DOCSLIB.ORG

DACH1 Mutation Frequency in Endometrial Cancer Is Associated with High Tumor Mutation Burden

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
DACH1 Mutation Frequency in Endometrial Cancer Is Associated with High Tumor Mutation Burden University of Kentucky UKnowledge Obstetrics and Gynecology Faculty Publications Obstetrics and Gynecology 12-30-2020 DACH1 Mutation Frequency in Endometrial Cancer Is Associated with High Tumor Mutation Burden McKayla J. Riggs University of Kentucky, [email protected] Nan Lin University of Kentucky, [email protected] Chi Wang University of Kentucky, [email protected] Dava W. Piecoro University of Kentucky, [email protected] Rachel W. Miller University of Kentucky, [email protected] Follow this and additional works at: https://uknowledge.uky.edu/obgyn_facpub See next page for additional authors Part of the Biostatistics Commons, Obstetrics and Gynecology Commons, Oncology Commons, and the Pathology Commons Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Repository Citation Riggs, McKayla J.; Lin, Nan; Wang, Chi; Piecoro, Dava W.; Miller, Rachel W.; Hampton, Oliver A.; Rao, Mahadev; Ueland, Frederick R.; and Kolesar, Jill M., "DACH1 Mutation Frequency in Endometrial Cancer Is Associated with High Tumor Mutation Burden" (2020). Obstetrics and Gynecology Faculty Publications. 28. https://uknowledge.uky.edu/obgyn_facpub/28 This Article is brought to you for free and open access by the Obstetrics and Gynecology at UKnowledge. It has been accepted for inclusion in Obstetrics and Gynecology Faculty Publications by an authorized administrator of UKnowledge. For more information, please contact [email protected]. DACH1 Mutation Frequency in Endometrial Cancer Is Associated with High Tumor Mutation Burden Digital Object Identifier (DOI) https://doi.org/10.1371/journal.pone.0244558 Notes/Citation Information Published in PLOS ONE, v. 15, issue 12, e0244558. This is an open access article, free of all copyright, and may be freely reproduced, distributed, transmitted, modified, built upon, or otherwise used by anyone for any lawful purpose. The work is made available under the Creative Commons CC0 public domain dedication. Authors McKayla J. Riggs, Nan Lin, Chi Wang, Dava W. Piecoro, Rachel W. Miller, Oliver A. Hampton, Mahadev Rao, Frederick R. Ueland, and Jill M. Kolesar This article is available at UKnowledge: https://uknowledge.uky.edu/obgyn_facpub/28 PLOS ONE RESEARCH ARTICLE DACH1 mutation frequency in endometrial cancer is associated with high tumor mutation burden 1☯ 2☯ 3,4³ 5³ 1,4³ McKayla J. RiggsID , Nan Lin , Chi Wang , Dava W. Piecoro , Rachel W. Miller , 6³ 7³ 1,4³ 1,2,4☯ Oliver A. HamptonID , Mahadev Rao , Frederick R. Ueland , Jill M. Kolesar * 1 Division of Gynecologic Oncology, Department of Obstetrics and Gynecology, University of Kentucky, Lexington, Kentucky, United States of America, 2 College of Pharmacy, University of Kentucky, Lexington, Kentucky, United States of America, 3 Department of Biostatistics, College of Public Health, University of a1111111111 Kentucky, Lexington, Kentucky, United States of America, 4 Markey Cancer Center, University of Kentucky, a1111111111 Lexington, Kentucky, United States of America, 5 Division of Pathology, Department of Pathology and a1111111111 Laboratory Medicine, University of Kentucky, Lexington, Kentucky, United States of America, 6 Department a1111111111 of Bioinformatics and Biostatistics, M2Gen, Tampa, Florida, United States of America, 7 Department of a1111111111 Pharmacy Practice, Manipal College of Pharmaceutical Sciences, Manipal Academy of Higher Education, Manipal, Karnataka, India ☯ These authors contributed equally to this work. ³ These authors also contributed equally to this work. * [email protected] OPEN ACCESS Citation: Riggs MJ, Lin N, Wang C, Piecoro DW, Miller RW, Hampton OA, et al. (2020) DACH1 Abstract mutation frequency in endometrial cancer is associated with high tumor mutation burden. PLoS ONE 15(12): e0244558. https://doi.org/10.1371/ Objective journal.pone.0244558 DACH1 is a transcriptional repressor and tumor suppressor gene frequently mutated in mel- Editor: Sumitra Deb, Virginia Commonwealth University, UNITED STATES anoma, bladder, and prostate cancer. Loss of DACH1 expression is associated with poor prognostic features and reduced overall survival in uterine cancer. In this study, we utilized Received: October 6, 2020 the Oncology Research Information Exchange Network (ORIEN) Avatar database to deter- Accepted: December 11, 2020 mine the frequency of DACH1 mutations in patients with endometrial cancer in our Kentucky Published: December 30, 2020 population. Peer Review History: PLOS recognizes the benefits of transparency in the peer review Methods process; therefore, we enable the publication of all of the content of peer review and author We obtained clinical and genomic data for 65 patients with endometrial cancer from the Mar- responses alongside final, published articles. The key Cancer Center (MCC). We examined the clinical attributes of the cancers by DACH1 editorial history of this article is available here: status by comparing whole-exome sequencing (WES), RNA Sequencing (RNASeq), micro- https://doi.org/10.1371/journal.pone.0244558 satellite instability (MSI), and tumor mutational burden (TMB). Copyright: This is an open access article, free of all copyright, and may be freely reproduced, distributed, transmitted, modified, built upon, or Results otherwise used by anyone for any lawful purpose. Kentucky women with endometrial cancer had an increased frequency of DACH1 mutations The work is made available under the Creative (12/65 patients, 18.5%) compared to The Cancer Genome Atlas (TCGA) endometrial can- Commons CC0 public domain dedication. cer population (25/586 patients, 3.8%) with p-value = 1.04E-05. DACH1 mutations were Data Availability Statement: Authors received no associated with increased tumor mutation count in both TCGA (median 65 vs. 8972, p-value special privileges in accessing the data. Raw data cannot be shared because they are both potentially = 7.35E-09) and our Kentucky population (490 vs. 2160, p-value = 6.0E-04). DACH1 identifying and contain sensitive patient data, mutated patients have a higher tumor mutation burden compared to DACH1 wild-type (24 PLOS ONE | https://doi.org/10.1371/journal.pone.0244558 December 30, 2020 1 / 21 PLOS ONE DACH1 mutation frequency in endometrial cancer is associated with high tumor mutation burden including geographic location, dates of diagnosis vs. 6.02, p-value = 4.29E-05). DACH1 mutations showed significant gene co-occurrence and dates of testing and receiving a medication. In patterns with POLE, MLH1, and PMS2. DACH1 mutations were not associated with an addition, there are contractual agreements between the University of Kentucky and the Kentucky increase in microsatellite instability at MCC (MSI-H) (p-value = 0.1342). Cancer Registry precluding data sharing. Any requests for data must be submitted to: Jacyln K. Conclusions McDowell, Epidemiologist, Kentucky Cancer DACH1 mutations are prevalent in Kentucky patients with endometrial cancer. These muta- Registry 2365 Harrodsburg Rd, Suite A230 Lexington, KY 40504 859-218-2228 Jaclyn. tions are associated with high tumor mutational burden and co-occur with genome destabi- [email protected]. lizing gene mutations. These findings suggest DACH1 may be a candidate biomarker for Funding: Funding for this project was received by future trials with immunotherapy, particularly in endometrial cancers. the NCI Cancer Center Support Grant (P30 CA177558). Dr. Piecoro's spouse's employment by Exelixis, Inc, is noted but completely unrelated to this project. His funding organization did not play a role in the study design, data collection and analysis, decision to publish, or preparation of the Introduction manuscript in any way. Dr. Hampton is employed Uterine cancer is increasing in incidence and mortality in the United States. In 2020, an esti- by M2Gen and serves as the chief officer of mated 65,620 women will be diagnosed with endometrial cancer, making it the fourth most bioinformatics over the ORIEN pipeline. M2Gen did not play a role in the study design, data collection common female cancer, with an estimated 12,590 deaths [1]. Kentucky is an above-average and analysis, or decision to publish. He and his risk region, with 29 new cases per 100,000 women compared to 27.6 per 100,000 women department assisted in separating our patients into nationally [2]. The mean five-year survival rate for endometrial cancer is 81.2%, with more DACH1 mutated vs wild-type cohorts through the than 67% of patients diagnosed at an early stage. The survival rate decreases to 69% for locally ORIEN software and provided the information metastatic and 16% for widely metastatic disease [3]. The treatment paradigm for endometrial regarding the ORIEN genomic processing pipeline for this paper. Dr. Hampton was not involved in the cancer has been unchanged for some time. Current first-line therapy includes a combination subsequent bioinformatics analysis. He did provide of surgery, carboplatin and paclitaxel chemotherapy, and radiation depending on the stage final proofreading of the manuscript prior to and risk. submission. The specific roles of these authors are To molecularly categorize endometrial cancers, Kandoth and colleagues performed an inte- articulated in the `author contributions' section. grated genomic, transcriptomic, and proteomic analysis of 373 endometrial carcinomas. They Competing interests: The employment of Dr. were able to classify these cancers into POLE ultramutated, microsatellite instability hypermu- Oliver Hampton by M2GEN does not alter our tated (MSI-H), copy number low, and copy
Load more

Recommended publications
  • Research Article Integrative Deep Learning for Identifying Differentially Expressed (DE) Biomarkers
    Hindawi Computational and Mathematical Methods in Medicine Volume 2019, Article ID 8418760, 10 pages https://doi.org/10.1155/2019/8418760 Research Article Integrative Deep Learning for Identifying Differentially Expressed (DE) Biomarkers Jayeon Lim ,1 SoYoun Bang,2 Jiyeon Kim,3 Cheolyong Park ,3 JunSang Cho,4 and SungHwan Kim 1 1Department of Applied Statistics, Konkuk University, Seoul, Republic of Korea 2Department of Data Science, Konkuk University, Seoul, Republic of Korea 3Department of Statistics, Keimyung University, Daegu, Republic of Korea 4Industry-University Cooperation Foundation, Konkuk University, Seoul, Republic of Korea Correspondence should be addressed to SungHwan Kim; [email protected] Received 5 April 2019; Revised 19 June 2019; Accepted 4 August 2019; Published 2 November 2019 Academic Editor: Esmaeil Ebrahimie Copyright © 2019 Jayeon Lim et al. +is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. As a large amount of genetic data are accumulated, an effective analytical method and a significant interpretation are required. Recently, various methods of machine learning have emerged to process genetic data. In addition, machine learning analysis tools using statistical models have been proposed. In this study, we propose adding an integrated layer to the deep learning structure, which would enable the effective analysis of genetic data and the discovery of significant biomarkers of diseases. We conducted a simulation study in order to compare the proposed method with metalogistic regression and meta-SVM methods. +e objective function with lasso penalty is used for parameter estimation, and the Youden J index is used for model comparison.
    [Show full text]
  • Using Evolutionary Conserved Modules in Gene Networks As a Strategy to Leverage High Throughput Gene Expression Queries Jeanne M
    Ecology, Evolution and Organismal Biology Ecology, Evolution and Organismal Biology Publications 9-2010 Using Evolutionary Conserved Modules in Gene Networks as a Strategy to Leverage High Throughput Gene Expression Queries Jeanne M. Serb Iowa State University, [email protected] Megan C. Orr Iowa State University M. Heather West Greenlee Iowa State University, [email protected] Follow this and additional works at: http://lib.dr.iastate.edu/eeob_ag_pubs Part of the Ecology and Evolutionary Biology Commons, Genetics Commons, and the Systems Biology Commons The ompc lete bibliographic information for this item can be found at http://lib.dr.iastate.edu/ eeob_ag_pubs/19. For information on how to cite this item, please visit http://lib.dr.iastate.edu/ howtocite.html. This Article is brought to you for free and open access by the Ecology, Evolution and Organismal Biology at Iowa State University Digital Repository. It has been accepted for inclusion in Ecology, Evolution and Organismal Biology Publications by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Using Evolutionary Conserved Modules in Gene Networks as a Strategy to Leverage High Throughput Gene Expression Queries Abstract Background: Large-scale gene expression studies have not yielded the expected insight into genetic networks that control complex processes. These anticipated discoveries have been limited not by technology, but by a lack of effective strategies to investigate the data in a manageable and meaningful way. Previous work suggests that using a pre-determined seednetwork of gene relationships to query large-scale expression datasets is an effective way to generate candidate genes for further study and network expansion or enrichment.
    [Show full text]
  • CSE642 Final Version
    Eindhoven University of Technology MASTER Dimensionality reduction of gene expression data Arts, S. Award date: 2018 Link to publication Disclaimer This document contains a student thesis (bachelor's or master's), as authored by a student at Eindhoven University of Technology. Student theses are made available in the TU/e repository upon obtaining the required degree. The grade received is not published on the document as presented in the repository. The required complexity or quality of research of student theses may vary by program, and the required minimum study period may vary in duration. General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain Eindhoven University of Technology MASTER THESIS Dimensionality Reduction of Gene Expression Data Author: S. (Sako) Arts Daily Supervisor: dr. V. (Vlado) Menkovski Graduation Committee: dr. V. (Vlado) Menkovski dr. D.C. (Decebal) Mocanu dr. N. (Nikolay) Yakovets May 16, 2018 v1.0 Abstract The focus of this thesis is dimensionality reduction of gene expression data. I propose and test a framework that deploys linear prediction algorithms resulting in a reduced set of selected genes relevant to a specified case. Abstract In cancer research there is a large need to automate parts of the process of diagnosis, this is mainly to reduce cost, make it faster and more accurate.
    [Show full text]
  • Estrogen Receptor Β, a Regulator of Androgen Receptor Signaling in The
    Estrogen receptor β, a regulator of androgen receptor PNAS PLUS signaling in the mouse ventral prostate Wan-fu Wua, Laure Maneixa, Jose Insunzab, Ivan Nalvarteb, Per Antonsonb, Juha Kereb, Nancy Yiu-Lin Yub, Virpi Tohonenb, Shintaro Katayamab, Elisabet Einarsdottirb, Kaarel Krjutskovb, Yu-bing Daia, Bo Huanga, Wen Sua,c, Margaret Warnera, and Jan-Åke Gustafssona,b,1 aCenter for Nuclear Receptors and Cell Signaling, University of Houston, Houston, TX 77204; bCenter for Innovative Medicine, Department of Biosciences and Nutrition, Karolinska Institutet, Novum, 14186 Stockholm, Sweden; and cAstraZeneca-Shenzhen University Joint Institute of Nephrology, Centre for Nephrology & Urology, Shenzhen University Health Science Center, Shenzhen 518060, China Contributed by Jan-Åke Gustafsson, March 31, 2017 (sent for review February 8, 2017; reviewed by Gustavo E. Ayala and David R. Rowley) − − − − As estrogen receptor β / (ERβ / ) mice age, the ventral prostate (13). Several ERβ-selective agonists have been synthesized (14– (VP) develops increased numbers of hyperplastic, fibroplastic le- 20), and they have been found to be antiinflammatory in the brain sions and inflammatory cells. To identify genes involved in these and the gastrointestinal tract (21, 22) and antiproliferative in cell changes, we used RNA sequencing and immunohistochemistry to lines (23–27) and cancer models (23, 28). We have previously − − compare gene expression profiles in the VP of young (2-mo-old) shown that there is an increase in p63-positive cells in ERβ / − − and aging (18-mo-old) ERβ / mice and their WT littermates. We mouse VP but that these cells were not confined to the basal layer also treated young and old WT mice with an ERβ-selective agonist but were interdispersed with the basal and luminal layer (13).
    [Show full text]
  • Endogenous Dach1 in Cancer
    www.impactjournals.com/oncoscience/ Oncoscience,Oncoscience Advance 2015, Publications Vol.2, No.10 2015 Editorial Endogenous Dach1 in cancer Kongming Wu, Xun Yuan and Richard Pestell The Dachshund gene is a key component of the epithelial cells (PEC) reduced Dach1 expression both in retinal determination gene network in Drosophila eye cultured cells and in extirpated tumor tissues [2]. Combined development. Recent studies have demonstrated an with previous finding that DACH1 represses ligand induced important role for the human Dachshund homologue transcriptional activation of the androgen receptor and 1 (DACH1) in tumorigenesis [1]. Mechanistic studies prostate cancer cellular proliferation in tissue culture [3], it demonstrated that DACH1 regulates its target genes via is likely that DACH1 conveys distinct functions at different either directly binding to specific DNA sequences within stages of prostate cancer onset and progression. chromatin or indirectly through forming protein complex The transition from hormone-dependent to castrate- with other transcriptional factors, including c-Jun and resistant prostate cancer (CRPC) is the major cause of Smad4. DACH1 restrained proliferation, migration therapeutic failure. Clinical studies have shown that in vitro and repressed tumor growth and metastasis in vivo. increased IL-6 and IL-8 signaling correlates with CRPC There prior observations were based on cultured cells and predicts poor prognosis [4]. IL-6 and IL-8 produced engineering DACH1 expression. The physiological role of by prostate cancer cell promote cancer cell proliferation the endogenous DACH1 had not been determined in part and invasion. because genetic deletion in the mice was periembryonic Moreover, IL-8 signaling from tumor cells initiates lethal.
    [Show full text]
  • Breast Cancer Type Classification Using Machine Learning
    Journal of Personalized Medicine Article Breast Cancer Type Classification Using Machine Learning Jiande Wu and Chindo Hicks * Department of Genetics, School of Medicine, Louisiana State University Health Sciences Center, 533 Bolivar, New Orleans, LA 70112, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-504-568-2657 Abstract: Background: Breast cancer is a heterogeneous disease defined by molecular types and subtypes. Advances in genomic research have enabled use of precision medicine in clinical man- agement of breast cancer. A critical unmet medical need is distinguishing triple negative breast cancer, the most aggressive and lethal form of breast cancer, from non-triple negative breast cancer. Here we propose use of a machine learning (ML) approach for classification of triple negative breast cancer and non-triple negative breast cancer patients using gene expression data. Methods: We performed analysis of RNA-Sequence data from 110 triple negative and 992 non-triple negative breast cancer tumor samples from The Cancer Genome Atlas to select the features (genes) used in the development and validation of the classification models. We evaluated four different classification models including Support Vector Machines, K-nearest neighbor, Naïve Bayes and Decision tree using features selected at different threshold levels to train the models for classifying the two types of breast cancer. For performance evaluation and validation, the proposed methods were applied to independent gene expression datasets. Results: Among the four ML algorithms evaluated, the Support Vector Machine algorithm was able to classify breast cancer more accurately into triple negative and non-triple negative breast cancer and had less misclassification errors than the other three algorithms evaluated.
    [Show full text]
  • A Screen to Uncover Mediators of Resistance to Liver X Receptor Agonistic Cancer Therapy
    Aus der Medizinische Klinik mit Schwerpunkt Hämatologie, Onkologie und Tumorimmunologie der Medizinischen Fakultät Charité – Universitätsmedizin Berlin DISSERTATION A screen to uncover mediators of resistance to liver X receptor agonistic cancer therapy - Ermittlung potenzieller Vermittler von Resistenz gegen die Liver-X Rezeptor agonistische Krebstherapie zur Erlangung des akademischen Grades Doctor medicinae (Dr. med.) vorgelegt der Medizinischen Fakultät Charité – Universitätsmedizin Berlin von Kimia Nathalie Tafreshian aus Stuttgart, Deutschland Datum der Promotion: 05.03.2021 I Table of contents TABLE OF FIGURES ....................................................................................................................... IV LIST OF TABLES ............................................................................................................................... V LIST OF ABBREVIATIONS ............................................................................................................ VI ABSTRACT ..................................................................................................................................... VIII 1. INTRODUCTION ........................................................................................................................ 1 Colorectal carcinoma ........................................................................................................................ 1 Drug resistance in cancer .................................................................................................................
    [Show full text]
  • DACH1 Inhibits Glioma Invasion and Tumor Growth Via the Wnt/Catenin Pathway
    Journal name: OncoTargets and Therapy Article Designation: Original Research Year: 2018 Volume: 11 OncoTargets and Therapy Dovepress Running head verso: Wang et al Running head recto: DACH1 inhibits glioma via the Wnt/catenin pathway open access to scientific and medical research DOI: 168314 Open Access Full Text Article ORIGINAL RESEARCH DACH1 inhibits glioma invasion and tumor growth via the Wnt/catenin pathway Jing Wang* Background/aim: Glioma is the most common and malignant nervous system tumor and Yan Zou* is associated with high-grade malignancy and high recurrence. The mammalian Dachshund1 Xuechao Wu (DACH1) is a recognized anti-tumor site and has low expression in several malignant tumors, Mu Chen including glioma. We designed and conducted this study to further determine the mechanism Shuai Zhang of DACH1 in glioma. Xiaojie Lu Patients and methods: The data collected from specimens of patients with glioma from GSE16011 and REMBRANDT databases were analyzed. The effect of DACH1 on proliferation, Qing Wang migration, and invasion of U87 and U251 cell lines was analyzed in vitro. The symbol targets Neurosurgery, The Affiliated Wuxi of the Wnt/β-catenin pathway were also evaluated through Western blot. No 2 People’s Hospital, Nanjing Medical University, Wuxi, Jiangsu, Results: DACH1 deficiency was found in glioma tissues, and the DACH1 level was negatively People’s Republic of China correlated with the tumor malignancy. DACH1 overexpression inhibited the tumor prolifera- For personal use only. *These authors contributed equally tion, migration, and invasion. High expression of DACH1 also dampened the Wnt/β-catenin to this work pathway, and the activation of the Wnt/β-catenin pathway partly led to the limited proliferation in glioma cells.
    [Show full text]
  • Dach1 (NM 007826) Mouse Tagged ORF Clone – MR216327 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR216327 Dach1 (NM_007826) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Dach1 (NM_007826) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Dach1 Synonyms: Dac; Dach Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 Dach1 (NM_007826) Mouse Tagged ORF Clone – MR216327 ORF Nucleotide >MR216327 representing NM_007826 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGTGCCGGCGGCTTTGATCCCTCCGACCCAGCTGGTCCCCCCTCAACCCCCGATCTCTACTTCTG CTTCCTCCTCGGGCACCACCACCTCCACCTCCTCGGCGACCTCGTCTCCGGCTCCATCCATCGGACCCCC GGCGTCGTCTGGGCCAACTCTGTTCCGGCCGGAGCCCATTGCCTCTTCTGCTTCTTCTTCAGCCGCGGCC ACAGTCACCTCTCCTGGTGGCGGCGGCGGCGGCAGCGGAGGCGGCGGTGGCAGCGGCGGCAACGGAGGCG GCGGCGGGAGCAACTGCAACCCCAGCCTGGCGGCCGGGAGCAGCGGCGGCGGCGTTAGCGCTGGCGGCGG CGGCGCCTCCAGCACCCCCATCACCGCGAGCACCGGCAGCAGCAGCAGTAGCAGCAGCAGCAGCAGCAGT AGCAGCAGCAGCAGCAGTAGCAGCAGCAGCAGCAGTAGCAGCAGCAGCTGCGGCCCCCTCCCTGGGAAAC CCGTGTACTCAACCCCGTCCCCAGTGGAAAACACCCCCCAGAATAATGAGTGCAAAATGGTGGATCTGAG AGGGGCCAAAGTGGCTTCCTTTACGGTGGAGGGCTGCGAGCTGATCTGCCTGCCCCAGGCTTTCGACCTG
    [Show full text]
  • Conserved Role for the Dachshund Protein with Drosophila Pax6 Homolog Eyeless in Insulin Expression
    Conserved role for the Dachshund protein with Drosophila Pax6 homolog Eyeless in insulin expression Naoki Okamoto, Yuka Nishimori, and Takashi Nishimura1 Laboratory for Growth Control Signaling, RIKEN Center for Developmental Biology, Chuo-ku Kobe, Hyogo 650-0047, Japan Edited by Lynn M. Riddiford, Howard Hughes Medical Institute, Janelia Farm Research Campus, Ashburn, VA, and approved December 29, 2011 (received for review September 29, 2011) Members of the insulin family peptides have conserved roles in the regulates two different processes in the IPCs during development. regulation of growth and metabolism in a wide variety of metazo- A previous study (10) demonstrated that a series of genes, dachs- ans. The Drosophila genome encodes seven insulin-like peptide hund (dac), ey, optix,andtiptop (tio), are expressed in the IPC lin- genes, dilp1–7, and the most prominent dilps (dilp2, dilp3, and eage at the embryonic stage. Interestingly, all these genes function dilp5) are expressed in brain neurosecretory cells known as “insu- in a genetic regulatory module to initiate the development of the lin-producing cells” (IPCs). Although these dilps are expressed in the eye from epithelial tissue (18–20). In mammals, the genes that same cells, the expression of each dilp is regulated independently. determine islet cell differentiation during embryogenesis control However, the molecular mechanisms that regulate the expression the tissue-specific expression of islet cell hormones in the adult. of individual dilps in the IPCs remain largely unknown. Here, we Therefore we tested whether genes that are involved in eye de- show that Dachshund (Dac), which is a highly conserved nuclear velopment regulate dilp expression at later stages of development.
    [Show full text]
  • The Transcription Factor Dach1 Is Essential for Podocyte Function
    Received: 29 June 2017 | Accepted: 24 December 2017 DOI: 10.1111/jcmm.13544 ORIGINAL ARTICLE The transcription factor Dach1 is essential for podocyte function Nicole Endlich1 | Felix Kliewe1 | Frances Kindt1 | Katharina Schmidt1 | Ahmed M. Kotb1,2 | Nadine Artelt1 | Maja T. Lindenmeyer3 | Clemens D. Cohen3 | Franziska Doring€ 1 | Andreas W. Kuss4 | Kerstin Amann5 | Marcus J. Moeller6 | Nazanin Kabgani6 | Antje Blumenthal1 | Karlhans Endlich1 1Department of Anatomy and Cell Biology, University Medicine Greifswald, Greifswald, Abstract Germany Dedifferentiation and loss of podocytes are the major cause of chronic kidney disease. 2Department of Anatomy and Histology, Dach1, a transcription factor that is essential for cell fate, was found in genome-wide Faculty of Veterinary Medicine, Assiut University, Assiut, Egypt association studies to be associated with the glomerular filtration rate. We found that 3Nephrological Center, Medical Clinic and podocytes express high levels of Dach1 in vivo and to a much lower extent in vitro. Policlinic IV, University of Munich, Munich, Germany Parietal epithelial cells (PECs) that are still under debate to be a type of progenitor cell 4Department of Functional Genomics, for podocytes expressed Dach1 only at low levels. The transfection of PECs with a University Medicine Greifswald, Greifswald, plasmid encoding for Dach1 induced the expression of synaptopodin, a podocyte-spe- Germany 5Department of Nephropathology, Institute cific protein, demonstrated by immunocytochemistry and Western blot. Furthermore, of Pathology, University Hospital Erlangen, synaptopodin was located along actin fibres in a punctate pattern in Dach1-expressing Erlangen, Germany PECs comparable with differentiated podocytes. Moreover, dedifferentiating podo- 6Department of Internal Medicine II, Nephrology and Clinical Immunology, RWTH cytes of isolated glomeruli showed a significant reduction in the expression of Dach1 Aachen University Hospital, Aachen, Germany together with synaptopodin after 9 days in cell culture.
    [Show full text]
  • Proteomic Analysis of Blood Exosomes from Healthy Females And
    biomolecules Article Proteomic Analysis of Blood Exosomes from Healthy Females and Breast Cancer Patients Reveals an Association between Different Exosomal Bioactivity on Non-tumorigenic Epithelial Cell and Breast Cancer Cell Migration in Vitro Oleg Tutanov 1, Evgeniya Orlova 2, Ksenia Proskura 1,3, Alina Grigor’eva 1, Natalia Yunusova 4,5, Yuri Tsentalovich 6 , Antonina Alexandrova 2 and Svetlana Tamkovich 1,7,* 1 Laboratory of Molecular Medicine, Institute of Chemical Biology and Fundamental Medicine, Siberian Branch of Russian Academy of Sciences, 630090 Novosibirsk, Russia; [email protected] (O.T.); [email protected] (K.P.); [email protected] (A.G.) 2 Laboratory of Carcinogenesis Mechanisms, “N.N. Blokhin Cancer Research Center” of the Ministry of Health of the Russian Federation, 115478 Moscow, Russia; [email protected] (E.O.); [email protected] (A.A.) 3 Department of Mammology, Novosibirsk Regional Clinical Oncological Dispensary, 630108 Novosibirsk, Russia 4 Laboratory of Tumor Biochemistry, Cancer Research Institute, Тomsk National Research Medical Center, Russian Academy of Science, 634028 Tomsk, Russia; [email protected] 5 Department of Biochemistry and Molecular Biology, Siberian State Medical University, 634050 Tomsk, Russia 6 Laboratory of Proteomics and Metabolomics, International Tomography Center SB RAS, 630090 Novosibirsk, Russia; [email protected] 7 Department of Molecular Biology and Biotechnology, Novosibirsk State University, 630090 Novosibirsk, Russia * Correspondence: [email protected] Received: 26 February 2020; Accepted: 24 March 2020; Published: 25 March 2020 Abstract: Exosomes are important intercellular communication vehicles, secreted into body fluids by multiple cell types, including tumor cells. They contribute to the metastatic progression of tumor cells through paracrine signalling.
    [Show full text]