DOCSLIB.ORG

Immunoglobulin Heavy Chain Expression Shapes the B Cell Receptor Repertoire in Human B Cell Development

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Immunoglobulin Heavy Chain Expression Shapes the B Cell Receptor Repertoire in Human B Cell Development Immunoglobulin heavy chain expression shapes the B cell receptor repertoire in human B cell development Eric Meffre, … , Michel C. Nussenzweig, Claudine Schiff J Clin Invest. 2001;108(6):879-886. https://doi.org/10.1172/JCI13051. Article Developing B cells must pass a series of checkpoints that are regulated by membrane-bound Igμ through the Igα-Igβ signal transducers. To determine how Igμ expression affects B cell development and Ab selection in humans we analyzed Ig gene rearrangements in pro-B cells from two patients who are unable to produce Igμ proteins. We find that Igμ expression does not affect VH, D, or JH segment usage and is not required for human Igκ and Igλ recombination or expression. However, the heavy and light chains found in pro-B cells differed from those in peripheral B cells in that they showed unusually long CDR3s. In addition, the Igκ repertoire in Igμ-deficient pro-B cells was skewed to downstream Jκs and upstream Vκs, consistent with persistent secondary V(D)J rearrangements. Thus, Igμ expression is not required for secondary V(D)J recombination in pro-B cells. However, B cell receptor expression shapes the Ab repertoire in humans and is essential for selection against Ab’s with long CDR3s. Find the latest version: https://jci.me/13051/pdf Immunoglobulin heavy chain expression shapes the B cell receptor repertoire in human B cell development Eric Meffre,1,2 Michèle Milili,2 Carla Blanco-Betancourt,2 Henedina Antunes,3 Michel C. Nussenzweig,1 and Claudine Schiff2 1Laboratory of Molecular Immunology, The Rockefeller University, Howard Hughes Medical Institute, New York, New York, USA 2Centre d’Immunologie de Marseille-Luminy, CNRS-INSERM–Université de la Méditerranée, Campus de Luminy, Marseille, France 3Fundacao Faculdade Federal de Ciencias, Medicas de Porto Alegre, Portugal Address correspondence to: Eric Meffre, The Rockefeller University, 1230 York Avenue, New York, New York 10021, USA. Phone: (212) 327-8098; Fax: (212) 327-8370; E-mail: [email protected]. Received for publication April 16, 2001, and accepted in revised form August 13, 2001. Developing B cells must pass a series of checkpoints that are regulated by membrane-bound Igµ through the Igα-Igβ signal transducers. To determine how Igµ expression affects B cell development and Ab selection in humans we analyzed Ig gene rearrangements in pro-B cells from two patients who are unable to produce Igµ proteins. We find that Igµ expression does not affect VH, D, or JH segment usage and is not required for human Igκ and Igλ recombination or expression. However, the heavy and light chains found in pro-B cells differed from those in peripheral B cells in that they showed unusu- ally long CDR3s. In addition, the Igκ repertoire in Igµ-deficient pro-B cells was skewed to downstream Jκs and upstream Vκs, consistent with persistent secondary V(D)J rearrangements. Thus, Igµ expres- sion is not required for secondary V(D)J recombination in pro-B cells. However, B cell receptor expres- sion shapes the Ab repertoire in humans and is essential for selection against Ab’s with long CDR3s. J. Clin. Invest. 108:879–886 (2001). DOI:10.1172/JCI200113051. Introduction third complementary determining region (CDR3). Pro- Expression of immunoglobulin heavy chains (Igµ) in and pre-B cells from adult bone marrow have longer pro-B cells induces pre-B cell development by assembly CDR3s than mature B cells (31–33). of a pre-B cell receptor (pre-BCR), which is a complex of Following successful IgH assembly and pre-BCR Igµ, surrogate light chains (ψL), and two signal-trans- expression, V(D)J recombination is targeted to the light ducing proteins, Igα and Igβ (1–6). Pre-BCR expression chain (IgL) genes (34–38). Those cells that produce in- induces proliferative expansion and downregulation of frame IgL chains test their newly synthesized Igs for self- recombinase-activating genes (RAG1 and RAG2), there- reactivity. In the mouse, B cells that produce self-reac- by ensuring allelic exclusion while selecting clones of tive receptors are either deleted or arrested in cells with productive VDJH rearrangements (7). Muta- development and undergo receptor editing (39-45). In tions in mIgµ, ψL, or Igα/Igβ genes that disrupt pre-BCR contrast, less is known about receptor selection and the assembly impede B cell development at the pro-B cell role of the BCR in regulating B cell development in stage in mice and humans (8–15). humans. Here we report on the role of the BCR in Ig Pre-BCR assembly is dependent on interaction repertoire selection in two patients with different muta- between VH variable regions and ψL, and in the mouse tions in the Igµ gene that impairs BCR assembly. the IgH repertoire is selected in part on the basis of this interaction (16–18). It has been proposed that VH Methods domains that pair well with ψL are positively selected Patient samples and cell preparation. Bone marrow samples at the pre-B cell stage, whereas VH domains that pair were obtained from two Igµ-deficient patients with poorly with ψL are not. However, selection differs in either a homozygous cytidine insertion in the Igµ gene –/– mouse fetal and adult B cell development such that VHs (Igµ ) or with a homozygous deletion of the Igµ locus that are counterselected in the adult are prominent in (Igµ∆) (see Results) (13, 46, 47) (C. Schiff, unpublished the fetal repertoire (18). observations). Samples were obtained when the Igµ∆ In contrast to mice, there is no apparent difference in patient was 2 years old, the Igµ–/– patient was 4 years +/– the VH repertoire between pro-B, pre-B, or fetal B cells old, and her Igµ brother (control) was 9 months old. and adult mature B cells in the human (19–30). How- The parents gave informed consent for this study. Bone ever, there is selection for IgH genes during human marrow mononuclear cells were isolated by Ficoll gra- B cell development as determined by the length of the dients and CD34+CD19+ pro-B cells were sorted on a The Journal of Clinical Investigation | September 2001 | Volume 108 | Number 6 879 FACSVantage after labeling with FITC anti-CD34 and and Igλ CDR3 length included amino acids between phycoerythrin anti-CD19 mAb’s (Beckman Coulter, conserved cystein 88 and the phenylalanine residue Brea, California, USA). embedded in Jκ or Jλ (51). Nontemplate (N) nucleotides RNA and RT-PCR. Total RNA was extracted from (52) found at Vκ-Jκ or Vλ-Jλ junctions were counted 104–105 purified cells using TRIzol Reagent (Life while template-dependent palindromic (P) nucleotides Technologies Inc., Rockville, Maryland, USA). RNA (53) were excluded. Differences in gene distribution was reverse transcribed with Superscript II (Life were analyzed with χ2 tests (Cochran-Mantel-Haenszel Technologies Inc.) according to the manufacturer’s test) adjusted by the Bonferroni method for multiple instructions. For RT-PCR reactions, cDNA was testing, and they were considered significant when amplified for 25 (actin), 35 (VH-Cµ), or 38 (Vκ-Cκ) P values were less than or equal to 0.05. cycles of 30 seconds at 94°C, 30 seconds at 60°C, and 30 seconds at 72°C, or for 40 cycles (Vλ-Cλ) of 30 Results seconds at 94°C, 30 seconds at 55°C, and 30 seconds IgH and IgL transcription is independent of Igµ expression. at 72°C, with a final 10-minute extension at 72°C Two patients with agammaglobulinemia and IgH using Hot Star Taq DNA polymerase (QIAGEN Inc., mutations were studied. Igµ–/– has a cytidine insertion Valencia, California, USA) and the following in the CH1 exon of the Igµ gene that leads to a primers: Vλ consensus sense, 5′GGG(G/A)TC(T/C)CT- frameshift and the inability to produce Igµ products ∆ GA(C/T/G)CG(A/C/G)TTCTCTGG(C/G)TCC3′; Cλ anti- (13, 46, 47). Igµ has a deletion in the Ig locus from 3′ sense, 5′CACAC(T/C)AGTGTGGCCTTGTTGGCTTG3′. of the diversity (D) region to Igγ2, with all junction (J) VH1, VH3, VH4, Cµ,Vκ consensus and Cκ primers were segments and Igµ, Igδ, Igγ3, and Igγ1 genes missing (C. described previously (48, 49). RT-PCR products were Schiff, unpublished observations). analyzed on 2% agarose gels and visualized by adding Flow cytometric analysis of bone marrow from Igµ–/– 0.3 pmol of 32PdATP to the PCR reaction. and Igµ∆ patients revealed that in both cases B cell dif- Cloning and sequencing. PCR products were gel-purified ferentiation was arrested at the CD34+CD19+ pro-B (Qiaquick; QIAGEN Inc.) and cloned into TA vectors cell stage (Figure 1a) (12, 13, 46, 47). To characterize (Invitrogen, Carlsbad, California, USA). Double- Ig expression in Igµ-deficient pro-B cells, transcripts stranded DNA sequences were obtained using anti- for heavy and light chain genes were amplified by sense Cµ, Cκ, or Cλ primers and Dye Terminator Cycle semiquantitative RT-PCR from sorted CD34+CD19+ Sequencing (Applied Biosystems, Foster City, Califor- pro-B cells from Igµ–/–, Igµ∆, and a control sibling (Fig- ∆ nia, USA). Sequences were analyzed by comparison ure 1). As expected, VH-Cµ mRNA was missing in Igµ with Ig basic alignment search tool (BLAST). IgH pro-B cells where the entire Igµ locus was deleted (Fig- CDR3 length was determined by counting amino acid ure 1b). In contrast, Igµ–/– and control pro-B cells residues between positions 94 and 102 (conserved tryp- showed similar levels of VH-Cµ transcripts revealing tophan in all JH segments) and D segments were iden- that the absence of Igµ protein does not affect the Igµ tified following the criteria of Corbett et al.
Load more

Recommended publications
  • Whole-Genome Microarray Detects Deletions and Loss of Heterozygosity of Chromosome 3 Occurring Exclusively in Metastasizing Uveal Melanoma
    Anatomy and Pathology Whole-Genome Microarray Detects Deletions and Loss of Heterozygosity of Chromosome 3 Occurring Exclusively in Metastasizing Uveal Melanoma Sarah L. Lake,1 Sarah E. Coupland,1 Azzam F. G. Taktak,2 and Bertil E. Damato3 PURPOSE. To detect deletions and loss of heterozygosity of disease is fatal in 92% of patients within 2 years of diagnosis. chromosome 3 in a rare subset of fatal, disomy 3 uveal mela- Clinical and histopathologic risk factors for UM metastasis noma (UM), undetectable by fluorescence in situ hybridization include large basal tumor diameter (LBD), ciliary body involve- (FISH). ment, epithelioid cytomorphology, extracellular matrix peri- ϩ ETHODS odic acid-Schiff-positive (PAS ) loops, and high mitotic M . Multiplex ligation-dependent probe amplification 3,4 5 (MLPA) with the P027 UM assay was performed on formalin- count. Prescher et al. showed that a nonrandom genetic fixed, paraffin-embedded (FFPE) whole tumor sections from 19 change, monosomy 3, correlates strongly with metastatic death, and the correlation has since been confirmed by several disomy 3 metastasizing UMs. Whole-genome microarray analy- 3,6–10 ses using a single-nucleotide polymorphism microarray (aSNP) groups. Consequently, fluorescence in situ hybridization were performed on frozen tissue samples from four fatal dis- (FISH) detection of chromosome 3 using a centromeric probe omy 3 metastasizing UMs and three disomy 3 tumors with Ͼ5 became routine practice for UM prognostication; however, 5% years’ metastasis-free survival. to 20% of disomy 3 UM patients unexpectedly develop metas- tases.11 Attempts have therefore been made to identify the RESULTS. Two metastasizing UMs that had been classified as minimal region(s) of deletion on chromosome 3.12–15 Despite disomy 3 by FISH analysis of a small tumor sample were found these studies, little progress has been made in defining the key on MLPA analysis to show monosomy 3.
    [Show full text]
  • In Silico Analysis of Single Nucleotide Polymorphism (Snps) in Human RAG1 and RAG2 Genes of Severe Combined Immunodeficiency
    Central JSM Bioinformatics, Genomics and Proteomics Bringing Excellence in Open Access Research Article *Corresponding author Mona Shams Aldeen S. Ali, Department of Applied Bioinformatics, Africa City of Technology, Khartoum, In silico Analysis of Single Sudan, Tel: 249121784688; Email: Submitted: 26 May 2016 Nucleotide Polymorphism Accepted: 17 June 2016 Published: 27 June 2016 (SNPs) in Human RAG1 and Copyright © 2016 Ali et al. RAG2 Genes of Severe OPEN ACCESS Keywords Combined Immunodeficiency • Severe combined immunodeficiency • Primary immunodeficiency Mona Shams Aldeen S. Ali1,2*, Tomador Siddig MZ1,2, Rehab A. • T lymphocytes Elhadi1,2, Muhammad Rahama Yousof2, Siddig Eltyeb Yousif • Recombinase activating genes • non synonymous Single Nucleotide Polymorphisms Abdallah1, Maiada Mohamed Yousif Ahmed2, Nosiba Yahia Mohamed Hassen1, Sulum Omer Masoud Mohamed1, Marwa Mohamed Osman2, and Mohamed A. Hassan2 1Department of Rheumatology, Omdurman Teaching Hospital, Sudan 2Department of Applied Bioinformatics, Africa City of Technology, Sudan Abstract Severe combined immunodeficiency is an inherited Primary immunodeficiency PID, which is characterized by the absence or dysfunction of T lymphocytes. Defects in RAG1 and RAG2 are known to cause a T-B-NK+ form of SCID. Recombinase activating genes RAG1 and RAG2 (OMIM 179615,179616 respectively) are expressed exclusively in lymphocytes and mediate the creation of double-strand. DNA breaks at the sites of recombination and in signal sequences during T− and B− cell receptor gene rearrangement. This study was focused on the effect of nonsynonymous single nucleotide polymorphisms in the function and structure of RAG1& RAG2 genes using In silico analysis. Only nsSNPs and 3’UTR SNPs were selected for computational analysis. Predictions of deleterious nsSNPs were performed by bioinformatics software.
    [Show full text]
  • Autoaggressive T Cells in the Periphery RAG2
    Cutting Edge: CD40-Induced Expression of Recombination Activating Gene (RAG) 1 and RAG2: A Mechanism for the Generation of Autoaggressive T Cells in the Periphery This information is current as of September 25, 2021. Gisela M. Vaitaitis, Michelle Poulin, Richard J. Sanderson, Kathryn Haskins and David H. Wagner, Jr. J Immunol 2003; 170:3455-3459; ; doi: 10.4049/jimmunol.170.7.3455 http://www.jimmunol.org/content/170/7/3455 Downloaded from References This article cites 24 articles, 12 of which you can access for free at: http://www.jimmunol.org/content/170/7/3455.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 25, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2003 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. THE JOURNAL OF IMMUNOLOGY CUTTING EDGE Cutting Edge: CD40-Induced Expression of Recombination Activating Gene (RAG) 1 and RAG2: A Mechanism for the Generation of Autoaggressive T Cells in the Periphery1 Gisela M.
    [Show full text]
  • Regulating Antigen-Receptor Gene Assembly
    REVIEWS REGULATING ANTIGEN-RECEPTOR GENE ASSEMBLY Mark S. Schlissel The genes encoding antigen receptors are unique because of their high diversity and their assembly in developing lymphocytes from gene segments through a series of site-specific DNA recombination reactions known as V(D)J rearrangement. This review focuses on our understanding of how recombination of immunoglobulin and T-cell receptor gene segments is tightly regulated despite being catalysed by a common lymphoid recombinase, which recognizes a widely distributed conserved recombination signal sequence. Probable mechanisms involve precise expression of the lymphoid-restricted recombination-activating genes RAG1 and RAG2, and developmentally regulated epigenetic alterations in template accessibility, which are targeted by transcriptional regulatory elements and involve chromatin-modifying enzymes. RECOMBINATION SIGNAL It has been nearly 25 years since Tonegawa and col- V(D)J recombination: levels of regulation 1 SEQUENCES leagues shattered one of the basic assumptions of V(D)J recombination has three types of regulation — (RSSs). Short, conserved DNA molecular biology, the inviolate structure of the lineage specificity, order within a lineage and allelic sequences that flank all genome, and in so doing solved a fundamental puzzle exclusion. Transcriptional regulation limits the expres- rearranging gene segments and serve as the recognition elements in immunology — the generation of antigen-receptor sion of RAG proteins to the progenitor stages of B- for the recombinase machinery.
    [Show full text]
  • Collaboration of RAG2 with RAG1-Like Proteins During the Evolution of V(D)J Recombination
    Downloaded from genesdev.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press Collaboration of RAG2 with RAG1-like proteins during the evolution of V(D)J recombination Lina Marcela Carmona,1 Sebastian D. Fugmann,2,3 and David G. Schatz1,4 1Department of Immunobiology, Yale University School of Medicine, New Haven, Connecticut, 06520, USA; 2Department of Biomedical Sciences, Chang Gung University, Tao-Yuan City 33302, Taiwan; 3Chang Gung Immunology Consortium, Chang Gung Memorial Hospital, Chang Gung University, Tao-Yuan City 33302, Taiwan; 4Howard Hughes Medical Institute, New Haven, Connecticut 06511, USA The recombination-activating gene 1 (RAG1) and RAG2 proteins initiate V(D)J recombination, the process that assembles the B- and T-lymphocyte antigen receptor genes of jawed vertebrates. RAG1 and RAG2 are thought to have arisen from a transposable element, but the origins of this element are not understood. We show that two ancestral RAG1 proteins, Transib transposase and purple sea urchin RAG1-like, have a latent ability to initiate V(D)J recombination when coexpressed with RAG2 and that in vitro transposition by Transib transposase is stimulated by RAG2. Conversely, we report low levels of V(D)J recombination by RAG1 in the absence of RAG2. Recombination by RAG1 alone differs from canonical V(D)J recombination in having lost the requirement for asymmetric DNA substrates, implicating RAG2 in the origins of the “12/23 rule,” a fundamental regulatory feature of the reaction. We propose that evolution of RAG1/RAG2 began with a Transib transposon whose intrinsic recombination activity was enhanced by capture of an ancestral RAG2, allowing for the development of adaptive immunity.
    [Show full text]
  • Chapter 5 Genetic Models
    Chapter 5 1 2 Organization and Expression of Immunoglobulin Genes 3 4 5 6 Genetic Models Models to Explain Antibody Diversity 1) The Germ Line Theory : “genome posses • How to account for : the large repertoire of antibody genes to – 1) Vast diversity of antibody specificities account for all the antibody diversity” – 2) Presence of Variable regions at the amino end of Heavy and Light chains, and a 2) The Somatic Variation Theory : “genome Constant region at the carboxyl end posses a relatively small number of – 3) Existence of isotypes (different Heavy antibody genes and diversity is generated by chains) with same antigenic specificity mutation and recombination of these genes during somatic development” The two-gene model : Tonegawa (1976): Immunoglobulin gene rearrangement • Developed by Dreyer and Bennet in 1965 • Two separate genes code for the Heavy and Light chains. One codes for the V region and the other for the C region • These genes come together during at the DNA level to form a continuous message • There are thousands of V genes in germ - J Probe - Digested fragments line but only one gene for the C region 1 Three genetic loci encode immunoglobulin molecules: - Two loci encoding the light chains Multigene Families - kappa locus - lambda locus • Light Chains : V, J and C gene segments. - One locus encoding the heavy chain • Lambda : Humans (30V, 4J and 7C genes) These three loci are located on different chromosomes. • Kappa : Humans (40V, 5J and 1C genes) • Heavy Chains : V, D, J and C gene segments • Heavy Chains : Humans (50V, 25D, 6J and 8 C genes) The loci encoding immunoglobulins have a unique structure.
    [Show full text]
  • Diagnostic Interpretation of Genetic Studies in Patients with Primary
    AAAAI Work Group Report Diagnostic interpretation of genetic studies in patients with primary immunodeficiency diseases: A working group report of the Primary Immunodeficiency Diseases Committee of the American Academy of Allergy, Asthma & Immunology Ivan K. Chinn, MD,a,b Alice Y. Chan, MD, PhD,c Karin Chen, MD,d Janet Chou, MD,e,f Morna J. Dorsey, MD, MMSc,c Joud Hajjar, MD, MS,a,b Artemio M. Jongco III, MPH, MD, PhD,g,h,i Michael D. Keller, MD,j Lisa J. Kobrynski, MD, MPH,k Attila Kumanovics, MD,l Monica G. Lawrence, MD,m Jennifer W. Leiding, MD,n,o,p Patricia L. Lugar, MD,q Jordan S. Orange, MD, PhD,r,s Kiran Patel, MD,k Craig D. Platt, MD, PhD,e,f Jennifer M. Puck, MD,c Nikita Raje, MD,t,u Neil Romberg, MD,v,w Maria A. Slack, MD,x,y Kathleen E. Sullivan, MD, PhD,v,w Teresa K. Tarrant, MD,z Troy R. Torgerson, MD, PhD,aa,bb and Jolan E. Walter, MD, PhDn,o,cc Houston, Tex; San Francisco, Calif; Salt Lake City, Utah; Boston, Mass; Great Neck and Rochester, NY; Washington, DC; Atlanta, Ga; Rochester, Minn; Charlottesville, Va; St Petersburg, Fla; Durham, NC; Kansas City, Mo; Philadelphia, Pa; and Seattle, Wash AAAAI Position Statements,Work Group Reports, and Systematic Reviews are not to be considered to reflect current AAAAI standards or policy after five years from the date of publication. The statement below is not to be construed as dictating an exclusive course of action nor is it intended to replace the medical judgment of healthcare professionals.
    [Show full text]
  • Immunology: Improving on Nature Review in the Twenty-First Century
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Elsevier - Publisher Connector Cell, Vol. 100, 129±138, January 7, 2000, Copyright 2000 by Cell Press Immunology: Improving on Nature Review in the Twenty-First Century Abul K. Abbas* and Charles A. Janeway Jr.² notion at the time, one that challenged existing concepts *Department of Pathology of how proteins conformed to the shapes of other inter- University of California San Francisco School acting proteins. Nevertheless, the clonal selection the- of Medicine ory became the foundation for our understanding of the San Francisco, California 94123 specificity and development of immune responses. The ² Section of Immunobiology molecular understanding of how the diverse repertoire Yale University School of Medicine of antigen receptors is generated came with the studies New Haven, Connecticut 06520 of Susumu Tonegawa in the 1970s (Tonegawa et al., 1977). Based on this work, and its many subsequent refinements, it is now known that the antigen receptors Introduction of B and T lymphocytes are encoded by genes that are Immunology is the study of the body's defenses against produced by somatic recombination of gene segments infection. The birth of immunology as an experimental during maturation of the cells. The recombination pro- science dates to Edward Jenner's successful vaccina- cess is initiated by the RAG proteins, and presence of tion against smallpox in 1796 (Jenner, 1798). The world- RAG genes during phylogeny identifies the evolutionary wide acceptance of vaccination led to mankind's great- time of appearance of the adaptive immune system, est achievements in preventing disease, and smallpox which is just past the appearance of vertebrates (Agra- is the first and only human disease that has been eradi- wal et al., 1998; Hiom et al., 1998).
    [Show full text]
  • B-Cell Differentiation Is Pressuromodulated As Determined by Pressuromodulation Mapping: Part I, Cell Differentiation Hemant Sarin
    Sarin Translational Medicine Communications (2018) 3:3 Translational Medicine https://doi.org/10.1186/s41231-018-0019-y Communications RESEARCH Open Access B-cell differentiation is pressuromodulated as determined by pressuromodulation mapping: Part I, cell differentiation Hemant Sarin Abstract Background: The episodic sub-episode block sums split-integrated weighted average-averaged gene overexpression tropy quotient (esebssiwaagoTQ) is a measure of the 5′ → 3′ reading direction intergene distance tropy that needs to be overcome for horizontal alignment of a gene for maximal transcription; and it is also an arbitrary unit measure of the intracellular pressure needed for maximal gene expression. In this study, B-cell differentiation is studied by esebssiwaagoTQ-based pressuromodulation mapping of B-cell stage marker genes. Methods: Locations of 25 B-cell differentiation stage genes, and locations of downstream and upstream genes were mined at GeneCards and at LNCipedia, pseudogenes included and enhancers excluded. The esebssiwaagoTQsforeach gene were determined. A pressuromodulation map was generated by arranging overexpressed B-cell stage marker genes in descending and ascending order by esebssiwaagoTQ in reference to periods of B-cell polarization. Results: The gene esebssiwaagoTQsareCD34 0.65 (0.648), PRDM1 0.36 (0.356), PTPRC 0.35 (0.345), MKI67 0.33 (0.329), ENPP1 0.31 (0.308), RAG2 0.31 (0.306), MS4A1 0.30 (0.299), PCNA 0.28 (0.285), ESPL1 0.28 (0.275), CD79B 0.27 (0.271), AICDA 0.27 (0.266), CD40 0.26 (0.257), APOBEC3A/-B 0.22 (0.216), CD38 0.21 (0.212), CD27 0.19 (0.194), APOBEC3C/−D/-F/−G 0.17 (0.173), CD19 0.15 (0.153), RAG1 0.14 (0.139), CD79A 0.14 (0.137), CR2 0.11 (0.109), and APOBEC3H 0.10 (0.102);theseare pressuromodulation mapped in reference to B-cell polarization state and differentiation stage.
    [Show full text]
  • Deletion of the RAG2 C Terminus Leads to Impaired Lymphoid Development in Mice
    Deletion of the RAG2 C terminus leads to impaired lymphoid development in mice Yoshiko Akamatsu*†‡, Robert Monroe‡§¶, Darryll D. Dudley§, Sheryl K. Elkin*, Frank Ga¨ rtner§ʈ, Sadiqur R. Talukder†**, Yousuke Takahama†**, Frederick W. Alt§, Craig H. Bassing§††‡‡, and Marjorie A. Oettinger*††‡‡ *Department of Molecular Biology, Massachusetts General Hospital, Boston, MA 02114; §The Howard Hughes Medical Institute, Children’s Hospital, Harvard Medical School, Center for Blood Research, Boston, MA 02115; †Institute for Genome Research, University of Tokushima, Tokushima 770-8503, Japan; and **RIKEN Research Center for Allergy and Immunology, Tokushima 770-8503, Japan Contributed by Frederick W. Alt, November 19, 2002 The recombination-activating gene (RAG)1 and RAG2 proteins required for activity, because full-length RAG1 and RAG2 are comprise the lymphocyte-specific components of the V(D)J recom- largely insoluble. However, the activities of these mutant ‘‘core’’ binase and are required for the assembly of antigen-receptor proteins differ from those of the full-length RAGs when assayed variable-region genes. A mutant truncated RAG2 protein (‘‘core’’ with extrachromosomal substrates in transfected cells. In this RAG2) lacking the C-terminal 144 amino acids, together with core context, the mutant core RAG proteins support V(D)J recom- RAG1, is able to mediate the basic biochemical steps required for bination with reduced efficiency and with different levels and V(D)J recombination in vitro and in transfected cell lines. Here we types of recombination products (9–15). examine the effect of replacing the endogenous RAG2 locus in mice Although not required for the biochemistry of V(D)J recom- with core RAG2.
    [Show full text]
  • ( 12 ) United States Patent
    US010100305B2 (12 ) United States Patent (10 ) Patent No. : US 10 , 100 , 305 B2 Iversen ( 45) Date of Patent : Oct. 16 , 2018 (54 ) METHODS AND COMPOSITIONS FOR 5 ,714 , 331 A 2 / 1998 Buchardt et al . MANIPULATING TRANSLATION OF 5 , 719 , 262 A 2 / 1998 Buchardt et al. 6 , 245 ,747 B1 6 / 2001 Porter et al. PROTEIN ISOFORMS FROM ALTERNATIVE 6 ,670 ,461 B1 12 / 2003 Wengel et al. INITIATION OF START SITES 6 ,692 , 911 B2 2 /2004 Pack et al . 6 , 969 , 766 B2 11 /2005 Kim et al. 7 , 022 , 851 B2 4 /2006 Kim et al . ( 75 ) Inventor : Patrick L . Iversen , Corvallis, OR (US ) 7 , 034 , 133 B2 4 / 2006 Wengel et al. 7 , 053 , 207 B2 5 / 2006 Wengel ( 73 ) Assignee : SAREPTA THERAPEUTICS , INC . , 7 . 060 . 809 B2 6 / 2006 Wengel et al. Cambridge , MA (US ) 7 ,070 , 807 B2 7 /2006 Mixson 7 ,084 , 125 B2 8 / 2006 Wengel ( * ) Notice : Subject to any disclaimer, the term of this 7 , 125 , 994 B2 10 / 2006 Kim et al. patent is extended or adjusted under 35 7 , 145 , 006 B2 12 / 2006 Kim et al. U . S . C . 154 ( b ) by 0 days . 7 , 163, 695 B2 1 / 2007 Mixson 7 , 179 ,896 B2 2 /2007 Kim et al. 7 ,211 ,668 B2 5 / 2007 Kim et al. ( 21 ) Appl. No .: 14 /232 , 858 7 ,517 ,644 B1 * 4 / 2009 Smith .. .. ** - -. .. 435 /6 . 12 7 , 569 ,575 B2 8 / 2009 Sorensen et al. ( 22 ) PCT Filed : Jul. 13 , 2012 7 ,572 ,582 B2 8 / 2009 Wengel et al.
    [Show full text]
  • Recombination-Activating Gene 1 and 2 (RAG1 and RAG2) in Flounder (Paralichthys Olivaceus)
    Recombination-activating gene 1 and 2 (RAG1 and RAG2) in flounder (Paralichthys olivaceus) 1,2 1, 1 1 1 XIANLEI WANG ; XUNGANG TAN *; PEI-JUN ZHANG ; YUQING ZHANG and PENG XU 1Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, China 2National Oceanographic Center, 88 Xuzhou Road, Qingdao, Shandong 266071, China *Corresponding author (Email, [email protected]) During the development of B and T lymphocytes, Ig and TCR variable region genes are assembled from germline V, D, and J gene segments by a site-specific recombination reaction known as V(D)J recombination. The process of somatic V(D)J recombination, mediated by the recombination-activating gene (RAG) products, is the most significant characteristic of adaptive immunity in jawed vertebrates. Flounder (Paralichthys olivaceus) RAG1 and RAG2 were isolated by Genome Walker and RT-PCR, and their expression patterns were analysed by RT-PCR and in situ hybridization on sections. RAG1 spans over 7.0 kb, containing 4 exons and 3 introns, and the full-length ORF is 3207 bp, encoding a peptide of 1068 amino acids. The first exon lies in the 5′-UTR, which is an alternative exon. RAG2 full-length ORF is 1062 bp, encodes a peptide of 533 amino acids, and lacks introns in the coding region. In 6-month- old flounders, the expression of RAG1 and RAG2 was essentially restricted to the pronephros (head kidney) and mesonephros (truck kidney). Additionally, both of them were mainly expressed in the thymus. These results revealed that the thymus and kidney most likely serve as the primary lymphoid tissues in the flounder.
    [Show full text]