STRAD Alpha / LYK5 (1-314, His-Tag) Human Protein – AR51542PU-S
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
A Sensitized RNA Interference Screen Identifies a Novel Role for the PI3K P110γ
Author Manuscript Published OnlineFirst on June 7, 2011; DOI: 10.1158/1541-7786.MCR-10-0200 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. 1 A sensitized RNA interference screen identifies a novel role for the PI3K p110γ isoform in medulloblastoma cell proliferation and chemoresistance Ana S. Guerreiro 1, Sarah Fattet 2,3, Dorota W. Kulesza 1, Abdullah Atamer 1, Alexandra N. Elsing 1, Tarek Shalaby 1, Shaun P. Jackson 4, Simone M. Schoenwaelder 4, Michael A. Grotzer 1, Olivier Delattre 2, and Alexandre Arcaro 1,5 1 Department of Oncology, University Children’s Hospital, Zurich, Switzerland 2 Laboratoire de Pathologie Moléculaire des Cancers, Institut Curie, Paris, France 3 Unité d'Hématologie et Oncologie Pédiatrique, Centre Hospitalier Universitaire Vaudois Lausanne (CHUV), Lausanne, Switzerland 4 Australian Centre for Blood Diseases, Monash University, 6th Floor Burnet Building Alfred Medical Research and Education Precinct, Prahran, Victoria, Australia 5 Division of Pediatric Hematology/Oncology, Department of Clinical Research, University of Bern, Switzerland Requests for reprints: Alexandre Arcaro, University of Bern, Department of Clinical Research, Tiefenaustrasse 120c, 3004 Bern, Switzerland. Tel. +41 31 308 80 29; FAX +41 31 308 80 28; Email [email protected] Grant Support: This work was supported by grants from the Werner und Hedy Berger-Janser – Stiftung zur Erforschung der Krebskrankheiten, the Forschungskredit der Universität Zürich, the Fondation FORCE, the Stiftung zur Krebsbekämpfung and the European Community FP7 (ASSET, project number: 259348) to AA. Running title: Role of p110γ in medulloblastoma Keywords: medulloblastoma; phosphoinositide 3-kinase; Akt; apoptosis; chemoresistance Downloaded from mcr.aacrjournals.org on October 5, 2021. -
Phytophthora Sojae Effector Avr1d Functions As an E2 Competitor and Inhibits Ubiquitination Activity of Gmpub13 to Facilitate Infection
Phytophthora sojae effector Avr1d functions as an E2 competitor and inhibits ubiquitination activity of GmPUB13 to facilitate infection Yachun Lina,b,c,1, Qinli Hud,e,1, Jia Zhoud,e, Weixiao Yina,f, Deqiang Yaog, Yuanyuan Shaoa, Yao Zhaoa,b,c, Baodian Guoa,b,c, Yeqiang Xiaa,b,c, Qian Chenh,i, Yan Wanga,b,c, Wenwu Yea,b,c, Qi Xiei, Brett M. Tylerj, Weiman Xingk,2, and Yuanchao Wanga,b,c,2 aDepartment of Plant Pathology, Nanjing Agricultural University, 210095 Nanjing, China; bThe Key Laboratory of Integrated Management of Crop Diseases and Pests (Ministry of Education), Nanjing Agricultural University, 210095 Nanjing, China; cThe Key Laboratory of Plant Immunity, Nanjing Agricultural University, 210095 Nanjing, China; dShanghai Center for Plant Stress Biology and Center of Excellence in Molecular Plant Sciences, Chinese Academy of Sciences, Shanghai 200032, China; eUniversity of Chinese Academy of Sciences, Beijing 100049, China; fDepartment of Plant Pathology, College of Plant Science and Technology and the Key Lab of Crop Disease Monitoring and Safety Control in Hubei Province, Huazhong Agricultural University, 430070 Wuhan, China; giHuman Institute, ShanghaiTech University, Shanghai 201210, China; hMinistry of Agriculture Key Lab of Pest Monitoring and Green Management, Department of Plant Pathology, College of Plant Protection, China Agricultural University, 100193 Beijing, China; iState Key Laboratory of Plant Genomics, Institute of Genetics and Developmental Biology, The Innovative Academy of Seed Design, Chinese Academy of Sciences, -
Potential Genotoxicity from Integration Sites in CLAD Dogs Treated Successfully with Gammaretroviral Vector-Mediated Gene Therapy
Gene Therapy (2008) 15, 1067–1071 & 2008 Nature Publishing Group All rights reserved 0969-7128/08 $30.00 www.nature.com/gt SHORT COMMUNICATION Potential genotoxicity from integration sites in CLAD dogs treated successfully with gammaretroviral vector-mediated gene therapy M Hai1,3, RL Adler1,3, TR Bauer Jr1,3, LM Tuschong1, Y-C Gu1,XWu2 and DD Hickstein1 1Experimental Transplantation and Immunology Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland, USA and 2Laboratory of Molecular Technology, Scientific Applications International Corporation-Frederick, National Cancer Institute-Frederick, Frederick, Maryland, USA Integration site analysis was performed on six dogs with in hematopoietic stem cells. Integrations clustered around canine leukocyte adhesion deficiency (CLAD) that survived common insertion sites more frequently than random. greater than 1 year after infusion of autologous CD34+ bone Despite potential genotoxicity from RIS, to date there has marrow cells transduced with a gammaretroviral vector been no progression to oligoclonal hematopoiesis and no expressing canine CD18. A total of 387 retroviral insertion evidence that vector integration sites influenced cell survival sites (RIS) were identified in the peripheral blood leukocytes or proliferation. Continued follow-up in disease-specific from the six dogs at 1 year postinfusion. A total of 129 RIS animal models such as CLAD will be required to provide an were identified in CD3+ T-lymphocytes and 102 RIS in accurate estimate -
Inaugural-Dissertation Zur Erlangung Der Doktorwürde Der Naturwissenschaftlich-Mathematischen Gesamtfakultät Der Ruprecht-Kar
Inaugural-Dissertation zur Erlangung der Doktorwürde der Naturwissenschaftlich-Mathematischen Gesamtfakultät der Ruprecht-Karls-Universität Heidelberg vorgelegt von Diplom-Biochemiker Stefan Knoth Tag der mündlichen Prüfung: 25.07.2006 Titel der Arbeit: Regulation der Genexpression bei der Erythroiden Differenzierung Gutachter: Prof. Dr. Stefan Wölfl, Universität Heidelberg Prof. Dr. Katharina Pachmann, Universität Jena Prof. Dr. Jürgen Reichling Prof. Dr. Ulrich Hilgenfeldt Zusammenfassung Viele Erkrankungen des blutbildenden Systems, insbesondere Leukämien, haben ihre Ursache in einer Störung der Differenzierungvorgänge, die ausgehend von undifferenzierten Stammzellen des Knochenmarks zu allen Arten von hochspezialisierten Blutzellen führen. Bei der Chronischen Myeloischen Leukämie (CML) im Stadium der Blastenkrise kommt es zu einer unkontrollierten Vermehrung unreifer Blasten. Alle Chronischen Myeloischen Leukämien exprimieren dass Fusionsprotein BCR-ABL welches aus der Translokation t(9;22)(q34;q11) resultiert. BCR-ABL ist eine konstitutiv aktive Proteinkinase und stimuliert die Zellen zu unkontrolliertem Wachstum. Es ist bekannt, dass sich bei transformierten Zellen mit verschiedenen Substanzen wie AraC oder Butyrat die Proliferation unterdrücken und eine weitere Differenzierung induzieren lässt. Daher werden diese Substanzen oder ihre Derivate als Therapeutika eingesetzt bzw. als solche erprobt. Bei CML-Zellen geht man davon aus, dass durch die genannten Chemikalien die Differenzierung in Richtung der erythroiden Reihe stimuliert wird, da verstärkt Hämoglobine synthetisiert werden. Wegen ihrer einfachen Handhabung in Kultur wurden diese Zellsysteme in der Vergangenheit häufig als Modelle zur Untersuchung der erythroiden Differenzierung verwendet. Die therapeutikastimulierte erythroide Differenzierung von CML-Zellen ist also in zweierlei Hinsicht interessant, einerseits aus medizinischer Sicht zur Bewertung der Vorgänge im behandelten Patienten und andererseits hinsichtlich der Eignung dieser Systeme als Modelle zur Erforschung der Erythropoese. -
Thesis Reference
Thesis A kinome-wide RNAi screen to identify genes controlling membrane lipid homeostasis in human cells GEHIN, Charlotte Abstract The control of lipid homeostasis is a fundamental process that allows cells to maintain the unique lipid composition of their membrane compartments and to deal with the energetic fluxes from metabolism. If most of enzymes involved in lipid metabolism are characterized, the question of the genetic control of lipid homeostasis is still outstanding. In order to find genes that control the homeostasis of membrane lipids, I combined a large-scale RNAi screen targeting the human knome with the techniques of targeted lipidomic analysis by mass spectrometry to monitor lipid changes in HeLa cells. Data analysis of the screen allowed the characterization of candidate genes involved in the control of membrane lipid homeostasis. In parallel, in the context of the NCCR Chemical Biology, I developed a robotically-assisted siRNA transfection assay and screened a library of chemicals potentially able to transfect siRNA in Human cells at least as efficiently than commercially available compounds. Reference GEHIN, Charlotte. A kinome-wide RNAi screen to identify genes controlling membrane lipid homeostasis in human cells. Thèse de doctorat : Univ. Genève, 2014, no. Sc. 4670 URN : urn:nbn:ch:unige-380353 DOI : 10.13097/archive-ouverte/unige:38035 Available at: http://archive-ouverte.unige.ch/unige:38035 Disclaimer: layout of this document may differ from the published version. 1 / 1 UNIVERSITÉ DE GENÈVE FACULTÉ DES SCIENCES -
Download Validation Data
PrimePCR™Assay Validation Report Gene Information Gene Name STE20-related kinase adaptor alpha Gene Symbol STRADA Organism Human Gene Summary The protein encoded by this gene contains a STE20-like kinase domain but lacks several residues that are critical for catalytic activity so it is termed a 'pseudokinase'. The protein forms a heterotrimeric complex with serine/threonine kinase 11 (STK11 also known as LKB1) and the scaffolding protein calcium binding protein 39 (CAB39 also known as MO25). The protein activates STK11 leading to the phosphorylation of both proteins and excluding STK11 from the nucleus. The protein is necessary for STK11-induced G1 cell cycle arrest. A mutation in this gene has been shown to result in polyhydramnios megalencephaly and symptomatic epilepsy (PMSE) syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their full-length nature is not known. Gene Aliases FLJ90524, LYK5, NY-BR-96, PMSE, STRAD, Stlk RefSeq Accession No. NC_000017.10, NT_010783.15, NG_015817.1 UniGene ID Hs.514402 Ensembl Gene ID ENSG00000125695 Entrez Gene ID 92335 Assay Information Unique Assay ID qHsaCID0016267 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000336174, ENST00000375840, ENST00000447001, ENST00000392950, ENST00000245865 Amplicon Context Sequence CGCTGCCCATGGCTTATCATGCTGAGGTTGCTGCGCAAACCAGACAGGTAGACC TTCCCATCCACAGAGATCAGGATGTGGCTGGCTTTGACACTCCTGTGTACATATC CCATGTGGTGGATGTAGTCGAGGGCCTTCAGCACCC Amplicon Length (bp) 115 Chromosome Location 17:61784683-61787899 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 103 Page 1/5 PrimePCR™Assay Validation Report R2 0.9994 cDNA Cq 22.26 cDNA Tm (Celsius) 84 gDNA Cq 41.26 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. -
Triphosphate Receptor in Arabidopsis Thaliana A
IDENTIFICATION OF A NOVEL EXTRACELLULAR ADENOSINE 5’-TRIPHOSPHATE RECEPTOR IN ARABIDOPSIS THALIANA A Dissertation Presented to The Faculty of the Graduate School At the University of Missouri – Columbia In Partial Fulfillment Of the Requirements for the Degree Doctor of Philosophy By An Quoc Pham Dr. Gary Stacey, Dissertation Supervisor December, 2019 The undersigned, appointed by the Dean of the Graduate School, have examined the Dissertation entitled: IDENTIFICATION OF A NOVEL EXTRACELLULAR ADENOSINE 5’-TRIPHOSPHATE RECEPTOR IN ARABIDOPSIS THALIANA Presented by An Quoc Pham A candidate for the degree of Doctor of Philosophy And hereby certify that, in their opinion, it is worthy of acceptance. Professor Gary Stacey Professor Walter Gassmann Professor Melissa G. Mitchum Professor Gary A. Weisman ACKNOWLEDGEMENTS I would like to thank my advisor, Prof. Gary Stacey, for giving me an excellent opportunity to work in his lab; thank you for your patience, understanding, encouragement, and guidance in research, career, and life. My sincere thanks to my advisory committee members, Prof. Walter Gassmann, Prof. Melissa G. Mitchum and Prof. Gary A. Weisman for their constructive advice and supportive encouragement. I appreciate Dr. Yangrong Cao and Dr. Kiwamu Tanaka, who guided me in the first two years. Also, I warmly thank Dr. Sung-Hwan Cho, Dr. Deawon Kim and Dr. Dongqin Chen for guiding me to complete my thesis. I want to thank Dr. Cuong T. Nguyen, my lab member, who not only contributed to this study but also supported me a lot in my student life. I am grateful to Prof. Bing Stacey, Dr. Phat Do and Dr. -
Anti-MEKK3 Antibody Catalog # ABO11227
10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Anti-MEKK3 Antibody Catalog # ABO11227 Specification Anti-MEKK3 Antibody - Product Information Application WB Primary Accession Q99759 Host Rabbit Reactivity Human Clonality Polyclonal Format Lyophilized Description Rabbit IgG polyclonal antibody for Mitogen-activated protein kinase kinase kinase 3(MAP3K3) detection. Tested with WB in Human. Reconstitution Add 0.2ml of distilled water will yield a concentration of 500ug/ml. Anti-MEKK3 antibody, ABO11227, Western blottingLane 1: HELA Cell LysateLane 2: A431 Anti-MEKK3 Antibody - Additional Information Cell LysateLane 3: MCF-7 Cell LysateLane 4: JURKAT Cell Lysate Gene ID 4215 Other Names Anti-MEKK3 Antibody - Background Mitogen-activated protein kinase kinase kinase 3, 2.7.11.25, MAPK/ERK kinase MAP3K3(Mitogen-activated protein kinase kinase 3, MEK kinase 3, MEKK 3, MAP3K3, kinase kinase 3), also known as MAP/ERK MAPKKK3, MEKK3 KINASE KINASE 3, MEKK3 or MAPKKK3, is an enzyme that in humans is encoded by the Calculated MW MAP3K3 gene. MAP3K3 is contiguously distal to 70898 MW KDa LYK5 on chromosome 17(Puffenberger et al., 2007). By yeast 2-hybrid analysis of a mouse Application Details T-cell cDNA library, Uhlik et al.(2003) showed Western blot, 0.1-0.5 µg/ml, Human<br> that a C-terminal fragment of mouse Protein Name Osm(CCM2) interacted with Mekk3, which Mitogen-activated protein kinase kinase activates p38 in response to sorbitol-induced kinase 3 hyperosmotic conditions. Mekk3 and Osm colocalized in the cytoplasmic compartment of Contents cotransfected cells, and the Mekk3-Osm Each vial contains 5mg BSA, 0.9mg NaCl, complex was recruited to Rac1 and 0.2mg Na2HPO4, 0.05mg Thimerosal, cytoskeletal actin-containing membrane ruffles 0.05mg NaN3. -
Open Full Page
Published OnlineFirst June 7, 2011; DOI: 10.1158/1541-7786.MCR-10-0200 Molecular Cancer Signaling and Regulation Research A Sensitized RNA Interference Screen Identifies a Novel Role for the PI3K p110g Isoform in Medulloblastoma Cell Proliferation and Chemoresistance Ana S. Guerreiro1, Sarah Fattet2,3, Dorota W. Kulesza1, Abdullah Atamer1, Alexandra N. Elsing1, Tarek Shalaby1, Shaun P. Jackson4, Simone M. Schoenwaelder4, Michael A. Grotzer1, Olivier Delattre2, and Alexandre Arcaro1,5 Abstract Medulloblastoma is the most common malignant brain tumor in children and is associated with a poor outcome. We were interested in gaining further insight into the potential of targeting the human kinome as a novel approach to sensitize medulloblastoma to chemotherapeutic agents. A library of small interfering RNA (siRNA) was used to downregulate the known human protein and lipid kinases in medulloblastoma cell lines. The analysis of cell proliferation, in the presence or absence of a low dose of cisplatin after siRNA transfection, identified new protein and lipid kinases involved in medulloblastoma chemoresistance. PLK1 (polo-like kinase 1) was identified as a kinase involved in proliferation in medulloblastoma cell lines. Moreover, a set of 6 genes comprising ATR, LYK5, MPP2, PIK3CG, PIK4CA, and WNK4 were identified as contributing to both cell proliferation and resistance to cisplatin treatment in medulloblastoma cells. An analysis of the expression of the 6 target genes in primary medulloblastoma tumor samples and cell lines revealed overexpression of LYK5 and PIK3CG. The results of the siRNA screen were validated by target inhibition with specific pharmacological inhibitors. A pharmacological inhibitor of p110g (encoded by PIK3CG) impaired cell proliferation in medulloblastoma cell lines and sensitized the cells to cisplatin treatment. -
Genetic Mapping of Glutaric Aciduria, Type 3, to Chromosome 7 and Identification of Mutations in C7orf10
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector REPORT Genetic Mapping of Glutaric Aciduria, Type 3, to Chromosome 7 and Identification of Mutations in C7orf10 Eric A. Sherman,1 Kevin A. Strauss,2,3,4 Silvia Tortorelli,5 Michael J. Bennett,6 Ina Knerr,7 D. Holmes Morton,2,3,4 and Erik G. Puffenberger2,3,* While screening Old Order Amish children for glutaric aciduria type 1 (GA1) between 1989 and 1993, we found three healthy children who excreted abnormal quantities of glutaric acid but low 3-hydroxyglutaric acid, a pattern consistent with glutaric aciduria type 3 (GA3). None of these children had the GCDH c.1262C/T mutation that causes GA1 among the Amish. Using single-nucleotide polymorphism (SNP) genotypes, we identified a shared homozygous 4.7 Mb region on chromosome 7. This region contained 25 genes including C7orf10,an open reading frame with a putative mitochondrial targeting sequence and coenzyme-A transferase domain. Direct sequencing of C7orf10 revealed that the three Amish individuals were homozygous for a nonsynonymous sequence variant (c.895C/T, Arg299Trp). We then sequenced three non-Amish children with GA3 and discovered two nonsense mutations (c.322C/T, Arg108Ter, and c.424C/T, Arg142Ter) in addition to the Amish mutation. Two pathogenic alleles were identified in each of the six patients. There was no consistent clinical phenotype associated with GA3. In affected individuals, urine molar ratios of glutarate to its derivatives (3-hydroxyglutarate, glutarylcarnitine, and glutarylglycine) were elevated, suggesting impaired formation of glutaryl-CoA. -
Global Patterns of Changes in the Gene Expression Associated with Genesis of Cancer a Dissertation Submitted in Partial Fulfillm
Global Patterns Of Changes In The Gene Expression Associated With Genesis Of Cancer A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy at George Mason University By Ganiraju Manyam Master of Science IIIT-Hyderabad, 2004 Bachelor of Engineering Bharatiar University, 2002 Director: Dr. Ancha Baranova, Associate Professor Department of Molecular & Microbiology Fall Semester 2009 George Mason University Fairfax, VA Copyright: 2009 Ganiraju Manyam All Rights Reserved ii DEDICATION To my parents Pattabhi Ramanna and Veera Venkata Satyavathi who introduced me to the joy of learning. To friends, family and colleagues who have contributed in work, thought, and support to this project. iii ACKNOWLEDGEMENTS I would like to thank my advisor, Dr. Ancha Baranova, whose tolerance, patience, guidance and encouragement helped me throughout the study. This dissertation would not have been possible without her ever ending support. She is very sincere and generous with her knowledge, availability, compassion, wisdom and feedback. I would also like to thank Dr. Vikas Chandhoke for funding my research generously during my doctoral study at George Mason University. Special thanks go to Dr. Patrick Gillevet, Dr. Alessandro Giuliani, Dr. Maria Stepanova who devoted their time to provide me with their valuable contributions and guidance to formulate this project. Thanks to the faculty of Molecular and Micro Biology (MMB) department, Dr. Jim Willett and Dr. Monique Vanhoek in embedding valuable thoughts to this dissertation by being in my dissertation committee. I would also like to thank the present and previous doctoral program directors, Dr. Daniel Cox and Dr. Geraldine Grant, for facilitating, allowing, and encouraging me to work in this project. -
Elucidating a Conserved Myosin XI-Rabe Gtpase Interaction That Is Required for Polarized Cell Growth in Plants
Elucidating a Conserved Myosin XI-RabE GTPase Interaction that is Required for Polarized Cell Growth in Plants A Dissertation Submitted to the Faculty of WORCESTER POLYTECHNIC INSTITUTE in Partial Fulfillment of the Requirement for the Degree of Doctor of Philosophy in Biology and Biotechnology July 31, 2020 by Robert George Orr Approved by: Dr. Luis Vidali Dr. Mary Munson Associate Professor Professor Dept. Biology & Biotechnology Dept. Biochemistry and Molecular Worcester Polytechnic Institute Pharmacology University of Massachusetts Medical School Dr. Elizabeth F. Ryder Dr. Amity L. Manning Associate Professor Assistant Professor Dept. Biology & Biotechnology Dept. Biology & Biotechnology Worcester Polytechnic Institute Worcester Polytechnic Institute Table of Contents Page List of Figures .................................................................................................................. iii Acknowledgements ......................................................................................................... v Preface ............................................................................................................................vi Abstract ........................................................................................................................... 1 Chapter 1 : Polarized Cell Growth in Plants and the Loss-of-Function Tools that Facilitate Our Understanding ........................................................................................... 3 1.1 Introduction ...........................................................................................................