DOCSLIB.ORG

Endocrine Pancreas Development and Regeneration: Noncanonical Ideas from Neural Stem Cell Biology

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Endocrine Pancreas Development and Regeneration: Noncanonical Ideas from Neural Stem Cell Biology 314 Diabetes Volume 65, February 2016 Jimmy Masjkur,1 Steven W. Poser,1 Polyxeni Nikolakopoulou,1 George Chrousos,2 Ronald D. McKay,3 Stefan R. Bornstein,1 Peter M. Jones,4 and Andreas Androutsellis-Theotokis1,5,6 Endocrine Pancreas Development and Regeneration: Noncanonical Ideas From Neural Stem Cell Biology Diabetes 2016;65:314–330 | DOI: 10.2337/db15-1099 Loss of insulin-producing pancreatic islet b-cells is a regeneration (1–4). Such plasticity in the adult brain is hallmark of type 1 diabetes. Several experimental para- exhibited only by endogenous neural stem cell (NSC) digms demonstrate that these cells can, in principle, be populations. How NSCs manage to maintain this plas- regenerated from multiple endogenous sources using ticity is an intensely studied question that has led to the signaling pathways that are also used during pancreas identification of unusual (noncanonical) signal trans- development. A thorough understanding of these path- duction pathways that help them manage the cellular ways will provide improved opportunities for therapeutic properties that define them as stem cells, namely the intervention. It is now appreciated that signaling path- ability to self-renew and the potential to differentiate “ ” “ ” ways should not be seen as on or off but that the into mature cell types. Part of this noncanonical ma- degree of activity may result in wildly different cellular chinery is a novel branch of the Notch signaling path- outcomes. In addition to the degree of operation of a way that has pronounced consequences in vitro and in signaling pathway, noncanonical branches also play im- vivo (5). It is logical to wonder whether other tissues portant roles. Thus, a pathway, once considered as “off” or “low” may actually be highly operational but may be also use these signaling pathways. using noncanonical branches. Such branches are only Plasticity in the pancreas is demonstrated by multiple now revealing themselves as new tools to assay them examples of trans- and dedifferentiation among various are being generated. A formidable source of noncanon- cell types reported; these have been experimentally PERSPECTIVES IN DIABETES ical signal transduction concepts is neural stem cells induced, whether by pharmacological or genetic manipu- because these cells appear to have acquired unusual lation or by the implementation of damage and regener- signaling interpretations to allow them to maintain their ation models (1,6–12). An impressive amount of work unique dual properties (self-renewal and multipotency). has been done identifying the molecular mechanisms that We discuss how such findings from the neural field can control this plasticity. The patterns that emerge indicate provide a blueprint for the identification of new molec- that a variety of signaling molecules and transcription ular mechanisms regulating pancreatic biology, with a factors act during development to both suppress and in- focus on Notch, Hes/Hey, and hedgehog pathways. duce fates as well as to maintain proper function of the adult cell types, including the Notch and hedgehog path- ways and a number of transcription factors, including To the neuroscientist, the pancreas can seem like a pancreatic and duodenal homeobox 1 (Pdx1), neurogenin highlyplasticorganwhosecellsareabletoundergovast 3 (Ngn3), and the hairy and enhancer of split-1 (Hes/Hey) changes in the context of homeostatic control and family (1,13–42). 1Department of Internal Medicine III, Technische Universität Dresden, Dresden, Corresponding author: Andreas Androutsellis-Theotokis, andreas.theotokis@ Germany uniklinikum-dresden.de. 2 First Department of Pediatrics, University of Athens Medical School and Aghia Received 6 August 2015 and accepted 2 November 2015. Sophia Children’s Hospital, Athens, Greece J.M. and S.W.P. contributed equally to this work. 3Lieber Institute for Brain Development, Baltimore, MD 4Diabetes Research Group, Division of Diabetes & Nutritional Sciences, King’s © 2016 by the American Diabetes Association. Readers may use this article as College London, London, U.K. long as the work is properly cited, the use is educational and not for profit, and 5Center for Regenerative Therapies Dresden, Dresden, Germany the work is not altered. 6Department of Stem Cell Biology, Centre for Biomolecular Sciences, Division of Cancer and Stem Cells, School of Medicine, University of Nottingham, Nottingham, U.K. diabetes.diabetesjournals.org Masjkur and Associates 315 A binary view of signal transduction (where a partic- Notch signaling is critical in the maintenance of pancre- ular pathway is either on or off) seems to be incomplete atic progenitors (24,35,47,48). Specifically, loss of function as emerging evidence points toward several examples of the Notch ligand Delta-like 1 (Dll1) results in premature where low activity of a particular pathway (e.g., Notch endocrine differentiation and depletion of the pancreatic and hedgehog) leads to vastly different developmental and progenitors (24,35). cellular outcomes. But a simply quantitative distinction Conversely, overexpression of the Notch intracellular between low and high activity of a signaling pathway domain prevents differentiation and traps cells in a may also not be sufficient. A cell that is exhibiting low progenitor state (48). This appears to be due to caNotch activity of a canonical pathway may actually also exhibit signaling because similar phenotypes involving pancreatic high activity in noncanonical pathways that are only now growth arrest are observed with genetic mouse models becoming revealed. For example, whereas canonical Notch deficient in recombining binding protein suppressor of (caNotch) signaling is often assessed by the amount of hairless (RBPJ-k), a transcriptional mediator of caNotch Hes1 expression (a caNotch pathway target gene), it is signaling (14) or Hes1 (24,35,46,49). Apart from Hes1, possible that the cell exhibits high expression of, for Notch signaling also regulates Sox9, a transcription factor example, Hes3, an indirect, noncanonical target of that, like Hes1, has multiple developmental roles in many Notch (noncaNotch) with distinct outcomes in NSCs tissues (2,46,50–54). The molecular mechanisms that (43). Low activity of a signaling pathway, as assessed by control Hes1 are very important for transcriptional con- measurements of its canonical functions, does not pre- trol and the responsiveness of pancreatic progenitors to cludethatotherbranchesofthesamepathwayarenot mitogenic support from the surrounding mesenchyme. In highly active. Noncanonicalbranchesmaybeunidenti- one example, Hes1 opposes expression of p57, which nor- fiedsimplybecausewehavenotyetdesignedassaysfor mally induces cell cycle exit (55). Notch activity is neces- them. sary for the cells to respond to fibroblast growth factor NSCs are a treasure trove of noncanonical functions, (FGF) 10, a mitogen expressed by the mesenchyme at perhaps because they are required to fit multiple proper- ;E9.5–11.5 (56). In fact, inhibition of Notch cleavage ties into their signal transduction machinery (e.g., their by a g-secretase inhibitor renders cells nonresponsive to self-renewal and cell fate–decision abilities), forcing them the proliferative effects of FGF10 (57–59). to come up with unique molecular solutions. Some of Later in development, these progenitors become more these have already proven important in pancreatic func- restricted in their differentiation potential and separate tion. We will focus on lessons learned about noncaNotch into two cell types: unipotent acinar progenitor “tip cells” and hedgehog signaling in NSCs as a paradigm for their and bipotent “trunk epithelial” cells that can generate potential roles in b-cell development and function. First, endocrine and duct cells. High caNotch signaling, as we discuss specific aspects of pancreatic development on assessed by the involvement of RBPJ-k and Hes1, pro- which light can be shed by our emerging understanding of motes the trunk fate (47,48,60–64). High caNotch signal- noncanonical signaling in NSCs. We do not aim to provide ing in trunk cells activates Hes1 and Sox9 (a repressor and a comprehensive review of the developmental processes an activator of Ngn3, respectively). On the one hand, of the pancreas because this has been meticulously done Hes1 activity apparently dominates this fight, leading to elsewhere (1–4). low Ngn3 levels and, subsequently, specification to the ductal fate. Low caNotch activity, on the other hand, OVERVIEW OF PANCREAS DEVELOPMENT AND leads to induction of only Sox9, leading to high Ngn3 INVOLVEMENT OF KEY PATHWAYS levels and the acquisition of the endocrine fate (3,65). In this section we present a brief overview of specific The interpretation of high versus low Notch activity aspects in pancreas development (Fig. 1). We focus only on is an important and recurring theme throughout this particular pathways that are of direct relevance to the con- perspective. cepts discussed here. At approximately mouse embryonic In this article, we discuss data acquired from different day 8.5 (E8.5), a prepancreatic region is specified in the gut developmental stages of the endocrine pancreas and also endoderm (44). For pancreatic specification to occur and from the exocrine pancreas; these observations point toward pancreatic markers to be induced, sonic hedgehog (Shh) novel regulatory signaling networks that may be of signif- expression must be suppressed from the presumptive icant interest to pancreas biology. However, additional pancreatic endoderm (31,33,34). Subsequently,
Load more

Recommended publications
  • Hes5 Regulates the Transition Timing of Neurogenesis and Gliogenesis In
    © 2017. Published by The Company of Biologists Ltd | Development (2017) 144, 3156-3167 doi:10.1242/dev.147256 RESEARCH ARTICLE Hes5 regulates the transition timing of neurogenesis and gliogenesis in mammalian neocortical development Shama Bansod1,2, Ryoichiro Kageyama1,2,3,4 and Toshiyuki Ohtsuka1,2,3,* ABSTRACT has been reported that the high mobility group AT-hook (Hgma) During mammalian neocortical development, neural stem/progenitor genes regulate gene expression by modulating chromatin structure cells (NSCs) sequentially give rise to deep layer neurons and (Ozturk et al., 2014), maintain neurogenic NSCs, and inhibit superficial layer neurons through mid- to late-embryonic stages, gliogenesis during early- to mid-embryonic stages through global shifting to gliogenic phase at perinatal stages. Previously, we found opening of the chromatin state (Kishi et al., 2012). However, the that the Hes genes inhibit neuronal differentiation and maintain mechanism by which the expression of these epigenetic factors is NSCs. Here, we generated transgenic mice that overexpress Hes5 in controlled remains to be analyzed. NSCs of the central nervous system, and found that the transition Here, we found that Hes5, a transcriptional repressor acting timing from deep to superficial layer neurogenesis was shifted earlier, as an effector of Notch signaling, regulates the timing of while gliogenesis precociously occurred in the developing neocortex neurogenesis and gliogenesis via alteration in the expression of Hes5-overexpressing mice. By contrast, the transition from deep to levels of epigenetic factors. Notch signaling contributes to the superficial layer neurogenesis and the onset of gliogenesis were elaboration of cellular diversity during the development of various delayed in Hes5 knockout (KO) mice.
    [Show full text]
  • STAT3-Ser/Hes3 Signaling: a New Molecular Component of the Neuroendocrine System?
    Review 77 STAT3-Ser/Hes3 Signaling: A New Molecular Component of the Neuroendocrine System? Authors P. Nikolakopoulou1, S. W. Poser1, J. Masjkur1, M. Fernandez Rubin de Celis1, L. Toutouna1, C. L. Andoniadou2, R. D. McKay3, G. Chrousos4, M. Ehrhart-Bornstein1, S. R. Bornstein1, A. Androutsellis-Theotokis1, 5, 6 Affiliations Affiliation addresses are listed at the end of the article Key words Abstract evidence suggests that a common non-canonical ●▶ STAT3 ▼ signaling pathway regulates adult progenitors in ●▶ Hes3 The endocrine system involves communication several different tissues, rendering it as a poten- ▶ stem cells ● among different tissues in distinct organs, includ- tially valuable starting point to explore their ing the pancreas and components of the Hypo- biology. The STAT3-Ser/Hes3 Signaling Axis was thalamic-Pituitary-Adrenal Axis. The molecular first identified as a major regulator of neural mechanisms underlying these complex interac- stem cells and, subsequently, cancer stem cells. In tions are a subject of intense study as they may the endocrine/neuroendocrine system, this path- hold clues for the progression and treatment of a way operates on several levels, regulating other variety of metabolic and degenerative diseases. A types of plastic cells: (a) it regulates pancreatic plethora of signaling pathways, activated by hor- islet cell function and insulin release; (b) insulin mones and other endocrine factors have been in turn activates the pathway in broadly distrib- implicated in this communication. Recent uted neural progenitors and possibly also hypo- advances in the stem cell field introduce a new thalamic tanycytes, cells with important roles in level of complexity: adult progenitor cells appear the control of the adrenal gland; (c) adrenal pro- to utilize distinct signaling pathways than the genitors themselves operate this pathway.
    [Show full text]
  • Roles and Regulation of Transcription Factor Mafa in Islet Β-Cells
    Endocr. J./ S. ARAMATA et al.: INSULIN TRANSCRIPTION AND MafA doi: 10.1507/endocrj.KR-101 REVIEW Roles and Regulation of Transcription Factor MafA in Islet β-cells * SHINSAKU ARAMATA, SONG-IEE HAN AND KOHSUKE KATAOKA Graduate School of Biological Science, Nara Institute of Science and Technology, 8916-5 Takayama-cho, Ikoma, Nara 630-0192, Japan ＊Graduate School of Life and Environmental Sciences, University of Tsukuba, Tsukuba Science City, Ibaraki 305-8572, Japan. Released online August 30, 2007 Correspondence to: Kohsuke KATAOKA, Graduate School of Biological Science, Nara Institute of Science and Technology, 8916-5 Takayama-cho, Ikoma, Nara 630-0192, Japan Abstract. Insulin is a critical hormone in the regulation of blood glucose levels. It is produced exclusively by pancreatic islet β-cells. β-cell-enriched transcription factors, such as Pdx1 and Beta2, have dual roles in the activation of the insulin gene promoter establishing β-cell-specific insulin expression, and in the regulation of β-cell differentiation. It was shown that MafA, a β-cell-specific member of the Maf family of transcription factors, binds to the conserved C1/RIPE3b element of the insulin promoter. The Maf family proteins regulate tissue-specific gene expression and cell differentiation in a wide variety of tissues. MafA acts synergistically with Pdx1 and Beta2 to activate the insulin gene promoter, and mice with a targeted deletion of mafA develop age-dependent diabetes. MafA also regulates genes involved in β-cell function such as Glucose transporter 2, Glucagons-like peptide 1 receptor, and Prohormone convertase 1/3. The abundance of MafA in β-cells is regulated at both the transcriptional and post-translational levels by glucose and oxidative stress.
    [Show full text]
  • Single-Cell Sequencing of Human Ipsc-Derived Cerebellar Organoids Shows Recapitulation of Cerebellar Development
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.01.182196; this version posted July 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Single-cell sequencing of human iPSC-derived cerebellar organoids shows recapitulation of cerebellar development Samuel Nayler1*, Devika Agarwal3, Fabiola Curion2, Rory Bowden2,4, Esther B.E. Becker1,5* 1Department of Physiology, Anatomy and Genetics; University of Oxford; Oxford, OX1 3PT; United Kingdom 2Wellcome Centre for Human Genetics; University of Oxford; Oxford, OX3 7BN; United Kingdom 3Weatherall Institute for Molecular Medicine; University of Oxford; Oxford, OX3 7BN; United Kingdom 4Present address: Walter and Eliza Hall Institute of Medical Research, Parkville Victoria 3052; Australia 5Lead contact *Correspondence: [email protected], [email protected] Running title: hiPSC-derived cerebellar organoids 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.01.182196; this version posted July 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. ABSTRACT Current protocols for producing cerebellar neurons from human pluripotent stem cells (hPSCs) are reliant on animal co-culture and mostly exist as monolayers, which have limited capability to recapitulate the complex arrangement of the brain. We developed a method to differentiate hPSCs into cerebellar organoids that display hallmarks of in vivo cerebellar development. Single- cell profiling followed by comparison to an atlas of the developing murine cerebellum revealed transcriptionally-discrete populations encompassing all major cerebellar cell types.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Rb and P53 Execute Distinct Roles in the Development of Pancreatic Neuroendocrine Tumors
    Author Manuscript Published OnlineFirst on June 26, 2020; DOI: 10.1158/0008-5472.CAN-19-2232 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. 1 Title: Rb and p53 execute distinct roles in the development of pancreatic neuroendocrine tumors 2 Running Title: Roles of Rb and p53 in pancreatic neuroendocrine tumors 3 4 1Yuki Yamauchi, 1,2Yuzo Kodama, 1Masahiro Shiokawa, 1Nobuyuki Kakiuchi, 1Saiko Marui, 5 1Takeshi Kuwada, 1Yuko Sogabe, 1Teruko Tomono, 1Atsushi Mima, 1Toshihiro Morita, 1Tomoaki 6 Matsumori, 1Tatsuki Ueda, 1Motoyuki Tsuda, 1Yoshihiro Nishikawa, 1Katsutoshi Kuriyama, 7 1Yojiro Sakuma, 1Yuji Ota, 1Takahisa Maruno, 1Norimitsu Uza, 2Atsuhiro Masuda, 3Hisato 8 Tatsuoka, 3Daisuke Yabe, 4Sachiko Minamiguchi, 5Toshihiko Masui, 3Nobuya Inagaki, 5Shinji 9 Uemoto, 1,6Tsutomu Chiba, and 1Hiroshi Seno 10 11 1Department of Gastroenterology and Hepatology, Kyoto University Graduate School of 12 Medicine, 54 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto, 606-8507, Japan. 13 2Department of Gastroenterology, Kobe University Graduate School of Medicine, 7-5-1 14 Kusunoki-cho, Chuo-ku, Kobe, Hyogo, 650-0017, Japan. 15 3Department of Diabetes, Endocrinology and Nutrition, Kyoto University Graduate School of 16 Medicine, 54 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto, 606-8507, Japan. 17 4Department of Diagnostic Pathology, Kyoto University Graduate School of Medicine, 54 18 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto, 606-8507, Japan. 1 Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2020 American Association for Cancer Research. Author Manuscript Published OnlineFirst on June 26, 2020; DOI: 10.1158/0008-5472.CAN-19-2232 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
    [Show full text]
  • Insulin/Glucose-Responsive Cells Derived from Induced Pluripotent Stem Cells: Disease Modeling and Treatment of Diabetes
    Insulin/Glucose-Responsive Cells Derived from Induced Pluripotent Stem Cells: Disease Modeling and Treatment of Diabetes Sevda Gheibi *, Tania Singh, Joao Paulo M.C.M. da Cunha, Malin Fex and Hindrik Mulder * Unit of Molecular Metabolism, Lund University Diabetes Centre, Jan Waldenströms gata 35; Box 50332, SE-202 13 Malmö, Sweden; [email protected] (T.S.); [email protected] (J.P.M.C.M.d.C.); [email protected] (M.F.) * Correspondence: [email protected] (S.G.); [email protected] (H.M.) Supplementary Table 1. Transcription factors associated with development of the pancreas. Developmental Gene Aliases Function Ref. Stage SRY-Box Transcription Factor Directs the primitive endoderm SOX17 DE, PFE, PSE [1] 17 specification. Establishes lineage-specific transcriptional programs which leads DE, PFE, PSE, Forkhead Box A2; Hepatocyte to proper differentiation of stem cells FOXA2 PMPs, EPs, [2] Nuclear Factor 3-β into pancreatic progenitors. Regulates Mature β-cells expression of PDX1 gene and aids in maturation of β-cells A pleiotropic developmental gene which regulates growth, and Sonic Hedgehog Signaling differentiation of several organs. SHH DE [3] Molecule Repression of SHH expression is vital for pancreas differentiation and development Promotes cell differentiation, proliferation, and survival. Controls C-X-C Motif Chemokine the spatiotemporal migration of the Receptor 4; Stromal Cell- CXCR4 DE angioblasts towards pre-pancreatic [4] Derived Factor 1 Receptor; endodermal region which aids the Neuropeptide Y3 Receptor induction of PDX1 expression giving rise to common pancreatic progenitors Crucial for generation of pancreatic HNF1 Homeobox B HNF1B PFE, PSE, PMPs multipotent progenitor cells and [5] Hepatocyte Nuclear Factor 1-β NGN3+ endocrine progenitors Master regulator of pancreatic organogenesis.
    [Show full text]
  • Supplemental Table 1. Complete Gene Lists and GO Terms from Figure 3C
    Supplemental Table 1. Complete gene lists and GO terms from Figure 3C. Path 1 Genes: RP11-34P13.15, RP4-758J18.10, VWA1, CHD5, AZIN2, FOXO6, RP11-403I13.8, ARHGAP30, RGS4, LRRN2, RASSF5, SERTAD4, GJC2, RHOU, REEP1, FOXI3, SH3RF3, COL4A4, ZDHHC23, FGFR3, PPP2R2C, CTD-2031P19.4, RNF182, GRM4, PRR15, DGKI, CHMP4C, CALB1, SPAG1, KLF4, ENG, RET, GDF10, ADAMTS14, SPOCK2, MBL1P, ADAM8, LRP4-AS1, CARNS1, DGAT2, CRYAB, AP000783.1, OPCML, PLEKHG6, GDF3, EMP1, RASSF9, FAM101A, STON2, GREM1, ACTC1, CORO2B, FURIN, WFIKKN1, BAIAP3, TMC5, HS3ST4, ZFHX3, NLRP1, RASD1, CACNG4, EMILIN2, L3MBTL4, KLHL14, HMSD, RP11-849I19.1, SALL3, GADD45B, KANK3, CTC- 526N19.1, ZNF888, MMP9, BMP7, PIK3IP1, MCHR1, SYTL5, CAMK2N1, PINK1, ID3, PTPRU, MANEAL, MCOLN3, LRRC8C, NTNG1, KCNC4, RP11, 430C7.5, C1orf95, ID2-AS1, ID2, GDF7, KCNG3, RGPD8, PSD4, CCDC74B, BMPR2, KAT2B, LINC00693, ZNF654, FILIP1L, SH3TC1, CPEB2, NPFFR2, TRPC3, RP11-752L20.3, FAM198B, TLL1, CDH9, PDZD2, CHSY3, GALNT10, FOXQ1, ATXN1, ID4, COL11A2, CNR1, GTF2IP4, FZD1, PAX5, RP11-35N6.1, UNC5B, NKX1-2, FAM196A, EBF3, PRRG4, LRP4, SYT7, PLBD1, GRASP, ALX1, HIP1R, LPAR6, SLITRK6, C16orf89, RP11-491F9.1, MMP2, B3GNT9, NXPH3, TNRC6C-AS1, LDLRAD4, NOL4, SMAD7, HCN2, PDE4A, KANK2, SAMD1, EXOC3L2, IL11, EMILIN3, KCNB1, DOK5, EEF1A2, A4GALT, ADGRG2, ELF4, ABCD1 Term Count % PValue Genes regulation of pathway-restricted GDF3, SMAD7, GDF7, BMPR2, GDF10, GREM1, BMP7, LDLRAD4, SMAD protein phosphorylation 9 6.34 1.31E-08 ENG pathway-restricted SMAD protein GDF3, SMAD7, GDF7, BMPR2, GDF10, GREM1, BMP7, LDLRAD4, phosphorylation
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Intrinsic Specificity of DNA Binding and Function of Class II Bhlh
    INTRINSIC SPECIFICITY OF BINDING AND REGULATORY FUNCTION OF CLASS II BHLH TRANSCRIPTION FACTORS APPROVED BY SUPERVISORY COMMITTEE Jane E. Johnson Ph.D. Helmut Kramer Ph.D. Genevieve Konopka Ph.D. Raymond MacDonald Ph.D. INTRINSIC SPECIFICITY OF BINDING AND REGULATORY FUNCTION OF CLASS II BHLH TRANSCRIPTION FACTORS by BRADFORD HARRIS CASEY DISSERTATION Presented to the Faculty of the Graduate School of Biomedical Sciences The University of Texas Southwestern Medical Center at Dallas In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY The University of Texas Southwestern Medical Center at Dallas Dallas, Texas December, 2016 DEDICATION This work is dedicated to my family, who have taught me pursue truth in all forms. To my grandparents for inspiring my curiosity, my parents for teaching me the value of a life in the service of others, my sisters for reminding me of the importance of patience, and to Rachel, who is both “the beautiful one”, and “the smart one”, and insists that I am clever and beautiful, too. Copyright by Bradford Harris Casey, 2016 All Rights Reserved INTRINSIC SPECIFICITY OF BINDING AND REGULATORY FUNCTION OF CLASS II BHLH TRANSCRIPTION FACTORS Publication No. Bradford Harris Casey The University of Texas Southwestern Medical Center at Dallas, 2016 Jane E. Johnson, Ph.D. PREFACE Embryonic development begins with a single cell, and gives rise to the many diverse cells which comprise the complex structures of the adult animal. Distinct cell fates require precise regulation to develop and maintain their functional characteristics. Transcription factors provide a mechanism to select tissue-specific programs of gene expression from the shared genome.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • The Role of Hes1 in Pancreas Development Expression, Interdependancy and Notch Signalling
    FACULTY OF SCIENCE UNIVERSITY OF COPENHAGEN PhD thesis Cand.scient. Rasmus Klinck Department of Beta Cell Regeneration, Hagedorn Research Institute, and The PhD School of Science, Faculty of Science, University of Copenhagen, Denmark. The role of Hes1 in pancreas development Expression, Interdependancy and Notch signalling. Academic Advisors Dr. Olaf Nielsen, Department of Biology, Faculty of Science, University of Copenhagen – Denmark Dr. Mette C. Jørgensen, Department of Beta Cell Regeneration, Hagedorn Research Institute Denmark Submitted: 31/05/11 Cover picture: e10.5 mouse embryo expressing EGFP under the control of the Hes1 promoter manually stitched together from 15 complete image stacks. 2 Preface This Ph.D. thesis is based on experimental work performed in the Department of β Cell Regeneration at the Hagedorn Research Institute, Gentofte, Denmark from January 2008 to December 2010. The faculty supervisor on the project was Professor Olaf Nielsen, Department of Genetics, Faculty of Science, University of Copenhagen, and the project supervisor was Mette Christine Jørgensen, Ph.D., Chemist, Department of Beta Cell Regeneration at the Hagedorn Research Institute. This thesis is submitted in order to meet the requirements for obtaining a Ph.D. degree at the Faculty of Science, University of Copenhagen. The thesis is built around three scientific Manuscripts: Manuscript I: “A BAC transgenic Hes1-EGFP reporter reveals novel expression domains in mouse embryos” Submitted to Gene Expression Patterns Rasmus Klinck1, Ernst-Martin Füchtbauer2, Jonas Ahnfelt-Rønne1, Palle Serup1,Jan Nygaard Jensen1, Ole Dragsbæk Madsen1, Mette Christine Jørgensen1 1Department of Beta Cell Regeneration, Hagedorn Research Institute, Niels Steensens Vej 6, DK-2820 Gentofte, Denmark .2Department of Molecular Biology, Aarhus University, C.
    [Show full text]