Correlation of Genetic Polymorphism of Vascular Endothelial Growth Factor Gene with Susceptibility to Lung Cancer

Home , Conflict of interest

ORIGINAL ARTICLE Correlation of genetic polymorphism of vascular endothelial growth factor gene with susceptibility to lung cancer

C Liu1, X Zhou2, F Gao1,ZQi1, Z Zhang1 and Y Guo1

The aim of the study is to study the correlation of genetic polymorphism of vascular endothelial growth factor (VEGF) gene with susceptibility to primary lung cancer. A total of 414 patients with primary lung cancer and 338 healthy volunteers were enrolled in this case–control study from September 2008 to October 2011. Gene identification with PCR-RFLP (polymerase chain reaction- based restriction fragment length polymorphism) was used to detect in white blood cells from the subjects the single-nucleotide polymorphisms (SNP) of VEGF gene, including +405G/C, − 460 T/C, − 1154G/A, − 2578C/A sites. Association of genotypes or haplotypes with susceptibility of lung cancer was analyzed with unconditional logistic regression adjusted by gender and age. Smoking was significantly associated with increased risk of lung cancer. Gene phenotypic analysis demonstrated that C allele of +405G/C in VEGF gene was significantly associated increased risk of lung cancer in males (P = 0.0094, odds ratio = 1.634.3), as that with carrying GCTC haplotype (odds ratio = 1.349), whereas carrying GACG had decreased risk for lung cancer (odds ratio = 0.044). No relationship existed between 460 T/C, − 1154G/A, − 2578C/A alleles of VEGF gene and risk of lung cancer. VEGF gene polymorphism may have a role in the development of lung cancer.

Cancer Gene Therapy (2015) 22, 312–316; doi:10.1038/cgt.2015.24; published online 12 June 2015

INTRODUCTION VEGF gene polymorphisms such as 257 8 A/C, 405G/C and 7 Lung cancer is the main cause of cancer death worldwide, and 936C/T. However, little is known about the significance of VEGF smoking is the major risk factor. Usually diagnosed at an advanced gene polymorphisms in the development of lung cancer in a stage, lung cancer is the most common malignancy in China, with Chinese population. The present study was to investigate whether − the highest mortality rate in male malignancies and the second VEGF 460 and +405 SNPs affect risk of lung cancer, and the results highest mortality rate in female malignancies. demonstrated that C allele of +405G/C in VEGF gene was associated Angiogenesis has an important role in tumor progression and with increased risk of lung cancer in males and carrying GCTC metastasis, and vascular endothelial growth factor (VEGF) is a key haplotype was associated with this risk in general population. element in this pathological process. VEGF, located on chromo- some 6p21.3 with eight exons and seven introns, is a regulator of MATERIALS AND METHODS vascular endothelium that promotes vascular growth, which eventually leads to proliferation and metastasis of tumor cells.1 Patients Accumulating data have shown that VEGF affects clinical out- This study was carried out in accordance with the approved guidelines by comes of a wide range of cancers, including but not limiting to the Ethics Committee of the Fourth Hospital of Hebei Medical University and patients have signed an informed consent. From September 2008 esophageal cancer, breast cancer, colon cancer, renal cancer, liver fi 2–4 to October 2011, a total of 260 patients with pathologically con rmed cancer and urinary bladder cancer. lung cancer and 260 healthy individuals were enrolled in this study at Genetic instability such as gene replication, deletion and the Department of Thoracic Surgery, the Fourth Affiliated Hospital of mutation is a hallmark of tumors. Genome-wide association Hebei Medical University (Table 1). None of the patients had received studies suggest that single-nucleotide polymorphism (SNP) affects preoperative radiotherapy or chemotherapy, nor did any of them have pathogenesis of different kinds of human cancers. VEGF poly- vascular proliferative conditions or concomitant cancers. The 260 healthy morphisms may influence VEGF synthesis. And several VEGF volunteers were Han Chinese without any kinship with the patients. fi − Information about age, sex and smoking history was collected from the SNPs have been recently identi ed. Among them, 460 T/C SNP patients with lung cancer and the healthy individuals. (rs833061) is located in the promoter region and +405G/C SNP (rs2010963) is located within the 5′-untranslated region. These two SNPs have been found to be associated with various cancers, PCR − − − including lung cancer.5 The genotype analysis of +405G/C, 460 T/C, 1154G/A, 2578C/A Recently, Renner et al.6 found that mutation of 936C → T polymorphism of VEGF gene was done by polymerase chain reaction- based restriction fragment length polymorphism and primer introduced in VEGF gene can eliminate binding site of the transcription restriction analysis-PCR. To extract blood mononuclear cell DNA, peripheral activator protein-4 (AP-4), which results in three-times lower blood mononuclear cells were isolated from the blood samples of patients level of plasma VEGF and consequent decreased risk of breast and total DNAs were isolated using proteinase K digestion-salting cancer. Recent studies also identified in lung cancer a spectrum of method. The four genetic loci were listed as follows: (1) VEGF-1154G/A:

1Department of Thoracic Surgery, the Fourth Hospital of Hebei Medical University, Shijiazhuang, China and 2Department of Thoracic Surgery, The Third Hospital of Shijiazhuang, Shijiazhuang, China. Correspondence: Dr Y Guo, Department of Thoracic Surgery, The Fourth Hospital of Hebei Medical University, 12 Jiankang Road, Shijiazhuang 050000, China. E-mail: [email protected] Received 27 December 2014; revised 8 April 2015; accepted 14 April 2015; published online 12 June 2015 VEGF polymorphism, susceptibility of lung cancer C Liu et al 313 5′-GAGCCCGGGCCCGAGCCGCGTGTGGA[A/G]GGGCTGAGGCTCGCCTGTCCCC Restriction analysis GCC-3′; (2) VEGF-2578 A/C: 5′-TGCCAGCTGTAGGCCAGACCCTGGCA[A/C]GAT The following probes were used: S1-TA: 5′-GCCCGGGCCCGAGCCGCGTG CTGGGTGGATAATCAGACTGAC-3′; (3) VEGF-406 T/C: 5′-TGAGTGTGTGCGTGT TGGAA-3′; S1-TG: 5′-TTTGCCCGGGCCCGAGCCGCGTGTGGAG-3′; S1-TR: GGGGTTGAGGG[C/T]GTTGGAGCGGGGAGAAGGCCAGGGG-3′;(4)VEGF-405C/ 5′-P-GGGCTGAGGCTCGCCTGTCCCCGCC-FAM-3′; S2-TA: 5′-TTTTCCAGCTGT G: 5′-GCGCG CGGGCGTGCGAGCAGCGAAAG[C/G]GACAGGGGCAAAGTGAGT AGGCCAGACCCTGGCAA-3′; S2-TC: 5′-TTTTTTTCCAGCTGTAGGCCAGACCCT GACCTGC-3′. GGCAC-3′;S2-TR:5′-P-GATCTGGGTGGATAATCAGACTGACTTT-FAM-3′;S3-TC: The primers used were: (1) S1-F: 5′-GGCGGATGGGTAATTTTCAGG-3′; 5′-TTTTTTTTAGTGTGTGCGTGTGGGGTTGAGGGC-3′;S3–TT:5′-TTTTTTTTTTTA S1-R: 5′-TCCCCGCTACCAGCCGACTTT-3′, 236 bp; (2) S2-F: 5′-CCTAGCACCTC GTGTGTGCGTGTGGGGTTGAGGGT-3′;S3-TR:5′-P-GTTGGAGCGGGGAGAAGG CACCAAACCA-3′; S2-R: 5′-CAGGGAACAAAGTTGGGGCTC-3′, 233 bp; (3) CCAGGGGTTTTTT-FAM-3′;S4-TC:5′-TTTTTTTTTTTTGCGCGGGCGTGCGAGCAG S3-F: 5′-TGAATGG AGCGAGCAGCGTCT-3′; S3-R: 5′-CGTGCGGACAGGGCC CGAAAGC-3′;S4-TG:5′-TTTTTTTTTTTTTTTGCGCGGGCGTGCGAGCAGCGAAA TGAGA-3′, 236 bp; (4) S4-F: 5′-TGTGGATTTTGGAAACCAGCAGA-3′; S4- R: GG-3′;S4-TR:5′-P-GACAGGGGCAAAGTGAGTGACCTGCTTTTTTTTT-FAM-3′. 5′-CGGTGTCTGTCTGTCTGTCCG-3′, 234 bp. The ligation reaction was performed in 10-μl volume, containing 3 μlof The PCR was carried out in 15-μl volume, containing 1 μl of DNA PCR product, 1.0 μl of Taq DNA ligase buffer, 5 units of Taq DNA ligase, template, 1.5 μl of the PCR buffer, 1.25 units of Taq DNA polymerase, 25 nM 0.1 pmol of each probe. The ligation reaction was done at 94 °C, 30 s of each primer, 3 mM of deoxynucleotide triphosphate and 2.5 mM of followed by 56 °C, 1 min, 25 cycles. The sizes of the ligation products were: MgCl2. The ampliﬁcation was done with 94 °C, 2 min; 55 °C, 15 s, 72 °C, 25 s, S1: 50/A, 53/G; S2: 57/A, 60/C; S3: 64/C, 67/T; S4: 71/C, 74/G. 72 °C, 3 min, 35 cycles. Sequencing Sequencing of 1 μl of the ligation products was done with ABI 3730XL DNA analyzer. Table 1. Characteristics of patients

Variables Lung cancer Controls P-value Statistical analysis patients n = 414 n = 338 Statistical analysis was done with SPSS 13.0 version. Correlation of VEGF gene polymorphism with risk of lung cancer was analyzed with logistic Age, (year) 59.80 ± 9.115 53.55 ± 15.20 0.100 regression. Haplotype and gene linkage analysis was conducted with Gender (%) 0.000 SHSsis. Po0.05 was considered statistically signiﬁcant. Male 295 (71.26) 184 (54.44) Female 119 (28.74) 154 (45.56) RESULTS Smoking (%) 0.000 − − Yes 229 (55.31) 53 (15.68) First of all, SNP genotypes of+405G / C, 460 T / C, 1154G / A, No 185 (44.69) 285 (84.32) − 2578C/A were consistent with Hardy-Weinberg equilibrium in both healthy control and patient subjects in this study (χ2 = 0.760, Tumor stage (%) P = 0.384, χ2 = 1.554, P = 0.213; χ2 = 0.502, P = 0.479 and χ2 = 1.488, I 111 (26.81) P = 0.223, respectively), which indicated a representative distribu- II 99 (23.91) tion of the subjects in the regional population. III 84 (20.29) As showed in Table 1, no signiﬁcant difference of gender IV 10 (2.42) Missing 110 (26.57) distribution and age ratio existed between lung cancer patients and the healthy individuals (Tables 1, P40.05). As expected, Cell type (%) positive smoking history was higher in the patient group than that Adenocarcinoma 193 (46.62) in healthy volunteers. Also, prevalence of lung cancer is higher in Squamous cell 133 (32.13) males than that in females. carcinoma Genotype analysis results demonstrated that, VEGF − 460T/C, Others 61 (14.73) − 1154G/A, − 2578C/A SNPs did not increase the risk of develop- Missing 27 (6.52) ment of lung cancer (Table 2). However, in patients with lung

Table 2. VEGF genotype frequencies of patients

Variables Total Male Female

Lung cancer Controls P-value Lung cancer Controls P-value Lung cancer Controls P-value patients n = 414 (%) n = 338 (%) patients n = 295 (%) n = 184 (%) patients n = 119 (%) n = 154 (%)

+405G4C 0.0094 0.2374 0.03 CC 80 (19.32) 54 (15.98) 52 (17.63) 27 (14.67) 28 (23.53) 27 (17.53) CG 208 (50.24) 145 (42.90) 151 (51.19) 86 (46.74) 57 (47.90) 59 (38.31) GG 126 (30.43) 139 (41.12) 92 (31.19) 71 (38.59) 34 (28.57) 68 (44.16) –460 T4C 0.5163 0.9881 0.3315 CC 21 (5.07) 23 (6.80) 16 (5.42) 10 (5.43) 5 (4.2) 13 (8.44) CT 164 (39.61) 138 (40.83) 115 (38.98) 73 (39.67) 49 (41.18) 65 (42.21) TT 229 (55.31) 177 (52.37) 164 (55.59) 101 (54.89) 65 (54.62) 76 (49.35) –1154G4A 0.9406 0.6684 0.4927 AA 9 (2.17) 8 (2.37) 8 (2.71) 4 (2.17) 1 (0.84) 4 (2.60) AG 117 (28.26) 92 (27.22) 85 (28.81) 47 (25.54) 32 (26.89) 45 (29.22) GG 288 (69.57) 238 (70.41) 202 (68.47) 133 (72.28 86 (72.27) 105 (68.18) –2578C4A 0.4305 0.9801 0.3059 AA 20 (4.83) 23 (6.80) 15 (5.08) 10 (5.43) 5 (4.2) 13 (8.44) AC 164 (39.61) 138 (40.38) 116 (39.32) 73 (39.67) 48 (40.34) 65 (42.21) CC 230 (55.56) 177 (52.37) 164 (55.59) 101 (54.89) 66 (55.46) 76 (49.35)

© 2015 Nature America, Inc. Cancer Gene Therapy (2015), 312 – 316 VEGF polymorphism, susceptibility of lung cancer C Liu et al 314 cancer, the C allele genotype (G/C and C/C) of VEGF +405G/C SNP, part linkage disequilibrium between the polymorphic loci although not correlating with histopathological type of the tumor, (D′ = 0.56, P = 0.00) (Figure 4). Compared with that of VEGF405G/ was significantly associated with increase of risk of lung cancer in 460 T haplotype, VEGF405G/460C haplotype significantly females, comparing that of G/G genotype (Po0.05, Table 3), with odds ratio = 1.760 (1.102–2.809) and 1.586 (1.105–2.278) respectively, after adjustment against age, sex, smoking status. Further- more, statistical analysis based on stratification of smoking status revealed that carrying the C allele genotype (VEGF +405G/C and C/C) remarkably increased in risk of development of lung cancer in smokers (Table 4). Stratified statistical analysis also showed that, compared with that of G/G genotype, C allele genotype-associated increase in risk of lung cancer was neither histological-type specific nor gender related (Table 3, Figures 1, 2, 3). Restriction fragment length polymorphism analysis also demonstrated that polymorphism of 460 T/C, − 1154G/A, − 2578C/A alleles was not Figure 1. The VEGF-460 T/C SNP genotyping by PCR-Bs1236I digestion. M:100 bp DNA molecular marker; 2,4,8: T/C heterozygous correlated with risk of development of lung cancer regardless of genotype; 3,6: C/C heterozygous genotype; 1,5,7,9,10: T/T hetero- pathological type of the tumor, after adjustment against age, sex, zygous genotype. smoking status (P-value all 40.05). More interesting, our data of haplotype analysis of VEGF − 460 T/C and VEGF 405G/C polymorphism loci demonstrated that

Table 3. Frequency distribution for VEGF genotype and histopathological cell type of lung cancer patients

Variables Cell type P-value

Adenocarcinoma Squamous cell Others n = 193 (%) carcinoma n = 61 (%) Figure 2. The VEGF-2578C/A SNP genotyping by PCR-BglII digestion. n = 133 (%) M: 100 bp DNA molecular marker; 1,7: C/A heterozygous genotype; 2,4,6: C/C heterozygous genotype; 3, 8: A/A heterozygous genotype. +405G4C 0.8175 CC 38 (19.69) 24 (18.05) 14 (22.95) CG 94 (48.70) 66 (49.62) 32 (52.46) GG 61 (31.61) 43 (32.33) 15 (24.59) –460 T4C 0.5519 CC 12 (6.22) 6 (4.51) 2 (3.28) CT 70 (36.27) 59 (44.36) 23 (37.70) TT 111 (57.51) 68 (51.13) 36 (59.02) –1154G4A 0.5084 AA 4 (2.07) 4 (3.01) 1 (1.64) AG 51 (26.42) 42 (31.58) 16 (26.23) GG 138 (71.5) 87 (65.41) 44 (72.13) –2578C4A 0.5949 AA 11 (5.70) 6 (4.51) 2 (3.28) AC 70 (36.27) 59 (44.36) 23 (37.70) Figure 3. The VEGF+405C/G SNP genotyping by PCR-BglII digestion. CC 112 (58.03) 68 (51.13) 36 (59.02) M: 100 bp DNA molecular marker; 1,7: G/C heterozygous genotype; 2,4,6: C/C heterozygous genotype; 3, 8: G/G heterozygous genotype.

Table 4. Risk estimation of VEGF genotype on lung cancer

Variables Crude OR (95%CI) P-valuea Adjusted ORb (95%CI) P-value

+405G4C 0.0096a 0.0163a CC vs GG 1.634 (1.073–2.490) 1.760 (1.102–2.809) CG vs GG 1.582 (1.148–2.182) 1.586 (1.105–2.278) –460 T4C 0.5181 0.6580 CC vs TT 0.706 (0.378–1.316) 0.727 (0.360–1.471) CT vs TT 0.919 (0.681–1.239) 0.934 (0.668–1.304) –1154G4A 0.6689 0.6290 AA vs GG 0.929 (0.353–2.446) 0.588 (0.199–1.34) AG vs GG 1.051 (0.761–1.451 0.975 (0.680–1.399) –2578C4A 0.4331 0.5957 AA vs CC 0.669 (0.356–1.257) 0.700 (0.343–1.426) AC vs CC 0.915 (0.678–1.234) 0.925 (0.662–1.292) Abbreviations: CI, conﬁdence interval; OR, odds ratio. aP-values were derived from the logistic model for type 3 analysis of effects. bAdjusted for age, gender, smoking.

Table 5. Haplotype analysis (n = 742, all those frequencyo0.03 will be ignored in analysis.)

Haplotype Case (freq) Control (freq) OR (95%CI) P-value

AACG 133.89 (0.162) 105.72 (0.156) 1.041 (0.788 ~ 1.375) 0.778 GACG 70.09 (0.085) 78.27 (0.116) 0.706 (0.503 ~ 0.992) 0.044 GCTC 367.98 (0.444) 251.84 (0.373) 1.349 (1.096 ~ 1.661) 0.005 GCTG 252.92 (0.305) 237.89 (0.352) 0.810 (0.652 ~ 1.006) 0.056 Abbreviations: CI, conﬁdence interval; OR, odds ratio.

GC and − 1154 GG genotypes do the opposite. In the 1900-case NSCLC study, –634G4C increases and − 1498 T/ − 634G/936C haplotype reduces the risk of lung cancer in Caucasian males, respectively.27,28 This phenomenon disappears after adjusting for age, gender, smoking status, pack-years of smoking and years since smoking cessation. Yet Heist et al.29 found that carriers of –634C and 936 T alleles had longer 5-year overall survival than non carriers. In contrast, in the present study, we found that VEGF +405G/C SNP, but not the other three SNPs (−460 T/C, − 1154G/A, − 2578C/A) were associated with the increased risk of lung cancer in male Han Chinese individuals, especially in the smokers. Figure 4. The VEGF-1154G/A SNP genotyping by PCR-BglII digestion. And our haplotype analysis demonstrated that part linkage M: 100 bp DNA molecular marker; 2,4,8: G/A heterozygous geno- disequilibrium between the VEGF − 460 T/C and VEGF − 405G/C type; 3,6:G/G heterozygous genotype; 1, 5, 7, 9, 10: A/A hetero- fi zygous genotype. polymorphic loci and VEGF405G/460C haplotype signi cantly increased the risk of lung cancer. Taken together, VEGF SNP is a increased the risk of lung cancer (odds ratio = 1.32, 95% significant genetic factor associated with the development of lung confidence interval = 1.08 ~ 1.96). cancer. Although emerging data indicate that VEGF SNP has an important role in the development, invasion and prognosis of DISCUSSION lung cancer, more questions about this phenomenon are needed Lung cancer is a leading cause of cancer mortality and disease to be answered. What are the SNPs of important clinical value? burden worldwide, with the vast majority of lung cancers present Are there any population/euthenics-specific SNP patterns? as advanced on diagnosis.8 Various risk factors for development of How do the SNPs affect the biological behavior of the tumor? lung cancer have been identified, including exposure to physical What are the mechanisms underlying VEGF SNPs? For example, (radon), chemical (smoking, cooking oil fumes and indoor coal some SNPs of VEGF gene are located in untranslated regions, the burning) and biological (human papillomavirus, Mycobacterium usual targeting regions of microRNA. This raised an interesting tuberculosis) carcinogens.9 Recent studies have shown that genetic question: is SNP part of the RNA interference pathway for instability also contributes to the development of lung cancer hemostasis? More clinical and experimental data need to be (Table 5). For example, positive family history is an independent collected to help us understand better the role of VEGF in the risk for this tumor, and recent studies have identified SNP biology of lung cancer. polymorphisms in individual genes or micro RNAs associated with increased risk for this malignancy.10–16 In the present study, we found that VEGF +405G/C SNP polymorphism is associated with CONFLICT OF INTEREST risk of lung cancer. Consistent with results of previous clinical and The authors declare no conflict of interest. experimental studies, our data also indicated that smoking is a risk factor for lung cancer, with a predilection in males. VEGF is a key mediator of angiogenesis by binding membrane ACKNOWLEDGEMENTS receptors whose intra-cytoplasm tic domain presents tyrosine The study is supported by Hebei Natural Science Funding (Grant # C2009001199). kinase activity.17–19 VEGF and its receptors are frequently over- expressed in human tumors and inhibition of angiogenesis with REFERENCES bevacizumab, a monoclonal antibody that selectively binds to VEGF has shown promising clinical efficacy.20–24 Multiple studies 1 Harris SR, Schoeffner DJ, Yoshiji H, Thorgeirsson UP. Tumor growth enhancing effects of vascular endothelial growth factor are associated with increased nitric have shown that high VEGF expression in tumor or in serum is an oxide synthase activity and inhibition of apoptosis in human breast carcinoma indicator of prognosis of non-small cell lung cancer and response – 25,26 xenografts. Cancer Lett 2002; 179:95 101. to anti-angiogenesis. As such, VEGF SNP has been extensively 2 Watson CJ, Webb NJ, Bottomley MJ, Brenchley PE. Identification of polymor- investigated for its role in predicting cancer susceptibility, phisms within the vascular endothelial growth factor (VEGF) gene: correlation progression and anti-VEGF therapeutic response in subjects with with variation in VEGF protein production. Cytokine 2000; 12: 1232–1235. tumors. Numerous SNPs in the promoter, 5′-, and 3′-untranslated 3 Mohammadi M, Bazrafshani MR, Day PJ, Ollier WE. Vascular endothelial growth regions in VEGF gene have been identified. Interestingly, 634G4C factor production is regulated by gene polymorphisms. Iran J Immunol 2009; 6: SNP in the 5′-untranslated regions and 936C4T SNP in the 119–129. 3′-untranslated regions of VEGF gene affect tumor tissue 4 Awata T, Inoue K, Kurihara S, Ohkubo T, Watanabe M, Inukai K et al. expression of VEGF. A common polymorphism in the 5'-untranslated region of the VEGF gene is associated with diabetic retinopathy in type 2 diabetes. Diabetes 2002; 51: Several threads of evidence give diverse picture of VEGF SNP in 1635–1639. lung cancer. Koukourakis et al. reported in a 36-case study that 5 Bradbury PA, Zhai R, Ma C, Xu W, Hopkins J, Kulke MJ et al. Vascular endothelial − 2578 CC, − 634 GG and − 1154 AA and GA genotypes are growth factor polymorphisms and esophageal cancer prognosis. Clin Cancer Res associated with low VEGF expression, whereas − 2578 CA, − 634 2009; 15: 4680–4685.

© 2015 Nature America, Inc. Cancer Gene Therapy (2015), 312 – 316 VEGF polymorphism, susceptibility of lung cancer C Liu et al 316 6 Renner W, Kotschan S, Hoffmann C, Obermayer-Pietsch B, Pilger. E. A common 19 Park do J, Thomas NJ, Yoon C, Yoon SS. Vascular endothelial growth factor a 936 C/T mutation in the gene for vascular endothelial growth factor is associated inhibition in gastric cancer. Gastric Cancer 2015; 18:33–42. with vascular endothelial growth factor plasma levels. J Vasc Res 2000; 37: 20 Datta-Mitra A, Riar NK, Raychaudhuri SP. Remission of psoriasis and psoriatic 443–448. arthritis during bevacizumab therapy for renal cell cancer. Indian J Dermatol 2014; 7 Maeda A, Nakata M, Yasuda K, Yukawa T, Saisho S, Okita R et al. Influence of 59: 632. vascular endothelial growth factor single nucleotide polymorphisms on non-small 21 Inglis DJ, Lavranos TC, Beaumont DM, Leske AF, Brown CK, Hall AJ et al. The cell lung cancer tumor angiogenesis. Oncol Rep 2013; 29:39–44. vascular disrupting agent BNC105 potentiates the efficacy of VEGF and mTOR 8 Slatore CG, Sullivan DR, Pappas M, Humphrey LL. Patient-centered outcomes inhibitors in renal and breast cancer. Cancer Biol Ther 2014; 15: 1552–1560. among lung cancer screening recipients with computed tomography: a 22 Cao R, Zhang S, Ma D, Hu. L. A multi-center randomized phase II clinical study of systematic review. J Thorac Oncol 2014; 9:927–934. bevacizumab plus irinotecan, 5-fluorouracil, and leucovorin (FOLFIRI) compared 9 Hasegawa Y. [Lung cancer: progress in diagnosis and treatments. Topics: I. Epi- with FOLFIRI alone as second-line treatment for Chinese patients with metastatic demiology and pathogenesis; 2. The etiology of lung cancer]. Nihon Naika Gakkai colorectal cancer. Med Oncol 2015; 32: 325. Zasshi 2014; 103: 1261–1266. 23 Mitry E, Walter T, Baudin E, Kurtz JE, Ruszniewski P, Dominguez-Tinajero S et al. 10 Zhao Y, Wei Q, Hu L, Chen F, Hu Z, Heist RS et al. Polymorphisms in microRNAs are Bevacizumab plus capecitabine in patients with progressive advanced associated with survival in non-small cell lung cancer. Cancer Epidemiol Biomarkers well-differentiated neuroendocrine tumors of the gastro-intestinal (GI-NETs) Prev 2014; 23: 2503–2511. tract (BETTER trial) - A phase II non-randomised trial. Eur J Cancer 2014; 50: 11 Guo Z, Wang H, Li Y, Li B, Li C, Ding. C. A microRNA-related single nucleotide 3107–3115. polymorphism of the gene is associated with survival of small cell lung cancer 24 Li H, Takayama K, Wang S, Shiraishi Y, Gotanda K, Harada T et al. Addition of patients. Biomed Rep 2013; 1:545–548. bevacizumab enhances antitumor activity of erlotinib against non-small cell lung 12 Wang G, Wang W, Gao W, Lv J, Fang J. Two functional polymorphisms in microRNAs cancer xenografts depending on VEGF expression. Cancer Chemother Pharmacol and lung cancer risk: a meta-analysis. Tumour Biol 2014; 35:2693–2699. 2014; 74: 1297–1305. 13 Xu J, Yin Z, Shen H, Gao W, Qian Y, Pei D et al. A genetic polymorphism in pre- 25 Weiss JM, Villaruz LC, Socinski MA, Ivanova A, Grilley-Olson J, Dhruva N et al. miR-27a confers clinical outcome of non-small cell lung cancer in a Chinese A single-arm phase II trial of pazopanib in patients with advanced non-small cell population. PLoS One 2013; 8: e79135. lung cancer with non-squamous histology with disease progression on bev- 14 Ding C, Li C, Wang H, Li B, Guo. Z. A miR-SNP of the XPO5 gene is associated with acizumab containing therapy. Lung Cancer 2014; 86:288–290. advanced non-small-cell lung cancer. Onco Targets Ther 2013; 6:877–881. 26 Danciu OC, Rayani S, Michals EA, Villano JL. Prolonged activity of bevacizumab in 15 Cheng M, Yang L, Yang R, Yang X, Deng J, Yu B et al. A microRNA-135a/b binding adenocarcinoma of the lung with multiple brain metastases. Med Oncol 2012; 29: polymorphism in CD133 confers decreased risk and favorable prognosis of lung 2619–2622. cancer in Chinese by reducing CD133 expression. Carcinogenesis 2013; 34: 27 Koukourakis MI, Papazoglou D, Giatromanolaki A, Bougioukas G, Maltezos E, 2292–2299. Sivridis E. VEGF gene sequence variation defines VEGF gene expression status 16 Chen Z, Xu L, Ye X, Shen S, Li Z, Niu X et al. Polymorphisms of microRNA and angiogenic activity in non-small cell lung cancer. Lung Cancer 2004; 46: sequences or binding sites and lung cancer: a meta-analysis and systematic 293–298. review. PLoS One 2013; 8: e61008. 28 Koukourakis MI, Papazoglou D, Giatromanolaki A, Panagopoulos I, Maltezos E, 17 Iacovelli R, Sternberg CN, Porta C, Verzoni E, Braud FD, Escudier B et al. Inhibition Harris AL et al. C2028T polymorphism in exon 12 and dinucleotide repeat poly- of the VEGF/VEGFR pathway improves survival in advanced kidney cancer. morphism in intron 13 of the HIF-1alpha gene define HIF-1alpha protein A systematic review and meta-analysis. Curr Drug Targets 2014; 16:164–170. expression in non-small cell lung cancer. Lung Cancer 2006; 53: 257–262. 18 Cao Y. VEGF-targeted cancer therapeutics-paradoxical effects in endocrine 29 Heist RS, Zhai R, Liu G, Zhou W, Lin X, Su L et al. VEGF polymorphisms and survival organs. Nat Rev Endocrinol 2014; 10: 530–539. in early-stage non-small-cell lung cancer. J Clin Oncol 2008; 26:856–862.