Cancer Gene Therapy (2015) 22, 312–316 © 2015 Nature America, Inc. All rights reserved 0929-1903/15 www.nature.com/cgt ORIGINAL ARTICLE Correlation of genetic polymorphism of vascular endothelial growth factor gene with susceptibility to lung cancer C Liu1, X Zhou2, F Gao1,ZQi1, Z Zhang1 and Y Guo1 The aim of the study is to study the correlation of genetic polymorphism of vascular endothelial growth factor (VEGF) gene with susceptibility to primary lung cancer. A total of 414 patients with primary lung cancer and 338 healthy volunteers were enrolled in this case–control study from September 2008 to October 2011. Gene identification with PCR-RFLP (polymerase chain reaction- based restriction fragment length polymorphism) was used to detect in white blood cells from the subjects the single-nucleotide polymorphisms (SNP) of VEGF gene, including +405G/C, − 460 T/C, − 1154G/A, − 2578C/A sites. Association of genotypes or haplotypes with susceptibility of lung cancer was analyzed with unconditional logistic regression adjusted by gender and age. Smoking was significantly associated with increased risk of lung cancer. Gene phenotypic analysis demonstrated that C allele of +405G/C in VEGF gene was significantly associated increased risk of lung cancer in males (P = 0.0094, odds ratio = 1.634.3), as that with carrying GCTC haplotype (odds ratio = 1.349), whereas carrying GACG had decreased risk for lung cancer (odds ratio = 0.044). No relationship existed between 460 T/C, − 1154G/A, − 2578C/A alleles of VEGF gene and risk of lung cancer. VEGF gene polymorphism may have a role in the development of lung cancer. Cancer Gene Therapy (2015) 22, 312–316; doi:10.1038/cgt.2015.24; published online 12 June 2015 INTRODUCTION VEGF gene polymorphisms such as 257 8 A/C, 405G/C and 7 Lung cancer is the main cause of cancer death worldwide, and 936C/T. However, little is known about the significance of VEGF smoking is the major risk factor. Usually diagnosed at an advanced gene polymorphisms in the development of lung cancer in a stage, lung cancer is the most common malignancy in China, with Chinese population. The present study was to investigate whether − the highest mortality rate in male malignancies and the second VEGF 460 and +405 SNPs affect risk of lung cancer, and the results highest mortality rate in female malignancies. demonstrated that C allele of +405G/C in VEGF gene was associated Angiogenesis has an important role in tumor progression and with increased risk of lung cancer in males and carrying GCTC metastasis, and vascular endothelial growth factor (VEGF) is a key haplotype was associated with this risk in general population. element in this pathological process. VEGF, located on chromo- some 6p21.3 with eight exons and seven introns, is a regulator of MATERIALS AND METHODS vascular endothelium that promotes vascular growth, which eventually leads to proliferation and metastasis of tumor cells.1 Patients Accumulating data have shown that VEGF affects clinical out- This study was carried out in accordance with the approved guidelines by comes of a wide range of cancers, including but not limiting to the Ethics Committee of the Fourth Hospital of Hebei Medical University and patients have signed an informed consent. From September 2008 esophageal cancer, breast cancer, colon cancer, renal cancer, liver fi 2–4 to October 2011, a total of 260 patients with pathologically con rmed cancer and urinary bladder cancer. lung cancer and 260 healthy individuals were enrolled in this study at Genetic instability such as gene replication, deletion and the Department of Thoracic Surgery, the Fourth Affiliated Hospital of mutation is a hallmark of tumors. Genome-wide association Hebei Medical University (Table 1). None of the patients had received studies suggest that single-nucleotide polymorphism (SNP) affects preoperative radiotherapy or chemotherapy, nor did any of them have pathogenesis of different kinds of human cancers. VEGF poly- vascular proliferative conditions or concomitant cancers. The 260 healthy morphisms may influence VEGF synthesis. And several VEGF volunteers were Han Chinese without any kinship with the patients. fi − Information about age, sex and smoking history was collected from the SNPs have been recently identi ed. Among them, 460 T/C SNP patients with lung cancer and the healthy individuals. (rs833061) is located in the promoter region and +405G/C SNP (rs2010963) is located within the 5′-untranslated region. These two SNPs have been found to be associated with various cancers, PCR − − − including lung cancer.5 The genotype analysis of +405G/C, 460 T/C, 1154G/A, 2578C/A Recently, Renner et al.6 found that mutation of 936C → T polymorphism of VEGF gene was done by polymerase chain reaction- based restriction fragment length polymorphism and primer introduced in VEGF gene can eliminate binding site of the transcription restriction analysis-PCR. To extract blood mononuclear cell DNA, peripheral activator protein-4 (AP-4), which results in three-times lower blood mononuclear cells were isolated from the blood samples of patients level of plasma VEGF and consequent decreased risk of breast and total DNAs were isolated using proteinase K digestion-salting cancer. Recent studies also identified in lung cancer a spectrum of method. The four genetic loci were listed as follows: (1) VEGF-1154G/A: 1Department of Thoracic Surgery, the Fourth Hospital of Hebei Medical University, Shijiazhuang, China and 2Department of Thoracic Surgery, The Third Hospital of Shijiazhuang, Shijiazhuang, China. Correspondence: Dr Y Guo, Department of Thoracic Surgery, The Fourth Hospital of Hebei Medical University, 12 Jiankang Road, Shijiazhuang 050000, China. E-mail: [email protected] Received 27 December 2014; revised 8 April 2015; accepted 14 April 2015; published online 12 June 2015 VEGF polymorphism, susceptibility of lung cancer C Liu et al 313 5′-GAGCCCGGGCCCGAGCCGCGTGTGGA[A/G]GGGCTGAGGCTCGCCTGTCCCC Restriction analysis GCC-3′; (2) VEGF-2578 A/C: 5′-TGCCAGCTGTAGGCCAGACCCTGGCA[A/C]GAT The following probes were used: S1-TA: 5′-GCCCGGGCCCGAGCCGCGTG CTGGGTGGATAATCAGACTGAC-3′; (3) VEGF-406 T/C: 5′-TGAGTGTGTGCGTGT TGGAA-3′; S1-TG: 5′-TTTGCCCGGGCCCGAGCCGCGTGTGGAG-3′; S1-TR: GGGGTTGAGGG[C/T]GTTGGAGCGGGGAGAAGGCCAGGGG-3′;(4)VEGF-405C/ 5′-P-GGGCTGAGGCTCGCCTGTCCCCGCC-FAM-3′; S2-TA: 5′-TTTTCCAGCTGT G: 5′-GCGCG CGGGCGTGCGAGCAGCGAAAG[C/G]GACAGGGGCAAAGTGAGT AGGCCAGACCCTGGCAA-3′; S2-TC: 5′-TTTTTTTCCAGCTGTAGGCCAGACCCT GACCTGC-3′. GGCAC-3′;S2-TR:5′-P-GATCTGGGTGGATAATCAGACTGACTTT-FAM-3′;S3-TC: The primers used were: (1) S1-F: 5′-GGCGGATGGGTAATTTTCAGG-3′; 5′-TTTTTTTTAGTGTGTGCGTGTGGGGTTGAGGGC-3′;S3–TT:5′-TTTTTTTTTTTA S1-R: 5′-TCCCCGCTACCAGCCGACTTT-3′, 236 bp; (2) S2-F: 5′-CCTAGCACCTC GTGTGTGCGTGTGGGGTTGAGGGT-3′;S3-TR:5′-P-GTTGGAGCGGGGAGAAGG CACCAAACCA-3′; S2-R: 5′-CAGGGAACAAAGTTGGGGCTC-3′, 233 bp; (3) CCAGGGGTTTTTT-FAM-3′;S4-TC:5′-TTTTTTTTTTTTGCGCGGGCGTGCGAGCAG S3-F: 5′-TGAATGG AGCGAGCAGCGTCT-3′; S3-R: 5′-CGTGCGGACAGGGCC CGAAAGC-3′;S4-TG:5′-TTTTTTTTTTTTTTTGCGCGGGCGTGCGAGCAGCGAAA TGAGA-3′, 236 bp; (4) S4-F: 5′-TGTGGATTTTGGAAACCAGCAGA-3′; S4- R: GG-3′;S4-TR:5′-P-GACAGGGGCAAAGTGAGTGACCTGCTTTTTTTTT-FAM-3′. 5′-CGGTGTCTGTCTGTCTGTCCG-3′, 234 bp. The ligation reaction was performed in 10-μl volume, containing 3 μlof The PCR was carried out in 15-μl volume, containing 1 μl of DNA PCR product, 1.0 μl of Taq DNA ligase buffer, 5 units of Taq DNA ligase, template, 1.5 μl of the PCR buffer, 1.25 units of Taq DNA polymerase, 25 nM 0.1 pmol of each probe. The ligation reaction was done at 94 °C, 30 s of each primer, 3 mM of deoxynucleotide triphosphate and 2.5 mM of followed by 56 °C, 1 min, 25 cycles. The sizes of the ligation products were: MgCl2. The amplification was done with 94 °C, 2 min; 55 °C, 15 s, 72 °C, 25 s, S1: 50/A, 53/G; S2: 57/A, 60/C; S3: 64/C, 67/T; S4: 71/C, 74/G. 72 °C, 3 min, 35 cycles. Sequencing Sequencing of 1 μl of the ligation products was done with ABI 3730XL DNA analyzer. Table 1. Characteristics of patients Variables Lung cancer Controls P-value Statistical analysis patients n = 414 n = 338 Statistical analysis was done with SPSS 13.0 version. Correlation of VEGF gene polymorphism with risk of lung cancer was analyzed with logistic Age, (year) 59.80 ± 9.115 53.55 ± 15.20 0.100 regression. Haplotype and gene linkage analysis was conducted with Gender (%) 0.000 SHSsis. Po0.05 was considered statistically significant. Male 295 (71.26) 184 (54.44) Female 119 (28.74) 154 (45.56) RESULTS Smoking (%) 0.000 − − Yes 229 (55.31) 53 (15.68) First of all, SNP genotypes of+405G / C, 460 T / C, 1154G / A, No 185 (44.69) 285 (84.32) − 2578C/A were consistent with Hardy-Weinberg equilibrium in both healthy control and patient subjects in this study (χ2 = 0.760, Tumor stage (%) P = 0.384, χ2 = 1.554, P = 0.213; χ2 = 0.502, P = 0.479 and χ2 = 1.488, I 111 (26.81) P = 0.223, respectively), which indicated a representative distribu- II 99 (23.91) tion of the subjects in the regional population. III 84 (20.29) As showed in Table 1, no significant difference of gender IV 10 (2.42) Missing 110 (26.57) distribution and age ratio existed between lung cancer patients and the healthy individuals (Tables 1, P40.05). As expected, Cell type (%) positive smoking history was higher in the patient group than that Adenocarcinoma 193 (46.62) in healthy volunteers. Also, prevalence of lung cancer is higher in Squamous cell 133 (32.13) males than that in females. carcinoma Genotype analysis results demonstrated that, VEGF − 460T/C, Others 61 (14.73) − 1154G/A, − 2578C/A SNPs did not increase