DOCSLIB.ORG

Ifns Directs the Biological Response To

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Ifns Directs the Biological Response To A Conserved IFN-α Receptor Tyrosine Motif Directs the Biological Response to Type I IFNs This information is current as Wenli Zhao, Carolyn Lee, Rebecca Piganis, Courtney of September 23, 2021. Plumlee, Nicole de Weerd, Paul J. Hertzog and Christian Schindler J Immunol 2008; 180:5483-5489; ; doi: 10.4049/jimmunol.180.8.5483 http://www.jimmunol.org/content/180/8/5483 Downloaded from References This article cites 44 articles, 22 of which you can access for free at: http://www.jimmunol.org/content/180/8/5483.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 23, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology A Conserved IFN-␣ Receptor Tyrosine Motif Directs the Biological Response to Type I IFNs1 Wenli Zhao,* Carolyn Lee,* Rebecca Piganis,‡ Courtney Plumlee,* Nicole de Weerd,‡ Paul J. Hertzog,‡ and Christian Schindler2*† Mammalian type I IFNs (IFN-Is) mediate their potent biological activities through an evolutionarily conserved IFN-␣ receptor (IFNAR), consisting of IFNAR1 and IFNAR2. These two chains direct the rapid activation of two founding members of the STAT family of transcription factors, STAT1 and STAT2. To understand how IFN-Is direct the recruitment and activation of STATs, a series of mutant murine IFNAR1 and IFNAR2 receptors were generated and evaluated in IFNAR1 and IFNAR2 knockout cells. These studies reveal that a single conserved IFNAR2 tyrosine, Y510, plays a critical role in directing the IFN-I-dependent activation of STAT1 and STAT2, both in murine fibroblasts and macrophages. A second IFNAR2 tyrosine, Y335, plays a more minor role. Likewise, Y510 > Y335 play a critical role in the induction of genes and antiviral activity traditionally associated with IFN-Is. The Downloaded from Journal of Immunology, 2008, 180: 5483–5489. nterferons, first recognized for their potent antiviral activity tyrosine motifs have been shown to direct the recruitment and 50 years ago, can be divided into three major classes, type I, activation of specific STATs, as well as other signaling mole- I II, and III (1–3). Of these, type I IFNs (IFN-Is3; e.g., IFN-␣ cules (e.g., suppressor of cytokine signaling (SOCS) and phos- and IFN-␤) are most abundant in number, distribution and expres- phatases) (11–16). Although studies on IFN-I response have http://www.jimmunol.org/ sion. Moreover, they are highly conserved among mammals in highlighted tissue specific differences in IFN-I-dependent both structure and function. Characterization of the ability of STAT activation (17), the mechanism by which this is achieved IFN-␣ to induce genes and antiviral response led to the identifi- has not been elucidated. Rather, despite strong conservation of cation of the JAK-STAT signaling cascade (4, 5). Subsequent biological response (5, 18), studies have implicated differing studies determined that four JAKs and seven STATs mediate the tyrosines, as well as nontyrosine motifs, in STAT recruitment biological response for all ϳ50 members of the four-helix bundle and activation (19–25). family of cytokines (5). Once activated, STAT1 and STAT2 form two important tran- The IFN-I receptor (IFN-␣ receptor; IFNAR) consists of two scription factors, ISGF-3 (STAT1ϩSTAT2ϩIRF9) and STAT1 chains, IFNAR1 and IFNAR2, which are associated with Tyk2 homodimers (5). ISGF-3 directs the expression of IFN-I-stim- by guest on September 23, 2021 and JAK1, respectively (3, 5). Gene targeting studies have re- ulated response element (ISRE) driven genes and the IFN-I au- vealed that both receptor chains and JAK1 are critical for bio- tocrine loop, whereas STAT1 homodimers direct the expression logical response (6–8). In contrast to humans however, loss of of GAS (␥-IFN activation site) driven genes, which IFN-␥ also Tyk2 in mice is only associated with modest defects in IFN-I induces through the formation of STAT1 homodimers. IFN-Is response (9, 10). Despite an important role in the elucidation of are also known to promote the activation of other STATs, es- JAK-STAT signaling, insight into how IFNAR directs STAT- pecially STAT3 and STAT4 (26, 27). However, a compelling dependent biological response lags behind that of most other role for STAT3 signaling in IFN-I response has not been elu- cytokine receptors, where conserved phosphorylated receptor cidated and STAT4’s role may be restricted to lymphocytes (data not shown) (26, 28). We set out to test the hypothesis that, as is the case with all *Department of Microbiology and †Department of Medicine, Columbia University, other cytokine receptors (11, 15, 29), evolutionarily conserved New York, NY 10032; and ‡Center for Monash Institute for Medical Research, Monash University, Clayton, Australia tyrosine motifs direct the IFN-I-dependent activation of STATs and the ensuing biological response. To this end, five of seven Received for publication December 4, 2007. Accepted for publication February 7, 2008. conserved and one of three nonconserved IFNAR tyrosines Ϫ Ϫ Ϫ Ϫ The costs of publication of this article were defrayed in part by the payment of page were mutated and evaluated in IFNAR1[ / ] and IFNAR2[ / ] charges. This article must therefore be hereby marked advertisement in accordance murine embryonic fibroblasts (MEFs), respectively. Only two with 18 U.S.C. Section 1734 solely to indicate this fact. IFNAR2 tyrosines were required for IFN-I response in fibro- 1 This work was supported by National Institutes of Health Grants AI 058211 (to blasts and macrophages, Y510 and Y335, with Y510 exhibiting a W.Z., C.L., and C.S.) and 5T32 AI07525 (to C.P.), the National Multiple Sclerosis 335 Society (Award RG 3237), and the Immunology Training Program (5T32 GM 07367 considerably more significant role than Y . This included to C.P.). IFN-I-dependent activation of STAT1, STAT2, and STAT3, as 2 Address correspondence and reprint requests to Dr. Christian Schindler, Columbia well as the expression of target genes and antiviral activity. University, Hammer Health Science Center 1212, 701 West 168th Street, New York, Consistent with an important role in the recruitment and acti- NY 10032. E-mail address: [email protected] vation of STATs, a phosphorylated Y510 peptide effectively 3 Abbreviations used in this paper: IFN-I, type I IFN; IFNAR, IFN-␣ receptor; SOCS, suppressor of cytokine signaling; ISRE, IFN-I-stimulated response element; GAS, competed for binding to STAT1, and likely STAT2. These stud- 510 ␥-IFN activation site; MEF, murine embryonic fibroblast; BMM, bone marrow mac- ies not only establish an important role for Y in murine IFN-I rophages; VSV, vesicular stomatitis virus; pMIG, MSCV-IRES-GFP; Q-PCR, response, but also raise the intriguing question as to what role quantitative-PCR. the remaining conserved tyrosine motifs may play in IFN-I Copyright © 2008 by The American Association of Immunologists, Inc. 0022-1767/08/$2.00 biology. www.jimmunol.org 5484 IFNAR CHARACTERIZATION Table I. Sequence of oligonucleotides and peptides Cloning R1 Forward 5ЈAGATCTAGCAGGAGGAGAATGTGAGCCG3Ј Reverse 5ЈTTACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCGCATAGAAGTGCTGGCTCTGTCC3Ј R1⌬471 Forward 5ЈCAAATGTCCAGACTACGCACTGTGTC3Ј Reverse 5ЈTTACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCACGCGTAATACTGCGGGGAGGCTTGAGT3Ј R1⌬511 Forward 5ЈAGATCTAGCAGGAGGAGAATGTGAGCCG3Ј Reverse 5ЈTTACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCACGCGTAGGCGCGTGCTTTACTTCTAC3Ј R2 Forward 5ЈGCAGATCTCCACCATGCGTTCACGATGCACCGTC3Ј Reverse 5ЈTTACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCTCTCATGATGTAGCCGTCCC3Ј R2⌬334 Forward 5ЈGCAGATCTCCACCATGCGTTCACGATGCACCGTC3Ј Reverse 5ЈTTACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCGCCCGTGACACTTGCTGTGG3Ј R2⌬372 Forward 5ЈGCAGATCTCCACCATGCGTTCACGATGCACCGTC3Ј Reverse 5ЈTTACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCACGCGTAGCTTCATCAGATTCCTCAGC3Ј R2⌬503 Forward 5ЈGCAGATCTCCACCATGCGTTCACGATGCACCGTC3Ј Reverse 5ЈTTACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCACGCGTATCGGAATCTGAGGTGTCTGA3Ј Mutagenesis R1Y455F Forward 5ЈGGAGCGTCTGGAAATTCCTGTGTCATGTGTGCTTC3Ј Reverse 5ЈGAAGCACACATGACACAGGAATTTCCAGACGCTCC3Ј R1Y518F Forward 5ЈGACCTCAGGAAGTTCAGCTCACAGACC3Ј Reverse 5ЈGGTCTGTGAGCTGAACTTCCTGAGGTC3Ј R1Y529F Forward 5ЈGACTCGGGCAACTTTTCCAACGAAGAG3Ј Reverse 5ЈCTCTTCGTTGGAAAAGTTGCCCGAGTC3Ј Downloaded from R2Y268F Forward 5ЈCGTAATGCTGAAACGGATTGGCTTCATATGCCTAAAAGACAATTTGCCC3Ј Reverse 5ЈGGGCAAATTGTCTTTTAGGCATATGAAGCCAATCCGTTTCAGCATTACG3Ј R2Y335F Forward 5ЈCACAGCAAGTGTCACTGGCTTCACCATGCATGAACTGAC3Ј Reverse 5ЈGTCAGTTCATGCATGGTGAAGCCAGTGACACTTGCTGTG3Ј R2Y510F Forward 5ЈGATGTGGGGGACGGCTTCATCATGAGAGGTAAG3Ј Reverse 5ЈCTTACCTCTCATGATGAAGCCGTCCCCCACATC3Ј Q-PCR ␤ 5ЈGCT CCT CCT GAG CGC AAG T3Ј -actin Forward http://www.jimmunol.org/ Reverse 5ЈTCG TCA TAC TCC TGC TTG CTG AT3Ј OAS-1 Forward 5ЈCTG CCA GCC TTT GAT GTC CT3Ј Reverse 5ЈTGA AGC AGG TAG AGA ACT CGC C3Ј MxA-1 Forward
Load more

Recommended publications
  • Type I Interferons and the Development of Impaired Vascular Function and Repair in Human and Murine Lupus
    Type I Interferons and the Development of Impaired Vascular Function and Repair in Human and Murine Lupus by Seth G Thacker A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Immunology) in The University of Michigan 2011 Doctoral Committee: Associate Professor Mariana J. Kaplan, Chair Professor David A. Fox Professor Alisa E. Koch Professor Matthias Kretzler Professor Nicholas W. Lukacs Associate Professor Daniel T. Eitzman © Seth G Thacker 2011 Sharon, this work is dedicated to you. This achievement is as much yours as it is mine. Your support through all six years of this Ph.D. process has been incredible. You put up with my countless miscalculations on when I would finish experiments, and still managed to make me and our kids feel loved and special. Without you this would have no meaning. Sharon, you are the safe harbor in my life. ii Acknowledgments I have been exceptionally fortunate in my time here at the University of Michigan. I have been able to interact with so many supportive people over the years. I would like to express my thanks and admiration for my mentor. Mariana has taught me so much about writing, experimental design and being a successful scientist in general. I could never have made it here without her help. I would also like to thank Mike Denny. He had a hand in the beginning of all of my projects in one way or another, and was always quick and eager to help in whatever way he could. He really made my first year in the lab successful.
    [Show full text]
  • IFN-Ε Protects Primary Macrophages Against HIV Infection
    RESEARCH ARTICLE IFN-ε protects primary macrophages against HIV infection Carley Tasker,1 Selvakumar Subbian,2 Pan Gao,3 Jennifer Couret,1 Carly Levine,2 Saleena Ghanny,1 Patricia Soteropoulos,1 Xilin Zhao,1,2 Nathaniel Landau,4 Wuyuan Lu,3 and Theresa L. Chang1,2 1Department of Microbiology, Biochemistry and Molecular Genetics and 2Public Health Research Institute, Rutgers University, New Jersey Medical School, Newark, New Jersey, USA.3Institute of Human Virology, University of Maryland School of Medicine, Baltimore, Maryland, USA.4Department of Microbiology, New York University School of Medicine, New York, New York, USA. IFN-ε is a unique type I IFN that is not induced by pattern recognition response elements. IFN-ε is constitutively expressed in mucosal tissues, including the female genital mucosa. Although the direct antiviral activity of IFN-ε was thought to be weak compared with IFN-α, IFN-ε controls Chlamydia muridarum and herpes simplex virus 2 in mice, possibly through modulation of immune response. We show here that IFN-ε induces an antiviral state in human macrophages that blocks HIV-1 replication. IFN-ε had little or no protective effect in activated CD4+ T cells or transformed cell lines unless activated CD4+ T cells were infected with replication-competent HIV-1 at a low MOI. The block to HIV infection of macrophages was maximal after 24 hours of treatment and was reversible. IFN-ε acted on early stages of the HIV life cycle, including viral entry, reverse transcription, and nuclear import. The protection did not appear to operate through known type I IFN-induced HIV host restriction factors, such as APOBEC3A and SAMHD1.
    [Show full text]
  • Type I Interferons in Anticancer Immunity
    REVIEWS Type I interferons in anticancer immunity Laurence Zitvogel1–4*, Lorenzo Galluzzi1,5–8*, Oliver Kepp5–9, Mark J. Smyth10,11 and Guido Kroemer5–9,12 Abstract | Type I interferons (IFNs) are known for their key role in antiviral immune responses. In this Review, we discuss accumulating evidence indicating that type I IFNs produced by malignant cells or tumour-infiltrating dendritic cells also control the autocrine or paracrine circuits that underlie cancer immunosurveillance. Many conventional chemotherapeutics, targeted anticancer agents, immunological adjuvants and oncolytic 1Gustave Roussy Cancer Campus, F-94800 Villejuif, viruses are only fully efficient in the presence of intact type I IFN signalling. Moreover, the France. intratumoural expression levels of type I IFNs or of IFN-stimulated genes correlate with 2INSERM, U1015, F-94800 Villejuif, France. favourable disease outcome in several cohorts of patients with cancer. Finally, new 3Université Paris Sud/Paris XI, anticancer immunotherapies are being developed that are based on recombinant type I IFNs, Faculté de Médecine, F-94270 Le Kremlin Bicêtre, France. type I IFN-encoding vectors and type I IFN-expressing cells. 4Center of Clinical Investigations in Biotherapies of Cancer (CICBT) 507, F-94800 Villejuif, France. Type I interferons (IFNs) were first discovered more than Type I IFNs in cancer immunosurveillance 5Equipe 11 labellisée par la half a century ago as the factors underlying viral inter­ Type I IFNs are known to mediate antineoplastic effects Ligue Nationale contre le ference — that is, the ability of a primary viral infection against several malignancies, which is a clinically rel­ Cancer, Centre de Recherche 1 des Cordeliers, F-75006 Paris, to render cells resistant to a second distinct virus .
    [Show full text]
  • Type I Interferon Suppresses Tumor Growth Through Activating the STAT3-Granzyme B Pathway in Tumor-Infiltrating Cytotoxic T Lymphocytes Chunwan Lu1,2,3*, John D
    Lu et al. Journal for ImmunoTherapy of Cancer (2019) 7:157 https://doi.org/10.1186/s40425-019-0635-8 RESEARCHARTICLE Open Access Type I interferon suppresses tumor growth through activating the STAT3-granzyme B pathway in tumor-infiltrating cytotoxic T lymphocytes Chunwan Lu1,2,3*, John D. Klement1,2,3, Mohammed L. Ibrahim1,2,3, Wei Xiao1,2, Priscilla S. Redd1,2,3, Asha Nayak-Kapoor2, Gang Zhou2 and Kebin Liu1,2,3* Abstract Background: Type I interferons (IFN-I) have recently emerged as key regulators of tumor response to chemotherapy and immunotherapy. However, IFN-I function in cytotoxic T lymphocytes (CTLs) in the tumor microenvironment is largely unknown. Methods: Tumor tissues and CTLs of human colorectal cancer patients were analyzed for interferon (alpha and beta) receptor 1 (IFNAR1) expression. IFNAR1 knock out (IFNAR-KO), mixed wild type (WT) and IFNAR1-KO bone marrow chimera mice, and mice with IFNAR1 deficiency only in T cells (IFNAR1-TKO) were used to determine IFN-I function in T cells in tumor suppression. IFN-I target genes in tumor-infiltrating and antigen-specific CTLs were identified and functionally analyzed. Results: IFNAR1 expression level is significantly lower in human colorectal carcinoma tissue than in normal colon tissue. IFNAR1 protein is also significantly lower on CTLs from colorectal cancer patients than those from healthy donors. Although IFNAR1-KO mice exhibited increased susceptibility to methylcholanthrene-induced sarcoma, IFNAR1-sufficient tumors also grow significantly faster in IFNAR1-KO mice and in mice with IFNAR1 deficiency only in T cells (IFNAR1-TKO), suggesting that IFN-I functions in T cells to enhance host cancer immunosurveillance.
    [Show full text]
  • Detecting the Stable Point of Therapeutic Effect of Chronic Myeloid
    Xu et al. BMC Bioinformatics 2019, 20(Suppl 7):202 https://doi.org/10.1186/s12859-019-2738-0 RESEARCH Open Access Detecting the stable point of therapeutic effect of chronic myeloid leukemia based on dynamic network biomarkers Junhua Xu1,MinWu1, Shanshan Zhu1,JinzhiLei2 and Jie Gao1* From The 12th International Conference on Computational Systems Biology (ISB 2018) Guiyang, China. 18-21 August 2018 Abstract Background: Most researches of chronic myeloid leukemia (CML) are currently focused on the treatment methods, while there are relatively few researches on the progress of patients’ condition after drug treatment. Traditional biomarkers of disease can only distinguish normal state from disease state, and cannot recognize the pre-stable state after drug treatment. Results: A therapeutic effect recognition strategy based on dynamic network biomarkers (DNB) is provided for CML patients’ gene expression data. With the DNB criteria, the DNB with 250 genes is selected and the therapeutic effect index (TEI) is constructed for the detection of individual disease. The pre-stable state before the disease condition becomes stable is 1 month. Through functional analysis for the DNB, some genes are confirmed as key genes to affect the progress of CML patients’ condition. Conclusions: The results provide a certain theoretical direction and theoretical basis for medical personnel in the treatment of CML patients, and find new therapeutic targets in the future. The biomarkers of CML can help patients to be treated promptly and minimize drug resistance, treatment failure and relapse, which reduce the mortality of CML significantly. Keywords: Chronic myeloid leukemia (CML), Dynamic network biomarkers (DNB), Differentially expressed genes (DEGs), Therapeutic effect index (TEI), Pre-stable state, Treatment time Introduction At present, the use of ABL kinase inhibitors (e.g.
    [Show full text]
  • Chemotherapy Followed by Anti-CD137 Mab Immunotherapy Improves Disease Control in a Mouse Myeloma Model
    Chemotherapy followed by anti-CD137 mAb immunotherapy improves disease control in a mouse myeloma model Camille Guillerey, … , Ludovic Martinet, Mark J. Smyth JCI Insight. 2019;4(14):e125932. https://doi.org/10.1172/jci.insight.125932. Research Article Immunology Immunotherapy holds promise for patients with multiple myeloma (MM), but little is known about how MM-induced immunosuppression influences response to therapy. Here, we investigated the impact of disease progression on immunotherapy efficacy in the Vk*MYC mouse model. Treatment with agonistic anti-CD137 (4-1BB) mAbs efficiently protected mice when administered early but failed to contain MM growth when delayed more than 3 weeks after Vk*MYC tumor cell challenge. The quality of the CD8+ T cell response to CD137 stimulation was not altered by the presence of MM, but CD8+ T cell numbers were profoundly reduced at the time of treatment. Our data suggest that an insufficient ratio of CD8+ T cells to MM cells (CD8/MM ratio) accounts for the loss of anti-CD137 mAb efficacy. We established serum M- protein levels prior to therapy as a predictive factor of response. Moreover, we developed an in silico model to capture the dynamic interactions between CD8+ T cells and MM cells. Finally, we explored two methods to improve the CD8/MM ratio: anti-CD137 mAb immunotherapy combined with Treg depletion or administered after chemotherapy treatment with cyclophosphamide or melphalan efficiently reduced MM burden and prolonged survival. Together, our data indicate that consolidation treatment with anti-CD137 mAbs might prevent MM relapse. Find the latest version: https://jci.me/125932/pdf RESEARCH ARTICLE Chemotherapy followed by anti-CD137 mAb immunotherapy improves disease control in a mouse myeloma model Camille Guillerey,1,2,3 Kyohei Nakamura,1 Andrea C.
    [Show full text]
  • Mechanisms of Type-I Ifn Inhibition: Equine Herpesvirus-1 Escape from the Antiviral Effect of Type-1 Interferon Response in Host Cell
    University of Kentucky UKnowledge Theses and Dissertations--Veterinary Science Veterinary Science 2019 MECHANISMS OF TYPE-I IFN INHIBITION: EQUINE HERPESVIRUS-1 ESCAPE FROM THE ANTIVIRAL EFFECT OF TYPE-1 INTERFERON RESPONSE IN HOST CELL Fatai S. Oladunni University of Kentucky, [email protected] Author ORCID Identifier: https://orcid.org/0000-0001-5050-0183 Digital Object Identifier: https://doi.org/10.13023/etd.2019.374 Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Oladunni, Fatai S., "MECHANISMS OF TYPE-I IFN INHIBITION: EQUINE HERPESVIRUS-1 ESCAPE FROM THE ANTIVIRAL EFFECT OF TYPE-1 INTERFERON RESPONSE IN HOST CELL" (2019). Theses and Dissertations--Veterinary Science. 43. https://uknowledge.uky.edu/gluck_etds/43 This Doctoral Dissertation is brought to you for free and open access by the Veterinary Science at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Veterinary Science by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known.
    [Show full text]
  • Open Chen-Thesis Finalv5.Pdf
    The Pennsylvania State University The Graduate School Department of Neural and Behavioral Sciences EPIGENETIC ANALYSIS OF IMMUNE ASSOCIATED SIGNALING MOLECULES DURING MOUSE RETINA DEVELOPMENT A Thesis in Anatomy by Chen Yang © 2013 Chen Yang Submitted in Partial Fulfillment of the Requirements for the Degree of Master of Science May 2013 The thesis of Chen Yang was reviewed and approved* by the following: Samuel Shao-Min Zhang Assistant Professor of Neural and Behavioral Sciences Thesis Advisor Colin J. Barnstable Department Head of Neural and Behavioral Sciences Professor of Neural and Behavioral Sciences Patricia J. McLaughlin Professor of Neural and Behavioral Sciences Director of Graduate Program in Anatomy *Signatures are on file in the Graduate School. ii ABSTRACT The retina is an immune-privileged organ. Many autoimmune diseases, such as AMD, glaucoma, and diabetic retinopathy, are caused by excessive inflammatory responses targeting self-tissue. The physiological functions of extracellular and intracellular signaling molecules of immune responses have been well characterized. The epigenetic aspects of these molecules in the retina, however, have not been well elucidated. In this study, we examined the expression of selected immune-related genes, and their transcriptional accessibility via epigenetic mapping, cluster analysis, and RT-PCR. Among these genes, interleukin receptor related genes and intracellular signaling molecules exhibit higher transcriptional accessibility. Epigenetic mapping of the toll-like receptor (TLR) family revealed that 3 out of 13 TLRs exhibit H3K4me2 accumulation during retina development, suggesting that TLR2, TLR3, and TLR9 are the only TLR members expressed in the retina. Most of the NF-κB signaling molecules exhibited transcriptional accessibility, implying their essential roles in inflammatory regulation during retina maturation.
    [Show full text]
  • Interferon-Alpha-Based Immunotherapies in the Treatment Of
    Zhang et al. Exp Hematol Oncol (2017) 6:20 DOI 10.1186/s40164-017-0081-6 Experimental Hematology & Oncology REVIEW Open Access Interferon‑alpha‑based immunotherapies in the treatment of B cell‑derived hematologic neoplasms in today’s treat‑to‑target era Li Zhang1,2, Yu‑Tzu Tai1*, Matthew Zhi Guang Ho1,3,4, Lugui Qiu5 and Kenneth C. Anderson1* Abstract B cell lymphoma and multiple myeloma (MM) are the most common hematological malignancies which beneft from therapeutic monoclonal antibodies (mAbs)-based immunotherapies. Despite signifcant improvement on patient outcome following the use of novel therapies for the past decades, curative treatment is unavailable for the major‑ ity of patients. For example, the 5-year survival of MM is currently less than 50%. In the 1980s, interferon-α was used as monotherapy in newly diagnosed or previously treated MM with an overall response rate of 15–20%. Noticeably, a small subset of patients who responded to long-term interferon-α further achieved sustained complete remission. Since 1990, interferon-α-containing regimens have been used as a central maintenance strategy for patients with MM. However, the systemic administration of interferon-α was ultimately limited by its pronounced toxicity. To address this, the selective mAb-mediated delivery of interferon-α has been developed to enhance specifc killing of MM and B-cell malignant cells. As such, targeted interferon-α therapy may improve therapeutic window and sustain responses, while further overcoming suppressive microenvironment. This review aims to reinforce the role of interferon-α by consolidating our current understanding of targeting interferon-α with tumor-specifc mAbs for B cell lymphoma and myeloma.
    [Show full text]
  • Wright1260921490.Pdf (1.84
    A POTENTIAL STRATEGY TO MAINTAIN HSV-1 IN A LATENT STATE: USE OF IMMUNOREGULATORY PEPTIDE MIMETICS A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science By NASRIN MAJIDI 2009 Wright State University WRIGHT STATE UNIVERSITY SCHOOL OF GRADUATE STUDIES December 7, 2009 I HEREBY RECOMMEND THAT THE THESIS PREPARED UNDER MY SUPERVISION BY Nasrin Majidi ENTITLED. A potential strategy to maintain HSV-1 in a latent state: use of immunoregulatory peptide mimetics. BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIRMENTS FOR THE DEGREE OF Master of Science. ___________________________ Nancy J. Bigley, Ph.D. Thesis Director ___________________________ Barbara E. Hull, Ph.D. Program Director Committee on Final Examination _______________________ Nancy J. Bigley, Ph.D. _______________________ Barbara E. Hull, Ph.D. _______________________ Cheryl L. Conley, Ph.D. _______________________ Dean Joseph F. Thomas, Jr., Ph.D. Dean, School of Graduate Studies ABSTRACT Majidi, Nasrin. M.S., Department of Biological Sciences, Microbiology and Immunology Program, Wright State University, 2009. A potential strategy to maintain HSV-1 in a latent state: use of immunoregulatory peptide mimetics. This study reviews the role of interferon-gamma (IFN-γ) in HSV-1 latency. CD8+ T cells inhibit the reactivation of HSV-1 in trigeminal ganglia (TG) by production of IFN-γ. Although CD8+ T cells include all the cytotoxic apparatus for cytotoxicity, latently infected neuronal cells are not killed by CD8+ T cells. The CD94-NKG2a molecule on CD8+ T cells, binds to Qa-1b (a MHC class I like molecule) present on neuronal cell to inhibit CD8+ T cells cytotoxicity.
    [Show full text]
  • Progression of Type 1 Diabetes from the Prediabetic Stage Is Controlled by Interferon-Α Signaling
    Progression of type 1 diabetes from the prediabetic stage is controlled by interferon-α signaling Brett S. Marroa, Brian C. Warea, Jaroslav Zaka,b, Juan Carlos de la Torrea, Hugh Rosenc, and Michael B. A. Oldstonea,1 aDepartment of Immunology & Microbial Science, The Scripps Research Institute, La Jolla, CA 92037; bNuffield Department of Clinical Medicine, University of Oxford, Oxford OX3 7DQ, United Kingdom; and cDepartment of Chemical Physiology, The Scripps Research Institute, La Jolla, CA 92037 Contributed by Michael B. A. Oldstone, February 28, 2017 (sent for review January 18, 2017; reviewed by Rafi Ahmed, Betty Diamond, Abner Louis Notkins, and Bellur S. Prabhakar) Blockade of IFN-α but not IFN-β signaling using either an antibody model was accomplished by placing the glycoprotein (GP) of or a selective S1PR1 agonist, CYM-5442, prevented type 1 diabetes lymphocytic choriomeningitis virus (LCMV) under the tran- (T1D) in the mouse Rip-LCMV T1D model. First, treatment with scriptional control of the rat insulin promoter (RIP) in C57BL/6 antibody or CYM-5442 limited the migration of autoimmune “anti- mice (13). In this model (Rip-LCMV), β cells express the self” T cells to the external boundaries around the islets and pre- known MHC-I restricted CD8 CTL GP immunodominant vented their entry into the islets so they could not be positioned to epitopes for the LCMV GP (amino acids 33–41 and 276–286, engage, kill, and thus remove insulin-producing β cells. Second, respectively) and the MHC-II restricted CD4 T-cell epitope CYM-5442 induced an exhaustion signature in antiself T cells by GP61–80.
    [Show full text]
  • Anti–Erbb-2 Mab Therapy Requires Type I and II Interferons and Synergizes with Anti–PD-1 Or Anti-CD137 Mab Therapy
    Anti–ErbB-2 mAb therapy requires type I and II interferons and synergizes with anti–PD-1 or anti-CD137 mAb therapy John Stagga,1, Sherene Loib, Upulie Divisekeraa, Shin Foong Ngiowa,c, Helene Dureta, Hideo Yagitad, Michele W. Tenga,c, and Mark J. Smytha,c,2 aCancer Immunology Program, Sir Donald and Lady Trescowthick Laboratories, Peter MacCallum Cancer Centre, East Melbourne, VIC 3002, Australia; bBreast Cancer Translational Research Laboratory, Jules Bordet Institute, Brussels B-1000, Belgium; cDepartment of Pathology, University of Melbourne, Parkville, VIC 3010, Australia; and dDepartment of Immunology, Juntendo University School of Medicine, Tokyo 113-8421, Japan Edited* by James P. Allison, Memorial Sloan-Kettering Cancer Center, New York, NY, and approved March 18, 2011 (received for review November 9, 2010) Trastuzumab, a monoclonal antibody targeting human epidermal show greater activity (9). It is further supported by the fact that growth factor receptor-2 (HER2/ErbB-2), has become the mainstay FcR-deficient mice fail to respond to anti–ErbB-2 mAb therapy of treatment for HER2-positive breast cancer. Nevertheless, its (10). In addition, human breast cancer biopsy samples have exact mechanism of action has not been fully elucidated. Although revealed an increase in tumor infiltrating FcR+ cells, mainly several studies suggest that Fc receptor-expressing immune cells NK cells, after trastuzumab treatment (6, 7). Finally, for some are involved in trastuzumab therapy, the relative contribution of patients, specific Fcr genotypes are associated with improved lymphocyte-mediated cellular cytotoxicity and antitumor cytokines progression-free survival in response to trastuzumab (5). Taken – remains unknown. We report here that anti ErbB-2 mAb therapy is together, these studies strongly suggest that FcR+ innate immune dependent on the release of type I and type II IFNs but is indepen- cells are instrumental to trastuzumab’s activity.
    [Show full text]