DOCSLIB.ORG

Chromosomal Mapping of the Tankyrase Gene in Human and Mouse Lingxiang Zhu,* Susan Smith,† Titia De Lange,† ,1 and Michael F

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Chromosomal Mapping of the Tankyrase Gene in Human and Mouse Lingxiang Zhu,* Susan Smith,† Titia De Lange,† ,1 and Michael F All articles available online at http://www.idealibrary.com on BRIEF MAPPING REPORTS Chromosomal Mapping of the Tankyrase Gene in Human and Mouse Lingxiang Zhu,* Susan Smith,† Titia de Lange,† ,1 and Michael F. Seldin* FIG. 1. Chromosomal localization of Tnks. The segregation of these genes among flanking genetic loci on mouse chromosome 8 in *Rowe Program in Genetics, Department of Biological Chemistry and [(C3H/HeJ-gld 3 Mus spretus)F1 3 C3H/HeJ-gld] interspecific back- Department of Medicine, University of California at Davis, cross mice is shown. Filled boxes represent the homozygous C3H Davis, California 95616; †The Rockefeller University, pattern and open boxes the F1 pattern. The number of mice with New York, New York 10021 each haplotype is shown in each column. The mapping of the refer- Received November 16, 1998; accepted January 27, 1999 ence loci as well as the relationship to other mouse chromosomal markers is available on the Internet: use htpp://www.informatics. jax.org/crossdata.html to enter DNA Mapping Panel Data Sets from MGD, then select the Seldin cross and Chromosome. A consensus map position of 18 cM on mouse chromosome 8 is derived from Functional gene description: Tankyrase (TNKS) is a interpolation using the most recent composite map (http://www. novel gene with homology to both ankyrins and the cata- informatics.jax.org/bin/ccr/current/index). lytic domain of poly(ADP-ribose) polymerase (PARP) that was recently cloned using a yeast two-hybrid screen with the telomere-specific DNA binding protein TRF1 (1). Tankyrase protein is located at telomeres, centrosomes, Flanking markers used: The human location was de- and nuclear pore complexes (1; S. Smith and T. de Lange, fined relative to the large number of markers typed in the in preparation). In vitro studies have demonstrated that Stanford G3 radiation hybrid panel (http://www-shgc. tankyrase has PARP activity and that both tankyrase and stanford.edu/RH/index.html). The strongest linked marker TRF1 can function as acceptors for ADP ribosylation. Since was AFM193xh4. For the mouse, the mapping of the ref- ADP ribosylation of TRF1 decreases its telomeric DNA erence loci (Fig. 1) as well as the relationship to other binding activity in vitro, the TNKS gene may function by mouse chromosomal markers is available on the Internet: modulating telomere length. use htpp://www.informatics.jax.org/crossdata.html to en- Description of clone or DNA: For human TNKS map- ter DNA Mapping Panel Data Sets from MGD, then select ping, a PCR specific for the TNKS gene was utilized. The the Seldin cross and Chromosome. primers (forward, 59CGAAGTGCTAGGGGAGTCCG; re- Method of mapping: The human chromosomal loca- verse, 59GTGGGAGAGGCTGGG GTGGT) amplified a tion of TNKS was defined using the Stanford G3 radiation 169-bp fragment from the TNKS gene (Accession No. hybrid map. The mouse chromosomal location was defined AFO82556). For mouse Tnks mapping, a mouse EST (Acces- using a panel of DNA samples from a well-characterized sion No. AA415426) that had 98% sequence homology with interspecific cross. Informative restriction fragments that human TNKS was used. segregated in the interspecific cross were identified on Source: The source of cDNA, as described above, was Southern blot hybridization using a cDNA probe specific sequence from a human cDNA clone and a mouse cDNA for Tnks according to methods previously described (2): clone. PstI fragments (C3H/HeJ-gld, 1.3 kb; Mus spretus, 3.5 kb). Results: For human, TNKS was positioned at 17.6 Method used to validate gene identity: Gene identity cR on human chromosome 8 with a LOD of 8.2 on the was validated by specific amplification and, for the mouse 10000 G3 map. The 1000:1 confidence interval is 6–30 cM (Ge´ne´- EST, stringent hybridization to a single disparate-sized re- thon position) of chromosome 8. For the mouse, comparison striction fragment in the two species of mouse used in the of the haplotype distribution of the Tnks-specific polymor- mapping panel. phisms and those previously defined in this interspecific cross (Fig. 1) indicated the following relationships (6stan- Supported by HG00734 (M.F.S.) and grants to T.d.L. from the NIH dard error): on mouse chromosome 8, centromere–Adrb3– (GM49046 and CA76027), the Rita Allen Foundation, and the San- 7.9 6 2.5 cM–Tnks, D8Mit24–10.5 6 2.9 cM–Glra3. This doz Foundation. T.d.L. is a recipient of the Burroughs Wellcome corresponds at a consensus position of 18 cM on mouse Fund Scholar Award in Toxicology. S.S. is a Leukemia Society of America Special Fellow. Sequence data from this article have been chromosome 8 and helps define the homology relationship deposited with the Mouse Genome Database under Accession No. between regions of human and mouse chromosome 8 (see J:51381. http:/www.ncbi.nlm.nih.gov/Homology/http://www.ncbi. 1 To whom correspondence should be addressed. Telephone: (530) nlm.nih.gov/genemap/).Interestingly TNKS/Tnks map to 754-6017. Fax: (530) 754-6015. E-mail: [email protected]. positions close to ankyrin 1 (ANK1/Ank1) located on hu- Genomics 57, 320–321 (1999) 320 Article ID geno.1999.5771 0888-7543/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved. BRIEF MAPPING REPORTS 321 man chromosome 8 (60.0–65.8 cM) and mouse chromo- the complete NBC3 gene (SLC4A7) and mapped it to chro- some 8 (9.5 cM). TNKS is more closely related to the ANK1 mosome 3p22. gene than to other ank repeat-containing genes; the ank Name of clone or DNA: A BAC human genomic DNA repeat is 39% identical to the repeat domain in ANK1, clone, 15, containing the entire human NBC3 gene was used suggesting a common derivation. It is notable that these for FISH analysis. results exclude Tnks as a candidate gene for the recently identified locus on distal mouse chromosome 2 that has Description of clone: Primers designed for screening 9 been implicated in telomere regulation in the mouse (3). the BAC human library were 5 -CTGCAACAGTGTCAA- TAAGTCATG-39 and 59-ACTGAAGTCATGAACACA- Homologies: Homologies are as indicated above. GAGAGGC-39. The 160-bp PCR product was derived from exon 20. References Source: The BAC clone 15 was isolated using a PCR- 1. Smith, S., Giriat, I., Schmitt, A., and de Lange, T. (1998). based screen of a human genomic BAC DNA library (Genome Tankyrase, a poly(ADP-ribose) polymerase at human telomeres. Systems). Science 282: 1484–1487. 2. Watson, M. L., and Seldin, M. F. (1994). Application of mouse Method used to validate gene identity: A series of crosses towards defining the genetics of disease phenotypes. primers was designed based on the known mNBC3 cDNA Methods Mol. Genet. 5: 369–387. sequence (5). These primers were used for cycle sequencing of 3. Zhu, L., Hathcock, K. S., Hande, P., Lansdorp, P. M., Seldin, the BAC clone 15. Sequences at the intron–exon boundaries M. F., and Hodes, R. J. (1998). Telomere length regulation in of the NBC3 gene were determined by aligning the cDNA mice is linked to a novel chromosome locus. Proc. Natl. Acad. Sci. sequence with the genomic sequence. USA 95: 8648–8653. Flanking markers: No flanking markers were used. Method of mapping: The chromosomal localization of the NBC3 gene was determined by fluorescence in situ hy- Mapping of the Human NBC3 bridization using as a probe the BAC genomic clone 15 con- taining this gene. DNA from clone 15 was identified by se- (SLC4A7) Gene to Chromosome 3p22 quencing and was then labeled with digoxigenin–dUTP by nick-translation. Labeled probe was combined with sheared Alexander Pushkin, Natalia Abuladze, Ivan Lee, human DNA and hybridized to normal metaphase chromo- 1 Debra Newman, James Hwang, and Ira Kurtz somes derived from phytohemagglutinin-stimulated periph- eral blood lymphocytes. Specific hybridization signals were Division of Nephrology, Center for Health Sciences, detected by incubating the hybridized slides in fluorescein- University of California at Los Angeles School of Medicine, Los Angeles, California 90095-1698 ated antidigoxigenin antibodies followed by counterstaining with DAPI for one-color experiments. Probe detection for Received December 2, 1998; accepted February 3, 1999 two-color experiments was accomplished by incubating the slides in fluoresceinated antidigoxigenin antibodies and Texas red avidin followed by counterstaining with DAPI. A total of 80 metaphase cells were analyzed with 74 exhibiting Functional gene description: NBC3, designated SLC4A7, specific labeling. is a new member of the sodium bicarbonate cotransporter Results: The initial experiment resulted in specific label- (NBC) family (6) cloned from a human muscle cDNA library ing of the short arm of a group A chromosome, which was (5). Muscle NBC3 (mNBC3) encodes a 1214-residue polypep- believed to be chromosome 3 on the basis of size, morphology, tide with 12 putative membrane-spanning domains. mNBC3 and banding pattern. A second experiment was conducted in is 78% homologous to NBC2 (3) and 39 and 46% homologous which a biotin-labeled probe that is specific for the centro- to pNBC1 and kNBC1, respectively (1, 2). The mNBC3 tran- mere of chromosome 3 was cohybridized with clone 15. This script is strongly expressed in skeletal muscle with less ex- experiment resulted in specific labeling of the centromere pression in heart. To begin to understand the genetic factors and the arm of chromosome 3. Measurement of 10 specifically responsible for this pattern of expression, we have isolated labeled chromosomes 3 demonstrated that NBC3 maps to a position that is 64% of the distance from the centromere to This work was supported by NIH Grant DK46976, the Iris and B. Gerald Cantor Foundation, the Max Factor Family Foundation, the the telomere of chromosome arm 3p, an area that corre- Verna Harrah Foundation, the Richard and Hinda Rosenthal Foun- sponds to band 3p22 (Fig.
Load more

Recommended publications
  • Rat Anti-TERF1 Monoclonal Antibody, Clone 683D (CABT-RM172) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
    Rat Anti-TERF1 monoclonal antibody, clone 683D (CABT-RM172) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Specificity Specifically detects murine Telomeric repeat-binding factor 1 (TRF1). Target TERF1 Immunogen His-tagged full-length recombinant mouse Telomeric repeat-binding factor 1 (TRF1). Isotype IgG1, κ Source/Host Rat Species Reactivity Mouse Clone 683D Purification Protein G purified Conjugate unconjugated Applications FC, ICC, IF, WB Molecular Weight ~51 kDa observed; 48.22 kDa calculated. Uncharacterized bands may be observed in some lysate(s). Format Liquid Size 100 μg, 25 μg Buffer 0.1 M Tris-Glycine (pH 7.4), 150 mM NaCl Preservative 0.05% sodium azide Storage Stable for 1 year at 2-8°C from date of receipt. Warnings Unless otherwise stated in our catalog or other company documentation accompanying the product(s), our products are intended for research use only and are not to be used for any other purpose, which includes but is not limited to, unauthorized commercial uses, in vitro diagnostic uses, ex vivo or in vivo therapeutic uses or any type of consumption or application to humans or animals. 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved BACKGROUND Introduction Telomeric repeat-binding factor 1 is encoded by the Terf1 gene in murine species. TRF1 is a component of the shelterin complex that is involved in the regulation of telomere length and protection. It binds to telomeric DNA as a homodimer and protects telomeres.
    [Show full text]
  • Whole Proteome Analysis of Human Tankyrase Knockout Cells Reveals Targets of Tankyrase- Mediated Degradation
    ARTICLE DOI: 10.1038/s41467-017-02363-w OPEN Whole proteome analysis of human tankyrase knockout cells reveals targets of tankyrase- mediated degradation Amit Bhardwaj1, Yanling Yang2, Beatrix Ueberheide2 & Susan Smith1 Tankyrase 1 and 2 are poly(ADP-ribose) polymerases that function in pathways critical to cancer cell growth. Tankyrase-mediated PARylation marks protein targets for proteasomal 1234567890 degradation. Here, we generate human knockout cell lines to examine cell function and interrogate the proteome. We show that either tankyrase 1 or 2 is sufficient to maintain telomere length, but both are required to resolve telomere cohesion and maintain mitotic spindle integrity. Quantitative analysis of the proteome of tankyrase double knockout cells using isobaric tandem mass tags reveals targets of degradation, including antagonists of the Wnt/β-catenin signaling pathway (NKD1, NKD2, and HectD1) and three (Notch 1, 2, and 3) of the four Notch receptors. We show that tankyrases are required for Notch2 to exit the plasma membrane and enter the nucleus to activate transcription. Considering that Notch signaling is commonly activated in cancer, tankyrase inhibitors may have therapeutic potential in targeting this pathway. 1 Kimmel Center for Biology and Medicine at the Skirball Institute, Department of Pathology, New York University School of Medicine, New York, NY 10016, USA. 2 Proteomics Laboratory, Department of Biochemistry and Molecular Pharmacology, New York University School of Medicine, New York, NY 10016, USA. Correspondence and requests for materials should be addressed to S.S. (email: [email protected]) NATURE COMMUNICATIONS | 8: 2214 | DOI: 10.1038/s41467-017-02363-w | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/s41467-017-02363-w ankyrases function in cellular pathways that are critical to function in human cells will provide insights into the clinical cancer cell growth including telomere cohesion and length utility of tankyrase inhibitors.
    [Show full text]
  • Mayer-Rokitansky-Küster- Hauser Syndrome
    Morcel et al. Orphanet Journal of Rare Diseases 2011, 6:9 http://www.ojrd.com/content/6/1/9 RESEARCH Open Access Utero-vaginal aplasia (Mayer-Rokitansky-Küster- Hauser syndrome) associated with deletions in known DiGeorge or DiGeorge-like loci Karine Morcel1,2*†, Tanguy Watrin1†, Laurent Pasquier1,3, Lucie Rochard1, Cédric Le Caignec4,5, Christèle Dubourg1,6, Philippe Loget7, Bernard-Jean Paniel8, Sylvie Odent1,3, Véronique David1,6, Isabelle Pellerin1, Claude Bendavid1,6 and Daniel Guerrier1 Abstract Background: Mayer-Rokitansky-Küster-Hauser (MRKH) syndrome is characterized by congenital aplasia of the uterus and the upper part of the vagina in women showing normal development of secondary sexual characteristics and a normal 46, XX karyotype. The uterovaginal aplasia is either isolated (type I) or more frequently associated with other malformations (type II or Müllerian Renal Cervico-thoracic Somite (MURCS) association), some of which belong to the malformation spectrum of DiGeorge phenotype (DGS). Its etiology remains poorly understood. Thus the phenotypic manifestations of MRKH and DGS overlap suggesting a possible genetic link. This would potentially have clinical consequences. Methods: We searched DiGeorge critical chromosomal regions for chromosomal anomalies in a cohort of 57 subjects with uterovaginal aplasia (55 women and 2 aborted fetuses). For this candidate locus approach, we used a multiplex ligation-dependent probe amplification (MLPA) assay based on a kit designed for investigation of the chromosomal regions known to be involved in DGS. The deletions detected were validated by Duplex PCR/liquid chromatography (DP/LC) and/or array-CGH analysis. Results: We found deletions in four probands within the four chromosomal loci 4q34-qter, 8p23.1, 10p14 and 22q11.2 implicated in almost all cases of DGS syndrome.
    [Show full text]
  • APC Mutations As a Potential Biomarker for Sensitivity To
    Published OnlineFirst February 8, 2017; DOI: 10.1158/1535-7163.MCT-16-0578 Companion Diagnostics and Cancer Biomarkers Molecular Cancer Therapeutics APC Mutations as a Potential Biomarker for Sensitivity to Tankyrase Inhibitors in Colorectal Cancer Noritaka Tanaka1,2, Tetsuo Mashima1, Anna Mizutani1, Ayana Sato1,3, Aki Aoyama3,4, Bo Gong3,4, Haruka Yoshida1, Yukiko Muramatsu1, Kento Nakata1,5, Masaaki Matsuura6, Ryohei Katayama4, Satoshi Nagayama7, Naoya Fujita3,4,5, Yoshikazu Sugimoto2, and Hiroyuki Seimiya1,3,5 Abstract In most colorectal cancers, Wnt/b-catenin signaling is acti- "short" truncated APCs lacking all seven b-catenin-binding vated by loss-of-function mutations in the adenomatous polyposis 20-amino acid repeats (20-AARs). In contrast, the drug-resistant coli (APC) gene and plays a critical role in tumorigenesis. cells possessed "long" APC retaining two or more 20-AARs. Knock- Tankyrases poly(ADP-ribosyl)ate and destabilize Axins, a neg- down of the long APCs with two 20-AARs increased b-catenin, ative regulator of b-catenin, and upregulate b-catenin signaling. Tcf/LEF transcriptional activity and its target gene AXIN2 expres- Tankyrase inhibitors downregulate b-catenin and are expected sion. Under these conditions, tankyrase inhibitors were able to to be promising therapeutics for colorectal cancer. However, downregulate b-catenin in the resistant cells. These results indicate colorectal cancer cells are not always sensitive to tankyrase that the long APCs are hypomorphic mutants, whereas they exert inhibitors, and predictive biomarkers for the drug sensitivity a dominant-negative effect on Axin-dependent b-catenin degra- remain elusive. Here we demonstrate that the short-form APC dation caused by tankyrase inhibitors.
    [Show full text]
  • Crystal Structure of a Tankyrase-Axin Complex and Its Implications for Axin Turnover and Tankyrase Substrate Recruitment
    Crystal structure of a Tankyrase-Axin complex and its implications for Axin turnover and Tankyrase substrate recruitment Seamus Morronea,1, Zhihong Chenga,1, Randall T. Moonb, Feng Congc, and Wenqing Xua,2 aDepartment of Biological Structure, University of Washington School of Medicine, Seattle, WA 98195; bDepartment of Pharmacology, Howard Hughes Medical Institute, and Institute for Stem Cell and Regenerative Medicine, University of Washington School of Medicine, Seattle, WA 98195; and cNovartis Institutes for Biomedical Research, Cambridge, MA 02139 Edited by* Stephen C. Harrison, Children's Hospital, Harvard Medical School, and Howard Hughes Medical Institute, Boston, MA, and approved December8, 2011 (received for review October 9, 2011) Axin is a tumor suppressor and a key negative regulator of the Ubiquitination of Axin, which leads to its subsequent turnover, Wnt/β-catenin signaling pathway. Axin turnover is controlled by its requires its poly-ADP-ribosylation (PARylation) (11). PARylation poly-ADP-ribosylation catalyzed by tankyrase (TNKS), which re- of proteins is catalyzed by a family of poly-ADP-ribose poly- quires the direct interaction of Axin with TNKS. This interaction merases (PARPs), with 18 known members in humans, which re- is thus an attractive drug target for treating cancers, brain injuries, gulate many aspects of biology including genomic stability, cell and other diseases where β-catenin is involved. Here we report the cycle, and energy metabolism (15, 16). Axin PARylation is speci- crystal structure of a mouse TNKS1 fragment containing ankyrin- fically catalyzed by tankyrases 1 and 2 (a.k.a. TNKS1/PARP5a repeat clusters 2 and 3 (ARC2-3) in a complex with the TNKS-bind- and TNKS2/PARP5b, respectively).
    [Show full text]
  • Discovery of a Novel Triazolopyridine Derivative As a Tankyrase Inhibitor
    International Journal of Molecular Sciences Article Discovery of a Novel Triazolopyridine Derivative as a Tankyrase Inhibitor Hwani Ryu 1, Ky-Youb Nam 2, Hyo Jeong Kim 1, Jie-Young Song 1 , Sang-Gu Hwang 1 , Jae Sung Kim 1 , Joon Kim 3,* and Jiyeon Ahn 1,* 1 Division of Radiation Biomedical Research, Korea Institute of Radiological & Medical Sciences, Seoul 01812, Korea; [email protected] (H.R.); [email protected] (H.J.K.); [email protected] (J.-Y.S.); [email protected] (S.-G.H.); [email protected] (J.S.K.) 2 Department of Research Center, Pharos I&BT Co., Ltd., Anyang 14059, Korea; [email protected] 3 Laboratory of Biochemistry, Division of Life Sciences, Korea University, Seoul 02841, Korea * Correspondence: [email protected] (J.K.); [email protected] (J.A.); Tel.: +82-2-970-1311 (J.A.) Abstract: More than 80% of colorectal cancer patients have adenomatous polyposis coli (APC) mutations, which induce abnormal WNT/β-catenin activation. Tankyrase (TNKS) mediates the release of active β-catenin, which occurs regardless of the ligand that translocates into the nucleus by AXIN degradation via the ubiquitin-proteasome pathway. Therefore, TNKS inhibition has emerged as an attractive strategy for cancer therapy. In this study, we identified pyridine derivatives by evaluating in vitro TNKS enzyme activity and investigated N-([1,2,4]triazolo[4,3-a]pyridin-3-yl)-1-(2- cyanophenyl)piperidine-4-carboxamide (TI-12403) as a novel TNKS inhibitor. TI-12403 stabilized β β AXIN2, reduced active -catenin, and downregulated -catenin target genes in COLO320DM and DLD-1 cells.
    [Show full text]
  • Structural Basis and Sequence Rules for Substrate Recognition by Tankyrase Explain the Basis for Cherubism Disease
    Structural Basis and Sequence Rules for Substrate Recognition by Tankyrase Explain the Basis for Cherubism Disease Sebastian Guettler,1,2 Jose LaRose,3 Evangelia Petsalaki,1,2 Gerald Gish,1 Andy Scotter,3 Tony Pawson,1,2,* Robert Rottapel,3,4,* and Frank Sicheri1,2,* 1Centre for Systems Biology, Samuel Lunenfeld Research Institute, Mount Sinai Hospital, 600 University Avenue, Toronto, Ontario M5G 1X5, Canada 2Department of Molecular Genetics, University of Toronto, 1 Kings College Circle, Toronto, Ontario M5S 1A8, Canada 3Ontario Cancer Institute and the Campbell Family Cancer Research Institute, 101 College Street, Room 8-703, Toronto Medical Discovery Tower, University of Toronto, Toronto, Ontario M5G 1L7, Canada 4Division of Rheumatology, Department of Medicine, Saint Michael’s Hospital, 30 Bond Street, Toronto, Ontario M5B 1W8, Canada *Correspondence: [email protected] (T.P.), [email protected] (R.R.), [email protected] (F.S.) DOI 10.1016/j.cell.2011.10.046 SUMMARY asparagine, arginine, lysine, cysteine, phosphoserine, and diph- thamide residues (reviewed in Hottiger et al., 2010). As a large The poly(ADP-ribose)polymerases Tankyrase 1/2 posttranslational modification of substantial negative charge, (TNKS/TNKS2) catalyze the covalent linkage of protein poly(ADP-ribosyl)ation (PARsylation) can influence pro- ADP-ribose polymer chains onto target proteins, tein fate through several mechanisms, including a direct effect regulating their ubiquitylation, stability, and function. on protein activity, recruitment of binding partners
    [Show full text]
  • ADP-Ribosyl)Hydrolases: Structure, Function, and Biology
    Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press SPECIAL SECTION: REVIEW (ADP-ribosyl)hydrolases: structure, function, and biology Johannes Gregor Matthias Rack,1,3 Luca Palazzo,2,3 and Ivan Ahel1 1Sir William Dunn School of Pathology, University of Oxford, Oxford OX1 3RE, United Kingdom; 2Institute for the Experimental Endocrinology and Oncology, National Research Council of Italy, 80145 Naples, Italy ADP-ribosylation is an intricate and versatile posttransla- Diversification of NAD+ signaling is particularly apparent tional modification involved in the regulation of a vast in vertebrata, being linked to evolutionary optimization of variety of cellular processes in all kingdoms of life. Its NAD+ biosynthesis and increased (ADP-ribosyl) signaling complexity derives from the varied range of different (Bockwoldt et al. 2019). ADP-ribosylation is used by or- chemical linkages, including to several amino acid side ganisms from all kingdoms of life and some viruses chains as well as nucleic acids termini and bases, it can (Perina et al. 2014; Aravind et al. 2015) and controls a adopt. In this review, we provide an overview of the differ- wide range of cellular processes such as DNA repair, tran- ent families of (ADP-ribosyl)hydrolases. We discuss their scription, cell division, protein degradation, and stress re- molecular functions, physiological roles, and influence sponse to name a few (Bock and Chang 2016; Gupte et al. on human health and disease. Together, the accumulated 2017; Palazzo et al. 2017; Rechkunova et al. 2019). In ad- data support the increasingly compelling view that (ADP- dition to proteins, several in vitro observations strongly ribosyl)hydrolases are a vital element within ADP-ribosyl suggest that nucleic acids, both DNA and RNA, can be signaling pathways and they hold the potential for novel targets of ADP-ribosylation (Nakano et al.
    [Show full text]
  • Identification of Genomic Targets of Krüppel-Like Factor 9 in Mouse Hippocampal
    Identification of Genomic Targets of Krüppel-like Factor 9 in Mouse Hippocampal Neurons: Evidence for a role in modulating peripheral circadian clocks by Joseph R. Knoedler A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Neuroscience) in the University of Michigan 2016 Doctoral Committee: Professor Robert J. Denver, Chair Professor Daniel Goldman Professor Diane Robins Professor Audrey Seasholtz Associate Professor Bing Ye ©Joseph R. Knoedler All Rights Reserved 2016 To my parents, who never once questioned my decision to become the other kind of doctor, And to Lucy, who has pushed me to be a better person from day one. ii Acknowledgements I have a huge number of people to thank for having made it to this point, so in no particular order: -I would like to thank my adviser, Dr. Robert J. Denver, for his guidance, encouragement, and patience over the last seven years; his mentorship has been indispensable for my growth as a scientist -I would also like to thank my committee members, Drs. Audrey Seasholtz, Dan Goldman, Diane Robins and Bing Ye, for their constructive feedback and their willingness to meet in a frequently cold, windowless room across campus from where they work -I am hugely indebted to Pia Bagamasbad and Yasuhiro Kyono for teaching me almost everything I know about molecular biology and bioinformatics, and to Arasakumar Subramani for his tireless work during the home stretch to my dissertation -I am grateful for the Neuroscience Program leadership and staff, in particular
    [Show full text]
  • Differential Roles of AXIN1 and AXIN2 in Tankyrase Inhibitor-Induced Formation of Degradasomes and Β-Catenin Degradation
    RESEARCH ARTICLE Differential Roles of AXIN1 and AXIN2 in Tankyrase Inhibitor-Induced Formation of Degradasomes and β-Catenin Degradation Tor Espen Thorvaldsen1,2☯, Nina Marie Pedersen1,2☯, Eva Maria Wenzel1,2*, Harald Stenmark1,2* 1 Centre for Cancer Biomedicine, Faculty of Medicine, Oslo University Hospital, Oslo, Norway, 2 Department of Molecular Cell Biology, Institute for Cancer Research, Oslo University Hospital, Oslo, Norway a1111111111 ☯ These authors contributed equally to this work. a1111111111 * [email protected] (EMW); [email protected] (HS) a1111111111 a1111111111 a1111111111 Abstract Inhibition of the tankyrase enzymes (TNKS1 and TNKS2) has recently been shown to induce highly dynamic assemblies of β-catenin destruction complex components known as OPEN ACCESS degradasomes, which promote degradation of β-catenin and reduced Wnt signaling activity Citation: Thorvaldsen TE, Pedersen NM, Wenzel in colorectal cancer cells. AXIN1 and AXIN2/Conductin, the rate-limiting factors for the sta- EM, Stenmark H (2017) Differential Roles of AXIN1 bility and function of endogenous destruction complexes, are stabilized upon TNKS inhibi- and AXIN2 in Tankyrase Inhibitor-Induced tion due to abrogated degradation of AXIN by the proteasome. Since the role of AXIN1 Formation of Degradasomes and β-Catenin versus AXIN2 as scaffolding proteins in the Wnt signaling pathway still remains incompletely Degradation. PLoS ONE 12(1): e0170508. doi:10.1371/journal.pone.0170508 understood, we sought to elucidate their relative contribution in the formation of degrada- somes, as these protein assemblies most likely represent the morphological and functional Editor: Masaru Katoh, National Cancer Center, JAPAN correlates of endogenous β-catenin destruction complexes. In SW480 colorectal cancer cells treated with the tankyrase inhibitor (TNKSi) G007-LK we found that AXIN1 was not Received: September 20, 2016 required for degradasome formation.
    [Show full text]
  • Gene Expression Mechanism and Repertoire of ASC-Mediated
    The Journal of Immunology Mechanism and Repertoire of ASC-Mediated Gene Expression1 Mizuho Hasegawa,2* Ryu Imamura,* Kou Motani,* Takumi Nishiuchi,† Norihiko Matsumoto,* Takeshi Kinoshita,* and Takashi Suda3* Apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) is an adaptor molecule that mediates inflammatory and apoptotic signals. Although the role of ASC in caspase-1-mediated IL-1␤ and IL-18 maturation is well known, ASC also induces NF-␬B activation and cytokine gene expression in human cells. In this study, we investigated the molecular mechanism and repertoire of ASC-induced gene expression in human cells. We found that the specific activation of ASC induced AP-1 activity, which was required for optimal IL8 promoter activity. ASC activation also induced STAT3-, but not STAT1-, IFN-stimulated gene factor 3- or NF-AT-dependent reporter gene expression. The ASC-mediated AP-1 activation was NF-␬B-independent and primarily cell-autonomous response, whereas the STAT3 activation required NF-␬B activation and was mediated by a factor that can act in a paracrine manner. ASC-mediated AP-1 activation was inhibited by chemical or protein inhibitors for caspase-8, caspase-8-targeting small-interfering RNA, and p38 and JNK inhibitors, but not by a caspase-1 inhibitor, caspase-9 or Fas-associated death domain protein (FADD) dominant-negative mutants, FADD- or RICK-targeting small-interfering RNAs, or a MEK inhibitor, indicating that the ASC-induced AP-1 activation is mediated by caspase-8, p38, and JNK, but does not require caspase-1, caspase-9, FADD, RICK, or ERK. DNA microarray analyses identified 75 genes that were induced by ASC activation.
    [Show full text]
  • Axin Family of Scaffolding Proteins in Development
    Journal of Developmental Biology Review Axin Family of Scaffolding Proteins in Development: Lessons from C. elegans Avijit Mallick 1 , Shane K. B. Taylor 1, Ayush Ranawade 2 and Bhagwati P. Gupta 1,* 1 Department of Biology, McMaster University, Hamilton, ON L8S-4K1, Canada; [email protected] (A.M.); [email protected] (S.K.B.T.) 2 Department of Bioengineering, Northeastern University, Boston, MA 02115, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-905-525-9140 (ext. 26451); Fax: +1-905-522-6066 Received: 12 August 2019; Accepted: 11 October 2019; Published: 15 October 2019 Abstract: Scaffold proteins serve important roles in cellular signaling by integrating inputs from multiple signaling molecules to regulate downstream effectors that, in turn, carry out specific biological functions. One such protein, Axin, represents a major evolutionarily conserved scaffold protein in metazoans that participates in the WNT pathway and other pathways to regulate diverse cellular processes. This review summarizes the vast amount of literature on the regulation and functions of the Axin family of genes in eukaryotes, with a specific focus on Caenorhabditis elegans development. By combining early studies with recent findings, the review is aimed to serve as an updated reference for the roles of Axin in C. elegans and other model systems. Keywords: Axin; C. elegans; pry-1; axl-1; WNT signaling; scaffolding protein; signal transduction; development Axin was first discovered as a negative regulator of WNT (wingless and int-1) signaling in mice while deciphering its role in embryonic axis formation [1]. This protein is the product of the mouse Fu (Fused) gene [2–4] and was named Axin for its initial discovered role in inhibiting axis formation (Axis inhibition).
    [Show full text]