Simon DB, Karet FE, Rodriguez-Soriano J, Hamdan JH, DiPietro A, Trachtman H, Sanjad SA, Lifton RP: Genetic heterogeneity of Bartter’s with Sigma Stat software. syndrome revealed by mutations in the K+ channel, ROMK. Nat Genet 14: 152–156, 1996 7. Simon DB, Bindra RS, Mansfield TA, Nelson-Williams C, Mendonca E, Stone R, Schurman S, Nayir A, Alpay H, Bakkaloglu A, Rodriguez- ACKNOWLEDGMENTS Soriano J, Morales JM, Sanjad SA, Taylor CM, Pilz D, Brem A, Trachtman H, Griswold W, Richard GA, John E, Lifton RP: Mutations in We thank the patients and their families for agreeing to participate the chloride channel gene, CLCNKB, cause Bartter’ssyndrometypeIII. in this study. We thank all of the staff of the genetics laboratory Nat Genet 17: 171–178, 1997 8. Birkenhäger R, Otto E, Schürmann MJ, Vollmer M, Ruf EM, Maier- ofGeorgesPompidouEuropean Hospital and all ofthe doctorsinvolved: Lutz I, Beekmann F, Fekete A, Omran H, Feldmann D, Milford DV, Hans-Jacob Bangstaf (Norway), Pierre Bataille (Boulogne-sur-Mer, Jeck N, Konrad M, Landau D, Knoers NV, Antignac C, Sudbrak R, France), Mohammed-Najib Bensemlali (Morocco), Delphine Brouet Kispert A, Hildebrandt F: Mutation of BSND causes Bartter syndrome (Lorient, France), Christophe Bouaka (Martigues, France), Marina with sensorineural deafness and kidney failure. Nat Genet 29: 310– Charbit (Paris, France), Gabriel Choukroun(Amiens, France), Renaud 314, 2001 9. Schlingmann KP, Konrad M, Jeck N, Waldegger P, Reinalter SC, Holder De La Faille (Bordeaux, France), Geneviève Dumont (Orleans, M, Seyberth HW, Waldegger S: Salt wasting and deafness resulting France), Olivier Dunand (La Reunion, France), Catherine Dupré- from mutations in two chloride channels. NEnglJMed350: 1314– Goudable (Toulouse, France), Claire Garandeau (Nantes, France), 1319, 2004 Angela Granadas (Madrid, Spain), Steven Grange (Rouen, France), 10. Vargas-Poussou R, Huang C, Hulin P, Houillier P, Jeunemaître X, Paillard M, Planelles G, Déchaux M, Miller RT, Antignac C: Functional Jean-Christophe Hebert (Guadeloupe, France), Aurélie Hummel characterization of a calcium-sensing receptor mutation in severe au- (Paris, France), Khalid Ismaïli (Brussels), Cynthia Kahil (Thonon les tosomal dominant hypocalcemia with a Bartter-like syndrome. JAm Bains, France), Christina Kanaka (Athens, Greece), Bruno Legallicier Soc Nephrol 13: 2259–2266, 2002 (Rouen, France), Renaud Leray (Montpellier, France), Bruno 11. Watanabe S, Fukumoto S, Chang H, Takeuchi Y, Hasegawa Y, Okazaki R, Chikatsu N, Fujita T: Association between activating mutations of Maranda (Sainte Foy, Quebec, Canada), Mohammed-Diab Mahmoud calcium-sensing receptor and Bartter’ssyndrome.Lancet 360: 692– (La Roche Sur Yon, France), Pierre Merville (Bordeaux, France), Bruno 694, 2002 Moulin (Strasbourg, France), Isabelle Raingeard (Montpellier, 12. Simon DB, Nelson-Williams C, Bia MJ, Ellison D, Karet FE, Molina AM, France), Mehta Sanjay (Toronto, Canada), David Schwarz (Zurich, Vaara I, Iwata F, Cushner HM, Koolen M, Gainza FJ, Gitleman HJ, Lifton ’ ’ Switzerland), Pascale Siohan (Quimper, France), Ivan Tack (Toulouse, RP: Gitelman s variant of Bartter s syndrome, inherited hypokalaemic alkalosis, is caused by mutations in the thiazide-sensitive Na-Cl co- France), Cécile Vigneau (Rennes, France), and João Esteves (Ponta transporter. Nat Genet 12: 24–30, 1996 Delgada, Açores, Portugal). 13. Jeck N, Konrad M, Peters M, Weber S, Bonzel KE, Seyberth HW: Mu- J.T.’s group is funded by a grant from l’Agence Nationale de la tations in the chloride channel gene, CLCNKB, leading to a mixed Recherche (grant no. ANR BLANC 14-CE12-0013-01/HYPERSCREEN). Bartter-Gitelman phenotype. Pediatr Res 48: 754–758, 2000 14. Zelikovic I, Szargel R, Hawash A, Labay V, Hatib I, Cohen N, Nakhoul This work was supported by the French Ministry of Health (Plan Maladies F: A novel mutation in the chloride channel gene, CLCNKB,asa Rares) and the European Community (grant nos. FP7EUNEFRON cause of Gitelman and Bartter syndromes. Kidney Int 63: 24–32, 201590 and EURenOmics 2012-305608). 2003

2550 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 2540–2552, 2017 www.jasn.org CLINICAL RESEARCH

15. Vargas-Poussou R, Dahan K, Kahila D, Venisse A, Riveira-Munoz E, 28. Grill A, Schießl IM, Gess B, Fremter K, Hammer A, Castrop H: Salt-losing Debaix H, Grisart B, Bridoux F, Unwin R, Moulin B, Haymann JP, nephropathy in mice with a null mutation of the Clcnk2 gene. Acta VantyghemMC,RigothierC,DussolB,GodinM,NivetH,DubourgL, Physiol (Oxf) 218: 198–211, 2016 Tack I, Gimenez-Roqueplo AP, Houillier P, Blanchard A, Devuyst O, 29. Teulon J, Lourdel S, Nissant A, Paulais M, Guinamard R, Marvao P, Jeunemaitre X: Spectrum of mutations in Gitelman syndrome. JAmSoc Imbert-Teboul M: Exploration of the basolateral chloride channels in Nephrol 22: 693–703, 2011 the renal tubule using. Nephron Physiol 99: 64–68, 2005 16. Andrini O, Keck M, Briones R, Lourdel S, Vargas-Poussou R, Teulon J: 30. Cho HY, Lee BH, Cheong HI: Translational read-through of a nonsense ClC-K chloride channels: Emerging pathophysiology of Bartter mutation causing Bartter syndrome. J Korean Med Sci 28: 821–826, syndrome type 3. Am J Physiol Renal Physiol 308: F1324–F1334, 2013 2015 31.ImbriciP,LiantonioA,CamerinoGM,DeBellisM,CamerinoC, 17. Peters M, Jeck N, Reinalter S, Leonhardt A, Tönshoff B, Klaus G G, Mele A, Giustino A, Pierno S, De Luca A, Tricarico D, Desaphy Konrad M, Seyberth HW: Clinical presentation of genetically defined JF, Conte D: Therapeutic approaches to genetic ion channelo- patients with hypokalemic salt-losing tubulopathies. Am J Med 112: pathies and perspectives in drug discovery. Front Pharmacol 7: 183–190, 2002 121, 2016 18. Jeck N, Konrad M, Hess M, Seyberth HW: The diuretic- and Bartter-like 32. Bacchetta J, Harambat J, Cochat P, Salusky IB, Wesseling-Perry K: salt-losing tubulopathies. Nephrol Dial Transplant 15[Suppl 6]: 19–20, Theconsequencesofchronickidneydiseaseonbonemetabolism 2000 and growth in children. NephrolDialTransplant27: 3063–3071, 19. Brochard K, Boyer O, Blanchard A, Loirat C, Niaudet P, Macher MA, 2012 Deschenes G, Bensman A, Decramer S, Cochat P, Morin D, Broux F, 33. Boer LA, Zoppi G: Bartter’s syndrome with impairment of growth hor- Caillez M, Guyot C, Novo R, Jeunemaître X, Vargas-Poussou R: mone secretion. Lancet 340: 860, 1992 Phenotype-genotype correlation in antenatal and neonatal vari- 34. Buyukcelik M, Keskin M, Kilic BD, Kor Y, Balat A: Bartter syndrome and ants of Bartter syndrome. Nephrol Dial Transplant 24: 1455–1464, growth hormone deficiency: Three cases. Pediatr Nephrol 27: 2145– 2009 2148, 2012 20. Stölting G, Bungert-Plümke S, Franzen A, Fahlke C: Carboxyl-terminal 35. Flyvbjerg A, Dørup I, Everts ME, Orskov H: Evidence that potassium truncations of ClC-Kb abolish channel activation by barttin via modi- deficiency induces growth retardation through reduced circulating fied common gating and trafficking. JBiolChem290: 30406–30416, levels of growth hormone and insulin-like growth factor I. Metabolism 2015 40: 769–775, 1991 21. Nozu K, Fu XJ, Nakanishi K, Yoshikawa N, Kaito H, Kanda K, Krol RP, 36. Hochberg Z, Amit T, Flyvbjerg A, Dørup I: Growth hormone (GH) Miyashita R, Kamitsuji H, Kanda S, Hayashi Y, Satomura K, Shimizu N, receptor and GH-binding protein deficiency in the growth failure of Iijima K, Matsuo M: Molecular analysis of patients with type III Bartter potassium-depleted rats. J Endocrinol 147: 253–258, 1995 syndrome: Picking up large heterozygous deletions with semi- 37. Akil I, Ozen S, Kandiloglu AR, Ersoy B: A patient with Bartter syn- quantitative PCR. Pediatr Res 62: 364–369, 2007 drome accompanying severe growth hormone deficiency and focal 22. Bettinelli A, Borsa N, Bellantuono R, Syrèn ML, Calabrese R, Edefonti A, segmental glomerulosclerosis. Clin Exp Nephrol 14: 278–282, Komninos J, Santostefano M, Beccaria L, Pela I, Bianchetti MG, 2010 Tedeschi S: Patients with biallelic mutations in the chloride channel 38. Bulucu F, Vural A, Yenicesu M, Caglar K: Association of Gitelman’s gene CLCNKB: Long-term management and outcome. Am J Kidney syndrome and focal glomerulosclerosis. Nephron 79: 244, 1998 Dis 49: 91–98, 2007 39. Hanevold C, Mian A, Dalton R: C1q nephropathy in association with 23. Keck M, Andrini O, Lahuna O, Burgos J, Cid LP, Sepúlveda FV, L’hoste Gitelman syndrome: A case report. Pediatr Nephrol 21: 1904–1908, S, Blanchard A, Vargas-Poussou R, Lourdel S, Teulon J: Novel CLCNKB 2006 mutations causing Bartter syndrome affect channel surface expression. 40. Lan HY, Chung AC: TGF-b/Smad signaling in kidney disease. Semin Hum Mutat 34: 1269–1278, 2013 Nephrol 32: 236–243, 2012 24. García Castaño A, Pérez de Nanclares G, Madariaga L, Aguirre M, 41. Blethen SL, Van Wyk JJ, Lorentz WB, Jennette JC: Reversal of Bartter’s Madrid A, Nadal I, Navarro M, Lucas E, Fijo J, Espino M, Espitaletta Z, syndrome by renal transplantation in a child with focal, segmental Castaño L, Ariceta G; RenalTube Group: Genetics of type III Bartter glomerular sclerosis. Am J Med Sci 289: 31–36, 1985 syndrome in Spain, proposed diagnostic algorithm. PLoS One 8: 42. Yokoyama T: [Endocrinological analysis before and after living-related e74673, 2013 renal transplantation in a patient of Bartter’s syndrome]. Nippon Jinzo 25. Andrini O, Keck M, L’Hoste S, Briones R, Mansour-Hendili L, Grand T, Gakkai Shi 37: 580–586, 1995 Sepúlveda FV, Blanchard A, Lourdel S, Vargas-Poussou R, Teulon J: 43. Lee SE, Han KH, Jung YH, Lee HK, Kang HG, Moon KC, Ha IS, Choi Y, CLCNKB mutations causing mild Bartter syndrome profoundly alter the Cheong HI: Renal transplantation in a patient with Bartter syndrome pH and Ca2+ dependence of ClC-Kb channels. Pflugers Arch 466: and glomerulosclerosis. Korean J Pediatr 54: 36–39, 2011 1713–1723, 2014 44. Houdayer C, Gauthier-Villars M, Laugé A, Pagès-Berhouet S, 26. Kobayashi K, Uchida S, Okamura HO, Marumo F, Sasaki S: Human CLC- Dehainault C, Caux-Moncoutier V, Karczynski P, Tosi M, Doz F, KB gene promoter drives the EGFP expression in the specificdistal Desjardins L, Couturier J, Stoppa-Lyonnet D: Comprehensive screen- nephron segments and inner ear. JAmSocNephrol13: 1992–1998, ing for constitutional RB1 mutations by DHPLC and QMPSF. Hum 2002 Mutat 23: 193–202, 2004 27.HenningsJC,AndriniO,PicardN,PaulaisM,HuebnerAK,Cayuqueo IK,BignonY,KeckM,CornièreN,BöhmD,JentschTJ,ChambreyR, Teulon J, Hübner CA, Eladari D: The ClC-K2 chloride channel is critical for salt handling in the distal nephron. JAmSocNephrol28: 209–217, This article contains supplemental material online at http://jasn.asnjournals. 2017 org/lookup/suppl/doi:10.1681/ASN.2016101057/-/DCSupplemental.

J Am Soc Nephrol 28: 2540–2552, 2017 Bartter Syndrome Type 3: Clinical and Genetics 2551 CLINICAL RESEARCH www.jasn.org

AFFILIATIONS

† *Pediatric Nephrology Unit, American Memorial Hospital, Reims University Hospital, Reims, France; UnitéMixtedeRechercheenSanté ‡ 1138, Team 3, Université Pierre et Marie Curie, Paris, France; Institut National de la Santé et la Recherche Médicale, Unité Mixte de ǁ Recherche en Santé 872, Paris, France; §Faculté de Médecine, Université Paris Descartes, Paris, France; Department of Genetics and ¶Centre d’Investigation Clinique, Hôpital Européen Georges Pompidou, Assistance Publique-Hôpitaux de Paris, Paris, France; †† **Cardiology Department, Hôpital de la Croix-Rousse, Hospices Civils de Lyon, Lyon, France; Centre de Recherche en Acquisition et Traitement de l’Image pour la Santé; Centre National de la Recherche Scientiﬁque Unité Mixte de Recherche 5220; Institut National de la Santé et la Recherche Médicale, Unité 1044; Institut National de Sciences Appliquées-Lyon; Université Claude Bernard Lyon 1, France; ‡‡ Pediatric Nephrology Unit, Hôpital Robert Debré, Assistance Publique-Hôpitaux de Paris, Paris, France; §§Centre de Référence des ǁǁ Maladies Rénales Héréditaires de l’Enfant et de l’Adulte, Paris, France; Néphrogones, Centre de Référence des Maladies Rénales Rares, †††† Pediatric Nephrology, Rhumatology and Dermatology Unit, Hôpital Femme-Mère-Enfant and Exploration Fonctionnelle Rénale et Métabolique, Groupement Hospitalier est Hôpital Edouard Herriot, Hospices Civils de Lyon, Lyon, France; ¶¶Nephrology Unit, Clinique du ††† Vert Galant, Tremblay-en-France, France; ***Nephrology Unit, Centre hospitalier de Saintonge, Saintes, France; Departement of ‡‡‡ ‡‡‡‡ Pediatrics, Centre Hospitalier Universitaire de Grenoble, Grenoble, France; Departement of Pediatrics and Departement of Nephrology, Centre de Référence des Maladies Rénales Rares du Sud-Ouest, Hôpital de Toulouse, Université Paul Sabatier, Toulouse, ǁǁǁ France; §§§Pediatric Nephrology Unit, Hôpital de la Timone, Assistance Publique des Hôpitaux de Marseille, Marseille, France; Pediatric Nephrology Unit and *****Department of Nephrology, Hôpital Necker-Enfants-malades, Assistance Publique des Hôpitaux de Paris, Paris, France; ¶¶¶Nephrology Unit, Centre Hospitalier du Pays d’Aix, Aix-en-Provence, France; ****Pediatric Nephrology Unit, Hôpital Trousseau, Assistance Publique des Hôpitaux de Paris, Paris, France; §§§§Pediatric Nephrology Unit, Centre Hospitalier Universitaire de Montpellier, ǁǁǁǁ Montpellier, France; Faculté de Médecine, Centre de Référence des Maladies Rénales Rares du Sud-Ouest, Aix-MarseilleUniversité– Vascular Research Center of Marseille, Marseille, France; ¶¶¶¶Nephrology Unit, Hôpital de la Conception, Assistance Publique des ††††† Hopitaux de Marseille, Marseille,France; Departement of Pediatrics, Hôpital Nord, Centre Hospitalier Universitaire de Saint Etienne, ‡‡‡‡‡ Saint Etienne, France; Department of Pediatrics and Adolescent Medicine, Centre Hospitalier Universitaire d’Amiens, Amiens, France; §§§§§Service de Néphrologie Pédiatrique, Groupement Hospitalier Pellegrin, Centre Hospitalier Universitaire de Bordeaux, Centre de ǁǁǁǁǁ Référence des Maladies Rénales Rares du Sud-Ouest, Bordeaux, France; Department of Pediatrics, Centre Hospitalier Universitaire Charles Nicolle, Rouen, France; ¶¶¶¶¶Nephrology Unit,Centre Hospitalier Universitaire Tours, Tours, France; ******Department of Pediatrics, †††††† Centre Hospitalier Pierre Oudot de Bourgoin-Jallieu, Bourgoin-Jallieu, France; Molecular Genetics Unit, Hospital do Divino Espírito ‡‡‡‡‡‡ Santo de Ponta Delgada, Entidade Pública Empresarial Regional, Açores, Portugal; Nephrology Unit, Centre Hospitalier Universitaire ǁǁǁǁǁǁ de Dijon, Dijon, France; §§§§§§Pediatric Nephrology Unit, Centre Hospitalier Universitaire de Besançon, Besançon, France; Pediatric Nephrology Unit, Hôpital Jeanne de Flandre, Centre Hospitalier Universitaire de Lille, Lille, France; ¶¶¶¶¶¶Pediatric Nephrology Unit, Centre Hospitalier Universitaire de Nantes, Nantes, France; *******Pediatric Nephrology Unit, Hôpitaux de Brabois, Centre Hospitalier ††††††† Universitaire de Nancy, Vandoeuvre Les Nancy, France; Centre for Nephrology, University College London, London, UK; and ‡‡‡‡‡‡‡ Institut National de la Santé et la Recherche Médicale, Unité Mixte de Recherche en Santé 970, Paris-Cardiovascular Research Center,Paris,France

2552 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 2540–2552, 2017

Supplementary Table 1. CLCNKB mutations in patients with the antenatal/neonatal Bartter syndrome phenotype (34 patients-32 families)

Consanguinity/ Exon/ Reference Mutation Patient Nucleotide* Protein Nucleotide* Protein Exon/ Intron Reference Geographic Origin Intron Mutation Class BN009-1a No/Guadeloupe BN024-1 a No/Central Africa BN026-1 a Yes/North Africa BN048-1 Yes/Caucasian BN061-1 Yes/nd BN066-1 No/Caucasian BN073-1 Yes/North Africa BN080-1 Yes/Western Africa c.(?_-30)_(*220 _?)del Absent 1 to 20 7 c.(?_-30)_(*220 _?)del Absent 1 to 20 7 CL/CL BN088-1 No/Turkey BN106-1 No/Central Africa BN115-1 Nd/Caucasian BN135-1 Nd/Central Africa BR016-1 No/Caucasian BR130-1 No/Central Africa BR152-1 Yes/North Africa BR154-1 No/Caucasian BR006-1 No/Caucasian c.610G>A p.Ala204Thr 7 7 c.610G>A p.Ala204Thr 7 7 PL/PL BR182-1 Yes/North Africa BR060-1b Yes/Turkey c.736G>C p.Gly246Arg 8 25 c.736G>C p.Gly246Arg 8 25 CL/CL BN124-1 Nd/Caucasian c.782-2A>G p.? 8 4 c.782-2A>G p.? 8 4 CL/CL BR058-1 Yes/North Africa c.1053+1G>T p.? 11 7 c.1053+1G>T p.? 11 7 CL/CL BN084-1 Yes/North Africa c.1217T>C p.Leu406Pro 12 This study c.1217T>C p.Leu406Pro 12 This study ?/? BR130-2 Nd/Guadeloupe c.(?_-30)_(*220 _?)del Absent 1 to 20 7 c.365G>T p.Gly122Val 5 This study CL/? BR133-1 No/Caucasian c.(?_-30)_(*220 _?)del Absent 1 to 20 7 c.610G>A p.Ala204Thr 7 7 CL/PL BN137-1 No/Asia c.(?_-30)_(*220 _?)del Absent 1 to 20 7 c.875G>T p.Cys292Phe 10 This study ?/CL DN101-1 Yes/Caucasian c.(?_-30)_(229+1_230-1)del p.? 1 to 3 This study c.610G>A p.Ala204Thr 7 7 CL/PL DN061-1 No/Caucasian c.(?_-30)_(229+1_230-1)del p.? 2 to 3 7 c.343A>C p.Thr115Pro 4 19 CL/CL BN104-1 No/Caucasian c.226C>T p.Arg76Ter 3 Nozu, 2010 c.1228-1G>A p.? 12 This study CL/CL BN104-2 No/Caucasian Bettinelli, BR102-1 c.446T>A p. Val149Glu 5 c.1897delC p.Leu633Ter 18 This study ?/? 2005 BN102-1 Nd/nd c.653G>A p.Ser218Asn 7 This study c.1033G>A p.Gly345Ser 11 This study ?/PL BN010-1 No/Caucasian c.1172G>A p.Trp391Ter 12 Nozu, 2010 c.1756+1G>A p.? 16 26 Cl/CL BN022-1 No/Caucasian c.1528G>A p.Ala510Thr 15 This study Wt/? BR109-1 No/Caucasian c.1693delG p.Glu565Argfs*7 16 This study ?/? *Numbering according to the reference cDNA sequence (GenBank: NM_000085.4). Nucleotide 1 is the A of the initiator methionine codon. aDescribed as patients 28 , 30 and 32 in reference 19.bDescribed in reference 25.

Supplementary Table 2. CLCNKB mutations in patients with the classic Bartter syndrome phenotype (51 patients – 49 families) Consanguinity/ Mutation Patient Geographic Nucleotide* Protein Exon/ Intron Reference Nucleotide* Protein Exon/ Intron Reference Class Origin BR015-1 No/Turkey BR015-2 No/Turkey BR028-1 Yes/Asia BR043-1 Yes/Caucasian BR054-1 Yes/Turkey c.(?_-30)_(*220 _?)del Absent 1 to 20 7 c.(?_-30)_(*220 _?)del Absent 1 to 20 7 CL/CL BR086-1 No/Caucasian BR105-1 No/Caucasian BR114-1 No/Caucasian BR126-1 No/Central Africa BR062-1 Yes/North Africa c.(781+1_782-1)_( *1 c.(781+1_782-1)_( *1 _?)del p.? 9 to 20 This study p.? 9 to 20 This study CL/CL BR062-2 Yes/North Africa _?)del BR113-1 Yes/North Africa c.97C>T p.Arg33Ter 2 This study c.97C>T p.Arg33Ter 2 This study CL/CL BR118-1c No/Caucasian c.508G>A p.Val170Met 6 27 c.508G>A p.Val170Met 6 27 PL/PL BR110-1c No/Central Africa c.371C>T p.Ala204Thr 7 7 c.371C>T p.Ala204Thr 7 7 PL/PL BR159-1 No/Caucasian No/West Africa BR070-1 c.891C>A p.Ser297Arg 10 4 c.891C>A p.Ser297Arg 10 4 PL/PL

BR122-1b Yes/North Africa c.1271G>A p.Gly424Glu 13 25 c.1271G>A p.Gly424Glu 13 25 CL/CL BR186-1 Yes/Caucasian c.1783C>T p.Arg595Ter 17 24 c.1783C>T p.Arg595Ter 17 24 CL/CL BR139-1 No/Caucasian c.1897delC p.Leu633Ter 18 This study c.1897delC p.Leu633Ter 18 This study ?/? BR065-1 Yes/Turkey c.1976C>T p.Thr659Met 19 This study c.1976C>T p.Thr659Met 19 This study ?/? Nd/Caucasian c.(?_-30)_(229+1_230- BR044-1 c.(?_-30)_(*220 _?)del Absent 1 to 20 7 p.? 1 to 3 This study CL/CL 1)del BR138-1 No/South America c.(?_-30)_(*220 _?)del Absent 1 to 20 7 c.371C>T p.Ala204Thr 7 7 CL/PL BR181-1c No/Caucasian c.(?_-30)_(*220 _?)del Absent 1 to 20 7 c.508G>A p.Val170Met 6 27 CL/PL BR172-1 No/Turkey c.(?_-30)_(*220 _?)del Absent 1 to 20 7 c.699_706del p.Trp234Leufs*45 8 This study CL/CL BR064-1 No/Caucasian 7 c.(?_-30)_(*220 _?)del Absent 1 to 20 c.782-2A>G p.? 8 4 CL/CL BR085-1 No/Caucasian BR166-1 No/Caucasian c.(?_-30)_(*220 _?)del Absent 1 to 20 7 c.1214_1221del p.Phe405Tyrfs*43 12 This study CL/CL BR153-1 No/North Africa c.(?_-30)_(*220 _?)del Absent 1 to 20 7 c.1217T>C p.Leu406Pro 12 This study CL/? BR179-1 No/Caucasian c.(?_-30)_(*220 _?)del Absent 1 to 20 7 c.1309G>C p.Gly437Arg 14 Lee, 2012 CL/? Yes/Asia 7 Fukuyama, BR140-1 c.(?_-30)_(*220 _?)del Absent 1 to 20 c.1830G>A p.Trp610Ter 17 CL/PL 2004 BR187-1 No/Caucasian c.(?_-30)_(576+1_577-1)del p.? 1 to 6 24 c.36delA p.Asn14Thrfs*3 2 This study CL/CL BR032-1 No/Caucasian c.(?_-30)_(576+1_577-1)del p.? 1 to 6 24 c.1172G>A p.Trp391Ter 12 Nozu, 2010 CL/CL BR161-1 Nd/Caucasian BR067-1b Nd/Asia c.(?_-30)_(1053+1_1054-1)del p.? 1 to 11 This study c.242T>C p.Leu81Pro 4 25 CL/PL

BR027-1 Nd/Reunion c.97C>T p.Arg33Ter 2 This study c.1816G>T p.Glu606Ter 17 This study CL/? No/Caucasian c.371C>T p.Pro124Leu 5 BR157-1c 7-27 c.655G>T p.Gly219Cys 7 27 PL/? c.1393G>A p.Gly465Arg 14 No/Caucasian c.371C>T p.Pro124Leu 5 BR116-1c 7-27 c.782-2A>G p.? 8 4 PL/CL c.1393G>A p.Gly465Arg 14 BR147-1c No/Caucasian c.508G>A p.Val170Met 6 27 c.708C>A p.Tyr236Ter 8 27 PL/CL BR125-1c No/Caucasian c.508G>A p.Val170Met 6 27 c.1928_1929+8del p.Glu643Glyfs*6 18 27 PL/? BR030-1 No/Caucasian c.371C>T p.Ala204Thr 7 7 c.1270G>A p.Gly424Arg 13 27 PL/CL BR192-1 No/Caucasian c.371C>T p.Ala204Thr 7 7 c.1334_1335del p.Ser445Phefs*5 14 23 PL/CL BR129-1 No/Caucasian c.371C>T p.Ala204Thr 7 7 c.1783C>T p.Arg595Ter 17 24 PL/CL BR071-1c No/Caucasian c.1172G>A p.Trp391Ter 12 Nozu, 2010 c.358G>C p.Gly120Arg 4 27 CL/PL BR134-1 No/Caucasian c.1172G>A p.Trp391Ter 12 Nozu, 2010 c.498+1G>C p.? 5 This study CL/CL BR100-1b No/Caucasian c.1052G>C p.Arg351Pro 11 27 c.1316T>C p.Leu439Pro 14 27 PL/CL Yes/Central Africa c.1183C>T p.Arg395Trp 2 12 BR050-1 This study c.1298-6G>A p.? 3 13 This study PL/? c. 1405G>C p.Ala469Pro 14 BR162-1 No/Caucasian c.1756+1G>A p.? 16 26 c.1783C>T p.Arg595Ter 17 24 CL/CL BR194-1 No/Caucasian c.371C>T p.Ala204Thr 7 7 PL/? BR057-1 No/Caucasian c.1172G>A p.Trp391Ter 12 Nozu, 2010 CL/? BR081-1 No/Caucasian c.1877G>A p.Cys626Tyr 18 15 ?/? BR174-1 Nd/nd *Numbering according to the reference cDNA sequence (GenBank: NM_000085.4). Nucleotide 1 is the A of the initiator methionine codon. bDescribed in reference 25. c Described as patients 5, 11, 8, 10, 9, 7, 6, 13 in reference 27.

Supplementary Table 3. CLCNKB mutations in patients with the Gitelman syndrome phenotype (30 patients – 30 families)

Consanguinity/ Mutation Patient Nucleotide # Protein Exon/ Intron Reference Nucleotide # Protein Exon/ Intron Reference Geographic Origin Class

GT148-1 Nd/Caucasian GT297-1 No/Cape Verde GT365-1 Nd/nd c.(?_-30)_(*220 _?)del Absent 1 to 20 7 c.(?_-30)_(*220 _?)del Absent 1 to 20 7 CL/CL GT518-1 Nd/nd GT673-1 No/Asia GT568-1 Yes/Caucasian c.371C>T p.Pro124Leu 5 7 c.371C>T p.Pro124Leu 5 7 PL/PL BT022-1c Nd/Caucasian BT218-1c No/Caucasian c.508G>A p.Val170Met 6 27 c.508G>A p.Val170Met 6 27 PL/PL GT207-1c No/nd GT424-1c No/Caucasian GT018-1 No/Caucasian c.1172G>A p.Trp39Tter 12 Nozu, 2010 c.1172G>A p.Trp391Ter 12 Nozu, 2010 CL/CL BT099-1b No/North Africa c.1271G>A p.Gly424Glu 13 25 c.1271G>A p.Gly424Glu 13 25 CL/CL GT143-1b Nd/Southern Africa c.1313G>A p.Arg438His 14 25 c.1313G>A p.Arg438His 14 25 CL/CL GT160-1 No/Caucasian c.1783C>T p.Arg595Ter 17 24 c.1783C>T p.Arg595Ter 17 24 CL/CL GT027-1b Nd/Caucasian c.(?_-30)_(*220 _?)del Absent 1 to 20 7 c.274C>T p.Arg92Trp 4 25 CL/PL GT331-1 No/Africa c.(?_-30)_(*220 _?)del Absent 1 to 20 7 c.761C>T p.Ala254Val 8 This study CL/? GT397-1 No/Caucasian c.20del p.Leu7Argfs*10 2 This study c.1298G>A p.Gly433Glu 14 24 CL/? No/Caucasian c.371C>T p.Pro124Leu 5 GT657-1 c.36delA p.Asn14Thrfs*3 2 This study 7-27 CL/PL c.1393G>A p.Gly465Arg 14 GT706-1 No/Caucasian c.97C>T p.Arg33* 2 This study c.508G>A p.Val170Met 6 27 CL/PL GT678-1 No/Central Africa c.97C>T p.Arg33* 2 This study c.761C>T p.Ala254Val 8 This study CL/? BT153-1 No/Caucasian c.371C>T p.Ala204Thr 7 7 c.1334_1335del p.Ser445Phefs*5 14 23 PL/CL GT394-1 No/Caucasian c.694T>C p.Ser232Pro 8 This study c.1877G>A p.Cys626Tyr 18 15 ?/? GT587-1 No/Caucasian c.226C>T p.Arg76Ter 3 Nozu, 2010 CL/? GT428-1 No/Caucasian c.508G>A p.Val170Met 6 27 PL/? GT660-1 No/Caucasian c.371C>T p.Ala204Thr 7 7 PL/? GT149-1 No/Caucasian c.887G>A p.Gly296Asp 10 15 CL/? BT188-1 Nd/nd c.1340T>C p.Ile447Thr 14 15 ?/? BT264-1 No/Caucasian c.1312C>T p.Arg438Cys 14 7 CL/? GT274-1 No/Guadeloupe c.1877G>A p.Cys626Tyr 4 18 15 ?/? GT475-1 No/Caucasian #Numbering according to the reference cDNA sequence (GenBank: NM_000085.4). Nucleotide 1 is the A of the initiator methionine codon. bDescribed in reference 25.cDescribed as patients 1, 2, 3, 4 in reference 27.

Supplementary Table 4. In silico predictions for previously unknown CLCNKB missense mutations Grantham MutPred Conservation distance 1 Exon/ PolyPhen- SNPs& Mutation Actionable Hypotheses Confident Hypotheses Very Confident Nucleotide (cDNA) Protein between species (physicoche SIFT 2 Probability of Intron 23 GO 4 Taster 5 Hypotheses (until C. elegans) mical deleterious 6 difference) mutation Loss of disorder ( P = Probably HCN 0.0311) c.365G>T p.Gly122Val 5 109 0.02 damaging Dis 0.9 DC p=1 0.86 HCAA Loss of glycosylation at 1 S121 ( P = 0.0332) HCN Benign Loss of glycosylation at c.653G>A p.Ser218Asn 7 46 0.2 Dis 0.89 DC p=1 0.82 HCAA 0.350 S218 ( P = 0.044) Possibly WCN DC c.694T>C p.Ser232Pro 8 74 0.03 damaging Dis 0.87 0.77 MCAA p=0.99 0.868 Possibly MCN DC c.761C>T p.Ala254Val 8 64 0.07 damaging Dis 0.5 0.78 MCAA p=0.99 0.532 Probably HCN c.875G>T p.Cys292Phe 10 205 0.08 damaging Dis 0.9 DC p=1 0.84 HCAA 0.998 Gain of disorder ( P = 0.0309) Gain of loop ( P = 0.0312) Probably MCN Loss of methylation at R346 ( P c.1033G>A p.Gly345Ser 11 56 0 damaging Dis 0.81 DC p=1 0.75 HCAA = 0.0479) 1 Gain of phosphorylation at G345 ( P = 0.0491) Possibly Polymor WCN c.1183C>T p.Arg395Trp 12 101 0.14 damaging Dis 0.87 phism 0.23 WCAA 0.670 p=1 Possibly Loss of stability ( P = MCN c.1217T>C p.Leu406Pro 12 98 0.05 damaging Dis 0.92 DC p=1 0.84 0.026) MCAA 0.17 Loss of stability ( P = 0.0025) Polymor WCN Tolerate Benign Neutral Gain of loop ( P = 0.0312) c.1340T>C p.Ile447Thr 14 89 phism 0.61 WCAA d 0.35 0.005 0.38 Loss of catalytic residue at p=1 P449 ( P = 0.0326) Probably Gain of methylation at G465 MCN Deleteri c.1393G>A p.Gly465Arg 14 125 damaging Dis 0.91 DC p=1 0.74 (P = 0.0061) HCAA ous 0.04 0.986 Probably Gain of glycosylation at A469 HCN Deleteri c.1405G>C p.Ala469Pro 14 27 damaging Dis 0.92 DC p=1 0.67 (P = 0.0414) MCAA ous 0.05 0.995 Probably Gain of glycosylation at A510 p.Ala510Thr MCN Deleteri c.1528G>A 15 58 damaging Dis 0.60 DC p=1 0.69 (P = 0.0382) (rs200634290) HCAA ous 0.01 0.937 Probably Gain of sheet ( P = 0.0266) MCN Deleteri c.1976C>T p.Thr659Met 19 81 damaging Dis 0.88 DC p=1 0.63 HCAA ous 0 0.999

Supplementary Table 5. In silico predictions for previously reported CLCNKB missense mutations (not expressed in vitro ) Grantham MutPred Conservation distance 1 Actionable Confident Hypotheses Very Confident Exon/ 2 PolyPhen- SNPs& Mutation Probability of Nucleotide (cDNA) Protein between species (physicoche SIFT 3 4 5 Hypotheses Hypotheses Intron 2 GO Taster deleterious (until C. elegans) mical mutation 6 difference) Probably Loss of glycosylation at S218 ( P HCN Deleterio c.655G>T p.Gly219Cys£ 7 159 damaging Dis 0.93 DC p=1 0.87 = 0.044) HCAA us 0 1 MCN Tolerate Benign DC Gain of catalytic residue at G296 c.887G>A p.Gly296Asp 10 94 Dis 0.90 0.88 WCAA d 0.1 0.013 p=0.91 (P = 0.0154) Gain of MoRF binding ( P = Gain of Polymor NCN Tolerate Benign 0.029) methylation at c.891C>A p.Ser297Arg 10 110 Dis 0.81 phism 0.97 HCAA d 0.06 0.34 S297 ( P = p=0.997 0.0051) Probably Gain of methylation at G424 ( P MCN Deleterio c.1270G>A p.Gly424Arg 13 125 damaging Dis 0.94 DC p=1 0.96 = 0.0379) HCAA us 0 1 Probably MCN Deleterio c.1298G>A p.Gly433Glu 14 98 damaging Dis 0.96 DC p=1 0.97 HCAA us 0 1 Possibly Loss of methylation at R438 ( P MCN Tolerate c.1309G>C p.Gly437Arg 14 125 damaging Dis 0.95 DC p=1 0.91 = 0.0443) HCAA d 0.08 0.75 Gain of helix ( P = 0.0496) Probably MCN Deleterio c.1877G>A p.Cys626Tyr 18 194 damaging Dis 0.83 Pm p=0 0.42 MCAA us 0 0.998 HC: Highly conserved, MC: Moderately conserved, WC: weakly conserved, NC: non conserverved, N nucleortids, AA amino acid 1 Grantham distance: Conservative (0-50), moderately conservative (51-100), moderately radical (101-150), or radical ( ≥151) 2For SIFT: A change is predicted to be deleterious with score<0.05; LC: low prediction confidence. 3For PolyPhen-2: Prediction of probably damaging, possibly damaging, or benign, along with a numerical score ranging from 0.0 (benign) to 1.0 (damaging). A prediction of probably damaging means that the substitution is predicted to be damaging with high confidence, while a prediction of benign means that the substitution is predicted to be benign with high confidence. A prediction of possibly damaging means that the substitution is predicted to be damaging, but with low confidence . 4For SNPs&GO: A change is predicted to be disease associated variation if the probability (p) is >0.5 (D); otherwise is classed as Neutral (N) 5For MutationTaster: Disease causing (DC), Polymorphism (Pm). The probability value (p) is the probability of the prediction, i.e. a value close to 1 indicates a high 'security' of the prediction. 6For MutPred: A general score (g) > 0.75 indicates high probability of deleterious mutation, g from 0.5 to 0.75 indicates low probability of deleterious mutation and g <0.5indicates non deleterious mutation. Additional information about molecular mechanisms is provided where relevant (combinations of high values of general scores and low values of property scores are referred to as hypotheses: scores withgeneral scores > 0.5 and p < 0.05 indicate actionable hypotheses; general scores > 0.75 and p < 0.05 indicate confident hypotheses; general scores > 0.75 and p < 0.01 indicate very confident hypotheses). £This mutation may be a splice-site mutation; Splice-site scores decreased by 77% for MaxEntScan (7.4 to 1.7) and 12% for Human Splice Finder (90 to 79).

Supplementary Table 6: Summary of available renal histology results in patients with type 3 BS

A/N BS A/N BS A/N BS CBS CBS A/N BS A/N BS Left Right

Nephrectomy Nephrectomy Age at biopsy (years) 2 23 28 41 27 6 6,5

Interstitial fibrosis No No Yes Yes Yes Yes Yes

Glomerular hypertrophy No Yes Yes Yes Yes No No Segmental 1/12 4/8 8/15 2/18 5/12 Most Most glomerulosclerosis Glomerular hyalinosis 4/8 3/18 7/12

No Yes Yes Yes Yes Yes Yes Tubular atrophy Tubular vacuolization or Yes Yes Yes No No Yes Yes dilation Tubular or interstitial No No No No No No calcification Juxtaglomerular No No Yes Yes No No No apparatus hypertrophy

Arteriolar wall Yes No Yes Yes Yes thickening hyaline deposits Yes No No No No

Fibrous endarteritis No No Yes

Supplemetary Figure 1. Renal function at last follow-up (or at end stage renal failure) in patients with different BS types. Data after transplantation or dialysis were not reported.

Supplemetary Figure 2. Percentages of different CKD stages between different BS types at last follow-up.

Supplementary Methods

Multiplex ligation-dependent probe amplification (MLPA)

The procedure can be divided into five major steps: 1) denaturation of genomic DNA (20 ng/µl in TE buffer) at 98°C, 2) hybridization of oligonucleotides in the MLPA ® probe mixture to the target sequence, 3) probe ligation with a thermostable ligase, 4) amplification with a pair of primers, one unlabeled and one labeled, complementary to the universal primer sequences of the MLPA ® probes, and 5) fluorescent amplicon separation by capillary electrophoresis on an ABI Prism 3730XL DNA Sequence Analyzer (Applied Biosystems, Foster City, CA). Data were analyzed and normalized with GeneMapper Software version 4.0 (Applied Biosystems, Foster City, CA) and Coffalyser.NET Software (MRC

Holland, Amsterdam, the Netherlands). The threshold ratios for deletions and duplications used here were ≤0.7 and ≥1.35, respectively.

Quantitative multiplex PCR of short fluorescent fragments (QMPSF)

QMPSF is a fluorescent multiplex PCR for the simultaneous amplification of multiple short exon fragments under semi-quantitative conditions. In each QMPSF, a fragment from the hydroxymethylbilane synthase ( HMBS ) gene was amplified as an internal control in each of three multiplex reactions. The 6FAM-labeled amplicons were then separated by capillary electrophoresis on an ABI Prism 3730XL DNA

Sequence Analyzer (Applied Biosystems, Foster City, CA). Data were analyzed with GeneMarker Software version 1.85 (Applied Biosystems,

Foster City, CA).

Supplemetary Table 7. Primers used for QMPSF

Multiplex 1 Forward Reverse Exon 2 CGTTAGATAGGGGCTGCGTGAAGGCTC GATAGGGTTATGTCCTGGACAAATGCCAG 6FAM Exon 3 CGTTAGATAGCAGCAGGCCTCCAAGGAT GATAGGGTTAACCACACTCTCAACAGCCAAGTC 6FAM Exon 4 CGTTAGATAGTGTACCCTGTGGCCCTCGTC GATAGGGTTACGCAGAAGATCCTCCCACCA 6FAM Exon 5 CGTTAGATAGTCCTGCACCCTGGCCTGT 6FAM GATAGGGTTACAGCCCAAGTCCCCTCTGA Exons 9-10 CGTTAGATAGCAGTTTCCGGGTGGACGTT GATAGGGTTAAACCTATTGTTCCTGATGAAGCC 6FAM Exon 11 CGTTAGATAGCTCGCCTCCATCACCTACCC GATAGGGTTATTGGGGGGATTAAGTGAGATACAC 6FAM Multiplex 2 Exon 12 CGTTAGATAGTCGCTGTTCGACAACCACTC GATAGGGTTACCACCAGCTGCGATGAGGT 6FAM Exons 13-14 CGTTAGATAGGTACTTCATGCCCATCTTTGTCTAT 6FAM GATAGGGTTAGTGATCCCTCCAGCCACG Exon 15 CGTTAGATAGCCAGCCTTGCCCTAACATG 6FAM GATAGGGTTAGCACCACTCACCCGATGTT Exon 16 CGTTAGATAGGGGTCTCACATCCCTGACTGT 6FAM GATAGGGTTACCTTGACCACCTCCTCCAGT Exon 19 CGTTAGATAGTGTTGAACCTTCATTCCCTCTTT 6FAM GATAGGGTTATCCCCAGTCTTCTCAGGCATA Multiplex 3 Exons 6-7 CGTTAGATAGCGTGCACCTGTCTGTGATGATG 6FAM GATAGGGTTAGGAGCTGCAAAGACTGTGGC Exon 8 CGTTAGATAGTCCAGGCTGGACGGGTCT 6FAM GATAGGGTTACAGGTGGCCGCAAAGAAG Exons 17-18 CGTTAGATAGGGTGCTAAGTAAATGTGAGTC 6FAM GATAGGGTTACAGCCAAGATGTCCTGGAG Exon 20 CGTTAGATAGGCTCTACTATTTACCCAGAAACCAC 6FAM GATAGGGTTACTGGCGGATTTGTCAGGTT

Bioinformatic analysis of mutations

Missense and splicing mutations were interpreted with Alamut V.2.5.1 software (Interactive Biosoftware, Rouen, France; http://www.interactivebiosoftware.com ). Complementary analyses were performed with SIFT ( http://www.Blocks.fhcrc.org/sift/SIFT.html ), PolyPhen-2 ( http://genetics.bwh.harvard.edu/pph/ ), Mutpred ( http://mutpred.mutdb.org/about.html ), SNPs&Go ( http://snps-and- go.biocomp.unibo.it/snps-and-go/info.htm ) and Mutation Taster (http://www.mutationtaster.org/documentation.htm

SUPPLEMENTARY REFERENCES 1) Bettinelli, A, Borsa, N, Syren, ML, Mattiello, C, Coviello, D, Edefonti, A, Giani, M, Travi, M & Tedeschi, S: Simultaneous mutations in the CLCNKB and SLC12A3 genes in two siblings with phenotypic heterogeneity in classic Bartter syndrome. Pediatr Res, 58 :1269-73, 2005. 2) Fukuyama, S, Hiramatsu, M, Akagi, M, Higa, M & Ohta, T: Novel mutations of the chloride channel Kb gene in two Japanese patients clinically diagnosed as Bartter syndrome with hypocalciuria. J Clin Endocrinol Metab, 89 :5847-50, 2004. 3) Lee, BH, Cho, HY, Lee, H, Han, KH, Kang, HG, Ha, IS, Lee, JH, Park, YS, Shin, JI, Lee, DY, Kim, SY, Choi, Y & Cheong, HI: Genetic basis of Bartter syndrome in Korea. Nephrol Dial Transplant, 27 :1516-21. 4) Nozu, K, Iijima, K, Kanda, K, Nakanishi, K, Yoshikawa, N, Satomura, K, Kaito, H, Hashimura, Y, Ninchoji, T, Komatsu, H, Kamei, K, Miyashita, R, Kugo, M, Ohashi, H, Yamazaki, H, Mabe, H, Otsubo, A, Igarashi, T & Matsuo, M: The pharmacological characteristics of molecular-based inherited salt-losing tubulopathies. J Clin Endocrinol Metab, 95 :E511-8.