Systematics of the African River Frog Genus Amietia (Anura

Home , Amietia, Amietia vertebralis, Anhydrophryne, Arthroleptella, Aubria, Cacosternum

University of Texas at El Paso DigitalCommons@UTEP

Open Access Theses & Dissertations

2015-01-01 Systematics Of The African River Frog Genus Amietia (anura: Pyxicephalidae) From Eastern Democratic Republic Of The onC go Thornton Robert Larson University of Texas at El Paso, [email protected]

Follow this and additional works at: https://digitalcommons.utep.edu/open_etd Part of the Biodiversity Commons, Biology Commons, Developmental Biology Commons, and the Evolution Commons

Recommended Citation Larson, Thornton Robert, "Systematics Of The African River Frog Genus Amietia (anura: Pyxicephalidae) From Eastern Democratic Republic Of The onC go" (2015). Open Access Theses & Dissertations. 1085. https://digitalcommons.utep.edu/open_etd/1085

This is brought to you for free and open access by DigitalCommons@UTEP. It has been accepted for inclusion in Open Access Theses & Dissertations by an authorized administrator of DigitalCommons@UTEP. For more information, please contact [email protected]. SYSTEMATICS OF THE AFRICAN RIVER FROG GENUS AMIETIA (ANURA:

PYXICEPHALIDAE) FROM EASTERN DEMOCRATIC REPUBLIC OF

THE CONGO

THORNTON LARSON

Department of Biological Sciences

APPROVED:

Eli Greenbaum, Ph.D., Chair

Jerry D. Johnson, Ph.D.

Shizue Mito, Ph.D.

Charles Amber, Ph.D. Dean of the Graduate School

2015

SYSTEMATICS OF THE AFRICAN RIVER FROG GENUS AMIETIA (ANURA:

PYXICEPHALIDAE) FROM EASTERN DEMOCRATIC REPUBLIC OF

THE CONGO

THORNTON R. LARSON, B.S.

THESIS

Presented to the Faculty of the Graduate School of

The University of Texas at El Paso

in Partial Fulfillment

of the Requirements

for the Degree of

MASTER OF SCIENCE

Department of Biological Sciences

THE UNIVERSITY OF TEXAS AT EL PASO

May 2015

ACKNOWLEDGMENTS I would like thank my family for their support through the whole graduate process and

encouraging me to have a fascination with nature and the outdoors. Thanks especially to my

parents, for putting up with the many frogs and muddy clothes, allowing me to pursue my interest in

reptiles and amphibians. I am grateful to my Uncle Mark for exposing me to many of my first

experiences with reptiles and amphibians. I thank my siblings for the adventures in various degrees

of suburban wilderness that brought more than one scrape and bruise. Great appreciation is due to

my grandparents for the immense support provided through the years of work.

I would like to thank my graduate committee, Dr. Eli Greenbaum, Dr. Jerry Johnson and Dr.

Shizue Mito. Special thanks to my thesis advisor Dr. Eli Greenbaum for allowing me into his lab at the last minute, and his excellent guidance which produced a fantastic project. I also thank other faculty members including, Dr. Craig Tweedie and Dr. Carl Lieb for their helpful opinions and advice on future directions.

I thank Jens V. Vindum (California Academy of Sciences) and Alan Resetar (Field Museum of Natural History) for access to specimens. I thank former undergraduate student Delilah Castro for her initial work on Amietia, which provided the basic foundation for the project. DNA samples were sequenced by Ana Betancourt at the UTEP Border Biomedical Research Center Genomic

Analysis Core Facility for services and facilities provided, supported by grants from the National

Center for Q4 Research Resources (5G12RR008124-12) and the National Institute Q5 on Minority

Health and Health Disparities (8G12MD007592-12) from the National Institutes of Health.

I am also thankful to lab members, both past and present, for all of their patience and

support. Thanks to Frank Portillo and Chris Anderson for helping me get started in the research

process. Thanks to Fernie Medina, Nancy Conkey, Danny Hughes, Adan Lara, Samantha Stewart

and Waleeja Rashid for all the added help and support that comes with working together in a lab.

ABSTRACT

The African river frog genus Amietia is found near rivers and other lentic water sources throughout

central, eastern and southern Africa. Because the genus includes multiple morphologically

conservative species, taxonomic studies of river frogs have been limited. We sampled 49

individuals of Amietia from multiple localities in and near the Albertine Rift (AR) of Burundi,

Democratic Republic of the Congo and Uganda. We utilized single-gene (16S) and concatenated

(12S, 16S, cytochrome b and RAG1) gene-tree analyses and coalescent species-tree analyses to construct phylogenetic trees. Two divergence dating approaches were used in BEAST, including secondary calibration points with 12S, 16S and RAG1 and a molecular clock with the 12S, 16S and cyt b gene. All analyses recovered Amietia as monophyletic with strong support, and revealed several well-supported cryptic lineages, which is consistent with other recent phylogeography studies of AR amphibians. Dating estimates were similar, and Amietia diversification is consistent with global cooling and aridification events in the Miocene and Pliocene, respectively. Our results suggest additional taxonomic work is needed to describe multiple new species of AR Amietia,

which have limited geographic distributions that are likely to be of conservation concern.

TABLE OF CONTENTS

ACKNOWLEDGMENTS ...... iv

ABSTRACT ...... v

TABLE OF CONTENTS ...... vi

LIST OF TABLES ...... viii

LIST OF FIGURES ...... ix

CHAPTER 1: INTRODUCTION ...... 1

1.1 Background ...... 1

1.2 Natural history ...... 3

1.3 Taxonomy and systematics...... 4

1.4 Study site ...... 5

1.5 Research objectives ...... 8

CHAPTER 2: MATERIALS AND METHODS ...... 9

2.1 Specimen acquisition and taxon sampling ...... 9

2.2 Laboratory protocols ...... 10

2.3 Sequencing alignment and phylogenetic analysis ...... 10

2.4 Species trees and species delimitation ...... 11

2.5 Divergence dating ...... 12

CHAPTER 3: RESULTS ...... 15

3.1 Gene-tree analyses...... 15

3.2 Species tree and species delimitation ...... 20

3.3 Divergence dating ...... 21

CHAPTER 4: DISCUSSION ...... 26

4.1 Biogeography of Albertine Rift Amietia ...... 26

4.2 Species limits and taxonomy ...... 28

4.3 Conservation concerns ...... 31

LITERATURE CITED ...... 33

APPENDIX I ...... 49

VITA ...... 53

vii

LIST OF TABLES

Table 2.1.1. Primers used for sequencing mitochondrial and nuclear genes ...... 9

Table 3.3.1. Calibrated time estimates for most relevant splits within Ranoidea from BEAST analyses. Calibration points are provided in the methods...... 22

Table 3.3.2. Molecular-clock estimates for most relevant splits within Ranoidea from BEAST analyses. Molecular clock rates are provided in the methods...... 23

viii

LIST OF FIGURES

Fig. 1.4.1 Elevation map for the Albertine Rift showing sampling localities for Amietia in this study. Colored shapes correspond to localities of clades within the phylogenies of

Figs. 3.1.1.–3.1.2...... 7

Fig. 3.1.1 Maximum-likelihood phylogeny with a 16S data set of Amietia. Closed circles denote clades with maximum likelihood values ≥ 70; open circles denote clades with Bayesian posterior probability values ≥ 0.95. Clade colors correspond to point localities in Fig. 1.4.1...... 18

Fig. 3.1.2. Maximum-likelihood phylogeny with combined 12S, 16S, cyt b and RAG1 data sets of

AR Amietia. Closed circles denote clades with maximum likelihood values ≥ 70; open circles denote clades with Bayesian posterior probability values ≥ 0.95. Clade colors correspond to point localities in Fig. 1.4.1...... 19

Fig. 3.2.1 Species tree generated in *BEAST for AR Amietia. Closed circles denote Bayesian posterior probability values ≥ 0.95 ...... 21

Fig. 3.3.1 Phylogenetic tree from secondary calibration-based BEAST analyses. Open circles denote calibration points, and numbers at the base of nodes denote mean highest posterior densities

(HPD) ...... 24

Fig. 3.3.2 Phylogenetic tree from molecular-clock BEAST analyses. Numbers at the base of nodes denote mean highest posterior densities (HPD) ...... 25

CHAPTER 1: INTRODUCTION

1.1 Background

With over 6525 species, the Order Anura is the most speciose taxon of amphibians

(AmphibiaWeb, 2015). These numbers continue to increase every year because DNA-based

analyses are identifying multiple cryptic taxa (e.g., van der Meijden et al., 2011). Molecular

and morphological evidence suggest anurans first split from the Order Caudata (salamanders) around 292 million years ago (mya) (Pyron, 2011), and had a major radiation at the end of the

Late Cretaceous period about 80 mya (Roelants et al., 2007), diverging into many families of

frogs that are recognized today.

The family Pyxicephalidae (first named by Bonaparte, 1850) includes two subfamilies:

Cacosterninae Noble, 1931 (66 species), and Pyxicephalinae Bonaparte, 1850 (6 species)

(Frost, 2015). Pyxicephalinae contains the genera Aubria Boulenger, 1917 (2 species) and

Pyxicephalus Tschudi, 1838 (4 species), whereas the subfamily Cacosterninae contains the

genera Amietia Dubois, 1987 (15 species), Anhydrophryne Hewitt, 1919 (3 species),

Arthroleptella Hewitt, 1926 (7 species), Cacosternum Boulenger, 1887 (12 species),

Ericabatrachus Largen, 1991 (1 species), Microbatrachella Hewitt, 1926 (1 species),

Natalobatrachus Hewitt and Methuen, 1912 (1 species), Nothophryne Poynton, 1963 (1

species), Poyntonia Channing and Boycott, 1989 (1 species), Strongylopus Tschudi, 1838 (11

species), and Tomopterna Duméril and Bibron, 1841 (3 species) (Frost, 2015). My proposed study is focused on the genus Amietia, with an emphasis on species from the Albertine Rift

(AR) in eastern Democratic Republic of the Congo (DRC). The genus Amietia currently

1 contains 16 species, including: A. amieti (Laurent, 1976),A. angolensis (Bocage, 1866), A.

desaegeri (Laurent, 1972), A. fuscigula (Duméril and Bibron, 1841), A. hymenopus

(Boulenger, 1920), A. inyangae (Poynton, 1966), A. johnstoni (Günther, 1894), A. lubrica

(Pickersgill, 2007), A. poyntoni Channing and Baptista, 2013, A.quecketti Channing and

Baptista, 2013, A. ruwenzorica (Laurent, 1972), A. tenuoplicata (Pickersgill, 2007), A.

vandijki (Visser and Channing, 1997), A. vertebralis (Hewitt, 1927), A. viridireticulata

(Pickersgill, 2007) and A. wittei (Angel, 1924). Some of these species have been placed in

disparate taxonomic classifications over the years; initially they were in the family Ranidae

Rafinesque, 1814. The species concerned were in the genus Rana until Dubois (1986) placed

R. vertebralis and R. umbraculata into the subgenus Amietia, and subsequently, Dubois

(1992) placed the remaining species into the subgenus Afrana. Dubois (2005) moved

Afrana and Amietia into the family Pyxicephalidae based on molecular evidence from van

der Meijden (2005). Subsequently, Frost et al. (2006) placed Amietia in the subfamily

Cacosterninae within the family Pyxicephalidae. Recent changes within the genus include

switching A. vertebralis to A. hymenopus and A. umbraculata to A. vertebralis based on

morphological data (Channing, 2015).

Five species of Amietia (A. amieti, A. angolensis, A. desaegeri, A. ruwenzorica and A. wittei) are currently known from the Albertine Rift (AR) of Central Africa, where the vertebrate communities are considered to be the most species-rich in continental Africa (Plumptre et al.,

2007; Greenbaum and Kusamba, 2012; Menegon et al., 2014; Greenbaum et al., 2015b; Portillo et al., 2015). Many threatened and endemic species reside within the AR (Plumptre et al. 2007;

Jenkins et al., 2013; Portillo et al., 2015), making it one of the most highly irreplaceable and important sites for conservation in Africa (Brooks et al., 2006). Many vertebrate species in the

AR are morphologically cryptic and endemic to a small number of sites, including small

2 mammals (Kerbis Peterhans et al., 2010; Demos et al., 2014), birds (Prigogine, 1971, 1977,

1978, 1984, 1985; Bowie et al., 2006), reptiles (Greenbaum et al., 2011, 2015; Menegon et al.,

2014) and amphibians (Laurent, 1964, 1972; Evans et al., 2008, 2011; Greenbaum and Kusamba,

2012; Portillo and Greenbaum, 2014a, b; Portillo et al., 2015). Viertel et al. (2012) recently described tadpole morphology and chytrid fungal infections in a Ugandan population of A. ruwenzorica, but no previous studies have assessed AR Amietia populations with molecular data.

There is some controversy about the various synonyms for Amietia angolensis. The enormous putative range and poor description of A. angolensis has made subsequent new species descriptions a challenge. Cryptic species would be overlooked when assigning an area for protection, because they are currently not recognized. Therefore an accurate assessment of the areas in which those cryptic species inhabit must be considered.

1.2 Natural history Amietia, traditionally known as river frogs because of their association with large rivers and other lentic bodies of water, are found throughout sub-Saharan Africa. Amietia are classified as frogs with muscular legs and mostly webbed feet; dorsal coloration is generally green or brown, usually with dark brown to black markings, often with light green or brown vertebral stripes (Channing, 2004).

Amietia typically inhabit rivers, ponds, dammed lakes and other permanent waters

throughout East and South Africa (Labiris, 1988; Channing, 2004). Amietia generally occur in

forests to open savannas, but they are rarely found far from water (Channing and Howell,

2006; Largen and Spawls, 2010). Most of the species within Amietia do not occur below 1000 meters in elevation, and many species are thought to be restricted to medium to high

3 elevations (Stewart, 1967; Largen and Spawls, 2010; Viertel et al., 2012). The diet of Amietia generally includes a variety of arthropods, and many species are, in turn, prey for various birds, snakes, small mammals, other frogs and even humans (Stewart, 1967; Channing, 2004).

In the DRC, relatively little is known regarding the breeding and life history of Amietia.

Breeding from other members of the genus, particularly in the warmer parts of its range, occurs throughout the year and peaks during the wet season (Channing, 2004; Channing and

Howell, 2006). Eggs are deposited in a mass in shallow water and are covered with debris.

Tadpoles are solitary, and with A. angolensis, in parts of their range, can take up to two years

to complete metamorphosis (Channing, 2004).

1.3 Taxonomy and systematics Dubois (1986) first named Amietia as a subgenus to contain A. vertebralis and A.

umbraculata, with the remainder of the currently recognized species of Amietia remaining in the genus Rana. Dubois (1992) found morphological similarities between species of African

Rana, and using Rana fuscigula as the type species, placed R. angolensis, R. amieti , R. desaegeri, R. dracomontana, R. fuscigula, R. johnstoni, R. ruwenzorica, and R. wittei into the genus Afrana. The current classification of these species in the genus Amietia was a result of morphological (Dubois, 2005) and genetic (van der Meijden et al., 2005) analyses that were able to support a monophyletic group containing both Amietia and Afrana. The species in the genera were subsequently classified into the genus Amietia and the family Pyxicephalidae

(Frost, 2006).

Controversy regarding the synonyms of some of the species continues to pose a problem in defining what is and is not a species of Amietia. For the area of the AR the debate to elevate

4 or synonymize Rana chapini Noble, 1924 and Rana nutti Boulenger, 1896 has continued for over a century (Laurent, 1972; Poynton and Broadley, 1985; de Witte, 1931, 1941). With the advent of molecular genetics, new evidence can now support the elevation of previously synonymized species, such as A. quecketti (Channing and Baptista, 2013), as well as, switching A. vertebralis to A. hymenopus and A. umbraculata to A. vertebralis based on morphological data (Channing, 2015).

1.4 Study site The Amietia included in this study were all collected from the AR in Central Africa, particularly eastern DRC and bordering countries (Fig. 1.4.1). The AR extends from 30 km north of Lake Albert to the southern tip of Lake Tanganyika (Plumptre et al., 2007), encompassing an area 650 km long and 70–90 km wide (Vande weghe, 2004). The highland areas of the AR average between 1400 m and 1800 m, but can get up to 3000 m in elevation and even 5000 m in the Ruwenzori Range (Demey and Louette, 2001).

Geographic events, such as tectonic activity, volcanic activity and climate change have led to the AR being one of the most speciose places in the world. Major uplifting events in the

Miocene and Pliocene altered climate patterns of the region, spurring diversification of the flora and fauna of the area (Pickford, 1990). Albertine Rift vertebrate communities are considered to be the most species rich in continental Africa (Greenbaum and Kusamba, 2012;

Plumptre et al., 2007). Microclimate changes created by uplifting events caused three shifts in species: adapting to the climate changes, becoming locally extinct, or emigrating out of the region only to become extinct (Pickford, 1990).

In parts of the AR, volcanic activity, uplifting events and climate change caused the

5 fragmentation of several rainforest habitats. These factors influenced major radiations of mammals in the Late Pliocene (Huhndorf et al., 2007). It is hypothesized that the fragmentation created refugias in times when other areas may not have been habitable. For example, during a period of glaciation around 1 mya, many of Africa’s tropical forest areas became arid, leaving some refugia to sustain species not suited for the change in climate

(Sayer et al., 1992). These refugia would act not only as a refuge, but isolate species. Over time the isolation events led to the evolution of large numbers of endemic species (Sayer et al., 1992). In eastern DRC, the montane forests break up a more uniform landscape compared to the rest of DRC (Chapin, 1932). Areas that had previously corresponded with those refuges are, generally, high in biodiversity, making the AR a center for endemism in Africa

(Vande weghe, 2004).

Within the AR, several ecoregions present a diversity of habitats among various elevations, including bamboo subalpine vegetation, montane forest, submontane forest, secondary forest, and grasslands (Doumenge, 1998; Burgess et al., 2004). The tropical forests of Africa have experienced dramatic changes in more recent times as well. Within the last

6,000 years, evidence of dry forest replacing some of the more moist forests began (Sayer et al., 1992). This has continued to modern times. With the modernization of man, there have been large clearings of forested areas; the timber trade is the largest threat to Africa’s forests, including the forests of the AR in DRC (Sayer et al., 1992). Human immigration from neighboring Rwanda and Burundi, which have a more agriculturally based culture, has exacerbated the deforestation of the area by way of land clearing for crops (Vande weghe,

2004).

Fig. 1.4.1. Elevation map for the Albertine Rift showing sampling localities for Amietia in this study. Colored shapes correspond to localities of clades within the phylogenies of Figs. 3.1.1.–3.1.2.

7 1.5 Research objectives 1. Determine the extent of genetic diversity of Amietia in eastern Democratic Republic

of the Congo.

2. Clarify biogeography in the Albertine Rift as it relates to the genus Amietia.

3. Identify lineages revealed by my DNA-based phylogeny.

4. Determine when populations of Amietia diverged from each other and if they correlate

with any temporal or spatial events for the Albertine Rift.

8 CHAPTER 2: MATERIALS AND METHODS

2.1 Specimen acquisition and taxon sampling

The majority of specimens examined for this study were collected by Dr. Eli Greenbaum

in the AR from 2007–2012. Field seasons 2007–2009 and 2012–2014 were during the dry

season, whereas 2009/2010, 2010/2011 and 2011/2012 were during the wet season. This study

will include molecular data on those 2007–2014 specimens as well as borrowed specimens from

various localities in sub-Saharan Africa (see Appendix I).

We sequenced 49 samples from the genus Amietia from locations throughout the AR in

Democratic Republic of the Congo (DRC), Burundi and Uganda (Fig. 1.4.1) using three

mitochondrial (12S, 16S and cytochrome b) and one nuclear (RAG1) (Table. 2.1.1). Additional

Amietia sequences were obtained from the studies of Dawood and Uqubay (2004), Scott (2005), van der Meijden et al. (2005, 2011), Bossuyt et al. (2006), Tarrant et al. (2008), Tolley et al.

(2010), Viertel et al. (2012), Channing and Baptista (2013) and Zancolli et al. (2014). Outgroup

samples included: Ptychadena cf. nilotica, Ptychadena cf. oxyrhynchus, Hildebrandtia ornata

(Ptychadenidae), Phrynobatrachus natalensis (Phrynobatrachidae) and Aubria masako

(Pyxicephalidae). Newly sequenced samples were deposited into GenBank.

Table 2.1.1. Primers used for sequencing mitochondrial and nuclear genes. Primer name Primer sequence Primer source 12SA 5’—AAACTGGGATTAGATACCCCACTAT—3’ Kocher et al. (1989) 12SB 5’—GAGGGTGACGGGCGGTGTGT—3’ 16SA 5’—CGCCTGTTTATCAAAAACAT—3’ Palumbi et al. (1991) 16SB 5’—CCGGTCTGAACTCAGATCACGT—3’ Cyt b— 5’—TATGTTCTACCATGAGGACAAATATC—3’ Bossuyt and CBJ10933 Milinkovitch (2000) Cyt b—C 5’—CTACTGGTTGTCCTCCGATTCATGT—3’ RAG1MartF1 5’—AGCTGCAGYCARTAYCAYAARATGTA—3’ Chiari et al. (2004); RAG1AmpR1 5’—AACTCAGCTGCATTKCCAATRTCA—3’ Pramuk et al. (2008)

9 2.2 Laboratory protocols

The Qiagen DNeasy tissue kit (Qiagen Inc., Valencia, CA, USA) or IBI Scientific

Genomic DNA Mini Kit (IBI Scientific, Peosta, IA, USA) were used to extract genomic DNA

from alcohol-preserved muscle or liver tissue samples. We used gene-specific primers in 25 µl

PCR reactions with an initial denaturation at 95 °C for 2 min, followed by denaturation at 95 °C

for 35 s, annealing at 50 °C for 35 s, and extension at 72 °C for 95 s with 4s added to the

extension per cycle for 32 (mitochondrial genes) or 34 (nuclear gene) cycles. The PCR products

were visualized using a 1.5% agarose gel stained with SYBR Safe DNA gel stain (Invitrogen

Corporation, Carlsbad, CA, USA). Sequencing reactions were purified with CleanSeq magnetic

bead solution (Beckman Coulter, Inc., Brea, CA, USA) and then sequenced using an ABI 3130xl

automated sequencer at the University of Texas at El Paso (UTEP) Border Biomedical Research

Center (BBRC) Genomic Analysis Core Facility.

2.3 Sequence alignment and phylogenetic analysis

Chromatograph data were interpreted with the program SeqMan (Swindell and Plasterer,

1997). Sequences were aligned using T-COFFEE (Notredame et al., 2000) with further manual adjustments in MacClade 4.08 (Maddison and Maddison, 2005). Phylogenetic trees were constructed using maximum likelihood (ML) and Bayesian inference (BI) criteria for both single-gene and concatenated data sets. The program RAxML v7.2.6 (Stamatakis, 2006) was used with the GTRGAMMA model for ML analyses, with a random starting tree and all parameters estimated. Clade support values inferred by ML analyses were estimated with the rapid bootstrap algorithm with 1000 replicates (Stamatakis et al., 2008). MrBayes 3.2.3

(Ronquist et al., 2012) was utilized to conduct BI analyses on the CIPRES Science Gateway 3.3

10 web portal (Miller et al., 2010). Eight data partitions were used in our model: single partitions for 12S and 16S, and independent codon positions for the protein-coding genes cyt b and RAG1.

The models of evolution most consistent with our data for BI analyses were determined with the

Akaike information criterion in jModelTest 2 (Darriba et al., 2012). Bayesian analyses were conducted with random starting trees, run for 20,000,000 generations, and Markov chains were sampled every 1000 generations. Convergence of multiple runs was verified through the program are we there yet? (AWTY) (Nylander et al., 2008). A conservative estimate of 25% of trees were discarded as “burn in” once convergence was reached. Phylogenies were visualized using FigTree v. 1.4.2 (Rambaut and Drummond, 2014).

2.4 Species trees and species delimitation

Species-level phylogenetic estimates were generated using the program *BEAST 1.8.1

(Drummond et al., 2012) for the combined 12S, 16S, cyt b and RAG1 data set. Species assignments for *BEAST were based on several sources of data, including gene trees, collection locality and morphology. Sequence evolution models were determined with jModelTest 2, and analyses were run with a Yule tree prior and unlinked loci and substation models. Each analysis was run for 50,000,000 iterations with Markov chains sampled every 1000 generations. Tracer v. 1.6 (http://tree.bio.ed.ac.uk/software/tracer/) was used to determine convergence and assess adequate sampling of all parameters. A conservative estimate of 25% of the trees were discarded as “burn in” once convergence was reached. Trace plots were reviewed to ensure the convergence of Markov chain Monte Carlo (MCMC) runs. Gametic phase of heterozygous sites was resolved through a coalescent-based Bayesian method (PHASE v. 2.1) (Stephens et al.,

2001) as executed in the software DnaSP v5.10.3 (Librado and Rozas, 2009). Gametic phase of

11 alleles for polymorphic sites were inferred with probabilities ≥ 0.7.

After generating a species guide tree in *BEAST, species delimitation was tested using

Bayesian Phylogenetics and Phylogeography (BPP v.2.0; Yang and Rannala, 2010). The

MCMC analyses were run for 500,000 generations, with a sampling interval of five, and a burn-

in period of 10,000. Analyses were initiated with different starting seeds. Because the prior

distributions on the ancestral population size and root age can affect the posterior probabilities

for models, the effect of different priors was evaluated by implementing three different

combinations of priors. Prior combinations were chosen from Leaché and Fujita (2010). The

first combination of priors assumed small ancestral population sizes and relatively small

divergence rates: ϴ = G(2,2000) and τ0 = G(2,2000), both with a prior mean = 0.001 and

variance = 5 × 10−7. The second combination of priors assumed large ancestral population sizes and deep divergence rates: ϴ = G(2,20) and τ0 = G(2,20), with a prior mean = 0.1 and variance =

0.01. The third combination mixes priors that assume large ancestral populations sizes ϴ =

G(2,20) and relatively small divergence rates among species τ0 = G(2,2000). The third

combination favors models containing fewer species and is considered to be a conservative

combination of priors. Each of the species delimitation models was assigned equal prior

probability.

2.5 Divergence dating

Two separate divergence dating analyses were conducted—one with secondary

calibration points and another with a molecular clock for the mitochondrial genes. The program

BEAST 1.8.1 (Drummond et al., 2012) was used with data sets for secondary calibrations (12S,

16S and RAG1) and molecular clocks (12S, 16S and cyt b) to estimate the divergence dates for

12 the lineages of Amietia in this study. Data from cyt b were excluded from the secondary

calibration analyses based on the study by van der Meijden et al. (2005), which did not include

this gene. Additional outgroups from the latter study included Petropedetes parkeri

(Petropedetidae), and the pyxicephalids Pyxicephalus adspersus, Tomopterna sp.,

Natalobatrachus bonebergi, Cacosternum boettgeri and Strongylopus fasciatus (Appendix I).

For the secondary calibration analyses, we applied an uncorrelated log-normal relaxed clock model with a coalescent tree prior. Analyses were run for 50,000,000 generations, sampling every 1000 generations. Based on dating estimates from Roelants et al. (2007), we used the following secondary calibrations: (1) the ancestral node of Ranoidea, which included

Ptychadena, Hildebrandtia, Phrynobatrachus, Petropedetes, Pyxicephalus, Tomopterna,

Natalobatrachus, Cacosternum, Strongylopus, Aubria and Amietia, was constrained with a zero offset of 116.7 million years ago (mya), a log-normal mean of 0.01 and a log-normal standard deviation of 1.0; (2) Africanura, comprised of all the previous genera with the exception of

Ptychadena, was constrained with a zero offset of 70.9 mya, a log-normal mean of 0.01 and a log-normal standard deviation of 1.0; and (3) Pyxicephalidae, comprised of Pyxicephalus,

Tomopterna, Natalobatrachus, Cacosternum, Strongylopus, Aubria and Amietia, was constrained

with a zero offset of 56.3 mya, a log-normal mean of 0.01 and a log-normal standard deviation of

1.0.

For molecular-clock rates, we applied a strict clock model with a coalescent tree prior to

our mitochondrial data sets. Analyses were run for 50,000,000 generations, sampling every 1000

generations. We assumed a range of substitution rates from 0.60% to 1.00% per million years

for cyt b and 0.20% to 0.30% per million years for both 12S and 16S, based on rates previously

published for amphibians (Macey et al., 1998, 2001; Monsen and Blouin, 2003; Fouquet et al.,

13 2009; Pröhl et al., 2010; Portillo et al., 2015).

We used the program Tracer v. 1.6 (Drummond et al., 2012) to determine the MCMC analysis stationarity, adequate effective sample sizes of the posterior probabilities and the appropriate “burn-in” percentage. Maximum clade credibility trees were summarized using the program TreeAnnotator v. 1.8.1 (Drummond et al., 2012) and visualized in FigTree v. 1.4.2.

14 CHAPTER 3: RESULTS

3.1 Gene-tree analyses

Our concatenated data set consisted of 2465 base pairs (12S [430 bp], 16S [555 bp], cyt b

[610 bp], and RAG1 [870 bp]). Four samples of Amietia failed to amplify for the gene cyt b

(Appendix I). Samples with missing data were still used in concatenated analyses, because

branch lengths are not biased by modest amounts of missing data (Pyron et al., 2013; Jiang et al.,

2014). The program jModelTest 2 selected the following models of nucleotide substitution: 12S

(TIM2 + G); 16S (TIM2 + I + G); cyt b 1st codon position (TVM + G), cyt b 2nd codon position

(TIM3 + G), cyt b 3rd codon position (TPM2uf + G); RAG1 1st codon position (TIM2 + G),

RAG1 2nd and 3rd codon positions (HKY + I). When a model was not available in MrBayes, the least restrictive model (GTR) was implemented.

Topologies for the ML and BI analyses were similar for both the 16S and concatenated data sets (Figures. 3.1.1–3.1.2). The ML likelihood scores were –3478.38 for 16S and –15766.74 for the concatenated analyses, respectively. The same well-supported clades were recovered for both single-gene and concatenated ML and BI analyses. There was weak support for the monophyly of the genus Amietia in the 16S analyses, but the genus was recovered as a well- supported monophyletic lineage in the concatenated analyses. Results for 16S analyses included

17 clades of Amietia: (1) A. wittei from Mount Kilimanjaro, Tanzania above 1700 m (GenBank);

(2) A. ruwenzorica from the Itombwe Plateau (ca. 2800 m), Kabobo Plateau (2440 m) and three topotypic GenBank samples from the Rwenzori Mountains (above 2400 m); (3) A. vertebralis from South Africa and Lesotho (GenBank); (4) A. quecketti from South Africa (GenBank); (5) A. fuscigula and A. vandijki from South Africa (GenBank); (6) A. hymenopus from South Africa

(GenBank); (7) A. poyntoni from South Africa (GenBank); (8) topotypic A. angolensis from

15 Angola (GenBank); (9) A. sp. 1 from the Kibara Mountains, Katanga, DRC (1157–1428 m); (10)

A. sp. 2 from the Itombwe Plateau, DRC (1965–2848 m); (11) A. cf. amieti from multiple forest localities in eastern DRC (811–2289 m); (12) A. sp. 3 from South Kivu and Katanga provinces

(744–1324 m); (13) A. sp. 4 from the Marungu Plateau and Kibara Mountains (1428–2037 m);

(14) A. cf. angolensis from South Africa and Tanzania (GenBank); (15) A. sp. 5 from Orientale

Province (823–2088 m); (16) A. desaegeri from Virunga National Park and the western foothills of the Ruwenzori Mountains (742–1478 m); and (17) A. lubrica from multiple localities in

Burundi, Uganda and eastern DRC (1173–2303 m). The Amietia cf. angolensis clade from

South Africa and Tanzania was recovered as the sister group to a clade including A. lubrica, A. desaegeri and A. sp. 5 with moderate support. Amietia cf. amieti was weakly supported as sister to the clade including A. sp. 3 and A. sp. 4, but the latter taxa were strongly supported as sister taxa. Amietia sp. 1 and A. sp. 2 were strongly supported as sister taxa. Amietia vandijki was recovered within the A. fuscigula clade; the former taxon is primarily distinguished from the latter by advertisement call (Visser and Channing, 1997). Recent taxonomic changes to Amietia based on morphology (recognition of A. vertebralis and A. hymenopus) by Channing (2015) are well supported within our tree.

Our concatenated phylogeny (Fig. 3.2.1) recovered a well-supported, monophyletic

Amietia lineage that included nine strongly supported clades: (1) A. ruwenzorica; (2) A. sp. 1; (3)

A. sp. 2; (4) A. cf. amieti; (5) A. sp. 3; (6) A. sp. 4; (7) A. sp. 5; (8) A. desaegeri; and (9) A. lubrica. The concatenated tree showed stronger support and longer branch lengths for all species clades and relationships compared to the single-gene analyses, rendering all clades from the AR as strongly supported. Amietia cf. angolensis is strongly supported as the most basal taxon within the genus. Amietia sp. 1 and A. sp. 2, which were weakly supported as sister taxa in the

16 single-gene analyses, are not recovered as sister taxa in the concatenated analysis.

17 Fig. 3.1.1. Maximum-likelihood phylogeny with a 16S data set of Amietia. Closed circles denote clades with maximum likelihood values ≥ 70; open circles denote clades with Bayesian posterior probability values ≥ 0.95. Clade colors correspond to point localities in Fig. 1.4.1.

18 Fig. 3.1.2. Maximum-likelihood phylogeny with combined 12S, 16S, cyt b and RAG1 data sets of AR Amietia. Closed circles denote clades with maximum likelihood values ≥ 70; open circles denote clades with Bayesian posterior probability values ≥ 0.95. Clade colors correspond to point localities in Fig. 1.4.1.

19 3.2 Species tree and species delimitation

Major clades in *BEAST analyses (Fig. 3.2.1) of AR populations of Amietia recovered the species congruent with the clades in the concatenated gene tree, with one minor difference. Amietia cf. angolensis from South Africa was recovered in a basal position in our concatenated tree analyses, but in our *BEAST analyses the taxon is nested in the middle of our

AR Amietia samples with low support. Estimates from *BEAST recovered strong support (pp ≥

95%) for the basal position of Amietia sp. 1 within a well-supported Amietia clade, and a clade including A. sp. 5, A. desaegeri and A. lubrica. The latter two taxa were also recovered as sister taxa with strong support. The three BPP analyses revealed nine distinct evolutionary lineages of

AR Amietia (identical to those in the concatenated analyses) with high posterior probability values (pp > 95%). Conservative BPP models that favored fewer species did not collapse species that had relatively shallow divergences between them (e.g., A. lubrica and A. desaegeri).

Fig. 3.2.1. Species tree generated in *BEAST for AR Amietia. Closed circles denote Bayesian posterior probability values ≥ 0.95.

3.3 Divergence dating

Results from the secondary calibration-based dating analysis suggest a basal divergence of Amietia in the Miocene 21.88 mya (12.99–31.32 mya, 95% highest posterior densities [HPD])

(Fig. 3.3.1) (Table 3.3.1). The common ancestor of AR Amietia diverged 15.92 mya (9.82–22.6 mya, HPD). Most AR Amietia lineages continued to diverge in the mid- to late Miocene. The most recent divergence between A. desaegeri and A. lubrica was 4.02 mya (1.95–4.42 mya,

HPD) in the early Pliocene.

21 Table 3.3.1. Calibrated time estimates for most relevant splits within Ranoidea from BEAST analyses. Calibration points are provided in the methods. Clade Age (million years 95% highest posterior ago) densities Ranoidea 118.11 116.74–120.96 Ptychadena oxyrhynchus, P. cf. nilotica, 68.87 21–117.31 Hildebrantia ornata Ptychadena oxyrhynchus, P. cf. nilotica 33.92 5.45–70.16 Africanura 73.37 70.94–79.57 Pyxicephalidae + Petropedetes parkeri 63.34 58.38–68.78 Pyxicephalidae 57.36 56.34–59.26 Pyxicephalus adspersus, Aubria masako 27.48 8.27–46.01 Cacosterninae 41.3 28.1–53.36 Cacosterninae excluding Tomopterna sp. 34.43 23.2–45.8 Natalobatrachus bonebergi, Strongylopus 27.26 14.68–40.24 faciatus, Cacosternum boettgeri Strongylopus faciatus, Cacosternum boettgeri 18.18 6.44–30.69 Amietia 21.88 12.99–31.32 Albertine Rift Amietia 15.92 9.82–22.6 Amietia sp. 1, A. sp. 2, A. cf. amieti, A. sp. 3, A. 14.77 9.29–20.75 sp. 4, A. sp. 5, A. desaegeri, A. lubrica Amietia sp. 2, A. cf. amieti, A. sp. 3, A. sp. 4, A. 13.33 8.2–18.9 sp. 5, A. desaegeri, A. lubrica Amietia cf. amieti, A. sp. 3, A. sp. 4, A. sp. 5, A. 11.56 7.13–16.6 desaegeri, A. lubrica Amietia cf. amieti, A. sp. 3, A. sp. 4 9.38 5.63–13.44 Amietia sp. 3, A. sp. 4 6.72 3.87–9.87 Amietia sp. 5, A. desaegeri, A. lubrica 6.86 3.59–10.62 Amietia desaegeri, A. lubrica 4.02 1.95–4.42

Topologies varied slightly within the more basal lineages (Amietia ruwenzorica, A. sp. 1

and A. sp. 2) of the molecular-clock analysis (note A. angolensis was not included) when

compared to the calibration-based dating analysis (Fig. 3.3.2) (Table 3.3.2). However, the two

methods produced nearly identical dating estimates. The molecular-clock dating analysis suggested a basal divergence of AR Amietia in the mid-Miocene 19.65 mya (15.4–24.78 mya,

HPD). The most recent divergence between A. desaegeri and A. lubrica was 3.59 mya (2.49–

4.76 mya, HPD) in the early Pliocene.

Table 3.3.2. Molecular-clock estimates for most relevant splits within Ranoidea from BEAST analyses. Molecular clock rates are provided in the methods. Clade Age (million years 95% highest ago) posterior densities Ptychadena oxyrhynchus, P. cf. nilotica, 34.54 27.3–43.03 Hildebrantia ornata Ptychadena oxyrhynchus, P. cf. nilotica 26.35 20.46–32.92 Africanura 54.84 44.4–67.31 Pyxicephalidae 37.65 29.47–46.86 Amietia 19.65 15.4–24.78 Amietia ruwenzorica, A. sp. 2, A. cf. amieti, A. sp. 12.5 9.74–15.59 3, A. sp. 4, A. sp. 5, A. desaegeri, A. lubrica Amietia ruwenzorica, A. sp. 2 9.29 6.9–11.98 Amietia cf. amieti, A. sp. 3, A. sp. 4, A. sp. 5, A. 10.54 8.11–13.28 desaegeri, A. lubrica Amietia cf. amieti, A. sp. 3, A. sp. 4 8.01 6.19–10.19 Amietia sp. 3, A. sp. 4 4.58 3.29–5.97 Amietia sp. 5, A. desaegeri, A. lubrica 5.78 4.3–7.53 Amietia desaegeri, A. lubrica 3.59 2.49–4.76

23 Fig. 3.3.1. Phylogenetic tree from secondary calibration-based BEAST analyses. Open circles denote calibration points, and numbers at the base of nodes denote mean highest posterior densities (HPD).

24 Fig. 3.3.2. Phylogenetic tree from molecular-clock BEAST analyses. Numbers at the base of nodes denote mean highest posterior densities (HPD).

25 CHAPTER 4: DISCUSSION

4.1 Biogeography of Albertine Rift Amietia

Our results are mostly congruent with other phylogenetic studies of amphibians and reptiles from the AR (Evans et al., 2011; Greenbaum et al., 2013; Greenbaum et al., 2015b;

Portillo et al., 2015) with regard to several areas of endemism within the AR. Our results did not recover a monophyletic clade of AR Amietia with the 16S or concatenated data sets (Fig. 3.1.1–

3.1.2). Diversification of AR Amietia coincided with a global cooling trend in the late Miocene and the aridification of Africa in the Pliocene, and not the formation of the AR in the late

Oligocene/early Miocene ca. 25 mya (Roberts et al., 2012). With the spread of savannas in the mid-Miocene (around 16 mya), Amietia associated with open habitats may have become widespread throughout habitats such as grasslands, whereas Amietia associated with forest habitats became restricted to forest refugia. Subsequent regrowth of forest may have fragmented grassland species of Amietia. Essentially this allowed the periods of reforestation to act as a barrier to limit dispersal of species closely dependent on savanna habitat (Furman et al., 2015), including most of the AR Amietia species. Relatively vagile and habitat generalist species of

Amietia (e.g., A. lubrica) likely spread throughout the AR during relatively xeric conditions in the Pliocene to Pleistocene. Forest species, such as snakes (Menegon et al., 2014; Greenbaum et al., 2015b), chameleons (Tolley et al., 2011), and frogs (Evans et al., 2011; Portillo et al., 2015) have shown similar patterns and dates of diversification under similar biogeographical processes.

In contrast, dating analyses of AR species of birds (Fjeldså and Bowie, 2008) and mammals

(Demos et al., 2014) recovered most divergence dates somewhat younger in the Pliocene, which might be explained by increased vagility of both birds and mammals, differences in molecular clock rates or dating methods.

26 The Ruwenzori Range within the AR is unique because it likely originated relatively

recently (Bauer et al., 2013) from a peneplain landcape around 2 mya (Kaufmann et al., 2015).

The relatively recent formation of the range is consistent with the shallow divergence between A.

lubrica and A. desaegeri, which suggests the formation of the mountain range is a potential

driver of speciation for other vertebrates in the AR. However, this geological process did not

influence the diversification of A. ruwenzorica, which our results indicate last shared a common

ancestor with other Amietia in the mid- to late Miocene 21.88 mya (12.99–31.32 mya, HPD) in

our calibrated analysis and 9.29 mya (6.9–11.98 mya, HPD) in our molecular-clock analysis.

Moreover, our analyses demonstrated Amietia ruwenzorica is not restricted to the higher elevations of the Ruwenzoris alone, but rather to several additional highlands within the AR as suggested by Frost (2015), including the Itombwe and Kabobo Plateaus.

The Itombwe Plateau harbors an unusually large number of endemic amphibians

(Greenbaum and Kusamba, 2012), including recent species descriptions for Xenopus itombwensis (Evans et al., 2008) and Leptopelis anebos (Portillo and Greenbaum, 2014a).

Amietia sp. 2 from Itombwe formed a reciprocally monophyletic clade that is genetically distinct

from other AR populations and is unequivocally a new species. The distinct Amietia sp. 5 lineage

from the Lendu Plateau and surrounding environs is consistent with a recently described,

endemic Kinyongia chameleon species (Greenbaum et al., 2012) and a genetically distinct

population of Boaedon fuliginosus (Greenbaum et al., 2015b) from the Lendu Plateau. The

relationship pattern between A. sp. 5 (including the Lendu Plateau), A. desaegeri and A. lubrica

is similar to Xenopus lenduensis from the Lendu Plateau, which is closely related to X. victorianus populations from eastern DRC, Burundi and Uganda (Furman et al., 2015).

The geological complexity of Katanga Province in DRC has led to impressive species

27 richness and approximately 12% of Katanga’s amphibians and reptiles are endemic (Broadley

and Cotterill, 2004). Our study demonstrates that the northern part of Katanga contains at least

four distinct species of Amietia, which are genetically distinct from A. angolensis and all other

species known from the AR. Specifically, A. sp. 4 is found in the Marungu and Mitwaba regions

in Katanga. The Marungu Plateau is known to harbor several endemic vertebrate species,

including several bird taxa, a cordylid lizard and at least one distinct species of Hyperolius

(Greenbaum et al., 2012). Although Amietia sp. 4 seems to be the only lineage that occurs in

Marungu, our study indicated that it is not endemic to the mountains.

4.2 Species limits and taxonomy

The results of our coalescent-based analyses suggest five unique genetic lineages likely

warrant full species status, but additional sampling and morphological analyses are needed.

Amietia sp. 1 occupies areas in woodland/savanna mosaic of the Kibara Mountains from 1157–

1428 m. Amietia sp. 2 was uncovered from montane forest edges and marshes from 1965–2848

m on the Itombwe Plateau. Amietia sp. 3 occupies forest edges and woodland/savanna mosaic

habitats in the regions west and south of the Itombwe Plateau in South Kivu and Katanga

Provinces from 744–1324 m. Amietia sp. 4 occupies montane grassland in the Marungu Plateau

and woodland/savanna mosaic of the Kibara Mountains at elevations from 1428–2037 m. One

sample of the latter clade was found in sympatry with Amietia sp. 1 at the Mayola River in the

Kibara Mountains. Differences between A. sp. 1 and A. sp. 4 are strongly supported by both

gene-tree analyses (Figs. 3.1.1–3.1.2), the species-tree analysis (Fig. 3.2.1) and by distinctive webbing, color pattern and other morphological characters (TRL, unpubl. data). Amietia sp. 5 occurs in woodland/savanna mosaic of the Lendu Plateau and surrounding region, and forest

28 edges of the Ituri rainforest from 823–2088 m. In future studies, further morphological evidence will be combined with the genetic data presented within this study to conclusively support the recognition of these additional species.

Our study suggests A. angolensis does not occur in the AR, and is likely much more limited in its distribution than currently recognized (Frost, 2015). Two distinct A. angolensis clades were recovered in our single-gene phylogeny, and it is likely that the lineage from

Tanzania and South Africa represents at least one new species. Further investigation throughout the range of A. angolensis, including populations in Malawi (Conradie et al., 2011) and Tanzania

(Zancolli et al., 2014), will likely result in the identification of additional unique lineages in the

A. angolensis complex.

Amietia lubrica is currently only known from the type locality (Lake Bunyonyi, Uganda)

(Pickersgill, 2007). Our study clearly demonstrated that A. lubrica is the most widespread species within the AR, with a geographic distribution extending from western Burundi to the

North Kivu Province of eastern DRC and western Uganda. Amietia desaegeri is currently considered to be distributed in the rain forests of eastern DRC, particularly in the Ruwenzori

Range (Amphibiaweb, 2015; Frost, 2015), but our study demonstrated that A. desaegeri also occurs in Virunga National Park. As noted above, A. ruwenzorica is found above 2000 m at the

Itombwe Plateau, Kabobo Plateau, and Ruwenzori Mountains, and the species is likely to occur in other montane regions of the AR.

According to Frost (2015) and Loveridge (1957), A. wittei should occur in eastern DRC.

Our study found no evidence of A. wittei in eastern DRC based on our single-gene analysis, which included GenBank data from this species (Fig. 3.1.1). It is possible that the confusion over the distribution of A. wittei can be attributed to its complicated taxonomic history. Amietia

29 wittei was synonymized with Rana nutti (Barbour and Loveridge, 1928), then removed from this

synonymy (Loveridge, 1929), and subsequently placed back into synonymy with R. nutti

(Loveridge, 1936). It was removed from synonymy again by Guibé (1950). These continuous

changes to the taxonomy may have led to little or no revision of the range for A. wittei.

The poorly known taxon Rana chapini is currently considered to be a synonym of A. angolensis (Frost, 2015), but given the enormous disjunct distribution and ecoregion differences between the lowland Congo Basin rainforest type locality for the former taxon (Batama, DRC) and the type locality of Candandula and Humpata in Angola (Angola-Miombo Woodlands), it is likely that these taxa are not conspecific. Locality data for EBG 2309 (Appendix I) (Fig. 1.4.1) at

Mafifi (near Epulu, 844 m) places our most western sample of A. sp. 5 about 230 km east of

Batama (528 m), the only known locality for R. chapini. Noble (1924) noted the single specimen of R. chapini was collected “in grass bordering the brook at Batama,” suggesting the habitat might have been at the edge of the rainforest and not inside of it, which is consistent with A. sp. 5 at Mafifi. However, preliminary morphological data from webbing of the fourth toe of these taxa (TRL, unpubl. data) suggest A. sp. 5 is not consistent with the original description of R. chapini. Rana (Amietia) chapini is likely a distinct species, but additional sampling is needed to confirm this hypothesis.

The clade referred to herein as A. cf. amieti contains samples collected within 100 km of the type locality of A. amieti at Lubile (Maniema Province, DRC). The samples were collected in forests ranging from 800–2289 m. There is extensive morphological variation among the vouchers, and comparison to type specimens is needed to confirm the identity of this clade.

30 4.3 Conservation concerns

Conservation for many of the species in the AR is a major call for concern. Four

countries (DRC, Burundi, Rwanda and Uganda) currently contain at least 13 national parks

(Plumptre et al., 2007) associated with the AR. The AR plays host to the most endemic

vertebrate fauna in continental Africa, including four currently recognized species of Amietia,

and many of these areas of high endemism are unprotected. Human activities involved with the

destruction of forests (e.g. logging) have been shown to negatively affect amphibians in the AR

(Behangana et al., 2009). Because most of the samples in this study were collected in pristine environments, conservation of forest habitats in these areas is important. A notable exception is

A. lubrica, which is common in degraded and disturbed habitats (topotypic samples were

collected in a hotel swimming pool adjacent to Lake Bunyonyi).

Another major cause for concern to the world’s amphibian populations is the increase in

species afflicted with Batrachochytrium dendrobatidis, commonly known as Bd or chytrid

fungus (Skerratt et al., 2007). The effects of Bd infection in AR amphibians are relatively unknown. However, samples of Amietia sp. 1–4 included in our study have been found to be

positive for chytrid (Greenbaum et al., 2014, 2015), and samples of A. ruwenzorica from the

Rwenzori Mountains (Uganda) have also tested positive for chytrid (Viertel et al., 2012). These

studies and additional ones from Malawi (Conradie et al., 2011) and Kenya (Kielgast et al.,

2010) suggested Amietia species have high rates of infection compared to other African genera

of frogs (Conradie et al., 2011; Greenbaum et al., 2015a). Given the high susceptibility of

Amietia to chytrid infection and the limited distribution of many species within the declining

pristine habitats of the AR (Fig. 1.4.1), it is likely that many Amietia species are threatened with

extinction.

31 Montane habitats act as tropical reservoirs of biodiversity (Sodhi et al., 2007), and because most AR Amietia are restricted to such habitats, increased efforts for conservation are urgently needed. With the new understanding of the diversity in Amietia evident in this study, there must also be a conservation reassessment to determine the best way to protect Amietia. For example, A. ruwenzorica is no longer endemic to one limited area of the AR, whereas other lineages (A. sp. 1–5) are likely to be new species that are not recognized or protected.

32 LITERATURE CITED

AmphibiaWeb: Information on amphibian biology and conservation. (2015). Berkeley,

California, USA: AmphibiaWeb. http://amphibiaweb.org/. (Accessed: Jan 3, 2015).

Angel, F. (1924). Description de deux batraciens nouveaux dAfrique orientale anglaise,

appartenant au genre Phrynobatrachus (Mission Alluaud et Jeannel, 1911–1912). Bulletin

du Museum National d’Histoire Naturelle, Paris 30, 130–131.

Barbour, T. and Loveridge, A. (1928). A comparative study of the herpetological faunae of the

Uluguru and Usumbara Mountains, Tanganyika Territory, with descriptions of new species.

Memoirs of the Museum of Comparative Zoology, 50, 87–265.

Bauer, F. U., Glasmacher, U. A., Ring, U., Karl, M., Schumann, A., and Nagudi, B. (2013).

Tracing the exhumation history of the Rwenzori Mountains, Albertine Rift, Uganda, using

low-temperature thermochronology. Tectonophysics, 599, 8–28.

Behangana, M., Kasoma, P. M. B., and Luiselli, L. (2009). Ecological correlates of species

richness and population abundance patterns in the amphibian communities from the

Albertine Rift, East Africa. Biodiversity and Conservation, 18, 2855–2873.

Bocage, J. V. B. d. (1866). Reptiles nouveaux ou peu recueillis dans les possessions portugaises

de l’Afrique occidentale, qui se trouvent au Muséum de Lisbonne. Jornal de Sciências,

Mathemáticas, Physicas e Naturaes, Lisbõa, 1, 57–78.

Bossuyt, F., Brown, R. M., Hillis, D. M., Cannatella, D. C., and Milinkovitch, M. C. (2006).

Phylogeny and biogeography of a cosmopolitan frog radiation: Late Cretaceous

diversification resulted in continent-scale endemism in the family Ranidae. Systematic

Biology, 55, 579–94.

33 Bossuyt, F. & Milinkovitch, M. C. (2000). Convergent adaptive radiations in Madagascan and

Asian ranid frogs reveal covariation between larval and adult traits. Proceedings of the

National Academy of Sciences of the United States of America, 97, 6585–6590.

Boulenger, G. A. (1896). Descriptions of two new frogs from Lake Tanganyika, presented to the

British Museum. Annals and Magazine of Natural History 18, 467–468.

Boulenger, G. A. (1920). Descriptions of three new frogs in the collection of the British

Museum. Annals and Magazine of Natural History, Series 9, 6, 106–108.

Bowie, R. C. K., Fjeldså, J., Hackett, S. J., Bates, J. M., and Crowe, T. M. (2006). Coalescent

models reveal the relative roles of ancestral polymorphism, vicariance, and dispersal in

shaping phylogeographical structure of an African montane forest robin. Molecular

Phylogenetics and Evolution, 38, 171–188.

Brooks, T. M., Mittermeier, R. A., da Fonseca, G. A. B., Gerlach, J., Hoffmann, M., Lamoreux,

J. F., Mittermeier, C. G., Pilgrim, J. D., and Rodrigues, A. S. L. (2006). Global biodiversity

conservation priorities. Science, 313, 58–61.

Broadley, D. G. and Cotterill, F. P. D. (2004). The reptiles of southeast Katanga, an overlooked

‘hot spot.’ African Journal of Herpetology, 53, 35–61.

Burgess, N., D’Amico Hales, J., Underwood, E., Dinerstein, E., Olson, D., Itoua, I., Schipper, J.,

Ricketts, T., and Newman, K. (2004). Terrestrial Ecoregions of Africa and Madagascar: A

Conservation Assessment. Washington, DC: Island Press.

Channing, A. (2004). Afrana fuscigula (Duméril and Bibron, 1841). In: Minter, L. R., M.

Burger,J. A. Harrison, H. H. Braack, P. J. Bishop, and D. Kloepfer (Eds.), Atlas and Red

34 Data Book of the Frogs of South Africa, Lesotho and Swaziland. Smithsonian Institution

Man and Biosphere Biodiversity Program, Washington, D.C., pp. 273–274.

Channing, A. (2015). The Maluti Mystery revisited: Taxonomy of African River Frogs

(Pyxicephalidae, Amietia) on the Drakensberg Mountains in southern Africa. Zootaxa,

3925, 271–280.

Channing, A. and Baptista, N. (2013). Amietia angolensis and A. fuscigula (Anura:

Pyxicephalidae) in southern Africa: A cold case reheated. Zootaxa, 3640, 501–520.

Channing, A., and Howell, K. M. (2006). Amphibians of East Africa. Cornell University Press,

Ithaca, New York.

Chapin, J. P. (1932). Birds of the Belgian Congo. Part I. Section A. Bulletin of the American

Museum of Natural History. 65, i–viii + 1–391.

Chiari, Y., Vences, M., Vieites, D. R., Rabemananjara, F., Bora, P., Ramilijaona

Ravoahangimalala, O., & Meyer, A. (2004). New evidence for parallel evolution of colour

patterns in malagasy poison frogs (Mantella). Molecular Ecology, 13, 3763–3774.

Conradie, W., Harvey, J., Kotzé, A., Dalton, D. L., and Cunningham, M. J. (2011). Confirmed

amphibian chytrid in Mount Mulanje area, Malawi. Herpetological Review, 42, 369–371.

Darriba, D., Taboada, G. L., Doallo, R., and Posada, D. (2012). jModelTest 2: More models, new

heuristics and parallel computing. Nature Methods, 9, 772.

Dawood, A. and Uqubay, S. M. (2004). A molecular phylogeny of the sand frog genus

Tomopterna (Amphibia: Anura: Ranidae) based on mitochondrial 12S and 16S rRNA

sequences. African Zoology, 39, 145–151.

35 de Witte, G. F. (1931). Liste des batraciens du Congo Belge (Collection du Musée du Congo

Belge à Tervuren). Premiére partie. Revue de zoologie et de botanique africaines. Tervuren

19, 232–273. de Witte, G. F. (1941). Batraciens et Reptiles. Exploration du Parc National Albert, Mission G.

F. De Witte (1933–1935). Fascicle 33. Institut des Parcs Nationaux du Congo Belge,

Bruxelles.

Demey, R. and Louette, M. (2001) Democratic Republic of Congo. In: Fishpool, L. D. C. and

M.I. Evans (Eds.). (2001), Important Bird Areas in Africa and associate islands: Priority

sites for conservation. Pisces Publications and Bird Life International. Newbury and

Cambridge, UK. pp.199–218.

Demos, T. C., Kerbis Peterhans, J. C., Agwanda, B., and Hickerson, M. J. (2014). Uncovering

cryptic diversity and refugial persistence among small mammal lineages across the eastern

Afromontane biodiversity hotspot. Molecular Phylogenetics and Evolution, 71, 41–54.

Doumenge, C. (1998). Forest diversity, distribution, and dynamique in the Itombwe Mountains,

South-Kivu, Congo Democratic Republic. Mountain Research and Development 18, 249–

264.

Drummond, A. J., Suchard, M. A., Xie, D., and Rambaut, A. (2012). Bayesian phylogenetics

with BEAUti and the BEAST 1.7. Molecular Biology and Evolution, 29, 1969–1973.

Dubois, A. (1986). Miscellanea taxinomica batrachologica. Alytes, 5, 7–95.

Dubois, A. (1992). Notes sur la classification des Ranidae (Amphibien Anoures). Bulletin

Mensuel de la Société Linnéenne de Lyon, 61, 305–352.

Dubois, A. (2005). Amphibia Mundi. 1.1. An ergotaxonomy of recent amphibians. Alytes, 23,

36 1–24.

Duméril, A. M. C. and Bibron, G. . (1841). Erpétologie Genérale ou Histoire Naturelle

Complète des Reptiles. Volume 8. Paris: Librarie Enclyclopedique de Roret.

Evans, B. J., Bliss, S. M., Mendel, S. A., and Tinsley, R. C. (2011). The rift valley is a major

barrier to the dispersal of African clawed frogs (Xenopus) in Ethiopia. Molecular Ecology,

20, 4216–4230.

Evans, B. J., Carter, T. F., Tobias, M. L., Kelley, D. B., Hanner, R., and Tinsley, R. C. (2008). A

new species of clawed frog (genus Xenopus) from the Itombwe Massif, Democratic

Republic of the Congo: Implications for DNA barcodes and biodiversity conservation.

Zootaxa, 1780, 55–68.

Fjeldså, J. and Bowie, R. C. K. (2008). New perspectives on the origin and diversification of

Africa’s forest avifauna. African Journal of Ecology, 46, 235–247.

Fouquet, A., Green, D. M., Waldman, B., Bowsher, J. H., McBride, K. P., and Gemmell, N. J.

(2009). Phylogeography of Leiopelma hochstetteri reveals strong genetic structure and

suggests new conservation priorities. Conservation Genetics, 11, 907–919.

Frost, D. R. (2015). Amphibian Species of the World: an Online Reference. Version 6.0 (April

2015). Electronic Database accessible at:

http://research.amnh.org/herpetology/amphibia/index.html. American Museum of Natural

History, New York, USA.

Frost, D. R., Grant, T., Faivovich, J., Bain, R. H., Haas, A., Haddad, C. F. B., De Sa, R. O.,

Channing, A., Wilkinson, M., Donnellan, S. C., Raxworthy, C. J., Campbell, J. A., Blotto,

B. L., Moler, P., Drewes, R. C., Nussbaum, R. A., Lynch, J. D., Green, D. M., and Wheeler,

37 W.C. (2006). The amphibian tree of life. Bulletin of the American Museum of Natural

History, 297, 1–371.

Furman, B. L. S., Bewick, A. J., Harrison, T. L., Greenbaum, E., Gvoždík, V., Kusamba, C., and

Evans, B. J. (2015). Pan-African phylogeography of a model organism, the African clawed

frog ‘Xenopus laevis.’ Molecular Ecology, 24, 909–925.

Greenbaum, E. and Kusamba, C. (2012). Conservation implications following the rediscovery of

four frog species from the Itombwe Natural Reserve, eastern Democratic Republic of the

Congo. Herpetological Review, 43, 253–259.

Greenbaum, E., Meece, J., Reed, K. D., and Kusamba, C. (2014). Amphibian chytrid infections

in non-forested habitats of Katanga, Democratic Republic of the Congo. Herpetological

Review, 45, 610–614.

Greenbaum, E., Meece, J., Reed, K. D., and Kusamba, C. (2015a). Extensive occurrence of the

amphibian chytrid fungus in the Albertine Rift, a Central African amphibian hotspot.

Herpetological Journal, 25, 91–100.

Greenbaum, E., Portillo, F., Jackson, K., and Kusamba, C. (2015b). A phylogeny of Central

African Boaedon (Serpentes: Lamprophiidae), with the description of a new cryptic species

from the Albertine Rift. African Journal of Herpetology, 64, 18–38.

Greenbaum, E., Sinsch, U., Lehr, E., Valdez, F., and Kusamba, C. (2013). Phylogeography of the

reed frog Hyperolius castaneus (Anura: Hyperoliidae) from the Albertine Rift of Central

Africa: Implications for taxonomy, biogeography and conservation. Zootaxa, 3731, 473–

494.

38 Greenbaum, E., Stanley, E. L., Kusamba, C., Moninga, W. M., Goldberg, S. R., and Bursey, C.

R. (2012). A new species of Cordylus (Squamata: Cordylidae) from the Marungu Plateau of

south-eastern Democratic Republic of the Congo. African Journal of Herpetology, 61, 14–

39.

Greenbaum, E., Villanueva, C. O., Kusamba, C., Aristote, M. M., and Branch, W. R. (2011). A

molecular phylogeny of Equatorial African Lacertidae, with the description of a new genus

and species from eastern Democratic Republic of the Congo. Zoological Journal of the

Linnean Society, 163, 913–942.

Guibé, J. (1950) “1948”. Catalogue Des Types d’Amphibiens du Musèum National d’Histoire

Naturelle. Paris, France: Imprimerie Nationale.

Günther, A. C. L. G. (1894) "1893". Second report on the reptiles, batrachians, and fishes

transmitted by Mr. H. H. Johnston, C.B., from British Central Africa. Proceedings of the

Zoological Society of London, 1893, 616–628.

Hewitt, J. (1927). Further descriptions of reptiles and batrachians from South Africa. Record of

the Albany Museum, 3, 371–415.

Huhndorf, M. H., Peterhans, J. C., and Loew, S. S. (2007). Comparative phylogeography of

three endemic rodents from the Albertine Rift, east central Africa. Molecular Ecology 16,

663–674.

Jenkins, C. N., Pimm, S. L., and Joppa, L. N. (2013). Global patterns of terrestrial vertebrate

diversity and conservation. Proceedings of the National Academy of Sciences of the

United States of America, 110, E2602–E2610.

39 Jiang, W., Chen, S.-Y., Wang, H., Li, D.-Z., and Wiens, J. J. (2014). Should Genes with Missing

Data Be Excluded from Phylogenetic Analyses? Molecular Phylogenetics and Evolution,

80, 308–318.

Kaufmann, G., Hinderer, M., and Romanov, D. (2015). Shaping the Rwenzoris: Balancing uplift,

erosion, and glaciation. International Journal of Earth Sciences, DOI: 10.1007/s00531-

015-1174-2.

Kerbis Peterhans, J. C., Hutterer, R., Mwanga, J., Ndara, B., Davenport, L., Karhagomba, I. B.,

and Udelhoven, J. (2010). African shrews endemic to the Albertine Rift: Two new species

of Myosorex (Mammalia: Soricidae) from Burundi and the Democratic Republic of Congo.

Journal of East African Natural History, 99, 103–128.

Kielgast, J., Rödder, D., Veith, M., and Lötters, S. (2010). Widespread occurrence of the

amphibian chytrid fungus in Kenya. Animal Conservation, 13, 36–43.

Kocher, T. D., Thomas, W. K., Meyer, A., Edwards, S. V., Pääbo, S., Villablanca, F. X., &

Wilson, A. C. (1989). Dynamics of mitochondrial DNA evolution in animals: Amplification

and sequencing with conserved primers. Proceedings of the National Academy of Sciences

of the United States of America, 86, 6196–6200.

Lambiris, A. J. L. (1988). A review of the amphibians of Natal. Lammergeyer. 39, 1–210.

Laurent, R. F. (1964). Adaptive modifications in frogs of an isolated highland fauna in Central

Africa. Evolution, 18, 458–467.

Largen, M., and Spawls, S. (2010). The Amphibians and Reptiles of Ethiopia and Eritrea.

Frankfurt am Main, Germany, Edition Chimaira,.

40 Laurent, R. F. (1972). Amphibiens. Fondation pour Favoriser les Recherches Scientifiques en

Afrique, Bruxelles, Exploration du Parc National des Virunga 22 (2e séries), 1–125, + I–

XI.

Laurent, R. F. (1976). Deux amphibiens nouveaux du Zaire. Revue de zoologie et de botanique

africaines, 90, 528–546.

Leaché, A. D. and Fujita, M. K. (2010). Bayesian species delimitation in West African forest

geckos (Hemidactylus fasciatus). Proceedings of the Royal Society B: Biological Sciences,

277, 3071–3077.

Librado, P. and Rozas, J. (2009). DnaSP v5: A software for comprehensive analysis of DNA

polymorphism data. Bioinformatics, 25, 1451–1452.

Loveridge, A. (1929). East African reptiles and amphibians in the United States National

Museum. Bulletin of the United States National Museum, 151, 1–135.

Loveridge, A. (1936). Scientific results of an expedition to rain forest regions in eastern Africa.

VII. Amphibians. Bulletin of the Museum of Comparative Zoology, 79, 369–430.

Loveridge, A. (1957). Check list of the reptiles and amphibians of East Africa (Uganda; Kenya;

Tanganyika; Zanzibar). Bulletin of the Museum of Comparative Zoology, 117, 153–362.

Macey, J. R., Schulte, J. A., and Larson, A. (1998). Phylogenetic relationships of toads in the

Bufo bufo species group from the eastern escarpment of the Tibetan Plateau: A case of

vicariance and dispersal. Molecular Phylogenetics and Evolution, 9, 80–87.

Macey, J. R., Strasburg, J. L., Brisson, J. A., Vredenburg, V. T., Jennings, M., and Larson, A.

(2001). Molecular phylogenetics of western North American frogs of the Rana boylii

species group. Molecular Phylogenetics and Evolution, 19, 131–143.

41 Maddison, D. R. and Maddison, W. P. (2005). MacClade: Analysis of Phylogeny and Character

Evolution. Sunderland, Massachusetts: Sinauer Associates, Inc.

Menegon, M., Loader, S. P., Marsden, S. J., Branch, W. R., Davenport, T. R. B., and

Ursenbacher, S. (2014). The genus Atheris (Serpentes: Viperidae) in East Africa: Phylogeny

and the role of rifting and climate in shaping the current pattern of species diversity.

Molecular Phylogenetics and Evolution, 79, 12–22.

Miller, M. A., Pfeiffer, W., and Schwartz, T. (2010). Creating the CIPRES Science Gateway for

inference of large phylogenetic trees. Proceediings of the Gateway Computing

Environments Workshop (GCE), 14 Nov. 2010, New Orleans, LA.

Monsen, K.. J. and Blouin, M. S. (2003). Genetic structure in a montane ranid frog, restricted

gene flow and nuclear–mitochondrial discordance. Molecular Ecology, 12, 3275–3286.

Noble, G. K. (1924). Contributions of the herpetology of the Belgian Congo based on the

collection of the American Museum Congo Expedition, 1909–1915. Bulletin of the

American Museum of Natural History 49, 147–347.

Noble, G. K. (1931). The Biology of the Amphibia. New York and London: McGraw-Hill.

Notredame, C., Higgins, D. G., and Heringa, J. (2000). T-Coffee: A novel method for fast and

accurate multiple sequence alignment. Journal of Molecular Biology, 302, 205–217.

Nylander, J. A., Wilgenbusch, J. C., Warren, D. L., and Swofford, D. L. (2008). AWTY (are we

there yet?): A system for graphical exploration of MCMC convergence in Bayesian

phylogenetics. Bioinformatics, 24, 581–583.

Palumbi, S., Martin, A., Romano, S., McMillan, W. O., Stice, L., & Grabowski, G. (1991). The

Simple Fool’s Guide to PCR. Version 2. Honolulu, HI: The University of Hawaii.

42 Pickersgill, M. (2007). Frog Search: Results of Expeditions to Southern and Eastern Africa from

1993–1999. Franfurt am Main, Germany: Edition Chimaira.

Pickford, M. (1990). Uplift of the roof of Africa and its bearing on the evolution of mankind.

Human Evolution 5, 1–20.

Plumptre, A., Davenport, T., Behangana, M., Kityo, R., Eilu, G., Ssegawa, P., Ewango, C.,

Meirte, D., Kahindo, C., Herremans, M., Kerbis Peterhans, J., Pilgrim, J. D., Wilson, M.,

Languy, M., and Herremans, M. (2007). The biodiversity of the Albertine Rift. Biological

Conservation, 134, 178–194.

Portillo, F. and Greenbaum, E. (2014a). A new species of the Leptopelis modestus complex

(Anura: Arthroleptidae) from the Albertine Rift of Central Africa. Journal of Herpetology,

48, 394–406.

Portillo, F. and Greenbaum, E. (2014a). A new species of the Leptopelis modestus complex

(Anura: Arthroleptidae) from the Albertine Rift of Central Africa. Journal of Herpetology,

48, 394–406.

Portillo, F. and Greenbaum, E. (2014b). At the edge of a species boundary: A new and relatively

young species of Leptopelis (Anura: Arthroleptidae) from the Itombwe Plateau, Democratic

Republic of the Congo. Herpetologica, 70, 100–119.

Portillo, F., Greenbaum, E., Menegon, M., Kusamba, C., and Dehling, J. M. (2015).

Phylogeography and species boundaries of Leptopelis (Anura: Arthroleptidae) from the

Albertine Rift. Molecular Phylogenetics and Evolution, 82, 75–86.

Poynton, J. C. (1966). A new subspecies of Rana from Rhodesia. Arnoldia. Zimbabwe 2, 1–3.

Poynton, J. C., and Broadley, D. G. (1985). Amphibia Zambesiaca 2: Ranidae. Annals of the

Natal Museum 27, 115–181.

43 Pramuk, J. B., Robertson, T., Sites Jr., J. W., & Noonan, B. P. (2008). Around the world in 10

million years: Biogeography of the nearly cosmopolitan true toads (Anura: Bufonidae).

Global Ecology and Biogeography, 17, 72–83.

Prigogine, A. (1971). Les oiseaux de l’Itombwe et de son hinterland. Vol. 1. Musee Royal de

l’Afrique Centrale. Annales Serie 8. Sciences Zoologiques, 185, 1–298.

Prigogine, A. (1977). The composition of Itombwe forest’s avifauna. Bonner Zoologische

Beiträge, 28, 369–383.

Prigogine, A. (1978). Les oiseaux de l’Itombwe et de son hinterland. Vol. 2. Musee Royal de

l’Afrique Centrale. Annales Serie 8, Sciences Zoologiques, 223, 1–134 + Figs. 15–25.

Prigogine, A. (1984). Les oiseaux de l’Itombwe et de son hinterland. Vol. 3. Musee Royal de

l’Afrique Centrale, Annales Serie 8. Sciences Zoologiques, 243, 1–146.

Prigogine, A. (1985). Conservation of the avifauna of the forests of the Albertine Rift. In:

Diamond, A.W., Lovejoy, T.E. (Eds.), Conservation of Tropical Forest Birds (pp. 275–

295). Cambridge, UK: International Council for Bird Protection.

Pröhl, H., Ron, S. R., and Ryan, M. J. (2010). Ecological and genetic divergence between two

lineages of Middle American túngara frogs Physalaemus (=Engystomops) pustulosus. BMC

Evolutionary Biology, 10, 146.

Pyron, R. A. (2011). Divergence time estimation using fossils as terminal taxa and the origins of

Lissamphibia. Systematic Biology, 60, 466–481.

Pyron, R. A., Burbrink, F. T., and Wiens, J. J. (2013). A phylogeny and revised classification of

Squamata, including 4161 species of lizards and snakes. BMC Evolutionary Biology, 13, 93.

44 Rambaut, A. and Drummond, A. (2014). FigTree v1.4.2. Institute of Evolutionary Biology.

University of Edinburgh, Edinburgh, UK

Roberts, E. M., Stevens, N. J., O’Connor, P. M., Dirks, P. H. G. M., Gottfried, M. D., Clyde, W.

C., Armstrong, R. A., Kemp, A. I. S., and Hemming, S. (2012). Initiation of the western

branch of the East African Rift coeval with the eastern branch. Nature Geoscience, 5, 289–

294.

Roelants, K., Gower, D. J., Wilkinson, M., Loader, S. P., Biju, S. D., Guillaume, K., Moriau, L.,

and Bossuyt, F. (2007). Global patterns of diversification in the history of modern

amphibians. Proceedings of the National Academy of Sciences of the United States of

America, 104, 887–892.

Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D. L., Darling, A., Höhna, S., Larger, B.,

Liu, L., Suchard, M. A., and Huelsenbeck, J. P. (2012). MrBayes 3.2: Efficient Bayesian

phylogenetic inference and model choice across a large model space. Systematic Biology,

61, 539–542.

Sayer, J., Yobwa, I., ma Mbaelélé, M., Mertens, H., d’Huart, J. –P., Doumenge, C., Wilson, R.,

Hart, J., and Hart, T. (1992). In: Sayer, J. A., C. S. Harcourt, and N. M. Collins (eds). The

Conservation Atlas of Tropical Forests: Africa. New York, London, Toronto, Sydney,

Tokyo and Singapore, Simon and Schuster.

Scott, E. (2005). A phylogeny of ranid frogs (Anura: Ranoidea: Ranidae), based on a

simultaneous analysis of morphological and molecular data. Cladistics, 21, 507–574.

45 Skerratt, L. F., Berger, L., Speare, R., Cashins, S., McDonald, K. R., Phillott, A. D., Hines, H.

B., and Kenyon, N. (2007). Spread of chytridiomycosis has caused the rapid global decline

and extinction of frogs. EcoHealth, 4, 125–134.

Sodhi, N. S., Brook, B. W., and Bradshaw, C. J. A. (2007). Tropical Conservation Biology.

Oxford, UK: Blackwell.

Stamatakis, A. (2006). RAxML–VI–HPC: Maximum likelihood-based phylogenetic analyses

with thousands of taxa and mixed models. Bioinformatics, 22, 2688–2690.

Stamatakis, A., Hoover, P., and Rougemont, J. (2008). A rapid bootstrap algorithm for the

RAxML web servers. Systematic Biology, 57, 758–771.

Stephens, M., Smith, N., and Donnelly, P. (2001). A new statistical method for haplotype

reconstruction from population data. American Journal of Human Genetics, 68, 978–989.

Stewart, M. M. (1967). Amphibians of Malawi. Albany, New York, State University of New

York Press.

Swindell, S. R. and Plasterer, T. N. (1997). SEQMAN: Contig assembly. Methods in Molecular

Biology, 70, 70–89.

Tarrant, J., Cunningham, M. J., and du Preez, L. H. (2008). Maluti mystery: A systematic review

of Amietia vertebralis (Hewitt, 1927) and Strongylopus hymenopus (Boulenger, 1920)

(Anura: Pyxicephalidae). Zootaxa, 1962, 33–48.

Tolley, K. A., Braae, A., and Cunningham, M. (2010). Phylogeography of the Clicking Stream

Frog Strongylopus grayii (Anura, Pyxicephalidae) reveals cryptic divergence across

climatic zones in an abundant and widespread taxon. African Journal of Herpetology, 59,

17–32.

46 Tolley, K. A., Tilbury, C. R., Measey, G. J., Menegon, M., Branch, W. R., and Matthee, C. A.

(2011). Ancient forest fragmentation or recent radiation? Testing refugial speciation models

in chameleons within an African biodiversity hotspot. Journal of Biogeography, 38, 1748–

1760.

van der Meijden, A., Vences, M., Hoegg, S., and Meyer, A. (2005). A previously unrecognized

radiation of ranid frogs in Southern Africa revealed by nuclear and mitochondrial DNA

sequences. Molecular Phylogenetics and Evolution, 37, 674–685.

van der Meijden, A., Crottini, A., Tarrant, J., Turner, A., and Vences, M. (2011). Multi-locus

phylogeny and evolution of reproductive modes in the Pyxicephalidae, an African endemic

clade of frogs. African Journal of Herpetology, 60, 1–12.

Vande weghe, J. P. (2004). Forests of Central Africa: Nature and man. Pretoria, South Africa,

Protea Book House.

Viertel, B., Veith, M., Schick, S., Channing, A., Kigoolo, S., Baeza-Urrea, O., Sinsch, U., and

Lötters, S. (2012). The stream-dwelling larva of the Ruwenzori River Frog, Amietia

ruwenzorica, its buccal cavity and pathology of chytridiomycosis. Zootaxa, 57, 43–57.

Visser, J. and Channing, A. (1997). A new species of river frog from the Swartberg, South Africa

(Ranidae: Afrana). Journal of African Zoology, 111, 191–198.

Yang, Z. and Rannala, B. (2010). Bayesian species delimitation using multilocus sequence data.

Proceedings of the National Academy of Sciences of the United States of America, 107,

9264–9269.

47 Zancolli, G., Rödel, M., Steffan-Dewenter, I., and Storfer, A. (2014). Comparative landscape

genetics of two river frog species occurring at different elevations on Mount Kilimanjaro.

Molecular Ecology, 23, 4989–5002.

48 APPENDIX I Voucher numbers, localities and GenBank numbers for genetic samples. DRC = Democratic Republic of the Congo. NOTE: Catalog numbers and GenBank numbers to be included in paper for publication. Species Collection No. Field No. Locality 12S 16S Cyt b RAG1 Ptychadena cf. nilotica EBG 1582 DRC: South Kivu: Lake Tanganyika, Uvira, Mulongwe Ptychadena oxyrhynchus EBG 2873 DRC: Katanga: road south of Kalemie Hildebrandtia ornata ELI 359 DRC: Katanga: 7 km south of Manono Hildebrandtia ornata ELI 361 DRC: Katanga: 7 km south of Manono Phrynobatrachus natalensis EBG 1791 DRC: North Kivu: Virunga National Park, Ndjuma Phrynobatrachus natalensis ELI 448 DRC: South Kivu: Kahuzi-Biega National Park Petropedetes parkeri No voucher — Cameroon: Nguti AY341628 AF124132 — DQ019505 Pyxicephalus adspersus ZFMK66446 — South Africa: KwaMbonambi AF206091 AF215505 — DQ019508 Aubria masako ELI 2156 DRC: Equateur: Npenda village Tomopterna sp. ZFMK 66403 — Namibia: Khorixas DQ019595 DQ019610 — DQ019514 Natalobatrachus bonebergi ZFMK 74837 — South Africa: The Haven AF215198 AF215396 — DQ019502 Cacosternum boettgeri ZFMK 66727 — Namibia: Hardap AF124096 AF215414 — AY571645 Strongylopus fasciatus ZFMK 66444 — South Africa: Little Brak DQ019594 AF215412 — DQ019513 Amietia ruwenzorica EBG 2227 DRC: Katanga: Kabobo Plateau Amietia ruwenzorica EBG 2094 DRC: South Kivu: Itombwe Plateau, Mugegema Amietia ruwenzorica — SL 437 Uganda: Rwenzori Mountains, — JF809877 — — Mubuku River Amietia ruwenzorica — SL 459 Uganda: Rwenzori Mountains, — JF809880 — — Mubuku River Amietia ruwenzorica — SL 459 Uganda: Rwenzori Mountains — GQ183599 — — Amietia vertebralis SAIAB DT16.1 — Lesotho — FJ411429 — — Amietia vertebralis — AC 1220 South Africa: Drakensberg: Naudes — AY255097 — — Nek Amietia quecketti — QQ 0114 South Africa — EF136555 — — Amietia quecketti — KTH 406 South Africa — EF136562 — — Amietia quecketti — AC 2737 South Africa: Eastern Cape — KC756354 — — Amietia quecketti No voucher — South Africa: Barberton DQ019576 DQ019596 — DQ019493 Amietia quecketti UFS QQ00009 — South Africa: Free State — FJ411440 — —

49 Amietia fuscigula — CR 1073 Africa — DQ347347 — — Amietia vandijki — MH 0107 South Africa: Swartberg — HQ014418 — — Amietia fuscigula — AC 3167 South Africa: Western Cape: — KC756306 — — Bainskloof Pass Amietia fuscigula — AC 2671 South Africa: Eastern Cape: — KC756317 — — Longmore Forest Reserve Amietia fuscigula — AC 2665 South Africa: Western Cape: — KC756321 — — Bloukrans Pass Amietia hymenopus UFS MPU100 — South Africa: Kwazulu-Natal — FJ411435 — — Amietia hymenopus UFS MH1323 — South Africa: Free State — FJ411434 — — Amietia angolensis — AC 3080 Angola: Humpata — KC756286 — — Amietia angolensis — AC 3016 Angola: Calandula — KC756291 — — Amietia poyntoni — MH 0975 South Africa: Harrismith — KC756304 — — Amietia poyntoni — AC 2764 South Africa: Rhodes — KC756283 — — Amietia wittei — — Tanzania: Mount Kilimanjaro — KJ469278 — — Amietia wittei — — Tanzania: Mount Kilimanjaro — KJ469273 — — Amietia wittei — — Tanzania: Mount Kilimanjaro — KJ469274 — — Amietia wittei — — Tanzania: Mount Kilimanjaro — KJ469276 — — Amietia sp. 1 ELI 149 DRC: Katanga: Kasongomwana Amietia sp. 1 ELI 236 DRC: Katanga: Mayola River, ca. 3 km E of Kakunko Amietia sp. 2 EBG 2018 DRC: South Kivu: Itombwe Plateau, Rurambo Amietia sp. 2 ELI 824 DRC: South Kivu: Itombwe Plateau, Mitamba Amietia sp. 2 ELI 818 DRC: South Kivu: Itombwe Plateau, Mitamba Amietia sp. 2 EBG 1588 DRC: South Kivu: Itombwe Plateau, Miki Amietia sp. 2 EBG 1646 DRC: South Kivu: Itombwe Plateau, Miki Amietia sp. 2 EBG 2058 DRC: South Kivu: Itombwe Plateau, Komesha Amietia sp. 2 EBG 2007 DRC: South Kivu: Itombwe Plateau, Kasozo River Amietia cf. amieti EBG 1312 DRC: South Kivu: Kahuzi-Biega National Park, Irangi Amietia cf. amieti ELI 490 DRC: South Kivu: Bizombo Amietia cf. amieti EBG 1559 DRC: South Kivu: N’Komo River

50 on road between Uvira and Bukavu Amietia cf. amieti EBG 1467 DRC: South Kivu: Kahuzi-Biega National Park, Mugaba Amietia cf. amieti EBG 1882 DRC: North Kivu: Lwanoli River Amietia sp. 3 MTSN 9978 — DRC: Katanga: Lwama Amietia sp. 3 MTSN 9837 — DRC: Katanga: Kinyama Amietia sp. 3 ELI 529 DRC: South Kivu: Byonga Amietia sp. 3 EBG 2201 DRC: Katanga: Force Bendera Amietia sp. 4 EBG 2926 DRC: Katanga: Pepa Amietia sp. 4 EBG 2978 DRC: Katanga: Pepa Amietia sp. 4 EBG 2897 DRC: Katanga: Kyalengwe Amietia sp. 4 ELI 186 DRC: Katanga: Mitwaba Amietia sp. 4 ELI 177 DRC: Katanga: Mitwaba Amietia sp. 4 ELI 235 DRC: Katanga: Mayola River, ca. 3 km E of Kakunko Amietia sp. 4 ELI 176 DRC: Katanga: Mitwaba Amietia angolensis CAS 191519 — South Africa: Barberton DQ019576 DQ019596 — DQ019493 Amietia angolensis RDS 926 — Tanzania — DQ022350 — — Amietia sp. 5 EBG 2381 DRC: Orientale: Lendu Plateau, Aboro Amietia sp. 5 EBG 2309 DRC: Orientale: Mafifi Amietia sp. 5 CK 114 DRC: Orientale: Banvokoto Amietia sp. 5 EBG 2465 DRC: Orientale: Bunia Amietia desaegeri — SL 478 Uganda: Rwenzori Mountains — GQ183600 — — Amietia desaegeri EBG 1879 DRC: North Kivu: Lwanoli River Amietia desaegeri EBG 1845 DRC: North Kivu: Kisanzi Amietia desaegeri EBG 1811 DRC: North Kivu: Virunga National Park, Ndjuma Amietia lubrica — SL 538 Uganda: Semliki — GQ183602 — — Amietia lubrica ELI 2716 Uganda: Lake Bunyonyi Amietia lubrica ELI 2715 Uganda: Lake Bunyonyi Amietia lubrica ELI 2826 Uganda: Rwenzori National Park, Ruboni Community Hotel Amietia lubrica CFS 1586 Burundi: Makamba West Amietia lubrica ELI 867 Burundi: Bururi Amietia lubrica CK 051 DRC: North Kivu: Virunga National Park, Kichanga-Mokoto Amietia lubrica CK 006 DRC: North Kivu: Virunga National Park, Kichanga-Mokoto

51 Amietia lubrica ELI 1152 Burundi: Kibira National Park, Mpishi Amietia lubrica ELI 1216 Burundi: Kibira National Park, Mpishi, Nyanutovu River Amietia lubrica CFS 1538 Burundi: Mukazira River Amietia lubrica ELI 1266 Burundi: Kibira National Park, ca. Rwegura Amietia lubrica ELI 993 Burundi: Gihofi Amietia lubrica ELI 1258 Burundi: Kibira National Park, ca. Rwegura Amietia lubrica ELI 975 Burundi: Bururi, Mivgaro Amietia lubrica ELI 848 Burundi: Muranvya, Gatambo

VITA

Thornton Larson obtained a B.S. in biology at Northland College in Ashland, Wisconsin in May 2011. He entered the Master’s program in Ecology and Evolutionary Biology at the

University of Texas at El Paso (UTEP) in the Fall of 2012. In addition to pursuing a graduate degree from UTEP, he participated in community programs, such as volunteering at the El Paso

Zoo and serving in Big Brothers and Big Sisters of El Paso. Thornton was supported as a graduate student through a teaching assistantship, assiting in classes such as Introductory

Biology (BIOL 1107), Organismal Biology (BIOL 1108) and Ecology Laboratory (BIOL 3117).

He is a member of the Society for the Study of Amphibians and Reptiles, Herpetologists’

League, American Society of Ichthyologists and Herpetologists, Chicago Herpetological Society,

Southwestern Association of Naturalists and the Society of Systematic Biologists. He has presented at the Joint Meetings of Ichthyologists and Herpetologists (JMIH) meeting in

Albuequerque, NM in July, 2013, JMIH in Chatanooga, TN in July-August 2014, 3rd Annual

Graduate Research expo at UTEP in November 2013, and the meeting for Southwestern

Association of Naturalists at Stillwater, OK in April 2014. Thornton has been accepted in the doctoral program in evolutionary biology at the University of Texas at Arlington under the guidance of Dr. Eric Smith. His long term goal is to take a research position at an academic institution to further research in the field of herpetology.

Permanent address: 678 N. Eagle Lane

Palatine, IL 60067

This thesis/dissertation was typed by Thornton Larson