DOCSLIB.ORG

Pathways Inflammation-Resolution Lipid Mediator Monooxygenases To

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Pathways Inflammation-Resolution Lipid Mediator Monooxygenases To Contributions of the Three CYP1 Monooxygenases to Pro-Inflammatory and Inflammation-Resolution Lipid Mediator Pathways This information is current as of September 26, 2021. Senad Divanovic, Jesmond Dalli, Lucia F. Jorge-Nebert, Leah M. Flick, Marina Gálvez-Peralta, Nicholas D. Boespflug, Traci E. Stankiewicz, Jonathan M. Fitzgerald, Maheshika Somarathna, Christopher L. Karp, Charles N. Serhan and Daniel W. Nebert Downloaded from J Immunol 2013; 191:3347-3357; Prepublished online 16 August 2013; doi: 10.4049/jimmunol.1300699 http://www.jimmunol.org/content/191/6/3347 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2013/08/20/jimmunol.130069 Material 9.DC1 References This article cites 60 articles, 27 of which you can access for free at: http://www.jimmunol.org/content/191/6/3347.full#ref-list-1 by guest on September 26, 2021 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Contributions of the Three CYP1 Monooxygenases to Pro-Inflammatory and Inflammation-Resolution Lipid Mediator Pathways Senad Divanovic,*,1 Jesmond Dalli,†,1 Lucia F. Jorge-Nebert,‡,1 Leah M. Flick,* Marina Ga´lvez-Peralta,‡ Nicholas D. Boespflug,* Traci E. Stankiewicz,* Jonathan M. Fitzgerald,† Maheshika Somarathna,‡ Christopher L. Karp,*,2,3 Charles N. Serhan,†,2 and Daniel W. Nebert‡,2 All three cytochrome P450 1 (CYP1) monooxygenases are believed to participate in lipid mediator biosynthesis and/or their local inactivation; however, distinct metabolic steps are unknown. We used multiple-reaction monitoring and liquid chromatography- Downloaded from UV coupled with tandem mass spectrometry–based lipid-mediator metabololipidomics to identify and quantify three lipid- mediator metabolomes in basal peritoneal and zymosan-stimulated inflammatory exudates, comparing Cyp1a1/1a2/1b1(2/2) C57BL/6J-background triple-knockout mice with C57BL/6J wild-type mice. Significant differences between untreated triple- knockout and wild-type mice were not found for peritoneal cell number or type or for basal CYP1 activities involving 11 identified metabolic steps. Following zymosan-initiated inflammation, 18 lipid mediators were identified, including members of the eicosa- noids and specialized proresolving mediators (i.e., resolvins and protectins). Compared with wild-type mice, Cyp1 triple-knockout http://www.jimmunol.org/ mice exhibited increased neutrophil recruitment in zymosan-treated peritoneal exudates. Zymosan stimulation was associated with eight statistically significantly altered metabolic steps: increased arachidonic acid–derived leukotriene B4 (LTB4) and decreased 5S-hydroxyeicosatetraenoic acid; decreased docosahexaenoic acid–derived neuroprotectin D1/protectin D1, 17S-hydroxydocosahex- aenoic acid, and 14S-hydroxydocosahexaenoic acid; and decreased eicosapentaenoic acid–derived 18R-hydroxyeicosapentaenoic acid (HEPE), 15S-HEPE, and 12S-HEPE. In neutrophils analyzed ex vivo, elevated LTB4 levels were shown to parallel increased neutrophil numbers, and 20-hydroxy–LTB4 formation was found to be deficient in Cyp1 triple-knockout mice. Together, these results demonstrate novel contributions of CYP1 enzymes to the local metabolite profile of lipid mediators that regulate neutrophilic inflammation. The Journal of Immunology, 2013, 191: 3347–3357. by guest on September 26, 2021 ipid mediators (LMs) derived from polyunsaturated fatty mation. Some are more involved in the initiation phase, whereas oth- acids (Fig. 7A) include .150 chemicals, many of which ers participate more in the resolution phase. L have potent bioactivity (1). The v-6 fatty acid, arachidonic Oxidative biosynthesis of LMs is carried out in multiple steps by acid (AA), is converted to 12 known classes of LMs: PGs, prostacy- specific arachidonate lipoxygenases (encoded by six human genes clins, thromboxanes, leukotrienes (LTs), epoxyeicosatrienoic acids [ALOX5, ALOX12, ALOX12B, ALOX15, ALOX15B,andALOXE3] (EETs), hydroxyeicosatetraenoic acids (HETEs), dihydroxyeicosate- and seven mouse genes [Alox5, Alox12, Alox12b, Alox12e, Alox15, traenoic acids (DHETEs), hydroperoxyeicosatetraenoic acids, v-and Alox8,andAloxe3]). In addition to the cyclooxygenases (COX1, v-1 alcohols, lipoxins, hepoxilins, and eoxins (2–4). AA is well COX2; official names PG G synthase-1 and -2) and arachidonate known to be converted by cytochrome P450 to EETs (5), some of lipoxygenases, there is considerable evidence (2–4) suggesting that which are active in inflammation (6). In contrast, the v-3 fatty acids cytochrome P450 (CYP) monooxygenases participate in the oxi- docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) are dative biosynthesis and inactivation of LMs. Members of the CYP1, converted to resolvins (E-series and D-series), neuroprotectins, and CYP2, CYP3, and CYP4 gene families, as well as CYP5A1 and maresins (2, 3, 7–9). Many v-6 and v-3 LMs participate in inflam- CYP8A1, are involved in biosynthesis and further inactivation of *Division of Cellular and Molecular Immunology, Cincinnati Children’s Hospital Address correspondence and reprint requests to Prof. Daniel W. Nebert, Department Research Foundation, Cincinnati, OH 45229; †Department of Anesthesiology, Peri- of Environmental Health, University of Cincinnati Medical Center, P.O. Box 670056, operative and Pain Medicine, Center for Experimental Therapeutics and Reperfusion Cincinnati, OH 45267-0056. E-mail address: [email protected] Injury, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA The online version of this article contains supplemental material. 02115; and ‡Department of Environmental Health, University of Cincinnati Medical Center, Cincinnati, OH 45267-0056 Abbreviations used in this article: AA, arachidonic acid; CYP, cytochrome P450; ddH O, doubly distilled water; DHA, docosahexaenoic acid; DHETE, dihydroxyei- 1S.D., J.D., and L.F.J.-N. contributed equally to this work and should be considered 2 cosatetraenoic acid; EET, epoxyeicosatrienoic acid; EPA, eicosapentaenoic acid; first authors. HDHA, hydroxydocosahexenoic acid; HEPE, hydroxyeicosapentaenoic acid; HETE, 2The Karp, Serhan, and Nebert laboratories contributed equally to this project. hydroxyeicosatetraenoic acid; LC-MS-MS, liquid chromatography coupled with tan- dem mass spectrometry; LM, lipid mediator; LTA , leukotriene A ;LTB, leukotri- 3Current address: The Bill and Melinda Gates Foundation, Seattle, WA. 4 4 4 ene B4; LXA4, lipoxin A4; MRM, multiple-reaction monitoring; PD1, protectin D1; Received for publication March 18, 2013. Accepted for publication July 19, 2013. RvE2, resolvin E2; TKO, Cyp1a1/1a2/1b1(2/2) triple-knockout on .99.8% C57BL/ 6J background; WT, C57BL/6J wild-type. This work was supported by Cystic Fibrosis Foundation Research Development Program Center Component II Grant (to C.L.K.), National Institutes of General Medical Sciences Ó (Grant P01 GM095467 to C.N.S.), and National Institute of Environmental Health Sci- Copyright 2013 by The American Association of Immunologists, Inc. 0022-1767/13/$16.00 ences (Grant T32 ES016646 to M.G.-P. and Grants R01 ES008147, R01 ES014403, and P30 ES06096 to D.W.N.). www.jimmunol.org/cgi/doi/10.4049/jimmunol.1300699 3348 CYP1-DEPENDENT LIPID MEDIATOR SIGNATURES DURING INFLAMMATION LMs (10). Although some P450-mediated specific reactions of Animals bioactive LMs have been described (reviewed in Ref. 4), the vast Generation of the TKO mouse line was described (17). TKO animals were majority remains to be determined, largely because of the tech- backcrossed for .10 generations onto C57BL/6J to ensure a genetic back- nical challenges involved in identifying LMs, particularly with ground that was .99.8% similar (19) to WT C57BL/6J mice. All TKO mice regard to stereochemistry. used in the experiments were age matched with WT controls. We found that The CYP1 gene family encodes three enzymes (CYP1A1, mice provided with regular laboratory chow gave highly variable results. Therefore, both WT and TKO mice were maintained, from prior to con- CYP1A2, and CYP1B1) in both human and mouse that are evo- ception, on flavone-free Laboratory Chow Diet 5001. This diet is designed to lutionarily highly conserved, suggesting that mouse CYP1 data assure minimal inherent biological variation in long-term studies because it may likely be extrapolated to human CYP1 functions. In contrast, is enriched with v-3 essential fatty acids (http://www.labdiet.com); indeed, the CYP2, CYP3, and CYP4 families are far more complex due to the 5001 diet provided us with highly reproducible data. Results appeared to be more consistent in males than in females; subsequently, for all experi- multiple gene-duplication events followed by “genetic drift” during ments described in this article we studied males only, between 50
Load more

Recommended publications
  • Studies on CYP1A1, CYP1B1 and CYP3A4 Gene Polymorphisms in Breast Cancer Patients
    Ginekol Pol. 2009, 80, 819-823 PRACE ORYGINALNE ginekologia Studies on CYP1A1, CYP1B1 and CYP3A4 gene polymorphisms in breast cancer patients Badania polimorfizmów genów CYP1A1, CYP1B1 i CYP3A4 u chorych z rakiem piersi Ociepa-Zawal Marta1, Rubiś Błażej2, Filas Violetta3, Bręborowicz Jan3, Trzeciak Wiesław H1. 1 Department of Biochemistry and Molecular Biology, Poznan University of Medical Sciences 2 Department of Clinical Chemistry and Molecular Diagnostics, 3Department of Tumor Pathology, Poznan University of Medical Sciences Abstract Background: The role of CYP1A1, CYP1B1 and CYP3A4 polymorphism in pathogenesis of breast cancer has not been fully elucidated. From three CYP1A1 polymorphisms *2A (3801T>C), *2C (2455A>G), and *2B variant, which harbors both polymorphisms, the *2A variant is potentially carcinogenic in African Americans and the Taiwanese, but not in Caucasians, and the CYP1B1*2 (355G>T) and CYP1B1*3 (4326C>G) variants might increase breast cancer risk. Although no association of any CYP3A4 polymorphisms and breast cancer has been documented, the CYP3A4*1B (392A>G) variant, correlates with earlier menarche and endometrial cancer secondary to tamoxifen therapy. Objective: The present study was designed to investigate the frequency of CYP1A1, CYP1B1 and CYP3A4 po- lymorphisms in a sample of breast cancer patients from the Polish population and to correlate the results with the clinical and laboratory findings. Material and methods: The frequencies of CYP1A1*2A; CYP1A1*2C; CYP1B1*3; CYP3A4*1B CYP3A4*2 polymorphisms were determined in 71 patients aged 36-87, with primary breast cancer and 100 healthy indi- viduals. Genomic DNA was extracted from the tumor, and individual gene fragments were PCR-amplified.
    [Show full text]
  • Cytochrome P450 Enzymes in Oxygenation of Prostaglandin Endoperoxides and Arachidonic Acid
    Comprehensive Summaries of Uppsala Dissertations from the Faculty of Pharmacy 231 _____________________________ _____________________________ Cytochrome P450 Enzymes in Oxygenation of Prostaglandin Endoperoxides and Arachidonic Acid Cloning, Expression and Catalytic Properties of CYP4F8 and CYP4F21 BY JOHAN BYLUND ACTA UNIVERSITATIS UPSALIENSIS UPPSALA 2000 Dissertation for the Degree of Doctor of Philosophy (Faculty of Pharmacy) in Pharmaceutical Pharmacology presented at Uppsala University in 2000 ABSTRACT Bylund, J. 2000. Cytochrome P450 Enzymes in Oxygenation of Prostaglandin Endoperoxides and Arachidonic Acid: Cloning, Expression and Catalytic Properties of CYP4F8 and CYP4F21. Acta Universitatis Upsaliensis. Comprehensive Summaries of Uppsala Dissertations from Faculty of Pharmacy 231 50 pp. Uppsala. ISBN 91-554-4784-8. Cytochrome P450 (P450 or CYP) is an enzyme system involved in the oxygenation of a wide range of endogenous compounds as well as foreign chemicals and drugs. This thesis describes investigations of P450-catalyzed oxygenation of prostaglandins, linoleic and arachidonic acids. The formation of bisallylic hydroxy metabolites of linoleic and arachidonic acids was studied with human recombinant P450s and with human liver microsomes. Several P450 enzymes catalyzed the formation of bisallylic hydroxy metabolites. Inhibition studies and stereochemical analysis of metabolites suggest that the enzyme CYP1A2 may contribute to the biosynthesis of bisallylic hydroxy fatty acid metabolites in adult human liver microsomes. 19R-Hydroxy-PGE and 20-hydroxy-PGE are major components of human and ovine semen, respectively. They are formed in the seminal vesicles, but the mechanism of their biosynthesis is unknown. Reverse transcription-polymerase chain reaction using degenerate primers for mammalian CYP4 family genes, revealed expression of two novel P450 genes in human and ovine seminal vesicles.
    [Show full text]
  • OCA) Is Controlled
    DMD Fast Forward. Published on November 5, 2020 as DOI: 10.1124/dmd.120.000240 This article has not been copyedited and formatted. The final version may differ from this version. Title page Regulation of intestinal UGT1A1 by the FXR agonist obeticholic acid (OCA) is controlled by CAR through intestinal maturation Downloaded from André A. Weber1, Elvira Mennillo1, Xiaojing Yang1, Lori W.E. van der Schoor2, Johan W. Jonker2, Shujuan Chen1, Robert H. Tukey1,* dmd.aspetjournals.org 1Laboratory of Environmental Toxicology, Department of Pharmacology, University of California, San Diego, La Jolla, CA 92093, USA. at ASPET Journals on September 25, 2021 2Center for Liver, Digestive and Metabolic Diseases, Department of Pediatrics, University of Groningen, University Medical Center Groningen, 9713 GZ Groningen, The Netherlands. Address correspondence to: Robert H. Tukey, Department of Pharmacology, University of California, San Diego 92093-0722. E-mail: [email protected] 1 DMD Fast Forward. Published on November 5, 2020 as DOI: 10.1124/dmd.120.000240 This article has not been copyedited and formatted. The final version may differ from this version. Running title page Running title: CAR activation by OCA induces UGT1A1 and IEC maturation Corresponding author: Robert H. Tukey, Department of Pharmacology, University of California, San Diego 9500 Gilman Drive, La Jolla, California, 92093-0722. E-mail: [email protected] Text pages: 16 (Abstract – Discussion, not including references and figure legends) Downloaded from Tables: 1 Figures: 7
    [Show full text]
  • Eicosanoids Mediate Insect Nodulation Responses to Bacterial Infections (Cyclooxygenase/Lipoxygenase/Phospholipase A2/Manduca Sexta/Serratia Marcescens) JON S
    Proc. Natl. Acad. Sci. USA Vol. 91, pp. 12418-12422, December 1994 Physiology Eicosanoids mediate insect nodulation responses to bacterial infections (cyclooxygenase/lipoxygenase/phospholipase A2/Manduca sexta/Serratia marcescens) JON S. MILLER, TUANH NGUYEN, AND DAVID W. STANLEY-SAMUELSON* Insect Biochemistry/Physiology Laboratory, Department of Entomology, University of Nebraska, Lincoln, NE 68583-0816 Communicated by Wendell L. Roelofs, September 12, 1994 (receivedfor review August 11, 1993) ABSTRACT We propose that nodule formation is medi- inhibiting eicosanoid biosynthesis. On the basis of these ated by eicosanoids in insects. Nodulation is the temporally and findings, we proposed that eicosanoid products of the cyclo- quantitatively predominant cellular defense response to bac- oxygenase and lipoxygenase pathways are involved in insect terial infection in insects and other invertebrates. Inhibition of immune responses to bacterial infections. Because most of eicosanoid biosynthesis in larvae of the tobacco hornworn our experiments were done during the first hour postinfection Manduca sexta immediately prior to intrahemocoelic infections (PI), long before the appearance of antibacterial proteins in with the bacterium Serratia marcescens strongly reduced the insect hemolymph, we suggested that eicosanoids mediate nodulation response. Inhibition of eicosanoid biosynthesis also one or more hemocytic defense responses (6). reduced formation of cellular aggregates at 1 hr postinfection, This suggestion opens a crucial question: which
    [Show full text]
  • Interactions Between the Parasite Philasterides Dicentrarchi and the Immune System of the Turbot Scophthalmus Maximus.A Transcriptomic Analysis
    biology Article Interactions between the Parasite Philasterides dicentrarchi and the Immune System of the Turbot Scophthalmus maximus.A Transcriptomic Analysis Alejandra Valle 1 , José Manuel Leiro 2 , Patricia Pereiro 3 , Antonio Figueras 3 , Beatriz Novoa 3, Ron P. H. Dirks 4 and Jesús Lamas 1,* 1 Department of Fundamental Biology, Institute of Aquaculture, Campus Vida, University of Santiago de Compostela, 15782 Santiago de Compostela, Spain; [email protected] 2 Department of Microbiology and Parasitology, Laboratory of Parasitology, Institute of Research on Chemical and Biological Analysis, Campus Vida, University of Santiago de Compostela, 15782 Santiago de Compostela, Spain; [email protected] 3 Institute of Marine Research, Consejo Superior de Investigaciones Científicas-CSIC, 36208 Vigo, Spain; [email protected] (P.P.); antoniofi[email protected] (A.F.); [email protected] (B.N.) 4 Future Genomics Technologies, Leiden BioScience Park, 2333 BE Leiden, The Netherlands; [email protected] * Correspondence: [email protected]; Tel.: +34-88-181-6951; Fax: +34-88-159-6904 Received: 4 September 2020; Accepted: 14 October 2020; Published: 15 October 2020 Simple Summary: Philasterides dicentrarchi is a free-living ciliate that causes high mortality in marine cultured fish, particularly flatfish, and in fish kept in aquaria. At present, there is still no clear picture of what makes this ciliate a fish pathogen and what makes fish resistant to this ciliate. In the present study, we used transcriptomic techniques to evaluate the interactions between P. dicentrarchi and turbot leucocytes during the early stages of infection. The findings enabled us to identify some parasite genes/proteins that may be involved in virulence and host resistance, some of which may be good candidates for inclusion in fish vaccines.
    [Show full text]
  • The Role of Ferroptosis in Breast Cancer Patients: a Comprehensive Analysis Zeng-Hong Wu1,2, Yun Tang3,Hongyu1 and Hua-Dong Li4
    Wu et al. Cell Death Discovery (2021) 7:93 https://doi.org/10.1038/s41420-021-00473-5 Cell Death Discovery ARTICLE Open Access The role of ferroptosis in breast cancer patients: a comprehensive analysis Zeng-Hong Wu1,2, Yun Tang3,HongYu1 and Hua-Dong Li4 Abstract Breast cancer (BC) affects the breast tissue and is the second most common cause of mortalities among women. Ferroptosis is an iron-dependent cell death mode that is characterized by intracellular accumulation of reactive oxygenspecies(ROS).Weconstructed a prognostic multigene signature based on ferroptosis-associated differentially expressed genes (DEGs). Moreover, we comprehensively analyzed the role of ferroptosis-associated miRNAs, lncRNAs, and immune responses. A total of 259 ferroptosis-related genes wereextracted.KEGGfunction analysis of these genes revealed that they were mainly enriched in the HIF-1 signaling pathway, NOD-like receptor signaling pathway, central carbon metabolism in cancer, and PPAR signaling pathway. Fifteen differentially expressed genes (ALOX15, ALOX15B, ANO6, BRD4, CISD1, DRD5, FLT3, G6PD, IFNG, NGB, NOS2, PROM2, SLC1A4, SLC38A1,andTP63) were selected as independent prognostic factors for BC patients. Moreover, T cell functions, including the CCR score, immune checkpoint, cytolytic activity, HLA, inflammation promotion, para-inflammation, T cell co-stimulation, T cell co-inhibition, and type II INF responses were significantly different between the low- risk and high-risk groups of the TCGA cohort. Immune checkpoints between the two groups revealed that the expressions of PDCD-1 (PD-1), CTLA4, LAG3, TNFSF4/14, TNFRSF4/8/9/14/18/25,andIDO1/2 among others were significantly different. A total of 1185 ferroptosis-related lncRNAs and 219 ferroptosis-related miRNAs were also included in this study.
    [Show full text]
  • Genetic Polymorphisms in Steroid Hormone Metabolizing Enzymes In
    TurkJMedSci 32(2002)217-221 ©TÜB‹TAK NeslihanAYGÜNKOCABAfi GeneticPolymorphismsinSteroidHormone MetabolizingEnzymesinHumanBreastCancer Abstract: Epidemiologicstudiesindicatethat metabolism(i.e., CYP17,CYP19,CYP1A1, Received:July04,2001 mostriskfactorsforbreastcancerarerelated CYP1B1,MnSOD,COMT,andGST)thatmay toreproductiveandhormonalfactors.The accountforaproportionofenzymatic evaluationofassociationsbetweenbreast variability.Anevaluationofassociations cancerriskandgeneticpolymorphismsin betweenbreastcancerriskandgenetic enzymesinvolvedinhormonemetabolism polymorphismsinenzymesinvolvedin maybeacosteffectivemannerinwhichto hormonemetabolismisdescribedinthisbrief determineindividualbreastcancer review. susceptibility.Anumberofmolecular DepartmentofToxicology,Facultyof epidemiologicstudieshavebeenconductedto evaluateassociationsbetweenpolymorphic KeyWords : Breastcancer,Genetic Pharmacy,GaziUniversity06330Hipodrom polymorphism,Steroidhormonemetabolism Ankara,Turkey genesinvolvedinsteroidhormone Breastcanceristhemostcommonlyoccurringcancer Metabolicactivationof17 β-estradiol(E2)hasbeen amongwomen,andthemorbidityrateofthisdisease postulatedtobeafactorinmammarycarcinogenesis.E2 continuestorise,whereasthemortalityrateisdeclining ismetabolizedviatwomajorpathways:formationof duetomoreadvanceddiagnosisandtreatment catecholestrogens,the2-OHand4-OHderivates;andC- techniques(1).Fewerbreastcancercasescanbe 16α hydroxylation(Figure).The2-OHand4-OHcatechol explainedbyrare,highlypenetrantgenessuchasBRCA1, estrogensareoxidizedtosemiquinonesandquinones. BRCA2
    [Show full text]
  • Quantitative Proteomics Analysis of Young and Elderly Skin with DIA Mass Spectrometry Reveals New Skin Aging-Related Proteins
    www.aging-us.com AGING 2020, Vol. 12, No. 13 Research Paper Quantitative proteomics analysis of young and elderly skin with DIA mass spectrometry reveals new skin aging-related proteins Jing Ma1,2, Mengting Liu1,2, Yaochi Wang1,2, Cong Xin1,2, Hui Zhang1,2, Shirui Chen1,2, Xiaodong Zheng1,2, Xuejun Zhang1,2, Fengli Xiao1,2,3, Sen Yang1,2 1Department of Dermatology of First Affiliated Hospital, and Institute of Dermatology, Anhui Medical University, Hefei, Anhui, China 2Key Laboratory of Dermatology, Anhui Medical University, Ministry of Education, Hefei, Anhui, China 3The Center for Scientific Research of Anhui Medical University, Hefei, Anhui, China Correspondence to: Fengli Xiao, Sen Yang; email: [email protected], [email protected] Keywords: aging, epidermal proteins, skin rejuvenation and aging, proteome, mass spectrometer Received: February 25, 2020 Accepted: May 27, 2020 Published: June 29, 2020 Copyright: Ma et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Skin aging is a specific manifestation of the physiological aging process that occurs in virtually all organisms. In this study, we used data independent acquisition mass spectrometry to perform a comparative analysis of protein expression in volar forearm skin samples from of 20 healthy young and elderly Chinese individuals. Our quantitative proteomic analysis identified a total of 95 differentially expressed proteins (DEPs) in aged skin compared to young skin. Enrichment analyses of these DEPs (57 upregulated and 38 downregulated proteins) based on the GO, KEGG, and KOG databases revealed functional clusters associated with immunity and inflammation, oxidative stress, biosynthesis and metabolism, proteases, cell proliferation, cell differentiation, and apoptosis.
    [Show full text]
  • (ALOX15B) (NM 001039130) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC214018 15 Lipoxygenase 2 (ALOX15B) (NM_001039130) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: 15 Lipoxygenase 2 (ALOX15B) (NM_001039130) Human Tagged ORF Clone Tag: Myc-DDK Symbol: ALOX15B Synonyms: 15-LOX-2 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 15 Lipoxygenase 2 (ALOX15B) (NM_001039130) Human Tagged ORF Clone – RC214018 ORF Nucleotide >RC214018 representing NM_001039130 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCGAGTTCAGGGTCAGGGTGTCCACCGGAGAAGCCTTCGGGGCTGGCACATGGGACAAAGTGTCTG TCAGCATCGTGGGGACCCGGGGAGAGAGCCCCCCACTGCCCCTGGACAATCTCGGCAAGGAGTTCACTGC GGGCGCTGAGGAGGACTTCCAGGTGACGCTCCCGGAGGACGTAGGCCGAGTGCTGCTGCTGCGCGTGCAC AAGGCGCCCCCAGTGCTGCCCCTGCTGGGGCCCCTGGCCCCGGATGCCTGGTTCTGCCGCTGGTTCCAGC TGACACCGCCGCGGGGCGGCCACCTCCTCTTCCCCTGCTACCAGTGGCTGGAGGGGGCGGGGACCCTGGT GCTGCAGGAGGGTACAGCCAAGGTGTCCTGGGCAGACCACCACCCTGTGCTCCAGCAACAGCGCCAGGAG GAGCTTCAGGCCCGGCAGGAGATGTACCAGTGGAAGGCTTACAACCCAGGTTGGCCTCACTGCCTGGATG AAAAGACAGTGGAAGACTTGGAGCTCAATATCAAATACTCCACAGCCAAGAATGCCAACTTTTATCTACA
    [Show full text]
  • Topic 3.1 Interactions of Xenobiotics with the Steroid Hormone Biosynthesis Pathway*
    Pure Appl. Chem., Vol. 75, Nos. 11–12, pp. 1957–1971, 2003. © 2003 IUPAC Topic 3.1 Interactions of xenobiotics with the steroid hormone biosynthesis pathway* Thomas Sanderson‡ and Martin van den Berg Institute for Risk Assessment Science, Utrecht University, P.O. Box 8017, 3508 TD Utrecht, The Netherlands Abstract: Environmental contaminants can potentially disrupt endocrine processes by inter- fering with the function of enzymes involved in steroid synthesis and metabolism. Such in- terferences may result in reproductive problems, cancers, and toxicities related to (sexual) differentiation, growth, and development. Various known or suspected endocrine disruptors interfere with steroidogenic enzymes. Particular attention has been given to aromatase, the enzyme responsible for the conversion of androgens to estrogens. Studies of the potential for xenobiotics to interfere with steroidogenic enzymes have often involved microsomal frac- tions of steroidogenic tissues from animals exposed in vivo, or in vitro exposures of steroid- ogenic cells in primary culture. Increasingly, immortalized cell lines, such as the H295R human adrenocortical carcinoma cell line are used in the screening of effects of chemicals on steroid synthesis and metabolism. Such bioassay systems are expected to play an increasingly important role in the screening of complex environmental mixtures and individual contami- nants for potential interference with steroidogenic enzymes. However, given the complexities in the steroid synthesis pathways and the biological activities of the hormones, together with the unknown biokinetic properties of these complex mixtures, extrapolation of in vitro effects to in vivo toxicities will not be straightforward and will require further, often in vivo, inves- tigations. INTRODUCTION There is increasing evidence that certain environmental contaminants have the potential to disrupt en- docrine processes, which may result in reproductive problems, certain cancers, and other toxicities re- lated to (sexual) differentiation, growth, and development.
    [Show full text]
  • Clozapine and Levomepromazine Induce the Cytochrome P450 Isoenzyme CYP3A4, but Not CYP1A1/2, in Human Hepatocytes P
    P.3.c.012 Clozapine and levomepromazine induce the cytochrome P450 isoenzyme CYP3A4, but not CYP1A1/2, in human hepatocytes P. Danek, A. Basińska-Ziobroń, W.A. Daniel, J. Wójcikowski Institute of Pharmacology, Polish Academy of Sciences, Kraków, Poland Introduction CYP1A1/2 and CYP3A4 are jointly involved in the metabolism of ca. 70% of all the marked drugs. Induction of cytochrome P450 isoenzymes is one of the most common causes of undesired drug–drug interactions. In the case of therapeutic agents active in their parent form, induction increases their elimination rate and reduces the desired pharmacological effect, whereas as regards pro-drugs, the enhanced formation of their active metabolite(s) may produce an increased pharmacological effect. The aim of the present study was to ascertain whether the neuroleptics with different chemical structures and mechanisms of pharmacological action clozapine and levomepromazine may induce CYP1A1/2 and CYP3A4 in human liver. Methods Experiments were performed in vitro using inducible-qualified human cryopreserved hepatocytes from three different donors (Thermo Fisher Scientific, Walthman, MA, USA). For the treatment of cells, the neuroleptics were added to the culture medium at therapeutic concentrations of 0.25, 0.75 and 2.5 μM for levomepromazine and 1, 2.5 and 10 μM for clozapine. Each treatment lasted 72 h and was renewed every 24 h when the culture medium was changed. Afterwards, the culture medium was changed to a medium without the neuroleptics, but containing the CYP isoform-specific substrates, i.e. 1000 μM caffeine (CYP1A1/2) or 200 μM testosterone (CYP3A4). CYP isoenzyme activities were determined in the culture medium using the following CYP isoform- specific reactions: caffeine 3-N-demethylation (CYP1A1/2) and testosterone 6β-hydroxylation (CYP3A4).
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]