Immunoglobulin heavy chain expression shapes the B cell receptor repertoire in human B cell development Eric Meffre, … , Michel C. Nussenzweig, Claudine Schiff J Clin Invest. 2001;108(6):879-886. https://doi.org/10.1172/JCI13051. Article Developing B cells must pass a series of checkpoints that are regulated by membrane-bound Igμ through the Igα-Igβ signal transducers. To determine how Igμ expression affects B cell development and Ab selection in humans we analyzed Ig gene rearrangements in pro-B cells from two patients who are unable to produce Igμ proteins. We find that Igμ expression does not affect VH, D, or JH segment usage and is not required for human Igκ and Igλ recombination or expression. However, the heavy and light chains found in pro-B cells differed from those in peripheral B cells in that they showed unusually long CDR3s. In addition, the Igκ repertoire in Igμ-deficient pro-B cells was skewed to downstream Jκs and upstream Vκs, consistent with persistent secondary V(D)J rearrangements. Thus, Igμ expression is not required for secondary V(D)J recombination in pro-B cells. However, B cell receptor expression shapes the Ab repertoire in humans and is essential for selection against Ab’s with long CDR3s. Find the latest version: https://jci.me/13051/pdf Immunoglobulin heavy chain expression shapes the B cell receptor repertoire in human B cell development Eric Meffre,1,2 Michèle Milili,2 Carla Blanco-Betancourt,2 Henedina Antunes,3 Michel C. Nussenzweig,1 and Claudine Schiff2 1Laboratory of Molecular Immunology, The Rockefeller University, Howard Hughes Medical Institute, New York, New York, USA 2Centre d’Immunologie de Marseille-Luminy, CNRS-INSERM–Université de la Méditerranée, Campus de Luminy, Marseille, France 3Fundacao Faculdade Federal de Ciencias, Medicas de Porto Alegre, Portugal Address correspondence to: Eric Meffre, The Rockefeller University, 1230 York Avenue, New York, New York 10021, USA. Phone: (212) 327-8098; Fax: (212) 327-8370; E-mail: [email protected]. Received for publication April 16, 2001, and accepted in revised form August 13, 2001. Developing B cells must pass a series of checkpoints that are regulated by membrane-bound Igµ through the Igα-Igβ signal transducers. To determine how Igµ expression affects B cell development and Ab selection in humans we analyzed Ig gene rearrangements in pro-B cells from two patients who are unable to produce Igµ proteins. We find that Igµ expression does not affect VH, D, or JH segment usage and is not required for human Igκ and Igλ recombination or expression. However, the heavy and light chains found in pro-B cells differed from those in peripheral B cells in that they showed unusu- ally long CDR3s. In addition, the Igκ repertoire in Igµ-deficient pro-B cells was skewed to downstream Jκs and upstream Vκs, consistent with persistent secondary V(D)J rearrangements. Thus, Igµ expres- sion is not required for secondary V(D)J recombination in pro-B cells. However, B cell receptor expres- sion shapes the Ab repertoire in humans and is essential for selection against Ab’s with long CDR3s. J. Clin. Invest. 108:879–886 (2001). DOI:10.1172/JCI200113051. Introduction third complementary determining region (CDR3). Pro- Expression of immunoglobulin heavy chains (Igµ) in and pre-B cells from adult bone marrow have longer pro-B cells induces pre-B cell development by assembly CDR3s than mature B cells (31–33). of a pre-B cell receptor (pre-BCR), which is a complex of Following successful IgH assembly and pre-BCR Igµ, surrogate light chains (ψL), and two signal-trans- expression, V(D)J recombination is targeted to the light ducing proteins, Igα and Igβ (1–6). Pre-BCR expression chain (IgL) genes (34–38). Those cells that produce in- induces proliferative expansion and downregulation of frame IgL chains test their newly synthesized Igs for self- recombinase-activating genes (RAG1 and RAG2), there- reactivity. In the mouse, B cells that produce self-reac- by ensuring allelic exclusion while selecting clones of tive receptors are either deleted or arrested in cells with productive VDJH rearrangements (7). Muta- development and undergo receptor editing (39-45). In tions in mIgµ, ψL, or Igα/Igβ genes that disrupt pre-BCR contrast, less is known about receptor selection and the assembly impede B cell development at the pro-B cell role of the BCR in regulating B cell development in stage in mice and humans (8–15). humans. Here we report on the role of the BCR in Ig Pre-BCR assembly is dependent on interaction repertoire selection in two patients with different muta- between VH variable regions and ψL, and in the mouse tions in the Igµ gene that impairs BCR assembly. the IgH repertoire is selected in part on the basis of this interaction (16–18). It has been proposed that VH Methods domains that pair well with ψL are positively selected Patient samples and cell preparation. Bone marrow samples at the pre-B cell stage, whereas VH domains that pair were obtained from two Igµ-deficient patients with poorly with ψL are not. However, selection differs in either a homozygous cytidine insertion in the Igµ gene –/– mouse fetal and adult B cell development such that VHs (Igµ ) or with a homozygous deletion of the Igµ locus that are counterselected in the adult are prominent in (Igµ∆) (see Results) (13, 46, 47) (C. Schiff, unpublished the fetal repertoire (18). observations). Samples were obtained when the Igµ∆ In contrast to mice, there is no apparent difference in patient was 2 years old, the Igµ–/– patient was 4 years +/– the VH repertoire between pro-B, pre-B, or fetal B cells old, and her Igµ brother (control) was 9 months old. and adult mature B cells in the human (19–30). How- The parents gave informed consent for this study. Bone ever, there is selection for IgH genes during human marrow mononuclear cells were isolated by Ficoll gra- B cell development as determined by the length of the dients and CD34+CD19+ pro-B cells were sorted on a The Journal of Clinical Investigation | September 2001 | Volume 108 | Number 6 879 FACSVantage after labeling with FITC anti-CD34 and and Igλ CDR3 length included amino acids between phycoerythrin anti-CD19 mAb’s (Beckman Coulter, conserved cystein 88 and the phenylalanine residue Brea, California, USA). embedded in Jκ or Jλ (51). Nontemplate (N) nucleotides RNA and RT-PCR. Total RNA was extracted from (52) found at Vκ-Jκ or Vλ-Jλ junctions were counted 104–105 purified cells using TRIzol Reagent (Life while template-dependent palindromic (P) nucleotides Technologies Inc., Rockville, Maryland, USA). RNA (53) were excluded. Differences in gene distribution was reverse transcribed with Superscript II (Life were analyzed with χ2 tests (Cochran-Mantel-Haenszel Technologies Inc.) according to the manufacturer’s test) adjusted by the Bonferroni method for multiple instructions. For RT-PCR reactions, cDNA was testing, and they were considered significant when amplified for 25 (actin), 35 (VH-Cµ), or 38 (Vκ-Cκ) P values were less than or equal to 0.05. cycles of 30 seconds at 94°C, 30 seconds at 60°C, and 30 seconds at 72°C, or for 40 cycles (Vλ-Cλ) of 30 Results seconds at 94°C, 30 seconds at 55°C, and 30 seconds IgH and IgL transcription is independent of Igµ expression. at 72°C, with a final 10-minute extension at 72°C Two patients with agammaglobulinemia and IgH using Hot Star Taq DNA polymerase (QIAGEN Inc., mutations were studied. Igµ–/– has a cytidine insertion Valencia, California, USA) and the following in the CH1 exon of the Igµ gene that leads to a primers: Vλ consensus sense, 5′GGG(G/A)TC(T/C)CT- frameshift and the inability to produce Igµ products ∆ GA(C/T/G)CG(A/C/G)TTCTCTGG(C/G)TCC3′; Cλ anti- (13, 46, 47). Igµ has a deletion in the Ig locus from 3′ sense, 5′CACAC(T/C)AGTGTGGCCTTGTTGGCTTG3′. of the diversity (D) region to Igγ2, with all junction (J) VH1, VH3, VH4, Cµ,Vκ consensus and Cκ primers were segments and Igµ, Igδ, Igγ3, and Igγ1 genes missing (C. described previously (48, 49). RT-PCR products were Schiff, unpublished observations). analyzed on 2% agarose gels and visualized by adding Flow cytometric analysis of bone marrow from Igµ–/– 0.3 pmol of 32PdATP to the PCR reaction. and Igµ∆ patients revealed that in both cases B cell dif- Cloning and sequencing. PCR products were gel-purified ferentiation was arrested at the CD34+CD19+ pro-B (Qiaquick; QIAGEN Inc.) and cloned into TA vectors cell stage (Figure 1a) (12, 13, 46, 47). To characterize (Invitrogen, Carlsbad, California, USA). Double- Ig expression in Igµ-deficient pro-B cells, transcripts stranded DNA sequences were obtained using anti- for heavy and light chain genes were amplified by sense Cµ, Cκ, or Cλ primers and Dye Terminator Cycle semiquantitative RT-PCR from sorted CD34+CD19+ Sequencing (Applied Biosystems, Foster City, Califor- pro-B cells from Igµ–/–, Igµ∆, and a control sibling (Fig- ∆ nia, USA). Sequences were analyzed by comparison ure 1). As expected, VH-Cµ mRNA was missing in Igµ with Ig basic alignment search tool (BLAST). IgH pro-B cells where the entire Igµ locus was deleted (Fig- CDR3 length was determined by counting amino acid ure 1b). In contrast, Igµ–/– and control pro-B cells residues between positions 94 and 102 (conserved tryp- showed similar levels of VH-Cµ transcripts revealing tophan in all JH segments) and D segments were iden- that the absence of Igµ protein does not affect the Igµ tified following the criteria of Corbett et al.