Effets De La Géomorphologie Des Rivières En Tresses Sur Les

Home , Asellidae

Effets de la géomorphologie des rivières en tresses sur les communautés d’invertébrés aquatiques et sur la structuration génétique des populations du crustacé isopode souterrain Proasellus walteri Cécile Capderrey

To cite this version:

Cécile Capderrey. Effets de la géomorphologie des rivières en tresses sur les communautés d’invertébrés aquatiques et sur la structuration génétique des populations du crustacé isopode souterrain Proasellus walteri. Ecologie, Environnement. Université Claude Bernard - Lyon I, 2013. Français. NNT : 2013LYO10124. tel-01869733

HAL Id: tel-01869733 https://tel.archives-ouvertes.fr/tel-01869733 Submitted on 6 Sep 2018

HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés.

N° d’ordre : 124-2013 Année 2013

THESE DE L‘UNIVERSITE DE LYON présentée devant

l’UNIVERSITE CLAUDE BERNARD LYON 1

pour l’obtention

du DIPLOME DE DOCTORAT (arrêté du 7 août 2006)

et soutenue publiquement le 11 juillet 2013 par

Cécile CAPDERREY

Sylvain DOLEDEC Président du Jury Jean-Nicolas BEISEL Rapporteur François POMPANON Rapporteur

Hervé PIEGAY Examinateur Loïc BOLLACHE Examinateur Christophe DOUADY Directeur de thèse

Florian MALARD Co-directeur de thèse Bernard KAUFMANN Encadrant

Résumé

Les rivières en tresses sont des grandes rivières alluviales de piémont montagneux à forte dynamique spatio-temporelle et à géomorphologie particulière. Leur cours traverse alternativement de vastes plaines et des rétrécissements de vallées ou canyons. Cette géomorphologie influence fortement les échanges d’eau entre la rivière avec sa nappe souterraine et sur l’épaisseur sédimentaire. Les échanges d’eau entre la rivière et sa nappe se produisent à différentes échelles allant de la vallée jusqu’à des bancs de graviers et peuvent créer des filtres biotiques et abiotiques qui influencent les communautés d’invertébrés. Les canyons créent des zones de moindre épaisseur sédimentaire voire d’absence de sédiments et peuvent représenter de fortes barrières à la dispersion pour des organismes inféodés au milieu sédimentaire souterrain. Ce travail de thèse a cherché à évaluer dans quelle mesure la géomorphologie pouvait donc structurer les communautés d’invertébrés de surface et souterraines et pouvait jouer sur la dispersion d’un organisme souterrain Proasellus walteri. Les différents résultats obtenus ont permis de montrer que la géomorphologie structurait les communautés d’invertébrés en mettant en évidence une forte réponse des communautés souterraines mais pas de surface et créait des zones de forte biodiversité à l’aval des plaines. Les résultats de cette étude ont également permis de conclure sur un effet positif de la géomorphologie des rivières en tresses sur la structuration génétique de P. walteri et de mettre en évidence de grandes tailles de populations ainsi que de fortes capacités de dispersion, permettant d’écarter certaines idées reçues sur le milieu souterrain.

Mots clés : géomorphologie ; rivières en tresses ; eau souterraine ; invertébrés ; communautés ; structuration génétique ; taille efficace de populations

Title

Geomorphology of large braided rivers as driver of biodiversity; how it can shape patterns of aquatic invertebrate communities and populations structure

Abstract

Braided rivers are large alluvial rivers found in piedmont mountainous areas. These rivers are very dynamic systems in space and time and exhibit particular geomorphology. The river flows alternatively into large alluvial plains or narrowing parts (also defined as canyons). This geomorphology impacts groundwater-surface water exchanges and sedimentary thickness. Groundwater- surface water exchanges occur at different scales, then interacting to shape biotic and abiotic filters for invertebrate communities. Canyons can reduce sedimentary continuity or interrupt it and may represent strong barriers to dispersal for sedimentary-dwelling organisms. This present work aimed at evaluating the effects of geomorphology in invertebrate community structure and as a potential barrier to dispersal in the subterranean organism Proasellus walteri. The different results obtained have shown that geomorphology structured invertebrate communities, highlighting a strong response in groundwater communities but not in surface communities and have shown that downstream parts of alluvial plains were hotspots of biodiversity. The results of this study also concluded on a positive effect of geomorphology in braided rivers on the genetic structure of P. walteri and underlined large effective population size and high dispersal ability, then removing some misconceptions about subterranean environment.

Keywords: geomorphology, braided rivers, groundwater, invertebrates, communities, genetic structure, effective population size.

A mon père.

Remerciements

REMERCIEMENTS

Mes plus sincères remerciements s’adressent en premier lieu à l’ensemble des membres de mon jury de thèse pour l’intérêt qu’ils ont porté à mon travail. Plus particulièrement, merci à François Pompanon et Jean-Nicolas Beisel, rapporteurs de ce travail, qui ont pris le temps de lire et de commenter ce manuscrit, merci à Loïc Bollache, Hervé Piégay et Sylvain Dolédec d’avoir accepté d’être respectivement examinateurs de ce travail et président du jury.

Après quatre années bien remplies, j’arrive au terme d’une belle histoire et souhaite en remercier les différents protagonistes en espérant n’oublier personne. Tâche difficile que d’écrire des remerciements ; trop long, trop court, des oublis… Tant pis, je prends le risque.

Je veux bien sûr commencer par remercier mes encadrants Christophe Douady, mon directeur de thèse, ainsi que Florian Malard, mon co-directeur et Bernard Kaufman. Christophe, merci pour la confiance que tu m’as accordée et pour ta rigueur qui m’auront permis de grandir lors de cette expérience. Merci pour le partage de ton amour de la science et ton aide sur mes nombreux terrains. Florian, un très grand merci pour l’enseignement permanent de ton expérience, de tes connaissances et ta générosité. Nos nombreuses discussions m’ont bien souvent retourné positivement le cerveau et je te suis reconnaissante d’une telle disponibilité et patience. D’un côté plus pratique, merci de m’avoir appris à « lire une rivière » et je n’oublie pas bien sûr de te dire merci pour tous les coups de frappe et de pompe que tu as donnés pour ce travail, en espérant ne pas avoir trop contribué à l’usure du cartilage de tes articulations. Bernard, merci pour ton aide aussi bien scientifique que morale. Merci pour tes conseils, ta disponibilité, ta bonne humeur, et les « à côtés » culturels propices à l’évasion. Encore merci pour la logistique qui m’aura permis de découvrir des coins superbes dans les Alpes de Haute-Provence.

Je souhaite également remercier chaleureusement Thibault Datry et Cécile Claret qui ont fortement contribué à ce travail par leur encadrement et conseils bienveillants. Merci Thibault, pour ton aide aussi bien théorique que technique et merci d’avoir grandement contribué à l’ambiance du terrain pour en faire de très bons souvenirs. Cécile, un très grand merci pour ton aide en identification, pour tes relctures et ton soutien, même à distance.

Merci également aux acteurs de l’équipe rivières en tresse de l’ENS. Un grand merci notamment à Hervé Piégay et Barbara Belletti pour leur éclairage permanent sur ce qui constituait pour moi la terra incognita de la géomorphologie. Merci pour votre aide et votre sourire.

Merci à l’ensemble des membres de l’équipe E3S, à commencer par Pierre Marmonier, pour ses conseils précieux et ses encouragements dans les périodes de doute, sans oublier sa bonne humeur communicative. Merci à la bande des « affreux ». Merci donc à Tristan Lefébure qui s’est retrouvé embarqué sur le terrain et dans mes microsat. Merci à Laurent Simon pour son aide quand j’ai été confrontée au côté obscur de la matière organique et pour sa gentillesse. Merci également à Florian Mermillod-Blondin pour m’avoir fait bénéficier de ses conseils et pour sa bonne humeur admirablement 4

Remerciements récurrente qui redonne le sourire à chaque café bu au 3ème. Merci aussi à Frédéric Hervant, Christophe Piscart, Michel Creuzé des Châtelliers et Damien Lemoine.

Un immense merci à Dominique Martin, pour son soutien indéfectible au cours de cette thèse. Les mots me manquent, mais tu es une vraie tatie. Le même immense merci à Marie-Jo Dole-Olivier, pour toute l’aide qu’elle a pu m’apporter, pour ses conseils, pour la relecture de nombreux éléments pendant la difficile étape de rédaction du manuscrit, pour sa gentillesse et pour toutes nos discussions qui ont fait du bien. Merci à Nadjette Houriez, que je remercie pour tellement de choses, la liste est aussi très longue.

Un gros, très gros merci à Lara Konecny-Dupré d’avoir été la bonne fée de mes manips. Merci à Lara pour son soutien et sa gentillesse face à mes déroutes moléculaires. Merci également à Marie-Rose Viricel et Odile Grolet qui contribué à ce que mon travail en blouse blanche soit une expérience inoubliable. Merci également à Audrey Second du DTAMB pour sa gentillesse, son efficacité et son empathie devant ma mine déconfite quand mes essais étaient peu concluants !

Merci à l’ensemble des membres du LEHNA, merci à ceux croisés au détour d’une passerelle pour leurs encouragements et conseils. La liste est longue et donc dans le désordre, merci à Jean Paul Léna pour les coups de bourre du lundi matin et nos discussions très enrichissantes, merci à Sandrine Plénet pour sa gentillesse et beaucoup de bons moments, merci à Félix Vallier, merci à Jean-Michel Olivier, merci également à Gudrun Bornette pour ses conseils et aide dans tout le démêlage du monde de l’E2M2.

Pour mener à bien ce travail il aura fallu porter, taper, pomper, trier, identifier... C’est pourquoi je remercie tous ceux qui ont donné de leur personne aussi bien les pieds dans l’eau que derrière une bino, ceux qui ont pris des coups de soleil, des coups de froid, des crampes et des courbatures. Merci donc à Guillaume Grosbois, Roland Corti, Ali Bourghous, Alexandre Degeorges, Lorna Arnaud, Sébastien Mendes et enfin Pauline Jean. Merci Pauline pour ton dévouement de ta licence à ton master 2, ta bonne humeur, tes bichocos et nos crises de rires … parfois nerveuses. Je te dois beaucoup et te souhaite le meilleur, « ça va le faire ».

Au cours de ces trois ans, j’ai découvert les joies de l’enseignement et ce fut une expérience très plaisante. Merci donc à Pierre Sagnes, Sandrine Plenet, Jean Paul Léna et Fabio Lepori, pour m’avoir fait confiance et pour leur gentillesse. Merci également à Marie Noëlle Truchet, Gisèle Journaux, et Valérie Ville pour leur sourire.

Merci aux différentes promos de thésards, M2, non permanents et post docs qui se sont succédés, qui ont su créer des ambiances mémorables et qui sont devenus pour certains plus que des collègues. Merci d’abord à ceux qui m’ont le plus supportée dans le bureau et le couloir. Merci donc à Lisa Lalouette et à Claire Morvan pour notre équipe de poney à roulette, merci à Clémentine François, merci meuf pour tout, merci à David Eme (R book humain, psychologue et catcheur à mi-temps) pour tout, merci à Jérôme Prunier et Jérôme Gippet pour leur aide scientifique et les pauses passerelle café/médias/triton (« il prend un café ? », « dis, si t’étais un chien… »). Merci à ceux qui sont encore au labo, à ceux qui sont partis plus loin et ceux qui sont maintenant très loin (au bout de l’Afrique ou outre-Atlantique) mais dont l’amitié et le soutien ont été précieux. Merci à vous pour 5

Remerciements tous ces bons moments passés ensemble du Toï Toï à la Villa Cusset en passant par les quais du Rhône et de la Saone. Merci donc à Karine Salin, Simon Navel, Natacha Foucreau, Soraya Rouifed, Emilien Luquet, Loïc Brepson, Claire Hemmer, Arnaud Foulquier, Delphine Cottin Mélissa De Wilde-Negrutiu, Jehanne Oudot-Canaff, Mathieu Troïanovski, Thomas Wardziak, Célia Rodriguez, Charlotte Grasset, Céline Colson-Proch, Géraldine Nogaro, Florent Arthaud, Arnaud Dehedin, Chafik Maazouzi, Yannick Negrutiu, Laurent Houriez, Antonin Vienney, Mathilde Novel, Pauline Jean, Kathleen Ferrand, Loïc Teulier, Julien Grangier, Kath, Pierre Charrier, Julia Desprat, Hugo Cayuela, Alice Merle…

Merci aux copains Bretons de Lyon, à Lisa qui m’a montré comment tenir la barre et le cap pendant la première année de ma thèse, merci à Nolwenn, Erwan, Gaëlle et à Jadou bien sûr. Merci pour nos « David Lynch moments » et nos moments à la « Passagère ». Je n’oublie pas de dire merci aux copaings de promo toulousains. Merci pour votre amitié et ces moments précieux autour d’une pinte place St Georges ou aux Terreaux, parfois améliorés de saucisse aveyronnaise à l’huile, ou de confit de canard devant un match du Stade Toulousain. Merci à Mary, Joris, Camille, Virginie, à mes grougnes Laurie et Marion. Marion, merci pour ton amitié sans faille. Merci à Jeremy également. Merci aux autres qui ont toujours suivi l’histoire et souvent depuis longtemps, merci donc à Galoute, Sève, Nath, Guillaume, Nonef, Lapinou, ChaQ, Marie, Minouche.

Enfin, de tout mon cœur merci à ma famille qui a cru en moi et m’a encouragée. Merci à Filou, Maytte, Miloue, Isa, Fafa, Elodie, Chloé. Merci donc à vache 1 pour tous ses cours de maths qui finalement ont peut-être servi. Merci à mes deux supers grand mères dont le soutien est juste énorme (aussi bien culinairement qu’affectivement). Mes pensées vont évidemment à mon grand père qui fut le premier à me mettre les pieds dans l’eau d’une rivière et une canne à pêche entre les mains sur le Jaur. C’est peut-être grâce à lui que j’y ai pris goût. Merci à ma Maman que j’aime tout simplement. Merci d’avoir cru à ma place quand moi je ne croyais plus. Merci de m’avoir, encouragée et laissée libre dans mes choix avec toute la bienveillance qui te caractérise. Maman, quand tu liras ce travail, ou du moins les remerciements (puisque je sais que tu connais déjà tout ce qu’il faut savoir sur la Proaselle n’est ce pas), je souhaite que tu y trouves ma profonde reconnaissance pour tout ce que tu as donné pour moi. Merci à mon « petit » frère Pierre d’avoir été toujours là, merci d’être aussi un pilier de ma vie, merci d’être toi. Merci à Manu pour tes encouragements incessants, ton optimisme et ta gentillesse. Une pensée évidente pour Chouchou qui me manque terriblement. Merci également à Laetitia, Cédric, petite Sarah, Michel, MaryLou. Et enfin, l’aboutissement de ce travail n’aurait certainement pas été le même sans toi, Jo. Merci à toi pour tout, m’avoir suivie, m’avoir supportée dans mes moments d’angoisse et de doutes et me supporter encore. Papa, merci de m’avoir enseigné que tout se gagnait par le travail et l’endurance, en voici un exemple pour toi.

En essayant continuellement, on finit par réussir. Donc, plus ça rate, plus on a de chances que ça marche… (Devise Shadok)

Table des matières

PREAMBULE ...... 11

INTRODUCTION ...... 15

1. La géomorphologie des rivières en tresses...... 16

1.1. Généralités ...... 16

1.2. Distribution géographique des rivières en tresses ...... 17

1.3. La genèse du tressage ...... 19

1.4. Les sédiments ...... 21

1.5. La plaine alluviale ...... 22

1.6. Les perturbations subies par les rivières en tresses ...... 24

2. Le milieu souterrain ...... 25

2.1. Structure du milieu souterrain ...... 25

2.2. Les organismes des aquifères souterrains et ses interfaces ...... 27

3. Les échanges nappe-rivière ...... 29

3.1. Principe des échanges ...... 29

3.2. Effets écologiques des échanges hyporhéiques ...... 29

3.3. Les échanges s’effectuent à différentes échelles spatiales ...... 30

3.4. L’ampleur des échanges hyporhéiques dans les rivières en tresses ...... 31

4. Structuration de la biodiversité dans les systèmes aquatiques ...... 33

4.1. La communauté ...... 33

4.2. La population : variabilité génétique et dispersion...... 37

5. La connectivité en milieu aquatique ...... 39

5.1. La connectivité au sein des réseaux dendritiques ...... 40

5.2. La connectivité des systèmes souterrains ...... 44

OBJECTIFS ET ORGANISATION DU DOCUMENT ...... 46

MATERIELS ET METHODES ...... 49

1. Géomorphologie et communauté : méthodes utilisées ...... 50 8

1.1. La prospection ...... 50

1.2. Validation du modèle hydrologique ...... 53

1.3. Echantillonnage des communautés hyporhéiques et benthiques ...... 54

1.4. Mesures physico-chimiques et chlorophylle ...... 55

1.5. Tri et identification des invertébrés et analyse de la matière organique ...... 56

1.6. Approche statistique choisie ...... 57

2. Géomorphologie et populations : modèle biologique et outils d'étude ...... 57

2.1. Modèle biologique d’étude ...... 57

2.2. Echantillonnage exploratoire ...... 60

2.3. Clarification systématique ...... 60

2.4. Etude de la variabilité génétique ...... 64

2.5. La génétique du paysage : cadre théorique ...... 65

CHAPITRE 1. La géomorphologie comme facteur structurant les communautés d’invertébrés ...... 67

CHAPITRE 2. Développement des marqueurs microsatellites et évaluation de la taille des populations en milieu souterrain ...... 104

CHAPITRE 3. La géomorphologie comme facteur structurant les populations hyporhéiques de Proasellus walteri ...... 131

CONCLUSIONS ET PERSPECTIVES ...... 164

1. Synthèse des résultats ...... 166

1.1. Effets de la géomorphologie des rivières en tresses sur les communautés d’invertébrés aquatiques ...... 166

1.2. Effets de la géomorphologie des rivières en tresses sur la structuration génétique des populations du crustacé P. walteri ...... 170

2. Implications en termes de gestion ...... 172

3. Perspectives ...... 174

3.1. Vers une meilleure quantification des écoulements hyporhéiques ...... 174

3.2. Vers une meilleure résolution taxonomique ...... 175

3.3. Autres mesures de la diversité...... 175

3.4. Effets des écoulements hyporhéiques sur les processus de l’écosystème ... 175

3.5. Variabilité des tailles de populations entre plaine et montagne ...... 176

3.6. Histoire démographique ...... 176

3.7. Evaluation de la dispersion pour d’autres organismes souterrains ...... 178

ANNEXE ...... 208

Préambule

PREAMBULE Le projet « Rivières en tresses »

Il y a aujourd’hui un enjeu de plus en plus important à comprendre le fonctionnement de tous les écosystèmes aquatiques ou hydrosystèmes. Pollution, agriculture de masse, augmentation de la population, disponibilité en eau potable et aménagements hydrauliques constituent autant de menaces qui modifient profondément le mode de fonctionnement des hydrosystèmes. Au milieu de ces interrogations se situe la prise en compte de la biodiversité. Pour gérer au mieux l’impact anthropique croissant sur les hydrosystèmes, les politiques de gestion se tournent vers un inventaire des services écosystémiques (biens, ressources utiles ou vitales que peut fournir un écosystème à l’être humain) dans le but de prioriser des actions de protection. La question des services écosystémiques que peut fournir un cours d’eau s’aborde notamment par l’évaluation de son potentiel écologique pour qu’à terme des bases scientifiques solides soient établies pour permettre la mise en place de plans de restauration écologique et de gestion durable.

Actuellement, parmi les cours d’eau les moins expertisés d’un point de vue écologique et physique figurent les rivières en tresses. Une rivière en tresses est une rivière qui sur certaines parties de son tracé s’écoule en de multiples chenaux mobiles qui divergent et convergent dans ses plaines alluviales. Ces rivières sont les systèmes aquatiques parmi les plus complexes et les plus dynamiques en milieu continental. Le tressage se produit quand des pentes modérées sont combinées à une très forte charge sédimentaire dans le lit de la rivière. L’énergie du cours d’eau ne se disperse alors plus uniquement de façon longitudinale mais latérale ce qui crée les multiples chenaux caractéristiques des tresses. Au cours des deux derniers siècles, ces rivières ont subi des dysfonctionnements dus aux apports et extractions sédimentaires d’origine anthropique qui ont drastiquement modifié le régime des rivières.

L’objectif de la DCE (Directive Cadre Eau) mise en place par l’Union Européenne, vise à atteindre d’ici à 2015 le bon « état écologique » pour les rivières. Des questions clés se posent pour les rivières en tresses. Comment définir le bon statut écologique d’une rivière en tresses? Quel est son potentiel écologique ? Peut-on s’attendre à une disparition progressive des rivières en tresses ? Dans le cadre de la convention de recherche qui lie la ZABR (Zone Atelier Bassin du Rhône) à l’agence de l’Eau RMC (Rhône Méditerranée Corse), une action a été initiée en 2008 sur la connaissance du

Préambule fonctionnement et son application à la gestion des rivières en tresses du Sud-Est de la France.

Cette action a pour but de définir pour les années à venir des travaux de recherche interdisciplinaires pour mieux caractériser les rivières en tresses d’un point de vue physique et écologique, afin de proposer des actions de restauration sur des bases solides. Ces travaux doivent servir à définir des priorités d’actions territoriales lors de la mise en œuvre de la DCE et affiner les différentes mesures préconisées à l’échelle des schémas locaux pour la préservation et la restauration écologique, la sécurité et la disponibilité de la ressource en eau. Ce projet est construit collectivement entre scientifiques et gestionnaires sur le thème de la caractérisation fonctionnelle des rivières en tresses, a pour objectif général d’établir une typologie biomorphologique des rivières en tresses du bassin du Rhône. C’est sur ce bassin que se concentre la plupart des rivières de ce type sur tout le territoire français, voire même en Europe.

Le projet a été programmé sur une période de 4 ans et aborde :

- L’évolution géomorphologique des cours d’eau (trajectoires géomorphologiques piloté par l’IRSTEA de Grenoble)

- La caractérisation des habitats (conjointement mené par l’UMR CNRS 5600 « Environnement Ville Société » et l’Université de Rennes)

- L’évaluation du potentiel écologique à partir de l’analyse des communautés d’invertébrés (confié à l’UMR CNRS 5023 « Laboratoire d’écologie des Hydrosystèmes Naturels et Anthropisés »). C’est dans le cadre de ce dernier volet que s’inscrit mon sujet de thèse.

Problématique générale

Ces rivières très mobiles posent un problème spécifique relatif aux outils d'évaluation de leur potentiel écologique. Comment identifier les mécanismes qui jouent sur la biodiversité de ces rivières? Jusqu’à présent, les outils écologiques disponibles ont

Préambule

été utilisés pour des cours d’eau où la stabilité géomorphologique est plus importante. Ces deux derniers siècles, les rivières en tresses ont été exposées à des menaces telles que l’incision de leur lit, liée à un déficit sédimentaire d’origine anthropique. Il est donc primordial de comprendre dans un premier temps l’originalité de leur fonctionnement biologique et de voir dans quelle mesure les outils connus peuvent s’appliquer pour répondre aux problématiques des d’assemblages des communautés ou de la dispersion des organismes. Les rivières en tresses s’inscrivent dans la typologie des grandes rivières alluviales de piémont montagneux et présentent une géomorphologie particulière. Leur tracé traverse alternativement des rétrécissements de vallées et de vastes plaines. Cette géomorphologie particulière a des effets sur les échanges que peut avoir la rivière avec sa nappe et sur la quantité de sédiments dans différentes parties de la rivière. C’est sur ces deux aspects et leurs effets sur les invertébrés que mon travail de thèse s’est focalisé.

La rivière échange de l’eau avec son bassin versant et sa nappe souterraine qui l’accompagne en créant des écoulements souterrains. L’eau de surface s’infiltre en amont dans les sédiments et s’exfiltre vers la surface à l’aval. Suivant l’épaisseur des alluvions, ce phénomène peut se produire à différentes échelles spatiales imbriquées : de l’amont vers l’aval des plaines, de l’amont vers l’aval de bancs de graviers, de l’amont vers l’aval de rochers et entre les galets et graviers. Les resserrements de vallée entraînent des remontées généralisées d’eau souterraine au milieu desquelles se produisent les écoulements entre les bancs de graviers. Ces différents écoulements créent des conditions biotiques et abiotiques différentes pour les communautés invertébrées de surface et souterraines. Dans ce travail, j’ai cherché à déterminer l’interaction de leurs effets sur ces communautés d’invertébrés. Les resserrements de vallées créent dans la rivière des zones de type canyons où la couche de sédiments est très amincie voire absente. Pour des organismes souterrains inféodés au milieu sédimentaire, ces parties peuvent représenter de fortes barrières à la dispersion. Je me suis donc attachée à évaluer dans quelle mesure ces discontinuités sédimentaires jouaient sur la dispersion des organismes souterrains via l’évaluation de leur différenciation génétique.

Dans ces systèmes, la nécessité s’impose de clarifier le lien entre la géomorphologie, les échanges d’eau entre la surface et le milieu souterrain, le degré de connectivité et la biodiversité des rivières en tresses (particulièrement des organismes invertébrés). En me focalisant sur des thématiques à enjeu majeur en écologie, à savoir

Préambule les d’assemblages des communautés et la dispersion des organismes, j’ai abordé trois objectifs précis.

Objectifs

1- Tester les effets de la géomorphologie des rivières en tresses via l’organisation des écoulements souterrains sur la composition et la structuration des communautés d’invertébrés.

2- En se référant à un organisme souterrain typique, délimiter et développer les connaissances sur la taille des populations en milieu souterrain.

3- Tester la géomorphologie des rivières en tresses comme facteur structurant des populations d’organismes souterrains, en s’intéressant à une espèce via une approche de génétique du paysage.

Introduction

INTRODUCTION

La discipline scientifique qu’on nomme aujourd’hui géomorphologie fluviale s’intéresse principalement à l’étude des processus physiques régissant le fonctionnement des cours d’eau (la dynamique fluviale) et des formes qui en résultent (la morphologie fluviale). Les rivières sont des écosystèmes d’eau courante dynamiques dans le temps et dans l’espace. Le long de leur trajet, elles s’écoulent sur différents types de substrats ; on distingue les rivières coulant sur une matrice rocheuse : « les rivières à lit rocheux » et les rivières s’écoulant sur des sédiments : « les rivières à lit meuble ou alluviales » dont font partie les rivières en tresses. Une vision holistique de tous les processus régissant les rivières alluviales s’est imposée progressivement jusqu’à aujourd’hui et il est désormais intégré que ces écosystèmes s’organisent selon trois dimensions spatiales (Ward 1989, Stanford & Ward 1993).

Les cours d’eau ont longtemps été considérés comme une seule et même entité organisée et fonctionnant suivant un axe longitudinal. La prise en compte de cette seule dimension a abouti à des modèles descriptifs longitudinaux qui tentent d’expliquer les modèles de répartition des espèces de poissons comme la zonation écologique d’Illies & Botosaneanu (1963) et celle des invertébrés et flux de matière comme défini par le « River Continuum Concept » (Vannote et al. 1980). Puis, progressivement s’est imposée une reconnaissance générale d’autres types d’interactions liant le chenal à ses zones ripariennes (Bravard et al. 1986 ; Gregory et al. 1991) faisant alors considérer la dimension latérale comme une composante elle-aussi fondamentale des cours d’eau. Enfin, même si le rôle de l’eau souterraine avait déjà été appréhendé dans les transformations des solutés au sein des rivières, la prise en compte des échanges eau souterraine – eau de surface a été plus lente, faisant rentrer désormais la dimension verticale comme troisième composante fondamentale des cours d’eau (Bravard et al. 1986, Creuzé des Châtelliers 1991, Stanford & Ward 1993).

La zone hyporhéique s’inscrit dans cette troisième dimension en tant que zone de contact entre la rivière et la nappe sous jacente (Orghidan 1959) et est aujourd’hui reconnue comme partie intégrante des rivières. Elle contient les sédiments interstitiels saturés sous le lit de la rivière et dans les berges qui contiennent une certaine proportion d’eau de surface (White 1993).

Introduction

Le rôle de la zone hyporhéique dans le fonctionnement des écosystèmes lotiques est devenu de plus en plus clair au cours des deux dernières décennies (Stanford & Ward 1993, Boulton et al. 1998, Krause et al. 2011, Dole-Olivier 2011). Le milieu hyporhéique est un écotone (c'est-à-dire une zone de transition écologique) entre les eaux de surface et les eaux souterraines (Gibert et al. 1990). Les échanges hydrologiques ayant lieu dans la zone hyporhéique permettent le transfert de nutriments, de solutés et d’organismes entre les deux milieux (Brunke & Gonser 1997). La zone hyporhéique présente de multiples fonctions biologiques; zone de production secondaire (Allen 1951, Wright- Stow et al. 2006) ; zone d’atténuation des pollutions aux métaux lourds (Gandy et al. 2007), zone de protection et de développement des pontes de salmonidés (Malcolm et al. 2003, 2005) ; nurserie et refuge pour les communautés invertébrées benthiques lors de perturbations en surface (Orghidan 1959, Dole-Olivier 2011, Stubbington 2012) comme les crues (Williams & Hynes 1974 ; Dole-Olivier et al. 1997) ou les assèchements (Delucchi 1989, del Rosario & Resh 2001).

1. La géomorphologie des rivières en tresses Une rivière en tresses est une rivière qui sur certaines parties de son tracé s’écoule en de multiples chenaux mobiles qui divergent et convergent dans une plaine alluviale. Ces rivières sont les systèmes aquatiques les plus complexes et les plus dynamiques en milieu aquatique continental (Leopold & Wolman 1957, Ward et al. 2002, Gray & Harding 2009).

1.1. Généralités Transversalement, le lit d’une rivière se définit suivant trois zones : Le lit mineur correspond au chenal de la rivière, il s’agit de la partie du lit en eau pour des débits moyens ou d’étiage. Le lit moyen (ou « bande active ») est la partie du lit utilisée pour des débits compris entre l’étiage et la crue de pleins bords (c'est-à-dire ayant pour limite les bords de la partie creusée par les chenaux) pour une fréquence annuelle ou biennale. Le lit majeur peut être mis en eau lors de crues de plus forte amplitude (souvent des crues centennales). Au sein de ce lit, pour des cours d’eau de rang supérieur, il est parfois possible de distinguer des unités spatiales constituées de formes relictuelles, témoins de l’activité passée du cours d’eau (ancien tracé). Le lit majeur renvoie à la notion hydrologique si l’on considère l’espace de submersion mais il est 16

Introduction aussi appelé « plaine alluviale » et renvoie dans ce cas à la notion géologique et géomorphologique si l’on considère la masse sédimentaire d’origine alluviale. L’ensemble de ces unités spatiales est généralement interconnecté par le réseau hydraulique de surface ou l’écoulement souterrain.

Un cours d’eau peut adopter différents types morphologiques ou styles fluviaux en réponse aux variations des paramètres de contrôle que sont ma pente, la charge en sédiments, les débits. On considère aujourd’hui qu’il existe deux styles fluviaux majeurs, le méandrage et le tressage. Il existe aussi des styles fluviaux secondaires car moins fréquents à la surface du globe comme le style rectiligne, le style vagabond, le style anastomosé et le style anabranché. Les rivières présentant le style fluvial « tressage » sont caractérisées par des chenaux multiples très mobiles dans l’espace et dans le temps, séparés par des bancs alluviaux ordinairement pas ou peu végétalisés (Rust 1978) car les crues annuelles ou à pluriannuelles arrachent régulièrement la végétation qui s’y développe (généralement une végétation pionnière herbacée ou arbustive).

1.2. Distribution géographique des rivières en tresses Les rivières en tresses se développent sur tous les continents en tête de bassin dans les régions arctiques et alpines, dans les régions méditerranéennes sujettes aux pluies torrentielles et dans certaines régions tropicales sujettes à la mousson (Bravard & Gilvear 1996). Les Alpes françaises sont l’une des dernières régions des Alpes où les rivières en tresses sont encore bien présentes (notamment dans la partie sud incluant le bassin versant de la Durance) par rapport à la Suisse, l’Italie et l’Autriche (Habersack & Piégay 2008). Aujourd’hui, l’estimation cumulée de la longueur de tressage atteint 650 km dans les Alpes françaises. On estime par ailleurs qu’environ 53% de ces rivières ont disparu ces deux derniers siècles, consécutivement à la chenalisation, l’endiguement et l’extraction de granulats induits par l’homme. Ainsi, le bassin versant de la Durance et une partie du bassin versant du Rhône sont les dernières régions des Alpes Méditerranéennes où ces rivières persistent encore (Habersack & Piégay 2008, Piégay et al. 2009). (Figure 1)

Introduction

Figure 1: Situation (A) du bassin Rhône-Méditerranée, (B) des secteurs en tresses dans le bassin avant la période d’endiguement et de constructions de barrages (18ème siècle – milieu du 19ème siècle) et (C) au début du 21ème siècle. (D) Situation des tronçons étudiés dans le cadre du projet rivières en tresses. D’après Piégay et al. (2009).

Introduction

1.3. La genèse du tressage Les rivières en tresses sont le produit d’environnements de haute énergie où la variabilité des débits et les charges sédimentaires interagissent pour créer des paysages dynamiques. Elles sont caractérisées par une abondante charge sédimentaire, des berges érodables et des pentes relativement raides (Leopold et Wolman 1957, Ferguson 1987, Gurnell et al. 2009). Le tressage se produit à partir d’un certain seuil atteint par la pente et la charge sédimentaire. Il s’agit de pentes assez élevées (>2.5 % ou 0.02 m/m) avec des charges de sédiments présentes dans le lit qui dépassent la capacité de charriage de la rivière. Une fois cette capacité atteinte, la rivière s’arrête de charrier, l’écoulement de la rivière s’effectue alors en chenaux multiples et la rivière adopte le style fluvial de tressage. En dessous de ce seuil, la rivière adopte le style fluvial en méandres (Figure 2, panneau A). Le tressage est en effet symptomatique d’une « surcharge » alluviale par rapport à la capacité moyenne de transport fournie par le produit « pente de la vallée x débit », c'est- à-dire la puissance maximale que peut développer le cours d’eau pour de fréquents épisodes de crue. Ces « surcharges », dépassant la capacité de transport entraînent l’apparition de premiers dépôts, lesquels conduisent à la formation de bancs alluviaux et peu à peu au tressage complet (Figure 2, panneau B). La concentration des dépôts sédimentaires sous forme de bancs favorise la divergence des écoulements vers l’extérieur du lit : l’érosion des berges et l’élargissement progressif du lit moyen est l’une des conditions majeures de développement du tressage. La rivière en tresses présente donc un large lit moyen encore appelé bande active (Bravard 1986). Cette bande active, constituée de bancs alluviaux peu ou pas végétalisés, remaniés et rajeunis par des évènements hydrologiques de fréquence moyenne à forte (entre crue annuelle et crue biennale) est souvent considérée comme la zone majeure de stockage temporaire de la charge sédimentaire pour quelques décennies (Figure 3). De nombreux indices de tressage ont été proposés depuis une quarantaine d’années (Bridge 1993) pour définir si une rivière présente un style fluvial de tressage. Ils intègrent la mesure du nombre de chenaux actifs le long de transects perpendiculaires à l’axe du lit moyen (la bande active). L’indice le plus souvent préconisé est celui défini par Ashmore (1991) qui quantifie simplement le nombre de chenaux moyens par transect.

Introduction

Figure 2 : (A) La génèse du tressage selon les expérimentations sur modèle réduit de Leopold & Wolman (1957) et (B) évolution de la pente et du style fluvial sous l’effet de l’augmentation de la charge sédimentaire (modifié d’après Schumm & Khan 1971).

Introduction

Figure 3 : Anatomie d’un secteur en tresses. Ici, une tresse sur le Buëch au niveau d’Eyguians (Hautes Alpes).

1.4. Les sédiments

1.4.1. L’origine Les apports sédimentaires d’une rivière en tresses peuvent présenter deux origines (Buffington et al. 2003). Des épandages fluvio-glaciaires, des éruptions volcaniques ou glissements de terrains constituent une origine d’apports externes de sédiments au cours d’eau. En revanche, les apports d’origine interne sont ceux mobilisables au sein du cours d’eau lui-même ou d’une partie de son lit majeur c'est-à- dire provenant de l’érosion des terrasses et berges constituées de dépôts d’alluvions.

1.4.2. La mobilisation A long terme la mobilisation de ces stocks sédimentaires est régulée par le climat et la géologie de la rivière (Schumm & Litchy 1965). Différents régimes climatiques contrôlent l’intensité et la fréquence des crues qui vont assurer la mobilité et le transport 21

Introduction des sédiments et potentiellement mettre à nu le faciès lithologique (le lit rocheux) de la rivière par érosion. La géologie de la rivière conditionne elle aussi le volume sédimentaire; il existe en effet des secteurs le long du cours d’eau qui subissent des contraintes morphologiques imposées par la vallée ; les canyons, où le lit rocheux peut affleurer et où par conséquent l’épaisseur de sédiments est minimale. Cumulé à ce phénomène, la dispersion de l’énergie du cours d’eau dans ces parties contraintes ne peut plus s’effectuer selon une dimension latérale mais devient uniquement concentrée de manière verticale. Le chenal érode alors les sédiments restants jusqu’au lit rocheux. Dans une moindre mesure, la végétation joue un rôle de force de cohésion dans la stabilisation des pentes et ravins, en ralentissant le transport de sédiments et en piégeant les éléments fins lors de forts orages (Bravard 2002). Une vaste politique de reboisement a été menée dans certaines régions Alpines et Pyrénéennes au XIXème siècle dans le but de diminuer l’érosion des pentes due aux alpages. Depuis cette période, un fort déclin des apports sédimentaires associés à une réduction des débits liquides lors des épisodes orageux ont mené à des rivières pour la plupart incisées.

1.5. La plaine alluviale La plaine alluviale est une des caractéristiques déterminantes d’une rivière en tresses qui peut s’étendre de quelques centaines de mètres à plus de 20 km (ex : fleuve Brahmapoutre). Ces plaines constituent des environnements hétérogènes de dépôts sédimentaires de différentes époques classés selon leur lithofaciès ou type de dépôt. (Miall 1977). En effet, selon le type de dépôt retrouvé dans la plaine alluviale (fin de type sable, à grossier de type galet), on peut déduire le régime hydrologique passé de la rivière. La plaine alluviale peut présenter des chenaux actifs très instables bordés par les éléments des dépôts sédimentaires stables (Miall 1977, Bravard & Gilvear 1996), ou stabilisés par les successions végétales (Amoros & Bornette 2002), rassemblant ainsi une grande variété d’habitats (Belletti et al. 2012).

Introduction

Quelques rivières en tresses…

Introduction

1.6. Les perturbations subies par les rivières en tresses Au cours des XIXe et XXe siècles, la demande croissante pour améliorer la navigabilité, permettre l’industrialisation, une agriculture extensive, la régulation généralisée des cours d’eau, la protection contre les crues et la production hydroélectrique ont modifié le fonctionnement de la majorité des rivières européennes (Petts et al.1989). On estime que 10 % seulement des rivières de la région Alpine européenne sont non-impactées ou proches des conditions naturelles (Habersack & Piégay 2008). Les conséquences de ces perturbations sont multiples; abaissement du niveau des nappes d’eau souterraine, chenalisation, diminution de la complexité géomorphologique, modification du transit sédimentaire, perte d’habitats au sein du chenal, modification du fonctionnement écologique et perte de biodiversité (Bravard et al. 1999 ; Kondolf et al. 2002). Compte tenu de l’importance de ces impacts, ces rivières nécessitent une gestion prioritaire. Les affleurements du lit rocheux peuvent être dus à un déficit sédimentaire d’origine anthropique, en effet, l’extraction de granulats dans le lit des rivières et les politiques de reforestations jouent directement sur la quantité de sédiments disponibles et mènent à terme à des phénomènes d’incision. C’est par exemple le cas sur la rivière Drôme, pour laquelle un gros déficit sédimentaire a été enregistré entre 1928 et 1996. Les 70 km les plus en aval de la rivière se sont incisés en moyenne de 2,9 m avec une intensité pouvant atteindre par endroits 5 m (Landon 1996, Liébault & Piégay 2002, Toone 2009).

Introduction

2. Le milieu souterrain Les eaux souterraines constituent la plus grande unité hydrologique après les océans, représentant 97% des eaux douces du globe (UNESCO, 1986). Le milieu souterrain est un écosystème peu connu et pourtant particulier de par les conditions parfois extrêmes qui y règnent (Culver et al. 2004). Les eaux souterraines ne reçoivent aucun rayonnement solaire, ce qui limite fortement la production primaire étant donné l’absence de photosynthèse. Une autre de leurs caractéristiques est leur pauvreté en ressources nutritives et l’absence de production d’oxygène (Malard & Hervant 1999). Le grand volume et le lent renouvellement des eaux souterraines confèrent aux écosystèmes souterrains une inertie notamment thermique (Ginet & Decou 1977) souvent assimilée à de la stabilité par rapport aux écosystèmes de surface.

2.1. Structure du milieu souterrain Le milieu aquatique souterrain est un milieu hétérogène dont l’unité fonctionnelle est l’aquifère. On reconnait trois grands types d’aquifères définis sur la taille des vides ou pores (Figure 4).

Les aquifères karstiques sont des systèmes présentant les vides de plus grande taille, ils se forment dans des massifs calcaires fracturés puis érodés par l’eau au cours des temps géologiques. Les aquifères karstiques peuvent couvrir une très large surface comme par exemple jusqu’à 25% de la surface totale du territoire français (Juberthie & Decu 1994). L’aquifère karstique présente une configuration hétérogène constituée d’un réseau et formé de drains principaux et secondaires, pouvant être ou non ennoyés selon le niveau d’eau de l’aquifère (Vervier 1988). Les « grottes et leurs habitats associés » sont considérés comme des parties de ce réseau physique qui possède sa fonctionnalité propre, appelé aussi « système karstique » (Mangin 1975). L’eau peut aussi s’écouler dans les failles, fissures et interstices présents dans des roches à faible dissolution, comme les roches cristallines de type granite ou gneiss, formant ainsi des aquifères fissurés. Ce type d’aquifère présente une porosité plus faible due à une moindre dissolution des roches et est moins connu et étudié d’un point de vue biologique car offrant une diversité d’habitats plus restreinte. Le troisième type d’aquifère est représenté par les aquifères poreux où on rencontre des petits vides dans des roches meubles telles que les accumulations d’alluvions, conglomérats et moraines. Plus précisément, il s’agit des interstices ménagés entre les 25

Introduction galets, graviers et grains de sable qui permettent la présence d’eau souterraine. C’est dans la partie superficielle de l’aquifère poreux, au contact des cours d’eau que se site la zone hyporhéique (Orghidan 1959). Cette zone est définie comme un écotone à l’interface eau entre l’eau de surface et l’eau souterraine (Gibert et al. 1990) et présente une grande variabilité d’épaisseur. Au dessous de la zone hyporhéique, dans la partie plus profonde de l’aquifère poreux se situe la zone phréatique, très stable car soustraite à l’influence des eaux de surface.

Figure 4 : Aquifères karstiques, poreux et fissurés et porosité associées. D’après Gibert (2001), dessin de Roger Laurent.

Introduction

2.2. Les organismes des aquifères souterrains et ses interfaces On a longtemps sous-estimé la biodiversité des eaux souterraines, et longtemps cru que seules des espèces très spécialisées étaient capables de coloniser un milieu aussi particulier. En réalité, on rencontre dans les eaux souterraines des organismes très variés (micro-organismes, invertébrés et vertébrés) avec un nombre d’espèces considérable, environ 6 700 espèces à l’échelle du globe (Ginet & Decou 1977, Gibert & Deharveng 2002, Culver & White 2004).

Généralement, la richesse et la composition des communautés d’invertébrés vivant dans le milieu aquatique varient en fonction de la connectivité entre les eaux de surface et les eaux souterraines. Le milieu hyporhéique est un écotone dont l’épaisseur varie, les communautés présentes dans cette interface contiennent généralement : (1) des organismes stygoxènes (épigés présents accidentellement), (2) des organismes stygophiles (épigés capables d’exploiter les ressources et de les utiliser pour une partie de leur cycle de vie), (3) des organismes stygobies (formes très spécialisées dont la totalité du cycle de vie a lieu dans les eaux souterraines, y compris dans la zone phréatique plus profonde). (Figure 5, 5bis). Le groupe le plus représenté en milieu souterrain est celui des Crustacés, dont surtout des copépodes et dans une moindre mesure les amhipodes et isopodes, Sket (1999). En France, on estime que 80% des stygobies sont des Crustacés (Ferreira et al. 2005).

Figure 5 : Classification écologique des invertébrés souterrains aquatiques (d’après Marmonier et al. 1993).

Introduction

Figure 5 bis : Représentation schématique du milieu poreux et exemple d’organismes aquatiques souterrains stricts. A : Proasellus slavus (isopode) ; B : Niphargus sp. (Amphipode) ; C : Bathynella sp. (Syncaride) ; D : Parastenocaris sp. (Harpacticoïde) ; E1 : Cryptocandona kieferi (Ostracode) ; E2 : Kovalevskiella sp. (Ostracode) ; F : Acanthocyclops gmeineri (Cyclopoïde) ; G : Oligochètes ; H : Bythispeum sp. (Gasteropode) ; I : biofilm bactérien. D’après Danielopol et al. (1994).

Image électronique virtuelle de la vie dans un habitat poreux

(Représentation artistique de P. Pospisil)

Introduction

3. Les échanges nappe-rivière Une rivière est perçue comme un éco-complexe rassemblant des habitats variés où les eaux de surface et celles de l’aquifère associé à la plaine alluviale interagissent fortement entre eux. Dans cette vision hétérogène, la zone hyporhéique est reconnue comme un élément important de l’aquifère alluvial sur tout le linéaire du cours d’eau, depuis les petits tributaires de tête de bassin versant jusqu’à l’embouchure des grandes rivières (Stanford & Ward 1988, Findlay 1995, Brunke & Gonser 1997). Quand on parle d’échange hyporhéique on imagine assez intuitivement un processus vertical. Cependant, il faut appréhender ce processus dans une dimension longitudinale. De l’amont vers l’aval des rivières, l’eau de surface s’infiltre dans la zone hyporhéique, parcourt une certaine distance dans les sédiments, se mélange éventuellement à l’eau souterraine puis regagne la surface à l’aval.

3.1. Principe des échanges L’échange hyporhéique se produit via la mise en mouvement de l’eau de la rivière vers les alluvions (infiltration) et un retour à la surface (exfiltration), on appelle ce phénomène l’échange hyporhéique (Vaux 1962, Bencala 2005). Cet échange est généré par des différences de pressions hydrauliques. Les obstacles à l’écoulement de l’eau (rochers, embâcles, forme du lit de la rivière, resserrement du lit de la rivière) créent des zones de forte pression en amont de l’obstacle et des zones de faibles pression à l’aval de l’obstacle. Si la porosité des sédiments le permet, une partie de l’eau de surface s’infiltre sous effet de la surpression, transite dans les sédiments hyporhéiques et s’exfiltre à aval de l’obstacle dans les zones de plus faible pression (Cooper 1965, Thibodeaux & Boyle 1987).

3.2. Effets écologiques des échanges hyporhéiques Les échanges hyporhéiques influencent la diversité des habitats et les processus écologiques, tant en surface que dans les eaux souterraines (Dent et al. 2001) et créent pour les communautés d’organismes microbiens et invertébrés une mosaïque dynamique et hétérogène d’habitats souterrains (Malard et al. 2002 ; Brunke et al. 2003). Ces organismes peuvent en retour modifier les caractéristiques physico-chimiques de l’eau infiltrée, en prélevant dans cette eau une partie des solutés nécessaires à leur développement et en relarguant dans le milieu d’autres solutés-déchets qui sont emportés par le flux (Triska et al. 1993). 29

Introduction

Le flux d’eau de surface qui s’infiltre dans les sédiments est enrichi en oxygène dissous ce qui permet de créer des conditions aérobies au sein de la zone hyporhéique que des organismes de surface peuvent coloniser. Cependant, la dégradation de la matière organique au sein de la zone hyporhéique consomme de l’oxygène et crée des gradients de concentration qui varient selon le temps de réaction, les concentrations initiales d’oxygène, la vitesse et la longueur des écoulements hyporhéiques (Findlay et al. 1993). En revanche, le flux d’eau souterraine s’exfiltrant apporte depuis la zone hyporhéique vers la surface des éléments sous forme réduite et des solutés transformés (Triska et al. 1993). Ce flux d’exfiltration peut aussi représenter un apport de nutriments et de cellules algales par exemple dans des rivières après une perturbation (Valett et al. 1994). Des facteurs additionnels, tels que la composition du sédiment, le taux de mélange entre eau de surface et eau hyporhéique vont influencer la température, le pH, la conductivité électrique, et les concentrations en éléments dissous de l’eau hyporhéique, produisant des gradients physico-chimiques auxquels les poissons, les macro-invertébrés et autres organismes sont sensibles (Boulton et al. 1998, Brunke & Gonser 1997).

3.3. Les échanges s’effectuent à différentes échelles spatiales Les obstacles déterminant les échanges hyporhéiques ont une origine géomorphologique. En effet, grains de sable, galets, rochers, embâcles, forme du lit de la rivière, forme de la vallée sont autant de formes géomorphologiques imbriquées qui conditionnent les échanges hyporhéiques à différentes échelles. Cette hiérarchie conduit donc à des circulations d’eau « emboîtées les unes dans les autres » (Toth 1963, Creuzé des Châtelliers 1991, Stanford & Ward 1993, White 1993, Harvey & Wagner 2000, Malard et al. 2003 ; Poole et al. 2006, Buffington & Tonina 2009, Boulton et al. 2010) sur toute une hiérarchie d’échelles spatiales allant de quelques centimètres à plusieurs kilomètres. Ces échanges et circulations d’eau se caractérisent par des temps de transit dans les alluvions plus ou moins longs. Il s’agit du temps passé par l’eau de surface après infiltration dans les sédiments jusqu’à sa ré-émergence en surface. On imagine assez aisément que le temps de transit entre l’infiltration en amont d’un rocher et l’exfiltration à l’aval de ce même rocher sera plus court (quelques minutes) que celui ayant lieu entre l’amont d’une plaine alluviale et l’aval de cette même plaine sous effet d’une constriction de la vallée (quelques mois ou années). Le temps de transit est une propriété

Introduction fondamentale des échanges hyporhéiques car les réactions chimiques qui ont lieu dans les sédiments dépendent du temps de contact entre l’eau de surface qui s’infiltre et l’eau souterraine (Hendricks & White 1991, Duff & Triska 2000).

3.4. L’ampleur des échanges hyporhéiques dans les rivières en tresses Dans les rivières en tresses, différentes caractéristiques géomorphologiques du paysage conditionnent les échanges hyporhéiques. Cela peut par exemple être un confinement du chenal dû à un resserrement de la vallée, une rupture de pente du cours d’eau et la complexité morphologique du chenal et de la plaine telles que le nombre et l’agencement des formes sédimentaires (Hauer et al. 2003 ; Malard et al. 2002 ; Wondzell 2006). De grands écoulements souterrains, de l’ordre de plusieurs kilomètres, se produisent depuis l’amont des plaines alluviales relativement large et non contraint ni latéralement ni verticalement par un élément rocheux ou imperméable, jusqu’à l’aval de plaine alluviale qui est limité par les resserrements latéraux de la vallée et/ou verticaux dus à une remontée du lit rocheux (Figure 6). Les rivières en tresses sont des systèmes caractérisés par de fortes charges en sédiments. Cette épaisseur sédimentaire peut atteindre plusieurs dizaines de mètres dans certaines vallées et dans ce cas, les temps de transit peuvent atteindre des dizaines d’années. Les principales unités géomorphologiques du chenal dans les rivières en tresses sont représentées par des bancs de graviers qui s’épandent sur une longueur variable de quelques dizaines à quelques centaines de mètres (échelle hectométrique). Localement, à l’échelle du banc de graviers, l’eau de surface des chenaux (principaux et secondaires) s’infiltre en amont du banc de graviers (têtes), parcourt le banc de gravier puis s’exfiltre dans la partie aval du banc (queue).

Introduction

Figure 6 : Exemple d’écoulements souterrains à deux échelles spatiales dans les rivières en tresses. Ecoulements locaux s’effectuant entre têtes et queues de bancs de graviers (échelle hectométrique) ; écoulements plus longs s’effectuant entre amont et aval de plaine (échelle plurikilométrique).

Introduction

4. Structuration de la biodiversité dans les systèmes aquatiques Les individus de la même espèce pouvant vivre en commun à un moment de leur cycle de développement dans un même biotope et interagir sur les mécanismes de leur reproduction forment une population (Legay & Debouzie, 1985). Les populations de différentes espèces qui vivent à un endroit donné au même moment interagissent entre elles de multiples façons (prédation, parasitisme, compétition) forment une communauté (Vellend 2010). Communauté et population sont deux niveaux d’organisation biologique en écologie qui sont souvent utilisés pour répondre à des questions de structuration de la biodiversité (approche à l’échelle des communautés) ou pour répondre à des problématiques de dispersion des espèces dans le cadre de la conservation par exemple (approche à l’échelle des populations). Une population et une communauté sont rarement des entités isolées au sein d’un paysage, c’est pourquoi quand on s’intéresse aux processus de dispersion, on envisage un niveau d’organisation supplémentaire pour chaque entité ; la métapopulation est un jeu de populations d’une seule espèce qui sont liées par des mécanismes de dispersion (Levins 1969, Hanski et Gilpin 1991, Hanski 1998) et la métacommunauté est un ensemble toutes les communautés ‘locales’ constituées d’espèces qui dispersent d’une communauté locale à l’autre et peuvent interagir (Wilson 1992).

4.1. La communauté

Les théories d’assemblage des communautés Les meilleures estimations suggèrent entre 1,5 et 30 millions d’espèces différentes d’organismes vivant sur Terre aujourd’hui (Erwin 1982, May 1990, Morin 2011). Une infime fraction de cet ensemble d’espèces présentes dans un endroit de la terre constitue une communauté écologique, sur laquelle interagissent différents processus qui la déterminent, la maintiennent et définissent sa diversité biologique. Les écologistes ont longtemps cherché à expliquer les différentes formes d’assemblage (patrons), de distribution et de coexistence des communautés dans les systèmes. Aujourd’hui, la structuration et les modalités d’assemblage des communautés forment un point central dans l’étude de la biodiversité. Ainsi, presque tout en écologie consiste à identifier les processus et la façon dont ils s’organisent et interagissent à travers les échelles pour déterminer la variation de composition des communautés dans les paysages (Wiens 1989, Levin 1992, Leibold et al. 2004, Cottenie 2005, Vellend 2010).

Introduction

Les études portant sur la biodiversité et ses patrons se sont souvent concentrées sur des systèmes où prédomine la stabilité spatio-temporelle. Dans ces systèmes, l’approche de type « niche » (Grinnell 1917, Pocheville 2010) est la plus fréquente. Par niche, on définit l’ensemble des facteurs qui conditionnent l’existence d’une espèce à un endroit donné. Il s’agit de facteurs abiotiques comme la température, l’humidité, la présence de nourriture et d’abris, ou biotiques comme la présence de compétiteurs et de prédateurs. Darwin (1859) avait d’ailleurs déjà abordé dans ses écrits le concept de niche comme étant un complexe de facteurs écologiques créant une place pour laquelle les espèces évoluent et s’excluent (exclusion compétitive). Cette théorie place l’individu (l’organisme biologique) au centre, en termes de réponse (traits de réponse espèce- spécifique) aux variables écologiques (Hutchinson 1957, Lewontin 1978). Depuis, on a intégré dans cette théorie, la potentialité de ces organismes à construire eux-mêmes et influencer leur propre niche, c'est-à-dire à en modifier les caractéristiques biotiques et abiotiques (Odling-Smee 1996, 2003 ; Kylafis & Loreau 2011) en modifiant la physico- chimie du milieu par exemple.

Une autre approche, dite « neutraliste » définie par Hubbell (2001), a permis d’établir des hypothèses nulles pour tester les règles d’assemblage des communautés (Caswell 1976, Bell 2001, Hubbell 2001, Chave & Leigh 2002, Alonso et al. 2006) en important dans l’écologie la théorie neutre de la génétique des populations. Cette théorie sort du cadre « niche » en postulant que les communautés ne peuvent pas être appréhendées par des outils relatifs à l’habitat mais plutôt par l’étude des phénomènes stochastiques de dispersion et de changements aléatoires dans la composition des communautés (dérive écologique). Ce modèle considère, comme la théorie de la niche, l’individu au centre mais uniquement via ses modalités de naissance et de mort. Le modèle neutraliste prend en compte la dispersion aléatoire, la population totale des individus dans l’écosystème, le nombre total d’espèces et l’origine de nouvelles espèces. Cependant, il ne prend pas en compte les potentielles interactions entres les individus ; exclusion compétitive, prédation, parasitisme etc... La théorie neutraliste a facilité le développement d’hypothèses quantitatives nulles testables en écologie des communautés, en biogéographie, en écologie de la conservation et tout particulièrement dans les communautés où les caractéristiques spatiales comme les barrières physiques jouent un rôle important. La théorie neutre est une hypothèse nulle dans le sens où elle suppose qu’il n’existe pas de différence parmi les individus en termes de taux de survie ou dans leurs réponses aux forces biologiques agissant sur une communauté. Le point de vue neutraliste fournit une explication aux processus écologiques et évolutifs qui 34

Introduction contrôlent l’assemblage et la dynamique des communautés en prenant en compte le rôle de la dispersion et de la dérive écologique (processus aléatoires). Les communautés locales peuvent être liées par la dispersion d’espèces qui peuvent potentiellement interagir entre elles (Gilpin & Hanski 1991, Wilson 1992) et forment alors une métacommunauté.

La métacommunauté peut être définie comme une unité biogéographique évolutive dans laquelle les individus vivent et éventuellement s’éteignent. Elle peut être subdivisée en un ensemble de communautés locales qui sont liées par la dispersion de multiples espèces potentiellement en interaction (Leibold et al. 2004) ou par un réseau de communautés liées par un échange de migrants (Mouquet & Loreau 2002). Si l’on établit un parallèle avec la dynamique d’une population dans une métapopulation (Hanski 1998), une communauté locale dans une métacommunauté a une probabilité d’extinction non nulle et peut être recolonisée par des individus dispersant depuis des communautés voisines. Les systèmes écologiques ne sont pas tous équivalents en termes de stabilité, c’est pourquoi théorie de la niche et théorie neutre sont deux approches complémentaires mais qui s’affrontent encore quand on s’intéresse aux processus dont dépendent les assemblages des communautés.

Il n’en reste pas moins que l’on reconnait de plus en plus en écologie que les patrons de composition et de diversité des espèces sont déterminés par des interactions autour des quatre catégories de processus fondamentaux analogues à ceux de la génétique des populations, eux-mêmes dérivés de la théorie neutre de l’évolution moléculaire (Kimura 1968, 1983). Ces quatre catégories sont la sélection, la dérive écologique, la spéciation et la dispersion (Vellend 2010). Ce sont ces différents processus, agissant à diverses échelles spatio temporelles qui vont influencer le nombre, l’identité et la relation des espèces au sein d’une communauté. En effet, l’assemblage d’une communauté locale est de plus en plus perçu comme l’issue d’un jeu de processus qui opèrent sur des échelles spatiales et temporelles imbriquées (Ricklefs & Schluter 1993, Leibold et al. 2004, Lowe et al. 2006, Morin 2011).

Théorie de la niche et théorie neutraliste dans les écosystèmes aquatiques Le cadre de la métacommunauté a été appliqué seulement récemment aux écosystèmes aquatiques (Thompson & Townsend 2006, Brown & Swann 2010, Finn &

Introduction

Poff 2011, Brown et al. 2011). Toutefois, les prémices de ce concept, particulièrement l’importance fondamentale de la dispersion dans les assemblages des communautés et les patrons de diversité (Townsend 1989, Cooper et al. 1990, Palmer et al. 1996) sont depuis longtemps des thèmes importants pour les écologistes des milieux aquatiques.

Une caractéristique frappante des systèmes aquatiques est la structuration hiérarchique de leurs habitats (Frissell et al. 1986). Du plus haut niveau hiérarchique vers le plus petit, on distingue successivement : les bassins versants, les segments de vallée, les tronçons de rivières, et les unités morphologiques telles que les alternances radiers-mouilles ou les bancs de graviers. Cette structure fournit un cadre conceptuel pour comprendre et prédire la composition des communautés benthiques dans les paysages aquatiques (Poff & Ward 1990, Poff 1997, Townsend et al. 2003). Une des théories en milieu aquatique, développée par Poff (1997) consiste à voir la composition d’une communauté, en l’absence de contraintes de dispersion, comme le résultat de l’action d’une séries de filtres sélectifs qui opèrent à différentes échelles (Figure 7). A chaque niveau hiérarchique sont donc associés un ou plusieurs filtres (biotiques et abiotiques) et des processus qui conditionnent au niveau suivant la présence d’une espèce dans la communauté. Ce modèle d’assemblage de communautés fournit un cadre niche-orienté dans lequel l’abondance des espèces dans une communauté locale dépend des traits fonctionnels d’une espèce nécessaires pour passer à travers ces différents filtres d’habitat.

Figure 7: Schéma conceptuel de la distribution des espèces via différents filtres d’habitats associés à chaque échelle des systèmes aquatiques. Modifié d’après Poff (1997).

Introduction

Pendant longtemps, les rivières en tresses ont été perçues comme des écosystèmes tellement instables qu’on pensait que les communautés d’invertébrés benthiques rencontrées dans une bande active étaient peu diversifiées et renfermaient des espèces faiblement compétitrices (Percival 1932, Scrimgeour & Winterbourn 1989), et pour lesquelles prédominait une approche de type niche (Grinell 1917). Depuis quelques années, une vue plus intégrative des rivières en tresses s’est développée, incluant les habitats latéraux de la plaine et les chenaux secondaires. De même une meilleure appréhension des échelles d’écoulements a mis en évidence une mosaïque tridimensionnelle d’habitats (Malard et al. 2002 ; Ward et al. 2002). Ces travaux ont révélé que les secteurs en tresses d’une rivière étaient des « hot spots » de biodiversité (Stanford 1998, Ward et al. 1999, Arscott et al. 2005, Gray 2005, Karaus et al. 2005, Gray et al. 2006, Gray & Harding 2009, Tockner et al. 2010). La forte instabilité des chenaux induit un turnover rapide des habitats de surface (cycles de mise en eau très courts et imprévisibles) et crée une mosaïque changeante d’habitats extrêmement dynamique où les communautés sont a priori d’avantage sous la dépendance de phénomènes stochastiques (Gray & Harding 2009). Dans ce cas il semblerait donc que seule une très faible proportion de l’hétérogénéité spatiale ou temporelle des communautés benthiques puisse être attribuée à une compatibilité entre traits biologiques et caractéristiques de l’habitat ; la théorie de la niche atteindrait donc ses limites surtout dans des environnements aquatiques très dynamiques et où le hasard, la dispersion, et l’ordre d’arrivée des espèces pourraient jouer un rôle capital.

4.2. La population : variabilité génétique et dispersion

Dans la théorie… La notion de population renvoie à ses paramètres propres qui relèvent de la démographie. Ces paramètres sont différents de ceux des individus (plutôt de l’ordre physiologique) et permettent de décrire la population par son taux de mortalité, son taux de natalité, son sex-ratio et sa longévité potentielle. La population possède aussi sa définition génétique : il s’agit d’une unité de reproduction où a priori tous les individus ont la même probabilité de se croiser entre eux et se reproduisent par conséquent moins avec les populations voisines. Il s’agit de la définition de la population idéale définie par le modèle de Wright-Fisher, où cette population est de taille constante dans laquelle les

Introduction individus se reproduisent une unique fois et au même moment (générations non chevauchantes), et où chaque gène d’une génération donnée est la copie d’un gène de la génération précédente. Bien entendu, ce modèle reste théorique car il est peu concevable dans la réalité où les limites d’une population sont incertaines, floues, et dépendent de facteurs comme la mobilité, le mode de reproduction, les interactions entre individus et donc de la fitness des individus.

L’étude de la variabilité génétique des populations passe par l’étude de son polymorphisme génétique qui repose sur quatre forces évolutives: la mutation (crée la variabilité génétique par substitutions, insertions, délétions au niveau des nucléotides et dont le devenir dépend des autres forces), la dérive (variations stochastiques des fréquences alléliques, d’autant plus forte que les populations sont petites), la migration (ou flux de gènes via l’échange d’individus) et la sélection naturelle.

Ce sont les changements dans le « patrimoine génétique de la population » c'est- à-dire les changements alléliques dans une population, qui vont permettre de retracer historiquement son parcours démographique. En effet, les approches de coalescence (Kingman 1982, Donelly & Tavare 1995, Kingman 2000) permettent rétrospectivement de suivre l’évolution de tous les allèles d’un gène donné trouvés à l’intérieur d’une population, jusqu’à une seule copie ancestrale en prenant en compte les évènements historiques qu’a vécus cette population (effets fondateurs, bottlenecks).

Dans le paysage… Les individus subissent leur paysage de différentes façons ce qui aboutit à l’établissement spatial de populations continues ou organisées en métapopulations. Dans le cas de populations continues, il n’y a a priori aucun effet limitant du paysage sur la dispersion des individus ; il en résulte des populations faiblement structurées, ou bien structurées par un simple effet d’isolement par distance (IBD, isolation by distance, Wright 1943, Slatkin 1993) où les individus les moins proches ont moins de probabilité de se reproduire entre eux. Les métapopulations (Levins 1969, Hanski 1998) sont définies comme des groupes de populations locales où les mouvements des individus sont possibles entre les différents « patchs » d’habitat (Hanski & Simberloff 1997). Ces mouvements d’individus entre patchs, donc de flux de gènes, ont des effets démographiques importants dans le sens où ils permettent le maintien des patchs (effet « rescue » de recolonisation qui empêche l’extinction d’un patch populationnel). La

Introduction configuration métapopulationnelle est courante puisque les paysages sont naturellement fragmentés et le deviennent de plus en plus sous la pression anthropique. La fragmentation des habitats a été identifiée comme l’une des causes majeures de perte de biodiversité (Vitousek et al. 1997) et généralement, un paysage trop lourdement fragmenté précède l’extinction d’une espèce (Ceballos & Ehrlich 2002, Keyghobadi 2007). Il y a par conséquent un enjeu majeur aujourd’hui pour les généticiens de la conservation à détecter des discontinuités génétiques dans les populations et déterminer la relation entre ces discontinuités et les caractéristiques paysagères et environnementales. Cette approche à l’interface entre écologie du paysage et génétique des populations a donné lieu à une discipline à part entière, la génétique du paysage (Manel et al. 2003) à l’heure actuelle en pleine expansion (Storfer et al. 2007, 2010).

5. La connectivité en milieu aquatique La connectivité d’un paysage est le degré avec lequel celui-ci peut faciliter ou empêcher le mouvement des individus entre différents patchs de ressources. Défini comme un élément vital pour le maintien des populations (Taylor et al. 1993), le concept de connectivité prend en compte un cadre structurel et fonctionnel. Structurel parce que la connectivité correspond aux attributs physiques d’un paysage (le réseau) et fonctionnel parce que la connectivité fonctionnelle détermine la réponse des individus à la structure du paysage (l’utilisation du réseau par les organismes) (Taylor et al. 1993, Goodwin 2003, Storfer et al. 2007). La connectivité structurelle d’un paysage est fondée sur la matrice de ce paysage. On entend par matrice, au sens métapopulationnel, tout ce qui entoure dans le paysage les patchs d’habitat favorables aux individus ; elle permet plus ou moins la dispersion mais en aucun cas le cycle de vie des individus. La connectivité fonctionnelle est estimée par le flux net d’individus dispersant entre patchs du paysage (Lowe & Allendorf 2010). Cette connectivité peut être diminuée par des modifications de structure du paysage via des phénomènes d’isolement des patchs, d’altération de la qualité de la matrice mais aussi par des processus génétiques tels qu’une diminution de diversité génétique et augmentation de la consanguinité. L’ensemble de ces phénomènes peut alors jouer sur la connectivité fonctionnelle en favorisant par exemple des comportements de philopatrie (Baguette et al. 2012).

Les paysages aquatiques présentent des structures physiques hétérogènes. Différentes entités peuvent être distinguées au sein des paysages fluviaux: le milieu

Introduction lentique (grands lacs, étangs connectés ou non connectés au chenal principal), le milieu lotique caractérisé par les eaux courantes et le milieu souterrain pouvant intégrer les environnements karstiques et poreux. Dans la synthèse ci-après, le choix a été fait de se concentrer sur la connectivité au sein des réseaux dendritiques des milieux de surface et la connectivité dans les réseaux souterrains.

5.1. La connectivité au sein des réseaux dendritiques L’organisation des cours d’eau peut être représentée sous la forme de réseau dendritique, composé d’une racine principale et de nombreuses ramifications (Frissell et al. 1986 ; Campbell Grant et al. 2007). La connectivité dans ce type de système est très spécifique puisqu’elle s’effectue dans un paysage unidimensionnel déterminé par cette structure longitudinale du réseau dendritique (Campbell-Grant et al. 2007 ; Chaput- Bardy et al. 2008). Frissell et ses collaborateurs (1986) ont décrit la structure de ce réseau comme étant un ensemble hiérarchisé constitué d’emboîtements d’habitats c'est- à-dire, les rivières, les segments (tronçons) de rivières, les seuils-radiers-mouilles et les microhabitats. Dans le cas des réseaux dendritiques, plusieurs modèles ont été développés pour comprendre les patrons de diversité génétique des taxons aquatiques (Figure 8)

Le « Stream Hierarchy Model » (Meffe & Vrijenhoek 1988, Hughes 2009) postule que la structuration génétique des populations suit la structure de connexion entre rivières et reflète les contraintes imposées par l’architecture du bassin versant (Rissler et al. 2004, Lowe et al. 2006). En effet, un bassin versant est divisé en sous bassins versants, eux-mêmes formés de différentes unités. Deux populations au sein d’une rivière seront ainsi plus proches génétiquement que deux populations provenant de deux rivières distinctes. Ainsi, plus les échelles considérées sont grandes, plus la différenciation génétique entre les populations est élevée. Certains patrons génétiques de populations d’espèces de poissons (Avise 2000) et de crustacés (Cook et al. 2002) sont effectivement explicables par cette configuration et calquent parfaitement au réseau dendritique. Toutefois chez d’autres espèces de poissons (Hurwood & Hughes 1998, Waters et al. 2001) et de crustacés (Hurwood & Hughes 2001), les patrons génétiques ne reflétaient pas l’architecture du réseau. Cette absence de concordance a été attribuée aux aménagements entre bassins d’origine anthropique (Hurwood & Hughes 1998, Waters et

Introduction al. 2001) et à une dispersion terrestre entre les cours d’eau lorsque le degré d’humidité le permettait comme par exemple chez une crevette Atyidae (Hurwood & Hughes 2001).

Le modèle IBD (isolation by distance) (Wright 1943, Slatkin 1993) est inévitable dans les systèmes aquatiques: les populations (ou les individus) les plus proches entre elles sont plus susceptibles d’échanger des gènes entre elles et sont donc plus connectées que celles qui sont distantes. Ce modèle peut expliquer le fait qu’il puisse exister une diminution générale de connectivité (donc une augmentation de différenciation génétique) avec l’augmentation de la distance géographique.

Il existe dans les systèmes aquatiques un phénomène de dérive des organismes vers l’aval qui biaise le flux de gènes dans ce sens du fait du transport passif des individus par le courant (Morrissey & de Kerckhove 2009), ce qui isole d’autant plus les populations situées à l’amont des réseaux dendritiques (les populations de sources). Les populations d’amont de rivières sont donc très spécifiques : en recevant moins de migrants et en présentant souvent des configurations en patchs de petites populations, elles sont donc plus vulnérables à la dérive génétique (Fraser et al. 2004). Pour ces populations d’amont, un modèle particulier a été développé ; le « Headwater Model » (Finn et al. 2007, Hughes et al. 2009, Finn et al. 2011, 2013) (que l’on pourrait traduire par « modèle des têtes de bassin »). Ce modèle, qui s’applique aux espèces qui sont plutôt spécialistes des sources et souvent capables de mouvements terrestres, propose (par opposition au Stream Hierarchy Model) que les populations de tête d’un bassin versant ne soient pas nécessairement plus connectées avec celles de leur propre bassin versant, qu’avec celles de la tête du bassin versant adjacent au niveau de la ligne de partage des eaux.

En revanche, dans le modèle IBD, la partie aval du réseau reçoit plus de gènes. Ceci corrélé à une augmentation de taille d’habitats de l’amont vers l’aval (augmentation de la largeur du lit de la rivière) se traduit par l’établissement de populations continues avec une plus forte connectivité dans les parties aval (Hughes et al. 2009). La structuration génétique de ces populations de grande taille est plutôt explicable par un « modèle de panmixie » (Wright 1943) où les individus ne sont pas limités dans la dispersion et ont tous a priori la même probabilité de se rencontrer et se reproduire. En résulte donc des populations fortement connectées entre elles et génétiquement homogènes.

Introduction

Enfin, il existe un dernier concept de configuration génétique rencontré dans les réseaux dendritiques décrit par le « Death Valley Model » (Meffe & Vrijenhoek 1988, Hughes et al. 2009). Il s’agit de populations fixes d’espèces de surface qui n’ont aucune capacité de dispersion terrestre, telles celles trouvées dans des petits « trous d’eau » isolés tout le long du linéaire de la rivière, sans aucune autre connexion hydrologique que le maintien en eau par l’eau souterraine. Ces populations peuvent se retrouver isolées pendant de longues périodes, sans aucun moyen d’échange entre elles et devenir très fortement différenciées génétiquement. Dans ce cas précis il n’y a aucune corrélation entre la distance génétique et la distance géographique, c'est-à-dire aucune IBD détectable.

Introduction

Figure 8 : Patrons génétiques attendus pour différents modèles de connectivité aquatique. La connexion de la rivière est représentée selon une rivière partagée en deux sous bassins versants où les points sont les sites échantillonnés. Le graphique en barres indique la quantité relative de variation génétique expliquée par partitionnement de la variance totale en intra (W, « within ») et inter (B, « between ») sous bassins versants. Pour le modèle « Headwater », G et S indiquent respectivement géographie et rivière.

Les corrélations montrent la différenciation génétique deux à deux (GD, ou FST) en fonction de la distance linéaire de la rivière (SD). D’après Hughes et al. (2013).

Introduction

5.2. La connectivité des systèmes souterrains Le réseau aquatique continental, le plus méconnu et sous-estimé en termes de biodiversité, est le système souterrain dont la structure peut s’apparenter à celle d’un réseau associant des grands pores et des petits pores. A l’heure actuelle, encore peu de choses sont connues sur sa connectivité fonctionnelle. Les études qui portent sur la structuration génétique des populations en milieu souterrain ont essentiellement été menées dans les réseaux karstiques mais sont absentes de la littérature en ce qui concerne le milieu hyporhéique pour lequel seules des hypothèses peuvent être émises.

Le « milieu poreux en grand » est représenté par les cavités, figures et conduits des aquifères karstiques. Ces systèmes constituent un réseau continu, similaire à celui observé dans les milieux d’eau courante (lotiques) avec des drains principaux et secondaires. Cependant, la continuité hydrologique n’est pas nécessairement pérenne et a lieu lorsque le niveau d’eau de l’aquifère est suffisamment élevé. Dans ce cas, ce type de structure peut s’apparenter à des milieux lentiques connectés (tels les lacs ou les zones humides connectées par des affluents) et dans lesquels les populations souterraines peuvent présenter une configuration métapopulationnelle (Levins 1969). Cette connectivité hydrologique a été montrée comme un important paramètre permettant la connectivité des populations et le flux de gènes chez les espèces stygobies de différentes sous-régions d’un réseau karstique (Kane et al. 1994, Sbordoni et al. 2000, Verovnik et al. 2004, Buhay & Crandall 2005, Finlay et al. 2006, Buhay et al. 2007, Venarsky et al. 2009).

La zone hyporhéique, par opposition au karst, correspond au « milieu poreux en petit ». La dispersion des organismes au sein de la zone hyporhéique est attendue comme étant intermédiaire entre celle des milieux lotiques (d’eau courante) et celle des milieux lentiques isolés (comme par exemple des étangs temporaires sans aucune connexion). Dans ce contexte, la structure génétique des populations peut effectivement s’apparenter à celle du milieu de surface en termes de connexions hydrologiques mais avec toutefois une contrainte supplémentaire : la dispersion ne se fait a priori que dans des conditions de continuité sédimentaire propices aux individus souterrains. Il semble donc primordial que la matrice sédimentaire soit en place et soit continue, pour que les organismes souterrains puissent disperser. Une rupture de cette matrice (comme celle pouvant être induite par les canyons des rivières en tresses) peut entraîner l’arrêt de la dispersion des individus donc du flux de gènes, puisqu’aucune autre voie ne peut être empruntée. Ce phénomène peut donc favoriser la différenciation génétique entre les populations.

Introduction

Dans l’approche de ce travail de thèse, un parallèle entre la structure des réseaux dendritiques de surface et hyporhéique a été établi. La zone hyporhéique suit en filigrane le réseau dendritique de surface mais elle peut présenter en son sein une forte hétérogénéité en termes de porosité et perméabilité (Malard et al. 2002). Par ailleurs, les endroits affectés par la géomorphologie de la rivière, qui joue sur la continuité et l’épaisseur de la matrice sédimentaire, peuvent mener à une structure de la zone hyporhéique en pointillés. La continuité de la zone hyporhéique est vraisemblablement plus impactée dans les parties montagneuses traversées par le cours d’eau que dans les zones de plaines situées en aval. Dans ces dernières, il est également envisageable que la dispersion latérale dans les nappes alluviales puisse favoriser la similarité génétique entre deux rivières adjacentes.

Matériels et méthodes

OBJECTIFS ET ORGANISATION DU DOCUMENT

L’objectif général de ce travail est d’évaluer dans les rivières en tresses, la réponse à la dynamique des écoulements en termes de structuration des communautés, la taille d’une population souterraine et la réponse en termes de structuration génétique des populations à la fragmentation de la zone hyporhéique.

Objectif n°1

Le premier objectif consiste à évaluer dans quelle mesure la structure hiérarchique des écoulements hyporhéiques dans les rivières en tresses peut structurer les communautés d’invertébrés benthiques et hyporhéiques. On rappelle qu’à l’échelle de la vallée, se produisent les écoulements hyporhéiques kilométriques (entre amonts de plaine non contraintes et avals de plaine contraintes par un resserrement), et, qu’imbriquée dans cette échelle se situe l’échelle des bancs de graviers, correspondants à des écoulements hyporhéiques hectométriques. Ces différents écoulements génèrent à chaque échelle des filtres d’habitat. Les écoulements à l’échelle de la vallée sont majoritairement associés à des remontées généralisées d’eau souterraine dans les avals de plaine qui apportent une eau plus froide en été et permettent des conditions de permanence en eau et de diversité d’habitats plus importants dans la plaine. Les écoulements à l’échelle du banc de graviers sont plus actifs biogéochimiquement que les « grands écoulements ». C’est en effet à cette échelle que se régule la distribution du carbone organique, de l’oxygène dissous et des nutriments. Ces deux niveaux hiérarchiques créent donc des filtres qui se superposent et agissent sur les organismes invertébrés dont le développement est sensible à la température, à la permanence en eau, à l’apport de nutriments et pour lesquels on attend des réponses spécifiques à chaque taxon. Ainsi, l’effet de l’écoulement souterrain à l’échelle d’une plaine alluviale qui devrait maintenir des conditions de permanence en eau donc favoriser des groupes tels que les poissons et les macro-crustacés mais, en revanche ne devrait pas affecter la distribution de taxons qui possèdent des formes de résistance à la dessiccation ou des stades aériens. Enfin, l’effet généralisé des remontées d’eau souterraines à l’échelle de la vallée peut jouer sur la structuration verticale des communautés en facilitant ou en inhibant l’entrée dans la zone hyporhéique des taxons de surface par exemple. C’est dans ce contexte que nous avons cherché à mettre en évidence les effets cumulés des deux types d’écoulements en Objectifs et organisation du document

établissant des prédictions sur les patrons physico-chimiques et taxonomiques. Ce travail fait l’objet d’un article soumis, présenté dans le Chapitre 1.

Objectif n°2

Lorsque l’on travaille sur les organismes de la zone hyporhéique, des questions se posent sur les effectifs peuplant ce milieu. La zone hyporhéique est un environnement que l’échantillonneur ne voit pas lorsqu’il est sur le terrain et qui reste peu connu dans la littérature des écosystèmes aquatiques. Les approches utilisées dans la littérature pour estimer la taille des populations en milieu terrestre et aquatiques passent parfois par la méthode de capture-marquage-recapture (CMR), lorsque les organismes sont suffisamment gros et donc « recapturables ». Dans le cas des organismes invertébrés souterrains, cette approche n’est pas réalisable mais il reste néanmoins possible d’estimer le nombre d’individus d’une population en accédant génétiquement à un de ses paramètres fondamentaux qui est la taille efficace (Ne). La taille efficace est l’un des paramètres les plus importants en biologie évolutive, écologie et biologie de la conservation. Elle est définie comme le nombre d’individus qui se reproduisent dans une population dite « idéale » c’est à dire panmictique avec un sex-ratio de 1 et où les générations ne se chevauchent pas. Connaitre ce paramètre permet d’évaluer les effets de la dérive génétique et de la sélection naturelle aussi bien que leurs conséquences sur la viabilité de la population en termes de perte de diversité génétique et l’augmentation de la consanguinité. L’estimation de la taille efficace passe par l’évaluation de la diversité génétique en utilisant par exemple des marqueurs microsatellites. Cette partie du travail a consisté à développer dans un premier temps des marqueurs microsatellites pour une espèce cible, Proasellus walteri, puis à évaluer la taille efficace de populations de P. walteri sur deux sites d’une même rivière. Ceci fait l’objet d’un article soumis, présenté dans le Chapitre 2.

Objectifs et organisation du document

Objectif n°3

Le troisième objectif a consisté à tester le rôle de la géomorphologie des rivières en tresses sur la structuration génétique de populations d’organismes souterrains. La dimension longitudinale des paysages aquatiques depuis longtemps étudiée a révélé que les patrons de connectivité y étaient très particuliers car contraints par l’aspect unidimensionnel des réseaux dendritiques. De ce phénomène, émergent des patrons génétiques caractéristiques tels qu’une diversité génétique plus importante à l’aval et une structuration des populations par l’IBD. La structure génétique des populations est le résultat de la configuration du paysage aquatique et des traits d’histoire de vie des organismes dont fait partie la dispersion Des organismes dispersant par voie aérienne au stade adulte peuvent contrecarrer les effets du phénomène de dérive unidimensionnelle et présentent au sein de leurs populations une faible structuration génétique. En revanche, pour des organismes ne possédant pas de stade ailé dont la dispersion se limite seulement à de faibles mouvements intra-rivière, la structuration génétique des populations est sous la dépendance du paysage environnant. La dimension verticale des paysages aquatiques incluant les eaux souterraines a été longtemps sous-estimée et aucune idée précise ne s’impose à l’heure actuelle sur les patrons de connectivité au sein de ces systèmes, bien que cette dimension soit associée au réseau dendritique. La relative continuité d’une rivière en surface et de la zone hyporhéique en milieu souterrain n’est vraisemblablement pas équivalente. C’est particulièrement le cas dans les rivières en tresses où la dynamique géomorphologique joue un rôle important dans la genèse d’une matrice sédimentaire d’épaisseur variable. Les resserrements de vallée créent des canyons où la couche d’alluvions peut être fortement amincie, voire totalement érodée. La fréquence de secteurs en canyons étant plus importante dans les parties montagneuses de ces rivières, il doit par conséquent exister une vraie différence de connectivité entre les secteurs en montagne et les secteurs en plaine des rivières. Le travail réalisé dans cet objectif consiste à évaluer dans quelle mesure les patrons génétiques classiques rencontrés en surface se retrouvent en milieu hyporhéique et à tester si la structuration génétique de P. walteri reflète les différences géomorphologiques plaine / montagne. Ce travail fait l’objet du Chapitre 3, présenté dans ce manuscrit sous la forme d’un article en préparation.

Matériels et méthodes

MATERIELS ET METHODES

Pour remplir les objectifs posés dans ce travail, différentes étapes de sélection de sites et plusieurs campagnes d’échantillonnage ont été menées et sont décrites dans cette section. Une zone d'étude a été définie au sein du bassin versant Rhône-Drôme- Durance à l’intérieur de laquelle six rivières ont été sélectionnées et échantillonnées pour répondre à l’objectif 1 et où trois rivières ont été retenues et échantillonnées pour répondre aux objectifs 2 et 3 (Figure 9).

Figure 9 : Rivières de la zone d’étude et échantillonnages menés dans le cadre de ce travail.

Matériels et méthodes

1. Géomorphologie et communauté : méthodes utilisées

1.1. La prospection La première phase du travail a débuté par une sélection rigoureuse des sites utilisés pour répondre au premier objectif de cette thèse. Cette première étape de sélection des sites d’échantillonnage a consisté à rechercher 12 sites au sein de la zone d’études du programme « Rivières en tresses » présentant les caractéristiques suivantes : 1) existence d’une large bande active en amont de plaine, non contrainte présentant de multiples chenaux (zones d’infiltration potentielle) suivie directement à l’aval, en fin de plaine ; 2) d’une bande active contrainte latéralement et/ou verticalement par un affleurement rocheux indiquant une fermeture souterraine de la plaine (zone d’exfiltration potentielle) (Figure 10, Figure 10 bis). Cette recherche a été effectuée à partir d’un système d’information géographique (SIG) couvrant les bassins versants de la Drôme, du Roubion, du Lez, de l’Eygues, de l’Ouvèze et de la Durance. Ce SIG comprend des photographies aériennes (Orthophotos, échelle 1 :25000), le réseau hydrographique, un modèle numérique de terrain, des cartes géologiques, une carte des formations du Quaternaire et la liste des secteurs retenus dans le cadre du projet « Rivières en tresses ». Au total, 60 sites potentiels, répartis au sein d’une trentaine de secteurs, ont été repérés et validés sur le terrain. Parmi ces 60 sites, 12 sites présentant chacun une bande active non contrainte en amont et contrainte en aval (soit 24 bandes actives) ont été retenus (Figure 9).

Matériels et méthodes

Figure 10 : Exemple de sélection de sites sous SIG présentant en amont de plaine une large bande active non contrainte (zone d’infiltration potentielle) et en aval de plaine une bande active contrainte latéralement et/ou verticalement par un resserrement rocheux. Sélection présentée pour un site (A) du petit Buëch (au niveau de Lus la Croix Haute), (B) de l’Eygues (au niveau des Pilles) et (C) du Buëch (au niveau d’Eyguians).

Matériels et méthodes

Figure 10 bis : Exemple de sélection de sites. Vue de la bande active au niveau d’une zone d’infiltration en amont et d’une zone d’exfiltration à l’aval. (A) Petit Buëch au niveau de Lus la Croix Haute (B) L’Eygues au niveau des Pilles. Matériels et méthodes

1.2. Validation du modèle hydrologique Dans un premier temps, le mode d’écoulement (infiltration et exfiltration à différentes échelles) défini précédemment a été validé dès l’arrivée sur le terrain en en se basant sur l’utilisation de gradients hydrauliques verticaux. Le gradient hydraulique vertical (GHV) est une mesure sans unité qui permet d’indiquer le sens et l’intensité des échanges. Il s’évalue à partir de la différence de niveau entre la ligne d’eau de l’écoulement en surface et le niveau piézométrique. De façon simple, un GHV négatif (niveau piézométrique situé en dessous de la ligne d’eau de la rivière) indique une infiltration de l’eau de surface vers la nappe et un GHV positif indique une exfiltration d’eau de la nappe vers la surface (Figure 11). (Voir le matériel et méthodes de l’article 1 pour plus de précisions). Des GHV ont donc été mesurés dans chaque partie (amont de plaine et aval de plaine) dans chacun des 12 sites, pour 3 têtes et 3 queues de bancs de graviers choisis aléatoirement. Toutes les mesures ont été réalisées dans la bande active afin d’éviter de confondre les effets de la dimension latérale des hydrosystèmes avec ceux des échanges hyporhéiques (dimension verticale).

Figure 11 : Photos (A) de mise en place du tube piézométrique sur le terrain (B) d’un GHV positif.

Matériels et méthodes

1.3. Echantillonnage des communautés hyporhéiques et benthiques Pour mettre en évidence les patterns de biodiversité associés à chaque échelle d’écoulement (bande active, banc de graviers) mais aussi au niveau de la profondeur, la seconde phase de ce travail a consisté à échantillonner les communautés benthiques et hyporhéiques dans les 12 sites retenus.

Pour tester l’effet de la bande active (contrainte vs non contrainte), l’effet banc de graviers (tête ou queue de banc) et leur interaction sur la richesse et la densité des assemblages d’invertébrés dans la zone hyporhéique, un échantillon a été prélevé à 60 cm sur 3 têtes et 3 queues de bancs de graviers dans les 2 bandes actives, menant à un total de 144 échantillons (12 sites x 2 bandes actives x 6 échantillons par bande active), (Figure 12). Ce même design a été appliqué en surface pour les communautés benthiques, à la différence que deux échantillons supplémentaires ont été collectés dans le chenal au niveau des radiers attenants aux têtes et queues des bancs échantillonnés pour les échantillons hyporhéiques (total des échantillons benthiques : 12 sites x 2 bandes actives x 12 échantillons par bande active soit 288 échantillons.

Pour tester l’effet de la profondeur, de la bande active (non contrainte en amont de plaine vs contrainte en aval de plaine) et leur interaction sur la richesse et la densité des assemblages d’invertébrés de la zone hyporhéique, un échantillon a été collecté dans les deux bandes aux profondeurs de 30, 60 et 90 cm sur 3 têtes et 3 queues de bancs de graviers sélectionnés lors de la vérification du contexte hydrologique à partir des GHV. Un total de 216 échantillons hyporhéiques a été collecté (12 sites x 2 bandes actives x 3 queues de bancs de graviers x 3 profondeurs), (Figure 12).

L’hyporhéos a été échantillonné à l’aide d’une pompe Bou-Rouch (Bou & Rouch 1967) ajustée sur un tube de 170 cm de hauteur et de 2,5 cm de diamètre interne. Cinq litres d’eau souterraine ont été pompés (contenant les organismes) et ensuite filtrés dans un filet de vide de maille de 200 μm. Le benthos a été échantillonné à l’aide d’un échantillonneur de Hess de 40 cm de diamètre, couvrant une surface de 0,125 m2, et équipé d’un filet de maille de 200 μm. Matériels et méthodes

Figure 12 : Echantillonnage de l’hyporhéos en tête et queue de bancs de graviers dans les bandes actives contraintes et non contraintes et vue transversale d’un banc de gravier indiquant les profondeurs d’échantillonnage.

1.4. Mesures physico-chimiques et chlorophylle Pour chaque point de prélèvement faunistique, les valeurs de conductivité électrique de l’eau, de la température, de l’oxygène dissous et du pH ont été enregistrées. Dans l’optique de déterminer la production autochtone dans chaque bande active, la chlorophylle a été mesurée par grattage une pointe de scalpel une zone d’environ 12 cm2 de périlithon sur 3 jeux de 5 galets pris aléatoirement dans chaque radier. L’analyse de la chlorophylle a été réalisée à l’IRSTEA de Lyon par spectrophotométrie après extraction à l’acétone selon la méthode de Lorenzen (1965).

Matériels et méthodes

L’échantillonnage selon la méthode Bou-Rouch (Bou & Rouch 1967)

Un tube en acier inoxydable marqué et muni d’une crépine est enfoncé dans le sédiment à la profondeur désirée. Une pompe est ensuite ajustée sur le tube pour collecter l’eau souterraine par pompage dans un seau ou directement dans un filet. Enfin, la récupération des organismes et sédiments contenus dans le volume d’eau pompée s’effectue par élutriations et décantations successives.

1.5. Tri et identification des invertébrés et analyse de la matière organique Les invertébrés des échantillons hyporhéiques ont été identifiés au LEHNA et les invertébrés des échantillons benthiques à l’IRSTEA de Lyon. Les invertébrés ont été identifiés jusqu’au niveau taxonomique le plus précis possible et confiés à des spécialistes pour certains groupes tels que les Oligochètes (M. Lafont), les Ostracodes (P. Marmonier), les Niphargidae, Salentinellidae et Syncarides (M. J. Dole-Olivier). Après tri et identification des invertébrés, la matière organique particulaire de chaque échantillon a été récupérée par élutriation pour la séparer du reste de sédiments fins, puis séchée à l’étuve. La matière organique particulaire séchée a ensuite été pesée puis acidifiée par ajout d’acide chlorhydrique pour éliminer les carbonates. Les échantillons acidifiés ont ensuite été replacés en étuve afin d’évaporer le surplus d’acide chlorhydrique. Une fraction de chaque échantillon a finalement été prélevée et broyée pour passage à l’analyseur élémentaire (effectué par L. Simon) afin de déterminer les proportions de carbone organique et d’azote. (Pour plus de détails techniques, se référer au matériel et méthodes de l’article 1). Matériels et méthodes

1.6. Approche statistique choisie Le modèle conceptuel des écoulements hyporhéiques emboîtés montre à quel point il est important de considérer les différentes échelles spatiales. Nous avons utilisé un modèle mixte d’analyse de variance (Pinheiro & Bates 2000, Bolker et al. 2009) pour tester les contraintes géomorphologiques à l’échelle de la plaine (plaine non contrainte vs contrainte, soit l’échelle kilométrique), et à l’échelle du banc de gravier (l’échelle hectométrique) et de leurs interactions sur les variables physico-chimiques et taxonomiques (densités et richesses invertébrées). Pour bien prendre en compte la hiérarchie du plan expérimental, l’unité « banc » a été imbriquée dans l’unité « plaine » elle-même imbriquée dans l’unité « site » qui constitue le plus haut niveau hiérarchique. Le site a été par ailleurs traité comme un facteur aléatoire car nous avons choisi 12 sites parmi n sans qu’il soit possible de contrôler les différences entre ces sites.

2. Géomorphologie et populations : modèle biologique et outils d'étude

2.1. Modèle biologique d’étude

Le genre Proasellus Le genre Proasellus (Dudich, 1925) appartient à l’embranchement des Arthropodes, au sous embranchement des Crustacés, à la classe des Malacostracés, à la sous-classe des Eumalacostracés, au super-ordre des Péracarides et l’ordre des Isopodes. Ce genre s’est fortement diversifié dans les eaux souterraines dans lesquelles il contient plus d’espèces que dans les eaux de surface (Juberthie & Decu 1994). Il comprend approximativement 120 espèces formellement décrites dans la littérature qui sont réparties en Europe et autour de la Méditerranée. La taxinomie morphologique de ce genre est fondée sur les organes copulateurs des mâles, plus précisément sur la morphologie du pléopode II (Racovitza 1922) qui a permis de définir 9 lignées : coxalis, ortizi, beticus- meridianus, slavus, cavaticus, hermallensis, pavani, anophtalmus et slovenicus (Sket 1965 ; Henry & Magniez 2003). Certaines de ces lignées contiennent des espèces de surface (coxalis, ortizi, beticus-meridianus). La lignée cavaticus compte aujourd’hui 9 espèces toutes anophtalmes: P. cavaticus, P. valdensis, P. walteri, P. Matériels et méthodes strouhali putaneus, P. strouhali strouhali, P. franciscoloi, P. synaselloides, P. maleri, et P. rouchi. Parmi ces 9 espèces formellement décrites, P. walteri a été choisi comme modèle biologique d’étude, sa présence ayant été documentée dans la zone d’étude (Henry 1976).

Proasellus walteri (Chappuis 1948) P. walteri (Figure 13) est une espèce stygobie de très petite taille (environ 2.5 mm), à corps dépigmenté, grêle et filiforme, dont la longévité a été estimée à plus de 4 ans en laboratoire (Henry 1976). Cette espèce vit dans les interstices de la zone hyporhéique des rivières et dans les nappes s’écoulant dans des sédiments non consolidés où elle se nourrit de débris végétaux très fins et de biofilm. On rencontre cette espèce sur les bassins versants du Rhône et du Rhin, avec une aire de distribution s’étendant du sud de la France jusqu’en Alsace.

Figure 13 : L’espèce étudiée : P. walteri (A) individu en vue latérale, (B) individu en vue dorsale, (C) femelle (à gauche) et mâle (à droite) de P. walteri, (D) Vue de la partie postérieure d’un individu mâle où la paire de pléopodes II a été ôtée pour être ensuite montée entre lame et lamelle. Photos : C. Capderrey. Matériels et méthodes

Le travail remarquable d’Henry (1976) sur l’écologie de cette espèce représente la seule base de données biologiques (locomotion, alimentation, reproduction, répartition) disponible

pour cette espèce. Henry (1976) a recensé les échantillonnages de P. walteri ayant été menés dans les sous-écoulements des affluents situés en rive gauche du Rhône ; la Drôme à Die (Bou, 1973), l’Ouvèze dans sa partie amont (Bou 1971) et au niveau de Sablet (à la limite de la confluence avec le Rhône (Bou 1968)). Ces échantillonnages ont révélé un grand nombre d’individus capturés à Die et Sablet qui laissaient penser à l’existence d’importantes densités d’individus avec une distribution quasi-continue car présentes sur plus de 30 km de linéaire de l’Ouvèze. De manière générale, il semblait que P. walteri se cantonnait aux nappes alluviales quaternaires où l’espèce peut présenter de fortes densités dès lors que des alluvions lui sont favorables. Les observations sur son comportement ont révélé qu’il s’agissait de crustacés marcheurs, incapables de nager et à activité motrice normalement très réduite. « Ils aiment à se tenir immobiles sur des substrats solides, mais évitent l’argile. P. walteri est capable d’avancer ou de reculer à une vitesse extraordinaire, ce qui témoigne de son adaptation à la vie psammique, pourtant son maintien en eau libre est possible » (Henry 1976). En termes de reproduction, la femelle de P. walteri ne pond que 6 à 10 œufs qu’elle incube entre ses oostégites en position ventrale (il s’agit d’un marsupium formé par des expansions de chitine qui se développe en période de reproduction). Les jeunes (appelés « pulli ») éclosent après une incubation de 70 à 80 jours (temps moyen pour les espèces de la lignée cavaticus). L’espèce présente un rythme annuel de reproduction avec un pic de femelles ovigères trouvé en mars et avril.

Récemment, trois entités cryptiques ont été décrites à l’intérieur de la morpho- espèce P. walteri (Morvan et al. 2013), il s’agit de P. walteri_T058, entité restreinte au bassin versant du Rhin, P. walteri_T059 au bassin versant de la Saône (affluent majeur du Rhône) et P. walteri_T060 au bassin versant du Rhône de sa confluence avec la Saône jusqu’à son embouchure. C’est ce dernier taxon qui a constitué notre espèce de référence. (Figure 14) Matériels et méthodes

Figure 14 : Localisation des trois entités cryptiques à l’intérieur de la morpho-espèce Proasellus walteri.

2.2. Echantillonnage exploratoire Lors des premières campagnes de prospection, nous avons échantillonné plusieurs sites sur l’ensemble de la zone d’étude « Rivières en tresses » (Figure 9), dans le but d’établir précisément la répartition de P. walteri_T060 par rapport aux rivières retenues pour l’étude de l’impact de la géomorphologie sur la structuration génétique (objectifs 2 et 3).

2.3. Clarification systématique Le fort taux de cryptisme existant au sein du genre Proasellus (une même espèce morphologique qui regroupe en réalité plusieurs espèces moléculaires) a amené à analyser avec précision à la fois morphologiquement et moléculairement tous les individus récoltés lors des campagnes de prospection, dans le but de définir l’aire de distribution de P. walteri à une échelle fine, sur laquelle l’étude de génétique du paysage a été menée. Par ailleurs, sur l’ensemble des cours d’eau Matériels et méthodes pouvant être retenus, P. walteri peut se retrouver en sympatrie avec une espèce morphologiquement proche : Proasellus synaselloides (Henry 1963).

Ainsi, dans un premier temps, tous les individus récoltés ont été sexés, les mâles ont ensuite été disséqués, montés entre lame et lamelle et identifiés à l’espèce à l’aide d’un microscope (nous rappelons ici que morphologiquement l’espèce peut être identifiée sur la base de la forme des organes copulateurs des mâles soit la seconde paire de pléopodes). (Figure 13-D, Figure 15)

Figure 15 : Comparaison du pléopode II mâle chez deux espèces de la lignée cavaticus : P. walteri et P. synaselloides. (D’après Henry, 1976).

Dans un deuxième temps, il a été vérifié par séquençage que les P. walteri définis précédemment sur une base morphologique correspondaient bien à une seule et même espèce et non à un complexe d’espèces cryptiques non différenciables morphologiquement. Cette seconde étape était essentielle car les phénomènes de convergence morphologique sont importants en milieu souterrain sont supposés masquer l’existence de nombreuses espèces cryptiques (Trontelj et al. 2009). La recherche de potentielles espèces cryptiques a été menée à travers une approche phylogénétique, fondée sur l’utilisation de 2 gènes mitochondriaux (16S et CO1) et d’un gène nucléaire (28S). Cette recherche a été effectuée sur la une partie de l’aire totale de distribution de P. walteri_T060 (zone délimitée entre le bassin versant de la Drôme- Rhône-Durance, Figure 16). Matériels et méthodes

Ainsi, deux zones géographiques distinctes ont pu être établies sur la base de l’étude morphologique et moléculaire des individus récoltés lors des prospections ; une correspondant à la présence de P. walteri localisée essentiellement sur les affluents rive gauche du Rhône (Drôme, Roubion, Lez, Eygues, Ouvèze), et une autre correspondant à la présence de P. synaselloides localisée sur le bassin versant de la Durance (Figure 16).

Une fois que l’aire d’étude a été cernée, un échantillonnage plus précis a été mené sur des sites sélectionnés sur les rivières Drôme, Roubion et Ouvèze. Toutefois, la validation de l’étape précédente ne permet pas de s’affranchir d’une double vérification systématique. En effet, dès l’échantillonnage, les individus ont été rigoureusement identifiés morphologiquement puis validés comme étant P. walteri (ou non) sur la base d’une PCR d’identification (pour plus de détails, se référer au chapitre 2) : on utilise une amorce « sens » commune à tous les individus du genre Proasellus et deux amorces « anti-sens » (une pour P. walteri et une pour P. synaselloides), et on vérifie par électrophorèse sur gel d’agarose les bandes attendues (qui doivent correspondre à 458 paires de bases pour P.walteri et 217 paires de bases dans le cas de P. synaselloides), (Figure 17).

Matériels et méthodes

Figure 16 : Séparation sur critères moléculaire de l’aire de répartition de P. walteri et de P. synaselloides. (A) Phylogénie basée sur le gène nucléaire 16S montrant les deux clades de Proaselles (Arbre 16S rDNA, PhyML, modèle GTR), (B) Cartographie de l’aire de répartition sur le bassin versant Rhône-Durance.

Matériels et méthodes

Figure 17 : Discrimination sur gel d’agarose de P. walteri et P. synaselloides.

2.4. Etude de la variabilité génétique De nombreuses mesures de statistiques descriptives (« summary statistics », Lowe et al. 2004) sont calculées à partir des données génétiques pour obtenir des informations sur la structuration des peuplements, les taux de dispersion entre populations ou encore les tailles efficaces. Ces mesures sont calculées à partir des fréquences alléliques observées pour chaque population échantillonnée. Elles permettent de définir l’écart à l’équilibre de Hardy-Weinberg, écart pouvant être imputable à des phénomènes de dépression de consanguinité, d’effet Wahlund (excès d’homozygotes, consécutif à la subdivision de peuplements en populations discrètes qui échangent peu de gènes) ou dérive génétique. C’est par exemple le cas des F-statistics

(FIS, FIT et FST) définis par Wright en 1951, et leurs dérivés (Neigel 2002 ; Holsinger & Weir 2009), Gst (Nei 1973), θ-statistics (Weir & Cockerham 1984), et Rst (Slatkin 1985).

Depuis quelques années, le panel d’outils disponibles en génétique des populations s’est enrichi avec l’apparition de méthodes permettant de s’affranchir de certaines contraintes liées à l’utilisation de postulats théoriques, tels que l’hypothèse d’équilibre dynamique entre flux de gènes et dérive génétique, à la base de l’utilisation des F-statistics. Ces nouvelles méthodes sont regroupées sous l’appellation générale d’approches bayésiennes qui permettent d’estimer la probabilité d’un paramètre d’intérêt (exemple : probabilité d’assigner tel ou tel génotype à une population), sur la base des données observées et d’hypothèses a priori. Les approches bayésiennes ont permis le développement de méthodes largement utilisées en génétique du paysage, telles que le partitionnement des données génétiques encore appelé « bayesian clustering methods » (appliqué par le logiciel STRUCTURE développé par Pritchard et al. Matériels et méthodes

2000), ou l’estimation de tailles de populations (comme par exemple dans ONeSAMP développé par Tallmon et al. 2008).

Dans ce travail, les marqueurs génétiques utilisés sont des marqueurs microsatellites. Il s’agit de séquences d’ADN caractérisées par la répétition de motifs composés de 2 à 10 nucléotides et réparties dans l’ensemble du génome. Un microsatellite correspond à un locus (un emplacement sur l’ADN) et la variabilité nucléotidique à ce locus précis définit un allèle. Chaque individu eucaryote possède deux copies d’un locus avec sa propre version. Soit les deux copies sont identiques chez l’individu (homozygote) soit les copies présentent deux allèles différents (hétérozygote). C’est l’étude de la variabilité à chaque locus (i.e. le polymorphisme) qui renseigne sur les différences et donc les degrés de divergence entre individus et donc entre populations. En théorie, ces loci sont neutres, c'est-à-dire non soumis à la sélection naturelle, c’est pour cela qu’on utilise ces marqueurs pour obtenir une image des flux de gènes réels.

Conformément à la majorité des études de génétique du paysage (Storfer et al.

2010), nous avons utilisé l’indice FST comme mesure du degré de différenciation des populations et des méthodes bayésiennes pour estimer les tailles de populations de P. walteri sur deux sites de la rivière Drôme (Chapitre 2) et pour déterminer la structuration génétique des populations de P. walteri sur trois rivières (Chapitre 3)

2.5. La génétique du paysage : cadre théorique L’estimation directe de la connectivité fonctionnelle du paysage par le déplacement des individus peut s’avérer particulièrement difficile, même lorsque la taille des organismes le permet (Manel et al. 2003, Spear et al. 2005, Broquet 2006, Boulet et al. 2007, Storfer et al. 2007, Spear et al. 2010). En revanche, les récentes avancées dans les techniques de séquençage automatique et l’accès à des marqueurs génétiques neutres hautement polymorphes (Holderegger & Wagner 2008, Abdelkrim et al. 2009) ont autorisé le développement d’une grande variété d’outils génétiques permettant une estimation directe des flux de dispersion entre les populations (Vandewoestijne & Baguette 2004, Storfer et al. 2007, Broquet & Petit 2009) au sein d’une discipline en pleine expansion : la génétique du paysage (Manel et al. 2003). A l’interface entre écologie du paysage et génétique des populations, la génétique du paysage (Manel et al. 2003), vise à étudier les flux de gènes et les patrons de structuration génétique des populations en relation avec la composition et la configuration du paysage (Manel et al. 2003, Storfer et al. 2007). Cette discipline récente, connait un véritable essor et constitue un axe de recherche très prometteur en biologie de la conservation (Storfer et al. 2010, Matériels et méthodes

Seegelbacher et al. 2010). Elle permet de quantifier l’impact des variables environnementales sur les patrons de variation génétique, d’identifier les barrières aux flux de gènes ou encore de définir l’échelle optimale de conservation de la diversité génétique au sein des populations (Manel et al. 2003, Storfer et al. 2007, 2010), le tout reposant sur le concept de connectivité fonctionnelle (Keyghobadi 2007, Holderegger & Wagner 2008).

Une approche couramment employée en génétique du paysage consiste à utiliser les méthodes dites « overlay » (Anderson et al. 2010) directement issues de la génétique des populations. Elles reposent sur l’emploi d’un large panel d’outils permettant de caractériser la structure des populations (par exemple les méthodes de clustering développées par Pritchard et al. 2000, et de clustering spatialisés dévelopées par Jombart et al. 2008) et d’identifier les discontinuités génétiques (par exemple le « wombling » défini par Crida & Manel (2007), Safner et al. 2011). Cependant, même si certaines de ces méthodes intègrent une information spatiale (Jombart et al. 2008), elles considèrent principalement la donnée génétique en elle-même et permettent une comparaison a posteriori entre la structure génétique observée et la configuration du paysage. Il exite un deuxième type d’approche en génétique du paysage qui regroupe les méthodes de type « corrélatives » (Cushman et al. 2006, Manel et al. 2009). Ces méthodes permettent une utilisation simultanée des données génétiques et paysagères via des corrélations matricielles par exemple (Cushman et al. 2006, 2010, Holderegger & Wagner 2008, Legendre & Fortin 2010) pour tester l’influence directe de la configuration du paysage sur les flux de gènes.

Les méthodes que j’ai utilisées pour tester l’effet de la géomorphologie des rivières en tresses sur la structuration génétique de P. walteri sont empruntées principalement aux approches « overlay » (par exemple le « clustering » des populations) et dans une moindre mesure aux approches corrélatives (tests de Mantel simples et partiels).

Chapitre 1

CHAPITRE 1. La géomorphologie comme facteur structurant les communautés d’invertébrés

Le rôle des écoulements hyporhéiques à différentes échelles spatiales dans la structuration des communautés d’invertébrés

Article 1: Invertebrate distribution across nested geomorphic features in braided river landscapes

Chapitre 1

INVERTEBRATE DISTRIBUTION ACROSS NESTED GEOMORPHIC FEATURES IN BRAIDED RIVER LANDSCAPES

Running head: geomorphic features and stream invertebrates

C. Capderrey 1*, T. Datry 2, A. Foulquier 3, C. Claret 4, and F. Malard 1

1: LEHNA, UMR CNRS 5023, Ecologie des Hydrosystèmes Naturels et Anthropisés, Université Lyon 1, Bât. Darwin C, 43 Bd 11 Novembre 1918, 69622 Villeurbanne, France.

2 : UR-MAEP, IRSTEA, Lyon, Institut national de la recherche en sciences et technologies pour l’environnement et l’agriculture, 5 Rue de la Doua, 69626 Villeurbanne, France.

3 : UR-MALY, IRSTEA, Lyon, Institut national de la recherche en sciences et technologies pour l’environnement et l’agriculture, 5 Rue de la Doua, 69626 Villeurbanne, France.

4 : IMBE, UMR CNRS 7263, Institut Méditerranéen de Biodiversité et d’Ecologie marine et continentale, Aix-Marseille, Université de Marseille, cedex 20, F-13397, France.

* : Correspondence : Cécile Capderrey, LEHNA, UMR CNRS 5023, Ecologie des Hydrosystèmes Naturels et Anthropisés, Université Lyon 1, Bât. Darwin C, 43 Bd 11 Novembre 1918, 69622Villeurbanne, France. E-mail : cecile.capderrey@univ- lyon1.fr

Article soumis à la revue Freshwater Science

Chapitre 1

Abstract

River landscapes are increasingly viewed as a collection of nested geomorphic features, the hydrological effects of which juxtapose to create a mosaic of habitat conditions both in the surface stream and the hyporheic zone. However, few studies have examined how these effects might interact across spatial scales to shape biodiversity patterns. Here, we show that the combined hydrological influences of spatially nested geomorphic features on hyporheic invertebrate communities create complex faunal distributional patterns within the longitudinal and vertical dimensions of river landscapes. The study was conducted in 12 braided river valley segments belonging to tributaries of the Rhône River, France. Valley segments were bounded downstream by geological knickpoints so that bedform-induced exchange flows beneath gravel bars and riffles were predictably embedded in exchange flows occurring at the valley segment scale. In the upstream reach (UR) and downstream reach (DR) of each valley segment, invertebrates were collected at the heads and tails of gravel bars in the hyporheic zone and at the upstream and downstream ends of riffles in the surface channels adjacent to the bars. Patterns of vertical hydraulic gradient and specific conductance and the resulting spatial heterogeneity of temperature, dissolved oxygen and particulate organic carbon were consistent with theoretical models, suggesting that DR are key points of flow convergence and water mixing. In particular, specific conductance increased and temperature decreased more steeply along gravel bars in DR, suggesting that water from long hyporheic flow paths or lateral aquifers was discharging at the tails of bars in DR. Density hotspots for insect larvae corresponded to hyporheic patches located at the heads of bars in DR, which received highest organic matter inputs from localized downwelling of surface water and were not affected by inputs of cold water from long hyporheic flow paths or lateral aquifers. Density of epigean taxa at the tails of bars decreased more steeply with depth in DR than in UR, and that of hypogean taxa increased more steeply. Viewing local hyporheic communities as the outcome of a series of environmental filters operating over multiple exchange flows induced by nested geomorphic features provides a general framework which may foster our understanding of biodiversity patterns in river landscapes.

KEY WORDS: groundwater – surface water interactions, stream hierarchy, geomorphology, braided rivers, hyporheic zone, benthic and hyporheic invertebrates, temperature, particulate organic carbon

Chapitre 1

Introduction

Nearly everything in community ecology is about identifying processes and the way they interact across scales to determine variation in the composition of communities across a landscape (Levin 1992, Leibold et al. 2004, Vellend 2010). The assembly of local communities is increasingly viewed to result from a limited set of processes operating over a range of spatial and temporal scales (Leibold et al. 2004, Lowe et al. 2006, Morin 2011). In stream ecology, the nested habitat levels developed by Frissell et al. (1986) – hereafter referred to as watershed, valley segment, stream reach, and bedform units – has provided a useful hierarchical spatial framework for understanding and predicting the composition of benthic communities across river landscapes (Poff 1997, Townsend et al. 2003). In the absence of dispersal constraints among locales of a region, Poff (1997) suggested that the composition of local stream communities could be predicted as a function of a series of selective filters, including the abiotic environment and biotic interactions, which operated over multiple nested habitat levels.

Geomorphic features induce surface-subsurface water exchanges across a wide range of scales in gravel-bed rivers (Harvey & Wagner 2000, Poole et al. 2006, Buffington & Tonina 2009, Boulton et al. 2010, Fig. 1). According to the hyporheic corridor concept (Stanford and Ward 1993), valley segment-scale exchange flows (VEF) typically occur over distances of several km in alluvial valley segments, bounded at their downstream ends by a geologic knickpoint. Surface water downwells into the alluvium of extensive plains in upstream reaches (UR) and is forced to the surface in downstream reaches (DR) prior to entering confined valley segments such as canyons. Field studies of VEF in alluvial rivers have often found that advected channel water returns to the surface of alluvial plains at discrete locations rather than discharging homogeneously into the main channel (Malard et al. 1999, Wondzell & Swanson 1999, Poole et al. 2004, Doering et al. 2012). In addition, DR of bounded valley segments are key points of water mixing because valley constrictions also cause lateral groundwater in the orthofluvial zone to converge and mix with subsurface advected channel water within the hyporheic zone (Malard et al. 1999, Poole 2010). Embedded within these VEF, are bedform-scale exchange flows (BEF) which generally occur over distances < 100 m between the upstream and downstream ends of well-defined bedform units such as gravel bars, meander bends and riffle-pool sequence (Harvey & Bencala 1993, Tonina & Buffngton 2009). The hypothetical configuration of exchange flows within the longitudinal

Chapitre 1 dimension of valley segments implies that hyporheic sediments at the downstream ends of bedform units in DR are fed by water from both VEF and BEF (Fig. 1).

Knowledge of environmental filters associated with different exchange flow scales should foster our ability to understand and predict the effects of surface- subsurface water exchanges on the distribution of species in stream communities. Generally, BEF would be predicted to be more biogeochemically active than VEF because the availability of organic matter and/or terminal electron acceptors in many gravel-bed rivers rapidly decreases with increasing residence time of water in subsurface sediments (Morrice et al. 2000, Fisher & Welter 2005). Therefore, they might predominantly regulate the distribution of organic carbon, dissolved oxygen (DO) and nutrients, whereas VEF might have a major influence on water temperature, water permanency and habitat diversity within alluvial plains (Stanley et al. 1997, Malard et al. 2002). Water emerging from longer flow paths sustains base flow and its temperature can be substantially different from that of surface water. However, the effects of surface- subsurface water exchanges on environmental filters are likely to be contingent on the stream system under study: return of water from VEF to the surface stream in alluvial plains would decrease summer water temperature in temperate or Mediterranean systems whereas it would increase the temperature of surface water in glacial-fed rivers (Malard et al. 2001, Poole et al. 2008). Similarly, the effects of multi-scale environmental filters would be taxon-specific: the significance of VEF in maintaining permanent flow conditions should favor taxa sensitive to desiccation, such as fish and macro-crustaceans, but it is not predicted to affect the distribution of taxa possessing desiccation-resistance forms or aerial stages (Datry 2012). Although we have a general framework for considering how exchange flows operating at multiple scales might influence the distribution of species across river landscapes, predictions about the precise way in which exchange flows interact to determine community dynamics across space would be case-specific.

In this study, we examined the composition of benthic and hyporheic invertebrate assemblages across nested geomorphic features in braided rivers of the southern French Alps, using a hierarchical sampling design comprising three spatial levels: valley segments, stream reaches and bedform units. Local downwelling of surface water at the heads of bars was predicted to increase the organic matter content of hyporheic sediments in UR and DR (prediction 1), whereas inputs of cold water from long hyporheic flow paths or lateral aquifers were predicted to reduce water 71

Chapitre 1 temperature at the tails of bars in DR only (prediction 2). We hypothesized that insect larvae which need food resources and elevated temperatures for their growth and development would preferentially select organic matter rich habitats at the heads of bars in UR and DR, and avoid cold water habitats at the tails of bars in DR (prediction 3). Similarly, inputs of cold water at depth into the sediment at the tails of bars in DR (see prediction 2) were predicted to restrict the vertical penetration of epigean taxa into the sediments (prediction 4), thereby enabling the colonization of shallower sediments by competitively-inferior taxa belonging to the hypogean fauna (prediction 5).

Chapitre 1

Fig. 1: Upper panel: theoretical organization of surface-subsurface water exchanges in a downstream bounded unconfined valley segment. Middle panels: predicted distribution patterns of organic matter (prediction 1), temperature (prediction 2), and insects (prediction 3) in the hyporheic zone along the longitudinal dimension of valley segments. Lower panels: predicted vertical distribution patterns of epigean and hypogean taxa at the tails of bars in downstream and upstream reaches of valley segments.

Chapitre 1

Methods

Study sites

All 12 study sites were located in braided rivers belonging to tributaries of the lower Rhône River, France (Table 1, Fig. 2a). The cumulated length of braided reaches in the French River Rhône catchment reached 650 km in the early 21st century, with most located on the margins of the Southern Alps (Piégay et al. 2009). Elevation and mean annual river discharge at the 12 study sites ranged from 200 to 1018 m a.s.l. and 0.9 to 23 m3/s, respectively. River bed sediment at all sites consisted of a mixture of pebbles, gravels and sands, with high permeability ranging from 2.10-3 to 2.10-2 m/s (Water Agency 2013).

Table 1: Characteristics of the 12 valley segments. Annual river discharge at the sites was obtained by multiplying values of stream specific discharge from the nearest gaging stations by the catchment area upstream of sites.

At the highest level in the spatial hierarchy of stream habitats (Frissell et al. 1986), we defined a site as an unconfined alluvial valley segment of variable length bounded at its downstream end by a geologic knickpoint (Fig. 2b). The knickpoint was a bedrock outcrop near the streambed which caused a restriction in the width and/or thickness of alluvial filling. The braided river band was on average seven times wider at the upstream end of an unconfined alluvial valley segment than at the geologic knickpoint (Table 1). At the middle level in the hierarchy, we divided each unconfined valley segment into an UR with a braided band at least 50 m in width and a DR where the

Chapitre 1 braided band progressively narrowed prior to entering the knickpoint (Fig. 2b). This distinction was made because VEF are typically caused by longitudinal changes in the width and/or thickness of alluvial plains (Stanford & Ward 1993). In particular, hyporheic water and lateral groundwater are forced by geologic knickpoints to converge towards the surface of alluvial plains prior to entering confined valley segments (Baxter & Hauer 2000). At the lowest level in the hierarchy, we identified in both UR and DR replicates of a channel bedform unit consisting of a gravel bar with a riffle-pool sequence in the channel adjacent to the bar. This bedform unit is a characteristic geomorphologic feature of braided rivers which has been repeatedly shown to induce exchange flows between the head and tail of gravel bars (Dole-Olivier & Marmonier 1992, Dole-Olivier et al. 1997) as well as between the concave upstream end and convex downstream end of riffles (Thibodeaux & Boyle 1987, Creuzé des Châtelliers & Reygrobellet 1990, Hendricks 1993, Brunke & Gonser 1997). Gravel bars were selected randomly but in DR they were located at a distance < 500 m from the geologic knickpoint that marked the downstream end a of valley segment. The distance between gravel bars in UR and DR varied from 0.5 to 4.5 km (mean: 2.4 r1.3 km, n = 12), depending on the total length of the valley segment.

Fig. 2: A- Locations of the 12 unconfined valley segments along the tributaries of the Rhône River, France. B- Selection of hyporheic sampling locations at the heads and tails of gravel bars in the upstream and downstream reaches of each valley segment. C-

Chapitre 1

Cross sectional view of a gravel bar showing the locations and depth distribution of hyporheic samples.

Surface – subsurface water exchanges

Detailed understanding of exchange flows across multiple spatial scales in alluvial valley segments requires the incorporation of inferences of water routing and mixing from hydrogeological modeling approaches (Poole et al. 2004) and field measurements collected using natural and artificial groundwater tracers (Malard et al. 1999, Harvey & Wagner 2000, Weissmann et al. 2002). Such a multifaceted approach was not conceivably applicable to the 12 alluvial valley segments examined in the present study. Instead, differences in surface-subsurface water exchanges between UR and DR were assessed using measurements of vertical hydraulic gradients (VHG) and specific conductance of water. We acknowledge that these measurements alone are not sufficient to distinguish between mixing of hyporheic water from flow paths of different lengths and mixing of hyporheic water with groundwater from lateral aquifers. All measurements were taken in the main channel and side channels to avoid confounding variation along the lateral dimension of rivers with that induced by surface- subsurface water exchange. In both reaches of the 12 study sites, seven to eight VHG were measured at the heads of three gravel bars and at the tails of three other bars (Fig. 2b). A total of 1103 VHG measurements were taken. The differential head between hyporheic water and surface water was determined as the difference in height (cm) between the surface water level and hyporheic water level measured in a transparent tube inserted into the streambed to a depth of 30 cm (Lee & Cherry 1978, Dahm & Valett 1996). VHG was calculated as the differential head divided by 30 cm: negative VHG readings indicated potential downwelling of surface water, whereas positive readings indicated potential upwelling of hyporheic water. Specific conductance of water was also used as an indicator of water exchanges between the surface stream and hyporheic zone and/or groundwater inputs from lateral aquifers. The specific conductance of water in carbonated sediments is primarily determined by the concentrations of bicarbonates and calcium, which increase with increasing residence time of water in the subsurface (Cox et al. 2007). Thus, specific conductance is positively related to subsurface flow path length, although this relationship is not necessarily linear (Dole-Olivier & Marmonier 1992).

Chapitre 1

Sampling of water and invertebrates in the hyporheic and benthic zones

To test the effect of reach (UR versus DR), within-bar position (head versus tail of gravel bars) and their interaction on the taxonomic richness and density of invertebrate assemblages in the hyporheic zone, one sample was collected at a depth of 60 cm into the streambed at the three heads and three tails of bars in both reaches (Fig. 2c). The same sampling design was used for the benthos, except that two benthic samples were taken at the upstream and downstream ends of riffles adjacent to the bars. A total of 144 hyporheic samples (12 sites × two reaches × six samples per reach) and 288 benthic samples (12 sites × two reaches × 12 samples per reach) were collected. Hyporheic invertebrates were collected in the wetted stream by hammering a mobile pipe (2.5-cm internal diameter, 14-cm long screened area, 5-mm diameter holes) to a depth of 60 cm below the streambed. A Bou-Rouch pump was then used to extract 5 L of hyporheic water and sediments at a constant discharge rate of approximately 10 L/min (Bou & Rouch 1967). Collected water and sediments were elutriated and filtered three times through a 150-μm mesh net to ensure that no invertebrates were left in the samples. Benthic invertebrate samples were randomly collected using a Hess sampler (40 cm diameter, S = 0.125 m², 200-μm mesh). Benthic and hyporheic samples were preserved in 96% ethanol. Periphyton biomass was quantified by randomly collecting three sets of five stones at the head of each riffle. A 12-cm2 area of each stone was scraped with a scalpel and rinsed with water to remove periphyton. The algal suspension from each set of five stones was collected in propylene bottles and stored at 4 °C.

To test the effects of sediment depth, reach (UR versus DR) and their interaction on the taxonomic richness and density of invertebrate assemblages, one hyporheic sample was collected at both reaches from depths of 30, 60, and 90 cm into the streambed at the three tails of bars selected for VHG measurements (Fig. 2c). A total of 216 hyporheic samples (12 sites × two reaches × three tails of bars × three sediment depths) were collected using the same method as described above. Sampling was completed within three weeks from 28 June to 17 July 2010.

Physicochemical analyses and invertebrate identification

Specific conductance, temperature (WTW instrument: LF 330), DO (WTW instrument: OXI 330) and pH (WTW instrument: pH 330) of surface and hyporheic water

Chapitre 1 were measured in the field. Algal suspensions from the three sets of five stones collected at riffle heads were filtered through glass fiber filters (Whatman GF/C). Chlorophyll a was determined by spectrophotometry after extraction in acetone (Lorenzen 1965). The quantities of carbon (particulate organic carbon, POC) and nitrogen (particulate organic nitrogen, PON) in organic matter that was not attached to the sediment were determined for each 5-L hyporheic sample after invertebrates had been removed (see below). Samples were agitated and rinsed with ultrapure water to extract a mixture containing organic matter (not attached to the sediment) and a small quantity of fine sediment (<< 5 g dry sediment). This mixture was dried at 50 °C for 48 hours and ground into a fine powder with a pestle and mortar. Three replicate samples were weighed in pre-combusted 10 × 10 mm silver capsules and 1 M HCl acid added to remove inorganic carbon (“capsule method” in Brodie et al. 2011). Acid treatment consisted of repeated additions of up to 100-μl HCL, with the samples being dried in an oven at 50 °C between each acid addition. The incremental addition of acid continued until there was no visual evidence of effervescence. Once dry, the capsules were crimped and folded into tin foil to improve sample combustion. The organic carbon and nitrogen contents of replicate samples were then determined using a Thermo Flash EA1112 elemental analyzer (Thermo Scientific) calibrated using aspartic acid and nicotinamide as standards. A high organic reference material with known values was analyzed for each ten samples and values of 2.25 ± 0.037 (1 σ) for %N and 45.36 ± 0.41 (1 σ) for %C were obtained. The mean carbon and nitrogen contents of replicate samples were used to calculate the total amounts of organic carbon and nitrogen (in g per 5-L hyporheic sample) not attached to the sediment. All invertebrates from hyporheic and benthic samples were enumerated under a dissecting microscope. Invertebrates were identified to the lowest practicable level depending on their development and condition. Insects were identified to genus or family except when individuals collected from the hyporheic zone were early-instar larvae. Non-insect taxa were generally identified to order although some were identified to genus or species level. We distinguished between epigean and hypogean taxa. Epigean taxa were represented by insect larvae (i.e. Coleoptera, Diptera and the group Ephemeroptera – Plecoptera – Trichoptera, hereafter EPT) and the amphipod Gammarus. Hypogean taxa completed their entire life cycle in subsurface water (Gibert et al. 1994) and were represented by the amphipods Niphargus, Niphargopsis, Salentinella, Ingolfiella, the isopods Proasellus and Microcharon and the Bathynellacea. We also distinguished permanent aquatic taxa (hereafter PAT), defined as taxa that spend their

Chapitre 1 entire lifecycle in water (including hypogean taxa described above, Oligochaeta, Ostracoda, Cyclopoida, Harpacticoida and Nematoda).

Data analysis

A mixed-model analysis of variance (ANOVA; Pinheiro & Bates 2000, Bolker et al. 2009) was used to examine the effects of reach (UR versus DR), within-bedform position and their interaction on VHG, physicochemical parameters and the taxonomic richness and density of invertebrate assemblages. Within-bedform position corresponded to differences between heads and tails of bars in the hyporheic zone and between the upstream end and downstream end of riffles in the benthic zone. Reach and within- bedform position were fixed effects. Site was treated as a random effect because we sampled 12 unconfined valley segments from a large population of segments, the difference among which was not controlled. To account for the stratified structure of the data, the random error structure was specified as reach nested in site and within- bedform position nested in reach because measurements made on smaller spatial units were pseudoreplicates as far as the effects of larger spatial units were tested (Crawley 2005). There were 12 (sites) × 2 (reaches) degrees of freedom (d.f.) in total for the reach level. Eleven d.f. were already used in the site level and 1 d.f. was retained for the reach effect. So, the error term for the reach effect had 12 d.f. (i.e. 24 –11–1). Similarly, there were 12 (sites) × 2 (reaches) × 2 (bedform positions) d.f. in total for the bedform level. Eleven and 12 d.f. were already used in the site and reach levels, respectively, and 1 d.f. was retained for each of the reach, within-bedform position and interaction effects. Consequently, the error term for the within-bedform position effect and the interaction had 22 d.f. (i.e. 48 –11–12–3). Differences between the two within-bedform positions were tested using Tukey tests with Bonferoni corrections when the interaction term was significant. A mixed-model ANOVA was also used to test for the effect of depth below the streambed and its interaction with the reach effect. Again, the random error structure was specified as reach nested in site and depth nested in reach. Data were tested for normality using Shapiro-Wilk tests and invertebrate densities were Ln (x+1) transformed prior to statistical analysis in order to minimize differences among variances. Significance for all statistical analyses was accepted at α = 0.05. All calculations were done in R (R Development Core Team 2011) using functions in the packages nlme (Pinheiro et al. 2012), mvtnorm (Gentz et al. 2012) and multcomp (Hothorn et al. 2008).

Chapitre 1

Ideally, studies seeking to attribute differences in invertebrate composition among spatial units to a particular environmental filter should demonstrate that differences among units are no longer significant when accounting for the influence of that particular filter. In this study, analysis of covariance was used to test whether differences in invertebrate densities between reaches and within-bedform positions were still significant after accounting for the effect of physicochemical parameters. First, the effect of site was removed by removing the mean per site to each of the original values (i.e. centered data). Second, we used linear regression models to test for significant relationships between within-site differences in invertebrate densities and physicochemical parameters (n = 48, i.e. 12 sites by four reach × gravel bar locations per site). Finally, physicochemical parameters that were significant in the regression models were introduced as covariates while testing for the effect of reach and within-bedform position on invertebrate densities.

Results

Surface-subsurface water exchanges and physicochemical heterogeneity

VHG were significantly higher at the tails of gravel bars and in DR, although 80 % of the 1103 VHG measurements were negative (Table 2, Fig. 3). Specific conductance exhibited a significant reach effect with higher values in DR both in the surface stream and the hyporheic zone. Specific conductance of hyporheic water was also significantly higher in the tails of gravel bars, the difference between heads and tails of bars typically being more pronounced in DR (i.e. significant interaction between reach and within-bar position). Tukey tests showed that hyporheic water was significantly higher in solutes in the tail than in the head of gravel bars, in DR only (p < 0.001).

There was no significant effect of reach on the temperature of hyporheic water, but the interaction between reach and within-bar position was highly significant (Table 2, Fig. 3). Hyporheic water was on average 1.9 °C colder in tails than in heads of gravel bars in DR (Tukey test, p < 0.001). This difference in temperature between tails and heads of gravel bars was as high as 4.6 °C in the DR of site 10. Hyporheic water had significantly higher DO concentrations in the head of gravel bars and the difference between heads and tails did not differ between reaches (Table 2, Fig. 3). DO concentrations in the surface stream were significantly lower in DR but this reach effect

Chapitre 1 was not significant in the hyporheic zone (p = 0.066). The hyporheic zone of DR was significantly enriched in POC, although organic content was highly variable among samples (Fig. 3). POC preferentially accumulated in the head of gravel bars in DR (Fig. 3), but the effect of within-bar position (p = 0.055) and its interaction with the reach factor (p = 0.054) were not significant. There were no significant differences in C/N ratio of POC between reaches, within-bar positions or any interaction between the two factors (Table 2, Fig. 3). The mean concentration of chlorophyll a was 24.7 r 54.3 mg/m2 and did not differ between reaches.

Chapitre 1

Table 2: Results of mixed-models analysis of variance for testing the effects of reach (upstream versus downstream reaches), within-bedform position (upstream versus downstream ends of riffles and heads versus tails of gravel bars for the surface stream and hyporheic zone, respectively) and their interaction on physicochemical parameters and the taxonomic richness and density of invertebrate assemblages.

Chapitre 1

Fig. 3: Differences in VHG and physicochemical parameters between the upstream (UR) and downstream (DR) reaches of valley segments, the head and tail of bedform units (i.e. riffles and gravel bars for the surface stream and hyporheic zone, respectively) and the four reach × bedform locations. The black horizontal bar, boxes, and dots show the average, interquartile range, and outliers, respectively (n=12 per-site-average values). The maximum length of each whisker is 1.5 times the interquartile range.

Chapitre 1

All parameters except the C/N ratio of POC varied significantly with depth (Table 3, Fig. 4). However, there were no interactions between depth and reach for any of the parameters, although vertical gradients of specific conductance and temperature were steeper in downstream reaches (Fig. 4). Specific conductance increased with depth below the sediment surface, whereas temperature, DO and POC decreased. The concentrations of DO and POC were significantly lower at depths of 60 and 90 cm than at 30 cm (Tukey tests, p < 0.05), whereas depth variation was typically more gradual for specific conductance and temperature (i.e. there were only significant differences between depths of 30 and 90 cm).

Table 3: Results of mixed-model analysis of variance for testing the effects of depth below the streambed (i.e. 30, 60 and 90 cm) and its interaction with the reach effect (upstream versus downstream reaches) on physicochemical parameters and the taxonomic richness and density of invertebrate assemblages in the hyporheic zone at the tails of gravel bars.

Chapitre 1

Fig. 4: Vertical profiles of physicochemical parameters in the hyporheic zone at the tails of gravel bars in upstream reaches and downstream reaches of valley segments. The black vertical bar, boxes, and dots show the average, interquartile range, and outliers, respectively (n=12 per-site-average values for each depth). The maximum length of each whisker is 1.5 times the interquartile range.

Chapitre 1

Effects of reach, within-bedform position and their interaction on invertebrate assemblages

More than 190,000 invertebrates belonging to 107 taxa were collected from the benthic and hyporheic sediments of the 12 unconfined valley segments. The mean density was 3,844 r 4,659 invertebrates per m2 in the benthic sediments (range: 16 - 27,432; n = 288) and 208 r 204 invertebrates per 5 L of pumped water in the hyporheic zone (range: 11 - 1,282; n = 288). Taxonomic richness and density of benthic invertebrates did not differ between reaches or between within-riffle positions, nor did the two factors significantly interact (Table 2). Insects and PAT exhibited distinct patterns of taxonomic richness and density in the hyporheic zone (Fig. 5). Taxonomic richness of insects did not show any significant effect whereas that of PAT was significantly higher in DR and in tails of bars. The difference in richness of PAT between heads and tails of bars was also more pronounced in DR (Tukey test, p = 0.01). There were no effects of reach or within-bar position on the density of insects, EPT or Chironomidae. However, the interaction between the two factors was either significant (insects and EPT) or nearly significant (Chironomidae) (Table 2). This resulted in the highest density being observed in the head of bars of DR (Fig. 5). Tukey tests indicated that EPT density was almost significantly higher in heads than in tails of bars in DR (p = 0.059). Densities of PAT, Copepoda and Oligochaeta were significantly higher in DR but there were neither effect of within-bar position nor interaction for these taxa (Table 2, Fig. 5). The density pattern of hypogean taxa resembled those of Copepoda and Oligochaeta although this was not statistically significant (p = 0.12, Fig. 5). Ostracoda was the only taxon to exhibit a significant effect of within-bar position, with higher hyporheic densities in the tail of bars in both UR and DR.

Chapitre 1

Fig. 5: Differences in richness and density of invertebrate taxa in the hyporheic zone between the upstream (UR) and downstream (DR) reaches of valley segments, the head

Chapitre 1

and tail of gravel bars and the four reach × gravel bar locations. Box-and-whisker plots as in Fig. 3.

General regression models showed that within-site variation in insect density was significantly correlated with within-site variation in temperature (r = 0.48, p < 0.001, n=48) and POC (r = 0.36, p = 0.01) whereas the density of PAT was significantly correlated with within-site variation in POC (r = 0.37, p = 0.008). Neither DO nor the C/N ratio of POC had a significant effect on the density of insects or PAT. The interaction between reach and within-bar position on the density of insects was no longer significant when temperature and POC were included as covariates (Table 4). Similarly, there was no longer any significant effect of reach on the density of PAT when POC was included as a covariate.

Table 4: Results of analysis of covariance for testing the effects of temperature, particulate organic carbon, reach (upstream versus downstream reaches), within-bar position (heads versus tails of gravel bars) and their interaction on the densities of insects and permanent aquatic taxa (PAT) in the hyporheic zone.

Chapitre 1

Effect of the interaction between depth and reach on the vertical distribution of invertebrates

Taxonomic richness and the density of most taxonomic/ecological groups varied significantly with depth at the tails of bars (Table 3). Taxonomic richness of insects and the density of epigean taxa decreased significantly with depth below the sediment surface, whereas the density of hypogean taxa increased (Fig. 6). There were no significant interactions between depth and reach although the mean density of epigean taxa decreased and that of hypogean taxa increased more steeply with depth in DR than in UR (Fig. 6). Tukey tests showed no significant difference in the density of epigean taxa between depths of 30 and 90 cm in UR (p = 0.26), whereas the difference was significant in DR (p = 0.05). Also, the interaction between depth and reach for the proportion of hypogean taxa was nearly significant (p = 0.085, Table 3). This proportion was significantly higher at depths of 60 and 90 cm than at a depth of 30 cm in DR (p < 0.0001), whereas the difference was significant only between 30 and 90 cm in UR (p = 0.009).

Chapitre 1

Fig. 6: Vertical profiles for richness and density of invertebrate taxa in the hyporheic zone at the tails of gravel bars in upstream reaches and downstream reaches of valley segments. Box-and-whisker plots as in Fig. 4.

Chapitre 1

Discussion

This study contributes to a growing body of literature illustrating the hierarchical nature of surface-subsurface exchange flows induced by nested geomorphic features and their effects on variation in nutrient concentrations (Dent et al. 2001), temperature (Poole et al. 2008), ecosystem processes (Doering et al. 2012) and species distributions across river landscapes (Baxter & Hauer 2000). The generality of our results is due to the hierarchical sampling of a random subset of 12 stream segments within a region, whereas most previous studies were based on data from a much smaller number of sites (Pepin & Hauer 2002, Malard et al. 2003, Doering et al. 2012). Patterns of VHG and specific conductance and the resulting spatial heterogeneity of physicochemical parameters were consistent with predictions 1 and 2, indicating that localized infiltration of surface water at the head of bars and input of water either from long hyporheic flow paths or lateral aquifers at the tails of bars affected environmental conditions in hyporheic habitats of DR. Moreover, we found that the distribution of interstitial communities within the longitudinal (prediction 3) and vertical (predictions 4 and 5) dimensions of braided river landscapes were effectively influenced by interactions between exchange flows operating at the spatial scales of valley segments and bedform units.

Surface-subsurface water exchanges and physicochemical heterogeneity

Our study was based on sampling a set of nested geomorphic units (valley segments, stream reaches and gravel bars) to test for the effect of exchange flows at multiple spatial scales on the composition of invertebrate assemblages. Therefore, hypothesis testing required that downstream bounded valley segments and gravel bars were effectively associated with VEF and BEF, respectively, as predicted from the application of basic hydrogeological principles to alluvial river systems (Toth 1963, Freeze & Cherry 1979, Stanford & Ward 1993). There was apparently little upwelling of advected channel water or lateral groundwater directly into the main channel because vertical hydraulic gradients were mostly negative, irrespective of position along a gravel bar or stream segment. However, we found that the pressure head of surface water relative to that of hyporheic water was consistently lower in tails than in heads of bars as well as in DR than in UR. Moreover, specific conductance was found to increase more steeply along gravel bars in DR, a pattern that was consistent with theoretical constructs 91

Chapitre 1 showing that water from long hyporheic flow paths or lateral aquifers mixes with locally- infiltrated channel water at the downstream ends of bedforms units in DR (Sophocleous 2002). Vertical changes in specific conductance also suggested that the local infiltration rate of main channel water did not differ markedly between UR and DR, but that mixing of locally-infiltrated channel water in DR occurred with water that had resided for a longer time in the subsurface. Indeed, specific conductance of hyporheic water was consistently higher at all depths in DR than in UR, although the increase in specific conductance with depth into the sediment was not significantly steeper in DR (but see Fig. 4). Higher specific conductance of surface water in DR suggested that advected channel and/or lateral groundwater might preferentially upwell into the surface of springbrooks within the active braided corridor and orthofluvial zone rather than directly into the main channel. Alluvial springbrooks in braided river systems are often associated with flow obstructions in the river valley and might correspond to the outlet of paleochannels of high permeability (Malard et al. 1999, Poole et al. 2004, Gray 2005).

Spatial patterns of temperature, DO and POC illustrated the variable influence of surface-subsurface water exchanges induced by nested geomorphic features on distinct environmental filters (Poole et al. 2008). DO concentrations were strongly affected by within-bar position, whereas the effect of reach was of marginal significance. This suggests that hyporheic respiration was fuelled by high organic matter inputs at the head of gravel bars but strongly declined with increasing distance from downwelling zones (Findlay 1995, Malard & Hervant 1999). None of the 108 DO measurements taken at the downstream end of gravel bars in DR fell below 1 mg/L, a threshold value below which invertebrate density in stream sediments typically declines (Strayer et al. 1997, Foulquier et al. 2011). In contrast, temperature probably declined at a more constant rate along hyporheic flow paths (Malard et al. 2002, Poole et al. 2008). Consequently, the effects of reach and within-bar position strongly interacted, as water from long hyporheic flow paths and/or lateral aquifers which converged at the tails of bars in DR was on average 1.9 °C colder than hyporheic water at the heads of bars. Hyporheic sediments were enriched in POC in heads of bars and DR but the reach effect might not be linked to VEF. Upwelling flow of nutrient-rich hyporheic water has been shown to enhance periphyton biomass over multiple spatial scales ranging from individual cobbles (Wyatt et al. 2008) to riffle-pool sequences. gravel bars (Valett et al. 1994, Fisher et al. 1998) and stream reaches (Stanford et al. 2005, Doering et al. 2012). In the present study, autochthonous production did not appear to be higher in DR, as we found no differences in chlorophyll a concentrations between reaches. Rather, the higher POC 92

Chapitre 1 content of hyporheic samples in DR most likely reflected an increase in allochthonous organic matter inputs due to the close vicinity of riparian vegetation and soils (Gregory et al. 1991, Zah & Uehlinger 2001). However, increased allochthonous inputs might also be linked indirectly to VEF if the rise of water-table due to valley constrictions stimulated the growth of terrestrial vegetation on the surface of gravel bars (Chui et al. 2011).

Longitudinal distribution of invertebrates across nested geomorphic features

Theoretically, the influence of BEF alone on environmental filters should result in similar differences in the composition of invertebrate assemblages between heads and tails of bars between reaches. The influence of VEF alone or its juxtaposition with that of BEF should produce a pattern of interactions between the effects of within-bar position and reaches, because water from long hyporheic flow paths or lateral aquifers are predicted to mix with locally-infiltrated channel water at the tails of gravel bars in DR (see Fig. 1). Our results suggested that the distribution of many taxa in the hyporheic zone might be influenced by a set of exchange flows operating at multiple spatial scales. Indeed, total taxonomic richness, invertebrate density, taxonomic richness of PAT, the density of insects and in particular EPT and chironomid densities all showed a pattern of interaction between the effects of reach and within-bar position. In fact, of all taxa examined, only the Ostracoda exhibited a within-bar position effect alone. The significance of interactions between nested geomorphic features was consistent with the conclusions of previous studies that documented either the role of BEF in structuring hyporheic invertebrate assemblages along various geomorphic bedforms (Franken et al. 2001, Olsen & Townsend 2003, Davy-Bowker et al. 2006) or the effect of VEF on the distribution of interstitial taxa among UR and DR in bounded confined valley segment (Malard et al. 2003). However, this study was the first to employ a nested sampling design for examining the simultaneous effects of BEF and VEF on the composition of hyporheic fauna across alluvial river landscapes. Furthermore, regression models and analysis of covariance suggested that variation in insect density between reaches and within-bar positions might predominantly be controlled by the combined influence of BEF and VEF on temperature and POC. Density hotspots for insect larvae including EPT and Chironomidae corresponded to hyporheic patches located at the heads of bars in DR, which received the highest organic matter inputs from localized downwelling water and were not affected by inputs of colder water from long hyporheic flow paths or lateral

Chapitre 1 aquifers. However, this relationship warrants further testing using either manipulative experiments and/or physiological tests with target species, since correlative approaches alone cannot provide firm conclusions about causation between surface-subsurface water exchanges, environmental filters and habitat preferences, in particular when these exchanges have covarying effects on multiple filters (Lancaster & Downes 2010). However, the low density of insect larvae in cold albeit well-oxygenated and organic- matter rich patches at the tails of bars in DR was consistent with the overriding influence of temperature on their growth and development (Ward & Stanford 1982, Gillooly et al. 2002). Baxter & Hauer (2000) also emphasized the ecological significance of interactive hyporheic flow paths by demonstrating that bull trout in the Swan River basin, Montana, preferentially spawned at the heads of riffles in stream reaches of bounded valley segments strongly influenced by upwelling water. The authors suggested that the distribution and abundance of bull trout redds might primarily be controlled by the stabilizing effect of VEF on temperature and flow regime and the role of localized downwelling of surface water in providing a constant oxygen supply (Baxter & Hauer 2000).

Permanent aquatic taxa including Oligochaeta and Copepoda and hypogean taxa showed a distinct distributional pattern in the hyporheic zone since the effect of reach alone was significant. Density of PAT was higher in DR, irrespective of the position along a gravel bar. The extent to which this pattern reflected a causal relationship with the distribution of POC, as indicated by correlative approaches was unclear, especially since aerial photographs over the last six years indicated that UR at five of the sites dried up at least once during low flow conditions. Water inputs from long hyporheic flow paths or lateral aquifers often sustain perennial flow conditions (Malard et al. 2002) and create alluvial springs laterally to main lotic channels, which may serve as source habitats for PAT in braided rivers (Burgherr et al. 2002, Gray et al. 2006, Gray and Harding 2009, Belletti et al. 2012). In a downstream bounded valley segment of the braided Roseg River, Switzerland, Malard et al. (2003) showed that longitudinal shifts in the density of PAT in the hyporheic zone most likely reflected differences in flow permanence and limited colonization after rewetting of hyporheic sediments. This study did not reveal any significant differences in the density and richness of benthic taxa between reaches and within-riffle positions. As suggested by VHG and physicochemical measurements, the upwelling flow of hyporheic water and/or lateral groundwater directly into the main channel might not be sufficient to affect habitat

Chapitre 1 conditions in the benthic zone. Pepin & Hauer (2002) found no differences in EPT density between downwelling and upwelling alluvial reaches of two northwestern Montana rivers but reported species-specific responses to differential hyporheic exchange. The authors suggested that the inherent spatial heterogeneity of benthic riffle habitats and the use of too broad a taxonomic level such as EPT could mask subtle differences in the distribution of species caused by variation in hyporheic exchanges. Also, dispersal may interact with selective factors more strongly in the surface stream than in the hyporheic zone because spatial heterogeneity in habitat conditions within the benthic zone of braided rivers is extremely responsive to fluctuation in river discharge (Malard et al. 2000, Arscott et al. 2002).

Vertical distribution of invertebrates across nested geomorphic features

The vertical distribution of invertebrates in the hyporheic zone of gravel-bed streams has been widely documented (Strommer and Smock 1989, Brunke & Gonser 1999, Weigelhofer & Waringer 2003). In their clinal model of interstitial communities, Brunke & Gonser (1999) showed that the preferential distribution of epigean taxa at shallow sediment depths reflected their fundamental niches, whereas the distribution of hypogean taxa at greater depths reflected their realized niches. According to this model, the penetration deep into the sediment by epigean taxa would be limited by organic matter availability, whereas the colonization of shallow sediment layers by hypogean taxa is restricted by interference competition. Also, the relative vertical distribution of epigean and hypogean taxa was shown to vary in response to the direction of hyporheic exchanges at the scale of bedform units such as meander bends or gravel bars (Brunke & Gonser 1999, Dole-Olivier & Marmonier 1992, Dole-Olivier et al. 1997). In this study, we further hypothesized that the combined effects of water inputs from both BEF and VEF at the tails of bars in DR (e.g. lower temperature and DO) would restrict depth penetration within the sediment by epigean taxa, thereby enabling hypogean taxa to colonize shallower sediment layers. Our data recovered characteristic vertical distribution patterns documented in earlier studies (see references above), including a shift in the relative density of epigean and hypogean taxa with increasing depth from the benthic layer (Brunke & Gonser 1999, Datry et al. 2005). According to our prediction, the mean density of epigean taxa at the tails of bars decreased more steeply with depth in DR and that of hypogean taxa increased more steeply. However, the interaction between reach and depth was not significant for densities and was marginally significant for the 95

Chapitre 1 proportion of hypogean taxa due to considerable variability around the mean. Reaching statistical significance would have necessitated increasing the power of our test, which implied sampling even more sites than the 12 sites selected. Nevertheless, our results strongly indicated that variation in the vertical distribution of interstitial communities across braided river landscapes was also influenced by the interaction between surface- subsurface water exchanges operating at the valley segment scale and bedform unit scale.

River landscapes are increasingly viewed as a collection of nested geomorphic features, the hydrological effects of which juxtapose to create a mosaic of habitat conditions both in the surface stream and the hyporheic zone. (Fisher et al. 1998, Lewis et al. 2007, Poole 2010). Here, we demonstrated that the hydrological influences of nested geomorphic features on hyporheic communities interacted to create complex distributional patterns within the longitudinal and vertical dimensions of river landscapes. Hydrological interactions induced by nested geomorphic features could also cause differences in the vertical distribution of invertebrate assemblages between the heads and tails of bedform units to vary between reaches, a third-order interaction that was not investigated in this study. Viewing local hyporheic communities as the outcome of a series of environmental filters operating over multiple nested geomorphic features provides a general framework which may facilitate the comparison and understanding of species distribution patterns across a range of stream types.

Acknowledgments This research was funded by the French Water Agency Rhône-Mediterranée-Corse. We benefited from the geomorphologic expertise of H. Piégay, B. Belletti and F. Liébault in selecting the sampling sites. We thank the large number of people who helped collect samples in the field: A. Bourghous, R. Corti, C. Douady, G. Grosbois, P. Jean, and B. Kaufmann. Many thanks to A. Desgeorges, L. Arnaud, and S. Mendes for their valuable help in processing invertebrate samples, to M.-J. Dole-Olivier and P. Marmonier for the identification of invertebrates, to L. Simon for POC analysis, to M. Philippe for the determination of Chlorophyll a and to Rachel Stubbington and Ross Vander Vorste for their careful reading of and helpful comments on the final version.

Chapitre 1

Literature Cited Arscott, D. B., K. Tockner, D. Van der Nat, and J. V. Ward. 2002. Aquatic habitat dynamics along a braided Alpine River ecosystem (Tagliamento River, Northeast Italy). Ecosystems 5: 802-814. Baxter, C.V., and F. R. Hauer. 2000. Geomorphology, hyporheic exchange and selection of spawning habitat by bull trout (Salvelinus confluentus). Canadian Journal of Fisheries and Aquatic Sciences 57: 1470-1481. Belletti, B., S. Dufour, and H. Piégay. 2012. Regional variability of aquatic pattern in braided reaches (example of the French Rhône basin). Hydrobiologia. doi: 10.1007/s10750- 012-1279-6. Bolker, B.M., M.E. Brooks, C.J. Clark, S.W. Geange, J.R. Poulsen, M.H.H. Stevens, and J-S. S. White. 2009. Generalized linear mixed models: a practical guide for ecology and evolution. Trends in Ecology and Evolution 24: 127-135. Bou, C., and R. Rouch. 1967. Un nouveau champ de recherches sur la faune aquatique souterainne. Comptes Rendus de l’Academie des Sciences Paris 265: 369-370. Boulton, A. J., T. Datry, T. Kasahara, M. Mutz, and J. A. Stanford. 2010. Ecology and management of the hyporheic zone: stream-groundwater interactions of running waters and their floodplains. Journal of the North American Benthological Society 29: 26-40. Brodie, C.R., M. J. Leng, J. S. L. Casford, C. P. Kendrick, J. M. Lloyd, Z. Yongqiang, M. I. Bird. 2011. Evidence for bias in C and N concentrations and δ13C composition of terrestrial andaquatic organic materials due to pre-analysis acid preparation methods. Chemical Geology 282: 67-83. Brunke, M., and T. Gonser. 1997. The ecological significance of exchange processes between rivers and groundwater. Freshwater Biology 37:1-33. Brunke, M., and T. Gonser. 1999. Hyporheic invertebrates –the clinal nature of intersticial communities structured by hydrological exchange and environmental gradients. Journal of the North American Benthological Society 18:344-362. Buffington, J. M., and D.Tonina. 2009. Hyporheic exchange in mountain rivers II: mechanisms and environmental effects. Geography Compass 3: 1063-1086. Burgherr, P., J. V. Ward, and C. T. Robinson. 2002. Seasonal variation in zoobenthos across habitat gradients in an alpine glacial floodplain Val Roseg, Swiss Alps. Journal of the North American Benthological Society 21: 561-575. Chui, T. F. M., S. Y. Low, and S.Y. Liong. 2011. An ecohydrological model for studying groundwater- vegetation interactions in wetlands. Journal of Hydrology 409:291-304. Cox M.H., G.W.Su, and J. Constantz. 2007. Heat, chloride, and specific conductance as groundwater tracers near streams. Ground Water 45: 187-195. Crawley, M. J. 2005. Statistics. An introduction using R. Chapter 7, Nested Analysis & Split Plot Designs. John Wiley & Sons, Ltd. The Atrium. Southern Gate, Chichester, West Sussex, England. 97

Chapitre 1

Creuzé des Châteliers, M., and J. L. Reygrobellet. 1990. Interaction between geomorphological processes, benthic and hyporheic communities : first results on a by-passed canal of the French Upper-Rhône River. Regulated Rivers: Research and Management 5: 139-158. Dahm, C. N., and H. M. Valett. 1996. Hyporheic Zones. Pages 107-119 in F. R. Hauer, and G. A. Lamberti (editors). Methods in Stream Ecology. Chapter 6. Academic Press, Inc. Datry, T., F. Malard, and J. Gibert. 2005. Response of invertebrate assemblages to increased groundwater recharge rates in a phreatic aquifer. Journal of the North American Benthological Society 24: 461-477. Datry, T. 2012. Benthic and hyporheic invertebrate assemblages along a flow intermittence gradient: effects of duration of dry events. Freshwater Biology 57: 563-574. Davy-Bowker, J., W. Sweeting, N. Wright, R. T. Clarke, and S. Arnott. 2006. The distribution of benthic and hyporheic macroinvertebrates from the heads and tails of riffles. Hydrobiologia 563: 109-123. Dent, C. L., N. B. Grimm, and S. G. Fisher. 2001. Multiscale effects of surface–subsurface exchange on stream water nutrient concentrations. Journal of the North American Benthological Society 20:162-181. Doering, M., U. Uehlinger, and K. Tockner. 2012. Vertical hydrological exchange, and ecosystem properties and processes at two spatial scales along a floodplain river (Tagliamento, Italy). Freshwater Science 32: 12-25. Dole-Olivier, M.J., and P. Marmonier. 1992. Patch distribution of interstitial communities: prevailing factors. Freshwater Biology 27: 177-191. Dole-Olivier, M- J., P. Marmonier, and J. L. Beffy. 1997. Response of invertebrates to lotic disturbance: is the hyporheic zone a patchy refugium? Freshwater Biology 37:257-276. Findlay, S. 1995. Importance of surface-subsurface exchange in stream ecosystems: the hyporheic zone. Limnology and Oceanography 40:159-164. Fisher, S. G., N. B. Grimm, and R. Gomez. 1998. Hierarchy, spatial configuration, and nutrient cycling in a desert stream. Australian Journal of Ecology 23: 41-52. Fisher, S. G., and J. R. Welter. 2005. Flowpaths as integrators of heterogeneity in streams and landscapes. Pages 311-328 in G. M. Lowett, C. G. Jones, M. G. Turner and, K. C. Weathers (editors) Ecosystem Function in Heterogeneous Landscapes. Springer, New York, New York. Foulquier, A., Malard F., Mermillod-Blondin, F., Montuelle, B., Dolédec, S., Volat, B., Gibert, J., 2011 - Surface water linkages regulate trophic interactions in a groundwater food web. Ecosystems 14: 1339-1353. Franken, R. J. M., R. G. Storey, and D. D. Williams. 2001. Biological, chemical and physical characteristics of down-welling and up-welling zones in the hyporheic zone of a north- temperate stream. Hydrobiologia 444: 183-195. Freeze, R. A., and J. A. Cherry. 1979. Groundwater, 604 pp., Prentice-Hall, Englewood Cliffs, New Jersey. 98

Chapitre 1

Frissell, C.A., W.J. Liss, C.E. Warren, and M.D. Hurley. 1986. A Hierarchical Framework for Stream Habitat Classification: Viewing Streams in a Watershed Context. Environmental Management 10: 199-214. Genz, A., Bretz F., Miwa T., Mi X., Leisch F., Scheipl F., and T. Hothorn. 2012. mvtnorm: Multivariate Normal and t Distributions. R package version 0.9-9993. Gibert, J., J. A. Stanford, M. J. Dole-Olivier, and J. V. Ward. 1994. Basic attributes of groundwater ecosystems and prospects for research. Pages 7-40 in J. Gibert, D. L. Danielopol, and J. A. Stanford (editors). Groundwater Ecology. Academic Press, San Diego, California. Gillooly, J. F., E. L. Charnov, G. B. West, V. M. Savage, and J. H. Brown. 2002. Effects of size and temperature on developmental time. Nature 417: 70-73. Gray, D. P. 2005. Braided river springs: distribution, benthic ecology, and the role in the landscape. Unpublished MSc thesis, University of Canterbury, Christchurch, New Zealand. Gray, D., M. R. Scarsbrook, and J. S. Harding. 2006. Spatial biodiversity patterns in a large New Zealand braided river. New Zealand Journal of Marine and Freshwater Research 40: 631-642. Gray, D., and J. S. Harding. 2009. Braided river benthic diversity at multiple spatial scales: a hierarchical analysis of β diversity in complex floodplain systems. Journal of the North American Benthological Society 28: 537-551. Gregory, S. V., F. J. Swanson, W. A. McKee, and K. W. Cummins.1991. An ecosystem perspective of riparian zones. Bioscience 8: 540-551. Harvey, J. W., and K. E. Bencala.1993. The effect of streambed topography on surface-subsurface water exchange in mountain catchments. Water Resources Research 29: 89-98. Harvey, J. W., and B. J. Wagner. 2000. Quantifying hydrological interactions between streams and their subsurface hyporheic zones. Pages 3-44 in J. B. Jones and P. J. Mulholland (editors). Streams and Ground Waters. Academic Press, San Diego, California. Hendricks, S. P. 1993. Microbial ecology of the hyporheic zone: a perspective integrating hydrology and biology. Journal of the North American Benthological Society 12:70- 78. Hothorn, T., F. Bretz, and P. Westfall. 2008. Simultaneous inference in general parametric models. Biometrical Journal 50: 346-363. Lancaster, J. and B. Downes. 2010. Linking the hydraulic world of individual organisms to ecological processes: putting ecology into ecohydraulics. River Research and Applications 26: 385-403. Lee, D. R., and J. A. Cherry. 1978. A field exercise on groundwater flow using seepage meters and mini-piezometers. Journal of Geological Education 27: 6-10. Leibold, M. A., M. Holyoak, N. Mouquet, P. Amarasekare, J. M. Chase, M. F. Hoopes, R. D. Holt, J. B. Shurin, R. Law, D. Tilman, M. Loreau, and A. Gonzalez. 2004. The metacommunity concept: a framework for multi-scale community ecology. Ecology Letters 7: 601-613.

Chapitre 1

Levin, S.A. 1992. The problem of Pattern and Scale in Ecology: The Robert H. MacArthur Award Lecture. Ecology 73:1943-1967. Lewis, D. B., N. B. Grimm, T. K. Harms, and J. D. Schade. 2007. Subsystems, flowpaths, and the spatial variability of nitrogen in a fluvial ecosystem. Landscape Ecology 22: 911-924. Lorenzen, C. J. 1965. Determination of chlorophylls and phaeopigments: spectrophotometric equations. Limnology and Oceanography 12: 343-346. Lowe, W.L., G.E. Likens, and M.E. Power. 2006. Linking scales in stream ecology. Bioscience 56:591-597. Malard, F., and F. Hervant. 1999. Oxygen supply and the adaptations of animals in groundwater. Freshwater Biology 41: 1-30. Malard, F., K. Tockner, and J. V. Ward. 1999. Shifting dominance of subcatchment water sources and flow paths in a glacial floodplain, Val Roseg, Switzerland. Arctic, Antarctic, and Alpine Research 31: 135-150. Malard, F., K. Tockner, J. V. Ward. 2000. Physico-chemical heterogeneity in a glacial riverscape. Landscape Ecology 15: 679-695. Malard, F., M. Lafont, P. Burgherr, and J. V. Ward. 2001. A comparison of longitudinal patterns in hyporheic and benthic oligochaete assemblages in a glacial river. Arctic, and Alpine Research 33: 457-466. Malard, F., K. Tockner, M- J. Dole-Oliver, and J. V. Ward. 2002. A landscape perspective of surface- subsurface hydrological exchanges in river corridors. Freshwater Biology 47:621-640. Malard, F., D. Galassi, M. Lafont, S. Dolédec, and J.V. Ward. 2003. Longitudinal patterns of invertebrates in the hyporheic zone of a glacial river. Freshwater Biology 48: 1709- 1725. Morin, P.J. 2011. Community Ecology 2nd edition. Blackwell, Oxford, United Kingdom and Malden, Massachusetts. Morrice, J. A., C. N. Dahm, H. M. Valett, P. V. Unnikrishna, and M. E. Campana. 2000. Terminal electron accepting processes in the alluvial sediments of a headwater stream. Journal of the North American Benthological Society 19: 593-608. Olsen, D. A., and C. R. Townsend. 2003. Hyporheic community composition in a gravel-bed stream: influence of vertical hydrological exchange, sediment structure and physicochemistry. Freshwater Biology 48: 1363-1378. Pepin, D. M., and F. R. Hauer. 2002. Benthic responses to groundwater–surface water exchange in 2 alluvial rivers in northwestern Montana. Journal of the North American Benthological Society 21:370-383. Piégay, H., A. Alber, L. Slater, L. Bourdin. 2009. Census and typology of braided rivers in the French Alps. Aquatic Sciences 71: 371-388. Pinheiro, J.C., and D. M. Bates. 2000. Mixed-effects models in S and S-PLUS. Springer. Pinheiro, J. C., D. Bates, S. DebRoy, D. Sarkar, and the R Development Core Team 2012. nlme: Linear and Nonlinear Mixed Effects Models. R package version 3.1-105. 100

Chapitre 1

Poff, N.L. 1997. Landscape filters and species traits: towards mechanistic understanding and prediction in stream ecology. Journal of the North American Benthological Society 16: 391-409.

Poole, G. C., J. A. Stanford, S. W. Running, C. A. Frissell, W. W. Woessner, and B. K. Ellis. 2004. A patchy hierarchy approach to modeling surface and subsurface hydrology in complex flood-plain environments. Earth Surface Processes and Landforms 9: 1259-1274.

Poole, G.C., J.A. Stanford, S.W. Running, and C.A. Frissell. 2006. Multiscale geomorphic drivers of groundwater flow paths: subsurface hydrologic dynamics and hyporheic habitat diversity. Journal of the North American Benthological Society 25:288-303.

Poole, G. C., S. J. O’Daniel, K. L. Jones, W. W. Woessner, E. S. Bernhardt, A. M. Helton, J. A. Stanford, B. R. Boer, and T. J. Beechie. 2008. Hydrologic spiraling: the role of multiple interactive flow paths in stream ecosystems. River Research and Applications 24: 1018-1031.

Poole, G.C. 2010. Stream geomorphology as a physical science basis for advances in stream ecology. Journal of the North American Benthological Society 29:12-25.

R Development Core Team (2011) R: a language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. http://www.R-project.org.

Sophocleous, M. 2002. Interactions between groundwater and surface water: the state of science. Hydrogeology Journal 10: 52-67.

Stanford, J.A., and Ward, J.V. 1993. An ecosystem perspective of alluvial rivers: connectivity and the hyporheic corridor. Journal of the North American Benthological Society 12: 48-60. Strommer, J. L., and L. A. Smock. 1989. Vertical distribution and abundance of invertebrates within the sandy substrate of a low-gradient headwater stream. Freshwater Biology 22: 263- 274. Stanley, E. H., S. G. Fisher, and N. B. Grimm. 1997. Ecosystem expansion and contraction in streams. Bioscience 47: 427-435.

Strayer, D. L., S. E. May, P. Nielsen, W. Wollheim, and S. Hausam. 1997. Oxygen, organic matter, and sediment granulometry as controls on hyporheic animal communities. Archiv für Hydrobiologie 140: 131-144. Stanford, J. A., M. S. Lorang, and F. R. Hauer. 2005. The shifting habitat mosaic of river ecosystems. Verhandlungen der Internationalen Vereinigung für theoretische und angewandte Limnologie 29:123-136. Thibodeaux, L. J., and J. O. Boyle. 1987. Bed-form generated convective transport in bottom sediments. Nature 325: 341-343.

101

Chapitre 1

Tonina, D., and J.M. Buffington. 2009. Hyporheic exchange in mountain rivers I: mechanisms and environmental effects. Geography Compass 3: 1038-1062.

Toth, J. 1963. A theoretical analysis of groundwater flow in small drainage basins. Journal of Geophysical Research 68: 4795-4812.

Townsend, C.R., S. Dolédec, R. Norris, K. Peacock, and C. Arbuckle. 2003. The influence of scale and geography on relationships between stream community composition and landscape variables: description and prediction. Freshwater Biology 48: 768-785.

Valett, H. M., S. G. Fisher, N. B. Grimm, and P. Camill. 1994. Vertical hydrologic exchange and ecological stability of a desert stream ecosystem. Ecology 75: 548-560.

Vellend, M. 2010. Conceptual synthesis in community ecology. The Quarterly Review of Biology 85: 183- 206.

Water Agency. 2013. L’eau dans le basin Rhône-Méditerannée. Alluvions de la Durance aval et moyenne et de ses affluents. Masse d’eau n°6302. http://www.rhone- mediterranee.eaufrance.fr/milieux-continentaux/eaux-souterraines/db_mesout/ (accessed date: March 2013).

Ward, J. V., and J. A. Stanford. 1982. Thermal responses in the evolutionary ecology of aquatic insects. Annual Review of Entomology 27: 97-117.

Weigelhofer, G., and J. Waringer. 2003.Vertical distribution of benthic macroinvertebrates in riffles versus deep runs with differing contents of fine sediments (Weidlingbach, Austria). International Review of Hydrobiology 88: 304-313.

Weissmann, G. S., Y. Zhang, E. M. LaBolle, and G. E. Fogg. 2002. Dispersion of groundwater age in an alluvial system. Water Resources Research 38: 1-14.

Wondzell, S. M., and F. J. Swanson. 1999. Floods, channel change, and the hyporheic zone. Water Resources Research 35: 555-567.

Wyatt, K. H., F. R. Hauer, and G. F. Pessoney. 2008. Benthic algal response to hyporheic-surface water exchange in an alluvial river. Hydrobiologia. 607: 151-161.

Zah, R., and U. Uehlinger. 2001. Particulate organic matter inputs to a glacial stream ecosystem in the Swiss Alps. Freshwater Biology 46: 1597-1608.

102

Chapitre 1

Réserve Naturelle des Ramières (Drôme) (Photo de la Réserve, dir. J.M. Faton)

103

Chapitre 2

CHAPITRE 2. Développement des marqueurs microsatellites et évaluation de la taille des populations en milieu souterrain

Article 2: Microsatellite development and first population size estimates for the groundwater isopod Proasellus walteri

104

Chapitre 2

MICROSATELLITE DEVELOPMENT AND FIRST POPULATION SIZE ESTIMATES FOR THE GROUNDWATER ISOPOD Proasellus walteri.

Capderrey C., Kaufmann B., Jean P., Malard F., Konecny-Dupré L., Lefébure T. & Douady C.J.

Cécile Capderrey, Bernard Kaufmann, Pauline Jean, Florian Malard, Lara Konecny- Dupré, Tristan Lefébure, Christophe J. Douady Université de Lyon ; UMR5023 Ecologie des Hydrosystèmes Naturels et Anthropisés ; Université Lyon 1 ; ENTPE ; CNRS ; 6 rue Raphaël Dubois, 69622 Villeurbanne, France.

Christophe J. Douady Institut Universitaire de France, Paris, F–75005, France.

Corresponding author:

Christophe J. Douady

E-mail: [email protected]

Phone: +33 4 72 44 79 54

Fax: +33 4 72 43 15 23

Article soumis à la revue Plos ONE

105

Chapitre 2

Abstract

Effective population size (Ne) is one of the most important parameters in evolutionary biology, ecology and conservation biology; however, few studies of Ne in surface freshwater organisms have been published to date. Even fewer studies have been carried out in groundwater organisms, although their evolution has long been considered to be particularly constrained by small Ne. In this study, we estimated the contemporary effective population size of the obligate groundwater isopod: Proasellus walteri (Chappuis, 1948). To this end, a genomic library was enriched for microsatellite motifs and sequenced using 454 GS-FLX technology. A total of 54,593 reads were assembled in 10,346 contigs or singlets, of which 245 contained candidate microsatellite sequences with suitable priming sites. Ninety-six loci were tested for amplification, polymorphism and multiplexing properties, of which seven were finally selected for Ne estimation. Linkage disequilibrium and approximate Bayesian computation methods revealed that Ne in this small interstitial groundwater isopod could reach large sizes (> 585 breeding individuals). Our results suggest that environmental factors in groundwater, while often referred to as extreme, are not necessarily associated with small Ne.

Keywords

Effective population size • Asellidae • Crustacea • Groundwater • Microsatellite • Pyrosequencing.

106

Chapitre 2

Introduction

Effective population size (Ne) is one of the most important parameters in evolutionary biology, ecology and conservation biology (e.g. Scribner et al. 1997, Waples 2002, Wang 2005, Charlesworth 2009, Luikart et al. 2010, Gossmann et al. 2011,

Serbezov et al. 2012). Ne is classically defined as the number of breeding individuals in an idealized population (i.e. a panmictic population, with sex ratio of one and no overlapping generations) that has the same rate of change of allele frequencies or heterozygosity than the population under consideration (Wright 1931). Knowing Ne allows evaluation of the effects of genetic drift and natural selection, as well as their consequences for population viability in terms of genetic diversity loss or inbreeding effects (e. g. Waples 2002, Frankham et al. 2009, Araguas et al. 2012). Accurate estimation of Ne has also become important from an analytical point of view since the formalization of the coalescent theory (Kingman 1982) and democratization of Bayesian inferences in population genetics, because informative priors significantly improve estimation and recovery of posterior densities (e.g. Ewing & Rodrigo 2006). Last but not least, accessing Ne provides access to genetic parameters such as migration, mutation or recombination rates.

Despite community agreement about the importance of Ne, it remains one of the most difficult parameter to assess in natural populations. First, no simple and general relationships exist between Ne and other demographic estimators such as total population size (population census size, Nc; Luikart et al., 2010) or density (Osborn et al.

2010). Indeed, the Ne/Nc ratio does not only vary among taxa but is also likely to vary within species, especially in those showing high fecundity or high variation in density or reproductive success, such as arthropods and teleostean fishes (Luikart et al. 2010,

Arden & Kapuscinski 2003). Second, estimating Ne from genetic data is also a challenging task because various approaches capture different components of effective population size (Schwartz et al. 1999, Leberg 2005, Luikart et al. 2010). Estimations of contemporary Ne, the focus of this study, were initially based on temporal methods that analyzed several samples collected at different times from the same population (Nei & Tajima 1981, Waples 1989, Wang 2001, Wang & Whitlock 2003). These methods were time consuming and unmanageable for taxa displaying long generation times. As a consequence, a more tractable parameter was frequently estimated from maternally inherited loci (e.g. mitochondrial genes): 4π = 2Ne(f)μ, where 4π is a measure of the

107

Chapitre 2

genetic diversity based on pairwise differences between sequences, Ne(f) is the effective number of females and μ is the mutation rate per locus per generation (e.g. Buhay &

Crandall 2005). 4π is usually evaluated at the species level, thereby indicating current trends in long-term Ne. Therefore, it should neither be confused with contemporary Ne, nor with another widely used composite parameter 4W (Watterson 1975), implemented for example in LAMARC (Kuhner et al. 2006), that gives access to historical trends in long-term Ne. Recent analytical developments implemented single-sample approaches for estimating contemporary effective population size, using nuclear markers such as microsatellites and single nucleotide polymorphism (Wang 2005, Tallmon et al. 2008,

Waples & Do 2008). As a consequence, estimates of contemporary Ne, while still sparse, are becoming more frequent in the literature.

A survey of the current literature on freshwater metazoans revealed that most our knowledge on Ne arises from studies of actinopterygian fishes, with a strong bias towards economically important Salmoniformes. In particular, much effort was devoted to highlight the effect of environmental variables (Ostergaard et al. 2003) and anthropogenic disturbances such as dams (Clemento et al. 2009) or restocking practices

(Dawnay et al. 2011, Gow et al. 2011) on Ne. Actinopterygian fishes hence provided a much-needed opportunity to compare approaches and methods to estimate Ne (Serbezov et al. 2012) or to infer the intraspecific variability of Ne (e.g. Massa-Gallucci et al. 2010). Aside from actinopterygian taxa, information is available for lampreys (Taylor et al. 2012), aquatic snails (Trouve et al. 2005; Djuikwo-Teukeng et al. 2011), mussels (Jones 2009), calanoid copepods (Zeller et al. 2008) and crayfishes, in the latter for current trends in long-term Ne only (Buhay & Crandall 2005, Dillman et al. 2007). Non- permanent aquatic dwellers did not receive much attention either with only a few studies dedicated to frogs (Ficetola et al. 2010, Phillipsen et al. 2011), newts (Jehle et al. 2005), hydrophilid beetles (Beebee 2007), caddisflies (Shama et al. 2011) and damselflies (Watts et al. 2007). Yet, most studies dealt with surface water taxa from streams, lakes, marshes, and springs, despite the fact that a large number of aquatic phylogenetic lineages are restricted to or occur predominantly in groundwater (Stoch & Galassi 2010). Rare exceptions concerned the estimation of current trends in long-term

Ne for groundwater crayfishes (Buhay & Crandal 2005, Finlay et al. 2006, Buhay et al.

2007) and the estimation of Ne as a product of an unknown mutation rate for diving beetles (Guzik et al. 2009).

108

Chapitre 2

In this study, we estimated the contemporary effective population size of the obligate groundwater isopod Proasellus walteri (Chappuis, 1948). A genomic library was enriched for microsatellite motifs and sequenced using 454 GS-FLX technology. A total of 54,593 reads were assembled in 10,346 contigs or singlets, of which 245 contained candidate microsatellite sequences with suitable priming sites. Ninety-six loci were tested for amplification, polymorphism and multiplexing properties. Two genotyping multiplexes, for a total of seven loci were finally tested for cross-species transferability and used to infer contemporary effective population size in P. walteri.

Materials and Methods

Sampling and taxonomic identification

P. walteri is a minute (body size: 3 mm), eyeless, and depigmented isopod which inhabits the interstices in the hyporheic zone of rivers and groundwater in unconsolidated sediments. Its geographic range encompasses two major river catchments, the Rhine and Rhône Rivers (Fig. 1). Proasellus is one of the most speciose genera in European groundwater, with approximately 120 species formally described in the literature. However, recent molecular studies by Morvan et al. (2013) revealed that it contained a large number of unrecognized (morphologically cryptic) species. Morvan and coauthors distinguished three cryptic species within the P. walteri morphospecies (see Fig. 1): P. walteri_T058 is restricted to the Rhine River catchment, P. walteri_T059 to the Saône River catchment (a major tributary of the Rhône River) and P. walteri_T060 to the southern part of the Rhône River catchment. Hereafter, the focal taxon in this study, P. walteri_T060, is referred to as P. walteri.

109

Chapitre 2

Fig. 1

Map showing the location of sampling sites. Dark, light and very light grey patterns show the River catchments colonized by Prosaellus walteri_T058, P. walteri_T059, and P. walteri_T060 (focal taxa), respectively. See Table 1 for site codes

The microsatellite library was developed using P. walteri individuals from Sauzet site, six sites were used in amplification tests, five for polymorphism tests and two for Ne estimations (Fig. 1; Table 1). Additionally, six species were collected to test for microsatellite loci cross-species transferability.

Individuals were collected using a Bou-Rouch pump (Bou & Rouch, 1967) at a depth of 60 cm below the riverbed. After water elutriation, samples were placed in 96% ethanol at ambient temperature for transportation back to the laboratory, then at 4°C until sorting and morphological identification.

110

Chapitre 2

Table 1: Description of sites and species, and their use in the study. Latitude and longitude are expressed in decimal degrees. Species names follow Morvan et al. (2013). Crosses indicate whether the corresponding sites were used for library construction, amplification tests, polymorphism tests, assessment of loci parameters (HWE), cross- transferability experiments and Ne estimates

111

Chapitre 2

Specimens were identified at the species level using original species diagnoses, which are mostly based on the morphology of male copulatory organs (second pleopod). Given the prevalence of cryptic species in the Proasellus genus (Morvan et al. 2013) and the occurrence of a morphologically similar species complex Proasellus synaselloides (Henry 1963) living in sympatry with P. walteri, molecular verifications were conducted for each individual after genomic DNA extraction. Following Chapman et al. (2003), we developed a multiplex PCR scheme using one genus-specific forward primer (16S- ProaF1: 5’-CCTATGAGTCGTTTAAATGGCCGCA-3’; Calvignac et al. 2011) and two species- specific reverse primers (16S-Pwalt-R458: 5’- CTATCTATATATATATTTGCTTATATAGGG-3’, 16S-Psyna-R217: 5’- TAAAGTTTTATAGGGTCTTATCGTCCA-3’, for P. walteri and P. synaselloides complex, respectively) targeting the 16S mitochondrial DNA. Reverse primers were designed in such a way that PCR products were different in size (458 and 217 bp for P. walteri and P. synaselloides complex, respectively) and could be differentiated by electrophoresis on 1.5% agarose gels.

Molecular identifications of species selected for cross-species transferability of microsatellites were performed by sequencing a fragment of the 16S using genus-specific primers (Forward: as above; reverse 16Sbr: 5′- CCGGTCTGAACTCAGATCACGT -3’; Palumbi et al. 1996) and by comparing obtained sequences to available references (Morvan et al. 2013). Standard PCRs were conducted with a final 15 μl volume containing 1.5 μl of standard buffer (10 X, Eurobio, Courtaboeuf, France), 0.24 μl of each primer (10 μM), 0.18 μl of MgCl2 (50 mM, Eurobio, Courtaboeuf, France), 0.15 μl of BSA (10 mg ml-1, New England Biolabs, Ipswich, USA), 0.13 μl of dNTP (20 mM, Eurogenetec), 0.13 μl of EurobioTaq DNA Polymerase (5 U μl-1, Eurobio, Courtaboeuf, France) and 2 μl of genomic DNA (c. 10 ng μl-1). Cycling conditions were as follows: (i) one step of initial denaturation (2 min) at 94°C, (ii) 36 cycles with denaturation (15 s) at 94°C, annealing (20 s) at 53 (16S-ProaF1/br) or 56°C (16S-ProaF1/16S-Pwalt-R458/-Psyna-R217), extension (30 s) at 72°C, and (iii) one step of final extension (5 min) at 72°C. Sanger sequencing was performed by Biofidal-Themis (Vaulx-en-Velin, France).

Development of microsatellite markers

Genomic DNA was extracted using the chloroform extraction method optimized for Proasellus by Calvignac et al. (2011). Briefly, DNA was extracted from whole

112

Chapitre 2 organisms following standard digestion (15 μg proteinase-K in 200 μl TNES buffer, 0.05 M Tris, 0.1 M NaCl, 0.01 M EDTA, 0.5% SDS) and salt-chloroform purification. DNA was resuspended in TE (TrisHCl, 10 mM, 1 mM EDTA) to a final volume of 16 μl. A microsatellite-enriched library was constructed by the Savannah River Ecology Laboratory according to Lance et al. (2010) using a pooled DNA extract from 166 individuals of P. walteri collected at Sauzet site (Table 1). DNA was digested using RsaI, DNA fragments were ligated to SNX linkers, and dynabeads linked to di-, tri- and tetranucelotide microsatellite motives were used for enrichment. The enriched library was subsequently sequenced using a 454 FLX sequencer (454 Life Sciences/Roche Applied Biosystems, Nutley, NJ, USA). Raw DNA sequences were cleaned of remnant vectors and assembled in contigs with CAP3 (Huang & Madan 1999). Appropriate microsatellite motifs with suitable priming sites were subsequently identified using the program MSATCOMMANDER 1.0.4 (Faircloth 2008). Among these, 96 microsatellite loci were selected according to their type of motifs (di- and tetranucleotids), the length and purity of their repeat tract, and their size class. We favored loci with di- and tetranuclelotid motifs with the purest stretch and the most numerous repeats. Loci were also chosen so that three size classes (100-200 bp, 200-300 bp, and 300-400 bp) were kept in similar proportions to facilitate multiplexing. They were tested for amplification using P. walteri individuals from six sites (Table 1). For each site, DNA extracted from eight individuals was pooled because the limited amount of DNA recovered from single organisms (30 ng to 100 ng) would have been insufficient to carry out the 96 amplification tests. Next, polymorphism of amplifiable loci was evaluated using six non- pooled individuals from five sites (total number of individuals = 30, Table 1). PCR reactions were conducted using the Type-it TM Microsatellite PCR Kit (QIAGEN) in a 10-

μl volume containing 5 μl of QIAGEN Multiplex PCR Master Mix, 3 μl of H2O, 1 μl of Primer Mix (2 μM), and 1 μl of DNA (20 ng μl-1). Cycling conditions were as follows: (i) one step of initial denaturation (5 min) at 95°C, (ii) 32 (amplification experiment) or 39 (polymorphism experiment) cycles with denaturation (30 s) at 95°C, annealing (90 s) at 57°C (amplification) or 50°C (polymorphism), extension (30 s) at 72°C, and (iii) one step of final extension (30 min) at 60°C. Amplification and polymorphism were tested on 1.5% or 3% agarose gels respectively.

113

Chapitre 2

Microsatellite genotyping

Despite resolute efforts at optimization, only four loci could be combined into two PCR mixes of two loci and the three remaining loci had to be amplified separately (Table 2). PCRs for the two mixes of two loci (PCR mix 1: Pwalt_Di12 with Pwalt_Di21; and PCR mix 2: Pwalt_Te30 with Pwalt_Te39) were run using the Type-it TM Microsatellite PCR Kit (QIAGEN) in a 10-μl volume containing 5 μl of QIAGEN Multiplex

PCR Master Mix, 1 μl of primer mix (F+R, 2 μM), 1μl of H2O, 1μl of QIAGEN Q-solution and 2 μl of genomic DNA (c. 10 ng μl-1). PCR reactions for Pwalt_Di31 and Pwalt_Di36 loci were run in a 10-μl volume containing 5.72 μl of H2O, 1 μl of standard buffer 10X (New England Biolabs, Ipswich, USA), 1 μl of primer mix (F+R, 2 μM), 0.1 μl of BSA (10 mg ml-1, New England Biolabs, Ipswich, USA), 0.09 μl of dNTP (20 mM, Eurogenetec), 0.09 μl of Taq DNA Polymerase (5 U μl-1, New England Biolabs, Ipswich, USA) and 2 μl of genomic DNA (c. 10 ng μl-1). PCRs for Pwalt_Te46 locus were conducted in a 10-μl volume containing 5.32 μl of H2O, 1 μl of standard buffer (10 X, Eurobio, Courtaboeuf, France), 1

μl of primer mix (2 μM), 0.4 μl of MgCl2 (50 mM, Eurobio, Courtaboeuf, France), 0.1 μl of BSA (10 mg ml-1, New England Biolabs, Ipswich, USA), 0.09 μl of dNTP (20 mM, Eurogenetec), 0.09 μl of EurobioTaq DNA Polymerase (5 U μl-1, Eurobio, Courtaboeuf, France) and 2 μl of genomic DNA (c. 10 ng μl-1). Cycling condition were set as follows: (i) one step of initial denaturation (5 min) at 95°C (both mixes) or 94°C (3 independent PCRs); (ii) 39 cycles with denaturation (30 s) at 95°C (both mixes) or 94°C (3 independent PCRs), annealing for 90 s (both mixes) or 30 s (3 independent PCRs) at 58°C (Mix1) or 56°C (Pwalt_Di31 locus) or 54°C (Mix3 and Pwalt_Di36 locus) or 48°C (Pwalt_Te46 locus) and extension (30 s) at 72°C; and (iii) one step of final extension at 60°C for 30 min (both mixes) or 72°C for 10 min (3 independent PCR). PCR products were diluted 50 times and pooled into two genotyping mixes: 1) genotyping mix A containing PCR mixes 1 and 2, and 2) genotyping mix B containing the three loci amplified separately (Table 2). These mixes were then beads-purified (AxyPrep Mag PCR Clean-up, Axygen, Union City, CA, U.S.A.) and genotyped by a service provider (Biofidal-Themis, Vaulx-en-Velin, France) on a 3730xl DNA Analyzer (Applied Biosystems).

For each locus, alleles were scored independently by two operators with GENEMARKER v.1.95 (SoftGenetics), using GS600 LIZ size standard (Applied Biosystems). Every ambiguous genotype was amplified and genotyped twice. The 114

Chapitre 2 presence of null alleles or allelic dropout was tested using MICRO-CHECKER (Van Oosterhout et al. 2004); when a significant presence was detected (p<0.05), null alleles frequencies were calculated. Polymorphism was measured at four sites (Livron, Aouste, Sauzet, and Bzedarrides) using GENETIX v.4.0.5.2 (Belkhir et al. 2004). Deviation from Hardy-Weinberg equilibrium (HWE) and linkage disequilibrium (LD) were estimated at the same sites using GENEPOP v.4.0 (Raymond and Rousset 1995; Rousset 2008). Significance values were adjusted for multiple testing (HWE) and comparisons (LD) using sequential Bonferroni corrections (Rice 1989).

Cross species transferability

Assessing microsatellite transferability for all Proasellus species was far beyond the scope of this paper. Instead, we selected one site for each of the two other cryptic species within P. walteri morphospecies, one site for P. strouhali, which is the sister species of P. walteri complex, one site for the more distantly related morphospecies P. valdensis and two sites for P. valdensis sister group, the P. synaselloides complex (Table 1; Morvan et al., 2013).

115

Chapitre 2

Table 2: Seven microsatellite loci from P. walteri with repeat motifs, PCR primers, fluoro-label marking, size ranges in base pairs (bp), PCR annealing temperatures (Ta ) and Genbank accession numbers

116

Chapitre 2

Estimation of effective population size

We estimated effective population size for two sampling sites (Table 1) using LDNE (Waples & Do 2008) and ONeSAMP (Tallmon et al. 2008). LDNE uses a linkage disequilibrium method initially developed by Hill (1981) and corrected for small sample size (Waples 2006) to estimate Ne from a single population sample, whereas ONeSAMP relies on approximate Bayesian computation (ABC). For LDNE, the lowest allele frequency used was 0.02. As no prior information was available on P. walteri census or effective population sizes, we used two as the lower value and 10,000 as the upper value for priors on Ne in ONeSAMP. Three exact replicate runs per dataset were performed as cross validation tests on the online ONeSAMP program because our datasets might not contain enough genetic information (i.e. number of loci) for the runs to converge. As neither LDNE nor ONeSAMP should be used with loci showing LD (Tallmon et al., 2008, Waples & Do, 2008), calculations were made dropping one locus per pair in LD, to strictly comply with the conditions imposed by the methods.

Results

Microsatellite characterization

A total of 54,593 reads were obtained using 454 sequencing from the enriched library of genomic DNA from P. walteri. Mean read length reached 242 bp for 13.106 bp of total sequence length. CAP3 assembled those reads in 4,225 contigs leaving 6,121 reads as singletons. MSATCOMMANDER identified 4,518 sequences that contained di-, tri- or tetranucleotid microsatellite loci (Supplementary File 1), but it was able to define amplification primers for only 245 microsatellite loci (Supplementary File 2). Among these, 96 loci were retained according to selection criteria. A total of 32 loci produced reliable amplification across five sampling sites of P. walteri (Table 1, Supplementary File 3) and 19 were found to be polymorphic on agarose gels. After fluorescent labeling, seven of these 19 loci were found to produce reliable genotyping (Supplementary File 3).

Gene diversity indices are reported in Table 3. Total number of alleles per locus was 11 in Pwalt_Di36, 15 in Pwalt_Di21 and Pwalt_Te30, 20 in Pwalt_Te39, 21 in Pwalt_Di31, 31 in Pwalt_Di12 and 42 for Pwalt_Te46 for a total 155 alleles. The number of alleles per locus per site ranged from five to 28 in 30 individuals genotyped at Sauzet and Bedarrides, and from seven to 30 in 90 individuals at Aouste and Livron. All loci had private alleles in at least one site and three loci had private alleles in all sites (Pwalt_Di12, Pwalt_Di21 and Pwalt_Te46). Observed and 117

Chapitre 2 expected heterozygosities ranged from 0.300 to 0.933 and 0.362 to 0.918, respectively. Significant deviations from Hardy-Weinberg equilibrium (HWE) were found in three loci out of seven and in two sites (Pwalt_Te39 in Livron and Aouste, Pwalt_Di12 in Aouste and Pwalt_Di21 also in Aouste). Tests with the program MICRO-CHECKER indicate significant null allele presence in three out of four cases of significant HWE deviations (Table 3), sometimes at high frequency (e.g. 0.196 and 0.166 for Pwalt_Te39 in Aouste and Livron, respectively). After applying sequential Bonferroni corrections no linkage disequilibrium (LD) was detected over all four sites (p > 0.573). However, within sites, Pwalt_Te30 and Pwalt_Te39 were in LD in Livron (p

= 0.014). .As a consequence, Ne was estimated in Livron without Pwalt_Te39.

Microsatellite transferability

Cross-species amplification success rates were highly variable among species (Table 4). The seven loci were found to amplify better in P. walteri’s closest relatives as both P. walteri_T058 and P. walteri_T059 were successfully amplified for all loci in at least three out of five individuals and amplifications gave polymorphic products for all but one locus per species (Pwalt_D31 in P. walteri_T058). Cross amplification in P. strouhali failed for four loci and produced monophorphic fragments for the three remaining loci. On the opposite, three loci were polymorphic in P. synaselloides complex and four in P. valdensis. Cross-amplifications were also highly variable among loci. Products were obtained from all species for Pwalt_Di12 and Pwalt_Di21 loci (86 and 73% of individuals, respectively), whereas Pwalt_Di36 gave reliable products solely in the P. walteri complex.

Effective population size

Ne point estimates and associated 95% confidence intervals are reported in Table 5.

LDNE provided large estimates of Ne in Livron (Ne = 892) and Aouste, where a negative value indicated that Ne was indistinguishable from infinity (Waples & Do, 2010). The lower confidence interval in Livron was 243 and reached 585 in Aouste. Upper confidence intervals reached infinity in both estimates. ONeSAMP results proved more challenging to analyze, as replicate runs did not seem to converge in Aouste, with point estimates ranging from 533 to 1844. Replicate runs were more stable in Livron where point estimates ranged from 142 to 186, with lowest and highest confidence intervals of 83 and 327, respectively. LDNE point estimates were

118

Chapitre 2 hence always higher than those provided by ONeSAMP, and in Livron, the LDNE estimate was even far above the highest confidence interval provided by ONeSAMP (892 vs 327).

119

Chapitre 2

Table 3: Summary data for microsatellites developed for P. walteri. Number of alleles (A), private allelic richness (pA), observed (HO) and expected (He) heterozygosities, fixation index (F), probability of deviation from Hardy-Weinberg equilibrium (p HWE) and frequency of null alleles (NA) are given for each locus for N individuals from four sampling sites of P. walteri. Uncorrected significant deviations from HWE are in bold. Frequencies of null alleles are given only when the probability of their presence was significant (p < 0.05) a Significant after sequential Bonferroni correction; bNot significant after sequential Bonferroni correction

120

Chapitre 2

Table 4: Cross-species amplification tests showing amplicon size ranges for the seven microsatellite loci in six different Proasellus species. Numbers between brackets indicate the number of individuals (out of five individuals) with positive amplification, • indicates non- specific amplification, — indicates negative amplification in all individuals

Table 5: Estimated mean effective population size (Ne) of P. walteri at two river sites inferred from 90 individuals using LDNE and ONeSAMP. Brackets show 95% confidence intervals

121

Chapitre 2

Discussion

We successfully identified 4,518 microsatellite loci in the non-model organism P. walteri. Of these, 245 contained flanking regions sufficiently long for further amplification, 96 were tested and seven proved to be useful for subsequent analyses in population genetics. This demonstrates that despite tremendous advances made over recent years in the development of microsatellite markers, this process can still be a challenging endeavor. Library screening using high throughput sequencing facilities can now be performed even for non-model organisms such as P. walteri and can reveal a large number of microsatellite loci. However this first stage, while being crucial to start with a large number of candidates, is by no means a guarantee as the number of useful loci may dwindle dramatically along the development process.

Our finding that sampling sites were characterized by highly polymorphic microsatellite loci does not support prevailing views that populations of subterranean organisms do not support high genetic diversity. While surprising at the site level, high diversity among sites, as is evidenced by numerous private alleles, was somewhat more expected. In a recent diversification study of the Aselloidea, Morvan et al. (2013) suggested using a Bayesian relaxed clock model that the three cryptic species of the P. walteri complex diverged between six and 10 millions years ago. Given this time frame, populations of P. walteri_T060 sampled in this study might have diverged a long time ago, thereby providing a reasonable explanation for both the high among-sites allelic diversity and the significant frequency of null alleles encountered at some sites and loci. Linkage disequilibrium between loci was found in one site only. Therefore, linkage processes affecting these loci, while highly significant were probably not caused by physical proximity on chromosomes. However, none of the many other processes resulting in linkage disequilibrium, such as bottlenecks, population substructuring or local selection regimes (Slatkin 2008) could be favored nor dismissed here.

Cross-species amplification was successful and polymorphism was high among species of the P. walteri complex, but both were hard to predict from phylogenetic distances in more distantly related species. Indeed, P. strouhali is more closely related to P. walteri complex than any of the other three species considered in this study (Morvan et al. 2013). Yet, cross amplifications in P. strouhali failed or were uninformative for all loci, whereas three and four loci were polymorphic in P. synaselloides complex (i.e. two cryptic species) and P. valdensis, respectively. The expectation that cross-species amplification and polymorphism decrease with increasing genetic distance between the species from which the loci were isolated and the target species was validated in several vertebrate taxa (Primmer et al. 2005; Carreras-Carbonell et al. 2008). It is however poorly documented in arthropods, and even much less so in freshwater 122

Chapitre 2 taxa. Primmer et al. (2005) suggested that the negative relationship between transferability and genetic distance was linear while Carreras-Carbonell et al. (2008) argued it was logarithmic. Our results, if confirmed by additional cross-species experiments, are more compatible with the pattern proposed by Carreras-Carbonell et al. (2008), with a high success rate between closely related species followed by a sharp decrease and large variance as phylogenetic distance increases. Whatever the relationship, success rates in cross species amplification and polymorphism reported in the present study suggest that the loci we characterized and developed might be of significant interest for future studies on the ecology of species within the P. walteri complex. These species occur in multiple sites within two major river catchments (the Rhine and Rhône rivers) that experienced contrasted Pleistocene climates, thereby providing a rare opportunity to test for the effect of past environmental conditions on population dynamics.

Estimates of Ne in P. walteri pointed toward large population sizes, with a point estimate of 892 in Livron and a minimum of 585 breeding individuals in Aouste. While similar to population sizes estimated in two species of calanoid copepods (Ne = 672.7 and 1027.4, Zeller et al. 2008), these estimates are at odds with the small sizes inferred in snails (Ne ≤ 10, Trouve et al. 2005; or Ne ≤ 245, Djuikwo-Teukeng et al. 2011), damselflies (Ne ≤ 250 in most sites and for most methods; Watts et al. 2007) or hydrophilid beetles (Ne < 20, Beebee 2007).

There was however a marked difference between the two sites investigated, as in Aouste, a very large population size combined with the limited number of loci available, seemed to prevent LDNE from providing a point estimate different from infinity, and resulted in the absence of convergence between ONeSAMP runs (Luikart et al. 2010). In contrast, ONeSAMP runs returned congruent values of Ne in Livron and both approaches suggested a smaller Ne than in Aouste. Such variations are consistent with current literature that often report effective population size estimates varying by several orders of magnitude in the same species (e.g. Phillipsen et al. 2011; Djuikwo-Teukeng et al. 2011). Furthermore, our observation empirically corroborates simulations suggesting that accurate and precise estimations can hardly be achieved for moderate or large population sizes (> c. 500; Waples and Do, 2010). Aside from its analytical shortcomings, our inference of large effective population size in an obligate groundwater organism such as P. walteri may not be as surprising as prevailing views may suggest. Indeed, Kane et al. (1994) using allozymes heterozygosity, and a calculation based on the classical relation He=4Neμ/(4Neμ +1) where He is the expected heterozygosity and μ the mutation rate, also reported large effective population sizes for Gammarus minus amphipods (Ne

5 4 = 2x10 ) and Astyanax fasciatus teleosteans (Ne = 9x10). For comparison, using the same formula with our data, He for the least and most polymorphic loci, and a mutation rate of 10-5 for

123

Chapitre 2

4 5 4 5 microsatellites, returned similar Ne ranges of 5x10 to 3x10 in Livron and 9x10 to 3x10 in Aouste. However, calculations based on this formula provide rough estimates that cannot be compared with LDNE or ONeSAMP estimates. Finding large Ne in groundwater taxa suggests that environmental factors in groundwater, while often referred to as extreme, are not necessarily associated with small effective population size. However, our results desperately call for further assessments of effective population sizes in groundwater as well as in closely related surface- dwelling species. Such comparisons will make it possible to formally test another central question in groundwater ecology: is effective population size reduced in groundwater-dwellers when compared to their surface counterparts? To our knowledge, the best evidence in favor of decreased population size in groundwater comes from mitochondrial comparisons in crayfishes (Buhay & Crandal 2005). However, Buhay & Crandal (2005) documented changes in current trends in long-term Ne of crayfishes rather than changes in contemporary Ne. Other evidences come from reduced heterozygosity values in groundwater (Avise & Selander 1972; Borowsky & Vidthayanon 2001; Hinaux et al. 2013), but this reduction may not be systematic (Cobolli

Sbordoni et al. 1996) nor readily interpretable in terms of Ne (Sbordoni et al. 2005). Importantly, to solve this issue, alternative molecular methods such as SNP detection and calling using RAD- tag sequencing (Hohenlohe et al. 2010) are very promising as the demand in number of independent loci to properly estimate Ne rises with rising population sizes (Luikart et al. 2010); thousands of loci can be used as compared to the paltry tens used in most microsatellite studies. These methods will also make it possible to access other long-standing issues including spatial delineation of population and dispersal processes.

Acknowledgements

This research was funded by the French Water Agency Rhône-Méditerranée-Corse; the Agence Nationale de la Recherche (ANR-08-JCJC-0120- 01, "DEEP"); the Institut Universitaire de France; and the European Commission (7th EU Framework Programme, Contract No. 226874, BioFresh). We thank D. Eme and P. Charrier who helped to collect specimens.

124

Chapitre 2

Literature cited

Araguas, R. M., O. Vidal, C. Pla & N. Sanz, 2012. High genetic diversity of the endangered Iberian three- spined stickleback (Gasterosteus aculeatus) at the Mediterranean edge of its range. Freshwater Biology 57: 143-154. Arden, W. R. & A. R. Kapuscinski, 2003. Demographic and genetic estimates of effective population size (Ne) reveals genetic compensation in steelhead trout. Molecular Ecology 12: 35-50. Avise, J. C. & R. K. Selander, 1972. Evolutionary genetics of cave-dwelling fishes of the genus Astyanax. Evolution 26: 1-19. Beebee, T. J. C, 2007. Population structure and its implications for conservation of the great silver beetle Hydrophilus piceus in Britain. Freshwater Biology 52: 2101-2111. Belkhir, K., P. Borsa, L. Chikhi, N. Raufaste & F. Bonhomme, 1996-2004. GENETIX 4.05, logiciel sous Windows TM pour la génétique des populations. Laboratoire Génome, Populations, Interactions, CNRS UMR 5171, Université de Montpellier II, Montpellier, France. Bou, C. & R. Rouch, 1967. Un nouveau champ de recherches sur la faune aquatique souterraine. Comptes Rendus de l’Academie des Sciences de Paris 265 : 369-370. Borowsky, R. L. & C. Vidthayanon, 2001. Nucleotide diversity in populations of balitorid cave fishes from Thailand. Molecular Ecology 10: 2799-2805. Buhay, J. & K. A. Crandal, 2005. Subterranean phylogeography of freshwater crayfishes shows extensive gene flow and surprisingly large population sizes. Molecular Ecology 14: 4259-4273. Buhay J., G. Moni, N. Mann & K. A. Crandall, 2007. Molecular taxonomy in the dark: Evolutionary history, phylogeography, and diversity of cave crayfish in the subgenus Aviticambarus, genus Cambarus. Molecular Phylogenetics and Evolution 42: 435-448. Calvignac, S., L. Konecny, F. Malard & C. J. Douady, 2011. Preventing the pollution of mitochondrial datasets with the nuclear mitochondrial paralogs (numts). Mitochondrion 11: 246-254. Carreras-Carbonell, J., E. Macpherson & M. Pascual, 2008. Utility of pairwise mtDNA genetic distances for predicting cross-species microsatellite amplification and polymorphism success in fishes. Conservation Genetics 9: 181-190. Chapman, D. D., D. L. Abercrombie, C. J. Douady, E. K. Pikitch, M. J. Stanhope & M. S. Shivji, 2003. A streamlined, bi-organelle, multiplex PCR approach to species identification: Application to global conservation and trade monitoring of the great white shark, Carcharodon carcharias. Conservation Genetics 4:415-425. Charlesworth, B., 2009. Effective population size and patterns of molecular evolution and variation. Nature Reviews Genetics 10: 195–205. Clemento, A. J., E. C. Anderson, D. Boughton, D. Girman & J. C. Garza, 2009. Population genetic structure and ancestry of Oncorhynchus mykiss populations above and below dams in south-central California. Conservation Genetics 10: 1321-1336.

125

Chapitre 2

Cobolli Sbordoni, M., E. DeMatthaeis, M. Mattocia, R. Berti & V. Sbordoni, 1996. Genetic variability and differentiation of hypogean Cyprinid fishes from Somalia. Journal of zoological systematic and evolutionary research 34:75-84. Dawnay, N., L. Dawnay, R. N. Hughes, R. Cove & M. I. Taylor, 2011. Substantial genetic structure among stocked and native populations of the European grayling (Thymallus thymallus, Salmonidae) in the United Kingdom. Conservation Genetics 12: 731-744. Dillman, C. B., B. K. Wagner, R. M. Wood, 2007. Systematics of Species of Special Concern in the Genus Orconectes from the Ozark Highlands. Case Studies from Species Pairs: Orconectes neglectus neglectus, Orconectes neglectus chaenodactylus and Orconectes macrus, Orconectes nana. Arkansas Wildlife Action Plan. T20-2. Djuikwo-Teukeng, F. F., F. Njiokou, L. Nkengazong, T. De Meeus, A. S. Ekobo & G. Dreyfuss, 2011. Strong genetic structure in Cameroonian populations of Bulinus truncatus (Gastropoda: Planorbidae), intermediate host of Schistosoma haematobium. Infection Genetics and Evolution 11: 17-22. Ewing, G. & A. G. Rodrigo, 2006. Coalescent-based estimation of population parameters when the number of demes changes over time. Molecular Biology and Evolution 23:988-995. Faircloth, B. C., 2008. MSATCOMMANDER: detection of microsatellite repeat arrays and automated, locus- specific primer design. Molecular Ecology 8:92–94. Ficetola, G. F., E. Padoa-Schioppa, J. Wang & T. W. J. Garner, 2010. Polygyny, census and effective population size in the threatened frog, Rana latastei. Animal Conservation 13: 82-89. Finlay, J. B., J. E. Buhay & K. A. Crandall, 2006. Surface to subsurface freshwater connections: phylogeographic and habitat analyses of Cambarus tenebrosus, a facultative cave-dwelling crayfish. Animal Conservation 9: 375-387. Frankham, R., J. D. Ballou & D. A. Briscoe, 2009. An Introduction to Conservation Genetics. 2nd edition. Cambridge University Press, Cambridge, UK. Gossmann, T. I., M. Woolfit & A. Eyre-Walker, 2011. Quantifying the variation in the effective population size within a genome. Genetics 189: 1389-1402. Gow, J. L., P. Tamkee, J. Heggenes, G. A. Wilson & E. B. Taylor, 2011. Little impact of hatchery supplementation that uses native broodstock on the genetic structure and diversity of steelhead trout revealed by a large-scale spatio-temporal microsatellite survey. Evolutionary Applications 4: 763-782. Guzik, M. T., S. J. B. Cooper, W. F. Humphreys & D. Austin, 2009. Fine-scale comparative phylogeography of a sympatric sister species triplet of subterranean diving beetles from a single calcrete aquifer in Western Australia. Molecular Ecology 18: 3683-3698. Hill, W. G., 1981. Estimation of effective population size from data on linkage disequilibrium. Genetical Research 38: 209-216. Hinaux, H., J. Poulain, C. Da Silva, C. Noirot, W. R. Jeffery, D. Casane & S. Retaux. 2013. De novo sequencing of Astyanax mexicanus surface fish and Pachón cavefish transcriptomes reveals enrichment of mutation in cavefish putative eye genes. PLoS ONE 8(1): e53553.

126

Chapitre 2

Hohenlohe, P. A., S. Bassham, P. D. Etter, N. Stiffler, E. A. Johnson & W. A. Cresko, 2010. Population genomics of parallel adaptation in threespine stickleback using sequenced RAD tags. PLoS Genetics 6: e1000862. Huang, X. & A. Madan, 1999. CAP3: A DNA sequence assembly program. Genome Research 9: 868-877. Jehle, R., G. A. Wilson, J. W. Arntzen & T. Burke, 2005. Contemporary gene flow and the spatio-temporal genetic structure of subdivided newt populations (Triturus cristatus, T-marmoratus). Journal of Evolutionary Biology 18: 619-628. Jones, J. W., 2009. Genetics, demography and modeling of freshwater mussel (Bivalvia: Unionidae) populations in the Clinch River, U.S.A. Ph.D. Dissertation. Virginia State University. 218pp. Kane, T. C., D. C. Culver & J. Mathieu, 1994. Biotic fluxes and gene flow. In J. Gibert, D. L. Danielopol & J. A. Stanford (eds), Groudwater Ecology, Academic Press 245-270. Kingman, J. F. C., 1982. On the Genealogy of Large Populations. Journal of Applied Probability 19: 27-43. Kuhner, M. K., 2006. LAMARC 2.0: maximum likelihood and Bayesian estimation of population parameters. Bioinformatics 22: 768-770. Lance S. L., J. E. Light, K. L. Jones, C. Hagen & J. C. Hafner, 2010. Isolation and characterization of 17 polymorphic microsatellite loci in the kangaroo mouse, genus Microdipodops (Rodentia: Heteromyidae). Conservation Genetics Resources 2: 139-141. Leberg, P., 2005. Genetic approaches for estimating the effective size of populations. Journal of Wildlife Management 69:1385–1399. Luikart, G., N. Ryman, D. A. Tallmon, M. K. Schwartz & F. W. Allendorf, 2010. Estimation of census and effective population sizes: the increasing usefulness of DNA-based approaches. Conservation Genetics Resources 11: 355-373. Massa-Gallucci, A., I. Coscia, M. O'grady, M. Kelly-Quinn & S. Mariani, 2010. Patterns of genetic structuring in a brown trout (Salmo trutta L.) metapopulation. Conservation Genetics 11: 1689-1699. Morvan, C., F. Malard, E. Paradis, T. Lefébure, L. Konecny-Dupré & C. J. Douady, 2013. Timetree of Aselloidea reveals species diversification dynamics in groundwater. Systematic Biology doi: 10.1093/sysbio/syt015. Nei, M. & F. Tajima, 1981. Genetic drift and estimation of effective population size. Genetics 98: 625-640.

Osborne, M. J., S. R. Davenport, C. W. Hoagstrom & T. F. Turner, 2010. Genetic effective size, Ne, tracks density in a small freshwater cyprinid, Pecos bluntnose shiner (Notropis simus pecosensis). Molecular Ecology 19: 2832-2844. Ostergaard, S., M. M. Hansen, V. Loeschcke & E. E. Nielsen, 2003. Long-term temporal changes of genetic composition in brown trout (Salmo trutta L.) populations inhabiting an unstable environment. Molecular Ecology 12: 3123-3135. Palumbi, S. R., 1996. Chapter 7: Nucleid Acids II: The Polymerase Chain Reaction. In Hillis, D. M., C. Moritz & B. K. Mable (eds), Molecular Systematics. Sinauer Associates, Sunderland, MA: 205-248. Phillipsen, I. C., W. C. Funk, E. A. Hoffman, K. J. Monsen & M. S. Blouin, 2011. Comparative analyses of effective population size within and among species: ranid frogs as a case study. Evolution 65: 2927- 2945. 127

Chapitre 2

Primmer, C. R., J. N. Painter, M. T. Koskinen, J. U. Palo & J. Merilä, 2005. Factors affecting avian cross- species microsatellite amplification. Journal of Avian Biology 36: 348-360. Raymond, M. & F. Rousset, 1995. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. Journal of Heredity 86:248-249. Rice W., 1989. Analyzing tables of statistical tests. Evolution 43: 223–225. Rousset, F., 2008. Genepop'007: a complete reimplementation of the Genepop software for Windows and Linux. Molecular Ecology Resources 8: 103-106. Sbordoni, V., G. Allegrucci & D. Cesaroni, 2005. Population structure of cave organisms. In Culver, D. & W. White (eds), The encyclopedia of Caves. Elsevier Academic Press: 447-455. Schwartz, M. K., D. A. Tallmon & G. Luikart, 1999. DNA-based methods for estimating population size: many methods, much potential, unknown utility. Animal Conservation 2:321–323. Scribner, K. T., J. W. Arntzen & T. Burke, 1997. Effective number of breeding adults in Bufo bufo estimated from age-specific variation at minisatellite loci. Molecular Ecology 6: 701-712. Serbezov, D., P. E. Jorde, L. Bernatchez, E. M. Olsen & L. A. Vollestad, 2012. Short-term genetic changes: evaluating effective population size estimates in a comprehensively described brown trout (Salmo trutta) population. Genetics 191: 579-592. Shama, L. N. S., K. B. Kubow, J. Jokela & C. T. Robinson, 2011. Bottlenecks drive temporal and spatial genetic changes in alpine caddisfly metapopulations. BMC Evolutionary Biology, 11: 278. Slatkin, M., 2008. Linkage disequilibrium – understanding the evolutionary past and mapping the medical future. Nature Reviews Genetics 9: 447-485. Stoch, F. & D.M.P. Galassi, 2010. Stygobiotic crustacean species richness: a question of numbers, a matter of scale. Hydrobiologia 653: 217-234.

Tallmon, D.A., A. Koyuk, G. Luikart & M.A. Beaumont, 2008. ONeSAMP: a program to estimate effective population size using approximate Bayesian computation. Molecular Ecology Resources 8: 299– 301. Taylor, E. B., L. N. Harris, E. K. Spice & M. F. Docker, 2012. Microsatellite DNA analysis of parapatric lamprey (Entosphenus spp.) populations: implications for evolution, taxonomy, and conservation of a Canadian endemic. Canadian Journal of Zoology 90: 291-303. Trouve, S., L. Degen & Goudet, J., 2005. Ecological components and evolution of selfing in the freshwater snail Galba truncatula. Journal of Evolutionary Biology 18: 358-370. Van Oosterhout, C., W. F. Hutchinson, D. P. M. Wills & P. Shipley, 2004. MICRO-CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Resources 4: 535-538. Wang, J., 2005. Estimation of effective population sizes from data on genetic markers. Philosophical Transactions of the Royal Society Biological Sciences 360: 1395-1409. Wang, J. & M. C. Whitlock, 2003. Estimating effective population size and migration rates from genetic samples over space and time. Genetics 163: 429-446.

128

Chapitre 2

Wang, J., 2001. A pseudo-likelihood method for estimating effective population size from temporally spaced samples. Genetical Research 78: 243-257. Waples, R. S. & C. Do, 2010. Linkage disequilibrium estimates of contemporary Ne using highly variable genetic markers: a largely untapped resource for applied conservation and evolution. Evolutionary Applications 3: 244-262. Waples, R. S. & C. Do, 2008. LDNE: a program for estimating effective population size from data on linkage disequilibrium. Molecular Ecology Resources 8: 753–756. Waples, R. S., 2006. A bias correction for estimates of effective population size based on linkage disequilibrium at unliked gene loci. Conservation Genetics 7: 167-184. Waples, R. S., 2002. Evaluating the effect of stage-specific survivorship on the Ne/N ratio. Molecular Ecology 11:1029-1037. Waples, R. S., 1989. A generalized approach for estimating effective population size from temporal changes in allele frequency. Genetics 121: 379–391. Watterson, G. A., 1975. On the number of segregating sites in genetical models without recombination. Theories in Population Biology 7: 256–276. Watts, P. C., I. J. Saccheri, S. J. Kemp & D. J. Thompson, 2007. Effective population sizes and migration rates in fragmented populations of an endangered insect (Coenagrion mercuriale: Odonata). Journal of Animal Ecology 76: 790-800. Wright, S., 1931. Evolution in Mendelian populations. Genetics 16: 97–159. Zeller, M., T. B. H. Reusch & W. Lampert, 2008. Small effective population sizes in two planktonic freshwater copepod species (Eudiaptomus) with apparently large census sizes. Journal of Evolutionary Biology 21: 1755-1762.

Supplementary material

Supplementary File 1

4,518 sequences identified by MSATCOMMANDER containing di-, tri- or tetranucleotid microsatellite loci

Supplementary File 2

245 microsatellite loci identified by MSATCOMMANDER with suitable priming regions

Supplementary File 3 (disponible en annexe de ce manuscrit)

96 loci selected using the nature, purity and number of repetitions as criteria and tested for the development of microsatellite markers in P. walteri

129

Chapitre 2

Quelques discontinuités sédimentaires…

Le « claps » de la Drôme, à l’amont de Luc en Diois (photo: M.J. Dole-Olivier)

La Drôme entre Luc en Diois et Recoubeau

(photo: J. Toone)

Le Roubion au niveau de Saou

(photo: C. Capderrey)

130

Chapitre 3

CHAPITRE 3. La géomorphologie comme facteur structurant les populations hyporhéiques de Proasellus walteri

Article 3: River geomorphology structures genetic diversity in the groundwater isopod Proasellus walteri.

Article en préparation

131

Chapitre 3

River geomorphology structures genetic diversity in the groundwater isopod Proasellus walteri

Capderrey C., Kaufmann B., Malard F., Konecny-Dupré L. & Douady C.J.

Introduction

Connectivity has been defined as “the degree to which the landscape facilitates or impedes movement” of individuals (Taylor et al. 1993). It includes structural and functional connectivity, respectively the physical characteristics that occur between patches and the dispersal behavior of organisms facing the different landscape matrices (Taylor et al. 1993, 2006, Baguette et al. 2012). Connectivity in riverscapes is often limited by natural and anthropogenic fragmentation: riverscapes are naturally fragmented ecosystems, where cascades (Costello et al. 2003, Crispo et al. 2006), catchment structure and hydrologic connectivity (Wilmer et al. 2008, Cook et al. 2011), slope (Caldera & Bolnick 2008), elevation (Castric et al. 2001) and temperature (Dionne et al. 2008) have strong impacts on observed genetic structure. The increasing threat of anthropogenic fragmentation superimposes constraints to the dispersal of organisms (Fahrig 2003, Keyghobadi 2007) and can lead to the extinction of populations. Numerous studies emphasized the threat of human induced barriers in shaping observable genetic structure, particularly in fishes (Neraas & Spruell 2001, Leclerc et al. 2008, Raeymaekers et al. 2008, Blanchet et al. 2010, Horreo et al. 2011 ) and to a lesser extent in invertebrates (Monaghan et al. 2002, Watanabe et al. 2010).

Riverscapes are three-dimensional interacting landscapes from upstream to downstream then including a longitudinal dimension (Vannote et al. 1980), a lateral dimension linking the stream and the riparian zones (Gregory et al. 1991) and a vertical dimension relating the stream with its groundwater (Stanford & Ward 1993).

The longitudinal dimension is the most studied in riverscapes connectivity. In such a one- dimensional landscape, connectivity is constrained by the dendritic structure of networks (Frissell et al. 1986, Meffe & Vrijenhoek 1988, Campbell Grant et al. 2007) and can lead to specific patterns of genetic structure (Chaput-Bardy et al. 2008, Morrissey & de Kerckhove 2009). Namely, the river flow often constrains the dispersal of organisms to a downstream direction (Bilton et al. 2001) and this may result in an asymmetric gene flow from upstream populations to downstream populations (Kawecki & Holt 2002, Morrissey & de Kerckhove 132

Chapitre 3

2009). In addition, in continuous populations with spatially limited dispersal, the process of isolation-by-distance (IBD) structures populations by decreasing gene flow with increasing waterway geographic distance (Wright 1943, Slatkin 1993).

Genetic structure of populations results from the interplay between riverscape structure and life history traits of organisms especially dispersal ability (Malmqvist 2002, Bohonak & Jenkins 2003, Finn et al. 2006, Hughes 2007, Hughes et al. 2009). Studies that compared the response of two species with differing life cycle traits found that patterns of genetic structure reflected differences in dispersal ability of the species considered (Zickovitch & Bohonak 2007, Stutz et al. 2010, Alp et al. 2012).

Strongly dispersing freshwater invertebrates such as flying insects with a flying adult stage are little impacted by riverscape connectivity and present a strong trend to homogenization within catchments (Alp et al. 2012) and among catchments (Schmidt et al. 1995, Hughes 2007, Chaput-Bardy et al. 2008) due to the strong gene flow (Monaghan et al. 2001, 2002). In contrast, population structure and distribution of poor dispersers are more likely to be under the influence of the surrounding landscape (Bohonak & Jenkins 2003, Hughes et al. 2009) and rare stochastic events such as major floods (Burridge et al. 2008). Freshwater crustaceans in particular have no winged stage and dispersal is presumably limited to within stream movements. Most studies on stream macrocrustaceans effectively demonstrated frequent high levels of genetic differentiation even over small geographic scales (e.g. decapods (Hughes et al. 1996, Hurwood & Hughes 2001, Gouin et al. 2011) and amphipods (Zickovich & Bohonak 2007, Alp et al. 2012)).

The vertical dimension in riverscapes has long been overlooked, although groundwater represents 98% of the total inland liquid water. Despite the fact that a large number of aquatic phylogenetic lineages are restricted to, or occur, predominantly in groundwater (Stoch & Galassi, 2010), very little is known about biology and dispersal of taxa inhabiting groundwater. Groundwaters present a diversity of habitats (i.e. aquifers), with different degrees of connectivity defined by their pore size. In this context, the most studied system is the karstic system associated with large pore size (i.e. caves) for which hydrologic connectivity is known to influence population connectivity and gene flow in stygobiotic species (Kane et al. 1992, Sbordoni et al. 2000, Verovnik et al. 2004, Buhay & Crandall 2005, Finlay et al. 2006, Buhay et al. 2007, Venarsky et al. 2009). However, to our best knowledge, no such study was carried out in the porous groundwater aquifer associated to streams known as the hyporheic zone and defined as the saturated interstitial sediments beneath the stream bed (Orghidan 1959, White 1993). The hyporheic zone is now recognized an integral component of the stream (Stanford & Ward 133

Chapitre 3

2003, Findlay 1995) and strong interactions link up stream and hyporheic zone throughout their course.

However, the continuity of hyporheic zone is not always correlated to the continuity of stream. This is particularly the case in large alluvial rivers such as braided rivers which are multiple-channel rivers found in temperate piedmont and mountain valley areas (Leopold & Wolman 1957). Braided rivers are large alluvial rivers where high sedimentary loads and moderate slopes create braided channels (Leopold & Wolman 1957) and where geomorphology plays a major role. Alternating alluvial plains and canyons (i.e. geological knickpoints) in braided rivers can be compared to a pearl necklace, where “pearls of sediments” are separated by canyons. Canyons are enclosed between two geological reliefs resulting from water erosion on sediments leading to bedrock outcrops and reduction in alluvial filling with sometimes remaining patches of sediments thus constraining the river and its hyporheic zone. This sedimentary matrix is more likely to be interrupted when the river flows in mountains river parts where canyons are more frequent than in plains parts. This phenomenon may lead to strong differences in connectivity between plains and mountains parts in rivers and to less connected populations in mountains parts. Furthermore, canyons have been already shown to restrict gene flow in surface freshwater taxa such as fishes (Burridge et al. 2007, Carrea et al. 2013). Such matrix discontinuities should have even stronger impacts on gene flow in subterranean taxa. In this paper we addressed the effect of geomorphology on connectivity in groundwater populations of an obligate sediment-dwelling isopod Proasellus walteri (Chappuis 1943) and addressed three main hypotheses:

1) Given the importance of geomorphology in these systems, we hypothesized that genetic differentiation would not be explained by IBD alone but also by physical barriers related to the number of canyons. 2) If true, and as canyons occur in mountain parts, we hypothesized stronger genetic differentiation between sites within mountains parts than within plains parts. 3) As a consequence of stronger genetic differentiation between sites within mountains parts, genetic diversity should be lower in mountains parts and higher in plains parts.

To test these hypotheses we used three river-replicates of a plains-mountains parts transition within which we characterized canyons and measured genetic diversity and differentiation between sites using seven highly polymorphic microsatellite markers.

134

Chapitre 3

Material and methods

Study organism

Proasellus walteri is a minute (body size inferior to 3 mm), eyeless and depigmented isopod which inhabits the interstices in the hyporheic zone. It is a slow-walking organism well adapted to interstitial life, unable to swim but able to survive in free water (Henry 1976). A recent study by Capderrey et al. (submitted), carried on two sites in the Drôme River, has shown that populations of P. walteri could reach large effective sizes (Ne > 500). Its geographic range encompasses the Rhine and Rhône Rivers catchments.

Sampling

A total of 25 sites were sampled in 3 braided rivers belonging to tributaries of the Rhône River, France, and were all located on the margins of the Southern Alps. Sampling sites were distributed as evenly as possible after taking account for the habitat constrains (i.e. presence of sediments). At each sampling site, river bed sediment consisted in a mixture of pebbles, gravels and sands that creates favorable interstitial conditions for P. walteri. We sampled 9 sites in the Drôme River, 8 in the Roubion River and 8 in the Ouvèze River. Sampling sites were separated from each other by a distance of 6 to 12 km. (Figure 1). We sampled 26 to 30 individuals at each site, except for Drôme River spring site: Dro-9 (n = 18) and for Ouv-2 (n = 22) leading to a total of 738 individuals (Table 1). (See below the paragraph “waterway distance and canyons frequency” for the description of canyons).

Individuals were collected in the wetted stream by hammering a mobile pipe (2.5-cm internal diameter, 14-cm long screened area, 5-mm diameter holes) to a depth of 50 to 100 cm below the streambed thus giving access to interstitial groundwater. Water was then extracted using a Bou-Rouch pump (Bou & Rouch 1967) into a 200-μm net. After water elutriation, samples were placed in 96% ethanol at ambient temperature for transportation back into the laboratory, then at 4°C until sorting and morphological identification. Specimens were sorted and identified at the species level using original species diagnoses, which are mostly based on the morphology of male copulatory organs (second pair of pleopods).

Waterway distances and canyons frequency

Waterway distances between each pair of sites of each river were calculated in Arcview 3.2 (Environmental Systems Research Institute, Redlands, USA) using coordinates of each sampled site. In addition, the presence of canyons in each river was assessed using airborne

135

Chapitre 3 photographs (IGN - BD Ortho-rectified airborne photographs at ca 1:25 000 scale) and confirmed by field exploration. Every kilometer of waterway distance that includes at least one canyon was reported and plotted on each river profile (Figure 1). All three selected rivers presented two river parts; a plains and a mountains part. Plains parts are void of canyons and are defined as the river section between the confluence with Rhône River and the first canyon encountered in the upstream direction, whereas mountains parts are defined from the river spring to the most downstream located canyon (Figure 1). Sampling design was adjusted in such a way that each plains part contained the four most downstream located sites with no canyons between two sites and each mountains part contained the four (or five for Drôme) most upstream located sites, always separated by at least one canyon.

Genotyping

DNA was obtained using the Chelex protocol developed by Casquet et al. (2012): each P. walteri was incubated overnight at 55 °C in 10 μl of Proteinase K solution (Qiagen) and 150 μl of 10% Chelex solution (Biorad, Marnes-la-Coquette, France).

Given the recent discovery of numerous cryptic species in the Proasellus genus (Morvan et al. 2013) and the occurrence of a morphologically similar species, Proasellus synaselloides (Henry 1963), living in sympatry with Proasellus walteri, species identification was confirmed by the multiplex PCR scheme described in Capderrey et al.(submitted).

For each PCR, 2 μl of the DNA template were used to amplify seven recently developed microsatellite markers (Pwalt_Di12, Pwalt_Di21, Pwalt_Te30, Pwalt_Te39, Pwalt_Di36, Pwalt_Di31 and Pwalt_Te46). These markers were grouped into five PCR sets (two sets of two markers and three independently amplified markers) as described in Capderrey et al. (submitted). PCR products were diluted 50 times and pooled in two genotyping mixes; (A) containing the two sets of two markers (Pwalt_Di12/Di21 and Pwalt_Te30/Te39) and (B) and the three independently amplified loci (Pwalt_Di31, Pwalt_Di36 and Pwalt_Te46). These mixes were then purified and discriminated using a capillary electrophoresis on a 3730xl DNA Analyser (Applied Biosystems). For each locus, alleles were scored independently by two operators with GENEMARKER v.1.95 (SoftGenetics), using GS600 LIZ size standard (Applied Biosystems). Any ambiguous genotype was amplified and genotyped twice.

Characteristics of microsatellite markers

In each sampled site, deviation from Hardy-Weinberg equilibrium (HWE) and linkage disequilibrium (LD) for each pair of loci were estimated using GENEPOP v. 4.0 (Raymond & 136

Chapitre 3

Rousset 1995, Rousset 2008) and significance values were adjusted with sequential Bonferroni correction (Rice 1979). Genotypes were checked for scoring errors arising from large allele dropout and null alleles using MICRO-CHECKER (Van Oosterhout et al. 2004). The frequency of null alleles was estimated using FreeNA (Chapuis & Estoup 2007). Observed (HO) and expected

(HE) heterozygosities were calculated using GENEPOP v 4.0 (Raymond & Rousset 1995, Rousset

2008). Polymorphism and genetic differentiation (pairwise FST and FST / (1-FST), (Weir & Cockerham 1984)) were calculated for each population using GENETIX v.4.0.5.2 (Belkhir et al. 2004).

Testing the effect of waterway distance and canyons on genetic differentiation between sites

First, simple Mantel tests (Mantel 1967) were used to assess the level of IBD (isolation by distance) in each river, by permuting 1000 times the genetic differentiation matrix with the waterway distance matrix. In a second time, partial Mantel tests (Smouse et al. 1986, Legendre et al. 2002) were used to assess the effect of canyons after controlling for waterway distance. Same analyses were performed with straight line Euclidian distance. All tests were performed with ZT software (Bonnet & Van de Peer 2002) to obtain Mantel correlation coefficient (r) and p- values outputs

Genetic structure

To evaluate if genetic structure is more pronounced in mountains parts than in plains parts, two levels of analysis were performed. We first evaluated the overall genetic differentiation for each river with the total number of sites and in second time investigated the most probable and the observed genetic structure within each river.

Overall genetic differentiation within each river

To assess overall genetic differentiation within each river, we conducted an Analysis of Molecular Varicance (AMOVA) in Arlequin version 3.1. (Excoffier et al. 2005) at three levels: between river parts (FCT) between sites within river parts (FSC) and between sites (FST). The significance of variance components was tested by 1000 permutations.

To test statistically the hypothesis that genetic differentiation between two sites would be higher in mountains parts than between two sites in plain parts, a mixed model analysis of variance (Pinheiro & Bates 2000, Bolker et al. 2009) was conducted for each river to test the effect of river and river parts on genetic differentiation (FST). River was treated as a random

137

Chapitre 3 effect and the stratified structure of the data was taken into account by nesting river parts within rivers (according to Crawley 2005). All calculations were done in R (R Development Core Team 2011) using functions in the packages “nlme” (Pinheiro et al. 2012), “mvtnorm” (Gentz et al. 2012) and “multcomp” (Hothorn et al. 2008). In order to follow the evolution of genetic differentiation between river parts for each river, between site position were plotted against the estimates of FST / (1-FST) (Rousset 1997).

Genetic structure within each river

To investigate if differentiation between sites in mountains parts in higher than within plains parts, the most probable population structure within each river was inferred using the software STRUCTURE 2.3.4., (Pritchard et al. 2000). The STRUCTURE analysis was performed in each river independently. The optimal number of clusters (K) was determined using the approach of Evanno et al. (2005) implemented in STRUCTURE HARVESTER (Earl & von Holdt, 2012) which consists in assessing the breakpoint in the slope of the distribution on lnP(D) as a function of K. Values of K ranging from 1 to 8 (the number maximum of putative populations sampled in the Roubion and the Ouvèze) and 1 to 9 (in the Drôme) were investigated, with a burn-in period of 10 000 followed by 100 000 iterations and 10 runs for each K. An admixture model without prior of geographical origin of samples was assumed and the correlated allele frequency model (Falush et al. 2003) was used. This model infers population structure using genotype data, where there are K populations, each characterized by a set of correlated allele frequencies at each locus.

An alternative approach to test whether a greater number of clusters could be observed in mountains parts, we used an approach with K = number of sampled sites on each river (i.e. maximum K approach). The same number of runs and iterations as above were used (burn-in period of 10 000 followed by 100 000 iterations and 10 runs for each K).

Patterns of genetic diversity

We calculated allelic richness per site as a measure of genetic diversity. Allelic richness (A) was calculated using a rarefaction procedure implemented in HP-RARE 1.0 (Kalinowski 2005). Allelic richness estimates for the sites included in the analysis were calculated for each river with rarefaction to 24, 28 and 24 individuals for respectively the Drôme, the Roubion and the Ouvèze. The relationship between mean allelic richness within each site of each river and waterway distance was assessed using a linear model in R (R Development Core Team 2011). Waterway

138

Chapitre 3 distance was included as linear and quadratic terms and the best model was selected for a significance at α=0.05 using likelihood ratio test procedure.

Results

Characteristics of microsatellite markers

All the seven loci were moderately to highly polymorphic except for Pwalt_Di31 which was monomorphic at three sites in the Roubion. The lowest mean allelic richness was encountered at the most upstream located sites for each river; i.e. in sites Dro-9, Rou-8 and Ouv- 8, with respectively 7.00, 3.41 and 6.55 alleles per locus. The highest allelic richness occurred at sites Dro-6, Rou-3 and Ouv-5, with respectively 13.35, 9.98 and 15.34 alleles, (Table 1). The total number of alleles across all loci was 186 for the Drôme, 187 for the Ouvèze and 125 for the Roubion. The number of alleles observed by locus ranged from 12 to 55 alleles for the Drôme, 11 to 27 for the Roubion and 16 to 40 for the Ouvèze. The number of alleles ranged from 12 (Pwalt_Di21) to 55 (Pwalt_Di12) alleles in the Drôme, from 11 (Pwalt_Di21) to 27 (Pwalt_Di12) in the Roubion and from 16 (Pwalt_Di21) to 40 (Pwalt_Te46) in the Ouvèze. Most sites (15/25) showed deviation from Hardy-Weinberg equilibrium and significant presence of null alleles. No significant linkage disequilibrium was detected.

139

Chapitre 3

Table 1: Sampling sites characteristics. Latitude and longitude are in decimal degrees, n indicates the number of individuals sampled by site, Ho and He indicates observed and expected heterozygosities, A is the mean allelic richness, F is the fixation index, pHWE indicates probability of deviation from Hardy-Weinberg equilibrium. (a indicates non significant after sequential Bonferroni correction).

140

Chapitre 3

Figure 1: River location in France (a and b) each river catchment is indicated by blue line (c) river longitudinal profiles with sampling sites location (each dot correspond to 1 km of river length, red dots correspond to kilometers that contain at least one canyon). Dotted lines indicate the separation between river parts: plains (on the left) and mountains (on the right).

141

Chapitre 3

Testing for the effect of waterway distance and canyons on genetic differentiation between sites

Simple Mantel tests with linearized pairwise FST matrices as measures of genetic distance showed a significant increase of genetic differentiation with waterway distances for the three rivers, therefore showing a significant pattern of IBD (the Drôme: r = 0.68, p < 0.001; the Roubion: r =0.62, p = 0.004; the Ouvèze: r = 0.64, p < 0.001). Partial Mantel tests revealed for the three rivers a strong significant relationship between genetic differentiation and the number of canyons when controlling for waterway distance, showing that genetic differentiation is more explicable after taking into account the number of canyons (the Drôme: r = 0.75, p = 0.002; the Roubion: r = 0.73, p = 0.002; the Ouvèze: r = 0,75, p = 0.003), (Table 2). As the results obtained were highly convergent regardless of waterway distance or straight line, we chose waterway distance as the most biological meaningful.

Table 2: Simple and partial Mantel tests showing the relationships between genetic distance

(FST; matrix Genetics), waterway distance (km; matrix Waterway distance) and canyons (number of canyons; matrix Canyons), for 1000 permutations. Significant correlations (p<0.05) are indicated in bold.

142

Chapitre 3

Genetic structure

Overall genetic differentiation in each river

For each river, most of the genetic variation indicated by AMOVA occurred significantly within sites with respectively 90.49 % for the Drôme (FST=0.095), 71.82 % for the Roubion

(FST=0.281) and 88.32 % for the Ouvèze (FST=0.117), (Table 3).

The genetic variation observed among sites within river parts were about the same level for the Roubion and the Ouvèze with a significant (p<0.001) percentage of variation of respectively 9.19% (FSC=0.113) and 9.97% (FSC=0.101) whereas it was weaker for the Drôme with 2.49% (FSC=0.026) but significant (p<0.001), (Table 3). However, the pattern of variation among river parts differed from one river to another. For the Drôme, 7.03% (FCT= 0.07) of the overall variation occured significantly among river parts (p=0.005), whereas the maximum observed among river parts was reached for the Roubion with 18.99% (FCT=0.19, p=0.03) of the total variance located between plain and mountain. In contrast, no significant variation

(p=0.238) occurred among river parts in the Ouvèze (1.71%, FCT=0.017), (Table 3).

Table 3: Results of the Analysis of molecular variance (AMOVA) partitioning genetic variance among river parts, among sites within river parts and within sites.

The mixed model analysis of variance showed no significant effect of river parts on the average genetic differentiation between two sites located in mountain part and two sites located in plain parts (p=0.1303) for the three rivers. However, on the three rivers, a trend to a higher genetic differentiation in mountains parts compared to plains parts can be noticed (Figure 2).

143

Chapitre 3

Figure 2: Mean differentiation between two sites for each river part (plains and mountains) for each river (n plain = 4 for each river; n mountain = 4 for the Roubion and the Ouvèze, = 5 for the Drôme).

Figure 3: Patterns of genetic differentiation between each site for each river. Dotted line indicates the separation between river parts: plains (on the left) and mountains (on the right).

144

Chapitre 3

Genetic structure within each river

For each river-replicate of plains-mountains transition, the STRUCTURE analysis supported respectively three, two and three major genetic clusters within the Drôme, the Roubion and the Ouvèze (Figure 4).

In the Drôme, the most supported genetic cluster number was K=3. The first cluster consisted of the most upstream located site, Dro-9, which appeared to be highly homogenous. A second cluster included the four sampled sites in the mountains part (Dro-8, Dro-7, Dro-6 and Dro-5). In this cluster, only two individuals out of 118 presented more than 50% similarity with Dro-9. The third genetic cluster included plain sites from Dro-4 to Dro-1. The transition between the second cluster and the third cluster occurred between sites Dro-4 and Dro-5. From Dro-4 to Dro-1 there is a progressive decrease of genetic similarity with cluster two.

The Roubion presented two highly genetically homogeneous clusters and a sharp change in genetic structure between sites Rou-6 and Rou-5. The first genetic cluster included the three most upstream-located populations (Rou-8, Rou-7 and Rou-6) and the second genetic cluster included the remaining sites (Rou-5, Rou-4, Rou-3, Rou-2 and Rou-1). However, despite the sharp transition between Rou-5 and Rou-6, a third of individuals in Rou-5 presented 20 to 40% similarity with the first genetic cluster.

In the Ouvèze the most supported genetic clustering was K=3. A first cluster included the two most upstream-located populations (Ouv-8 and Ouv-7). Whereas Ouv-8 was genetically homogenous, in Ouv-7, 13 out of 30 individuals were 20 to 70% genetically similar to the second genetic cluster defined by the analysis. The second genetic cluster included Ouv-6, Ouv-4, Ouv-3 and 15 out of 26 individuals of Ouv-5. The third cluster included the two most downstream located sites (Ouv-2 and Ouv-1) and 11 out of 26 individuals of Ouv-5.

145

Chapitre 3

Figure 4: Results of STRUCTURE analysis for P. walteri on each river. STRUCTURE identified three optimal genetic clusters on the Drôme (shades of blue), two optimal clusters on the Roubion (shades of orange) and three optimal clusters on the Ouvèze River (shades of purple). Each bar shows a single individual, with each shade representing the contribution of a given cluster to an individual’s genotype. Dotted line indicates the separation between river parts: plains (on the left) and mountains (on the right).

The approach based on observed genetic structure following the number of sampled sites (i.e. for the maximum K for each river), disentangled in the Drôme mountains part, site Dro- 8 (Figure 5) from the genetic cluster (Dro-5, Dro-6, Dro-7, Dro-8) previously found in the optimal approach (where optimal K=3). In the Drôme plains part, the maximum K approach underlined that sites Dro-1, Dro-2, Dro-3 and Dro-4 were genetically similar. This approach of maximum K did not display more genetically structured units in mountain part in the Roubion than in the optimal approach (where K=2). The same homogenous and little diversified cluster was indeed found for the three most upstream located sites in the Roubion (Rou-8, Rou-7, Rou- 6) and the maximum K approach separated Rou-4 and Rou-5 (Figure 5) where the highest level of genetic differentiation was observed (FST / (1-FST) = 0.35, Figure 3) and corresponded to the location of the transition between the two river parts. However in the Roubion plains part, the 146

Chapitre 3 maximum K approach found that sites Rou-1, Rou-2 and Rou-3 were genetically similar and presented more genetic diversity than the remaining sites

The two most upstream located sites in the Ouvèze (Ouv-8 and Ouv-7), previously clustered together in the optimal approach, were also separated in two genetic distinct groups when we consider the maximum K approach (Figure 5). These sites also showed the strongest genetic differentiation observed in this river (observed FST / (1-FST) Ouv-6-7 = 0.166 and FST /

(1-FST) Ouv-7-8 = 0.13, Figure 3). In the Ouveze plains part, the two most downstream located sites (Ouv-1 and Ouv-2) were identified as a single group with low genetic diversity, corroborated by the low genetic differentiation between these two sites (FST / (1-FST) = 0.012).

Figure 5: Genetic structure observed by sampled site with K=9 (maximum K) in the Drôme, K=9 sampling sites in the Roubion and in the Ouvèze. Dotted line indicates the separation between river parts: plains (on the left) and mountains (on the right).

147

Chapitre 3

Patterns of genetic diversity

Mean allelic richness within sites increased significantly from the most upstream located site to the most downstream located site in the Roubion with a strong linear relationship (R2=0.83, p<0.001). The relationship between within-sites mean allelic richness and waterway distance were better explained by a quadratic model in Drôme (R2=0.74; p=0.004) and Ouvèze (R2=0.5; p=0.03). (Figure 6)

Figure 6: Patterns of allelic richness against waterway distance from the most downstream- located site to the most upstream-located site for each river. Dotted lines indicate the separation between river parts: plain (on the left) and mountain (on the right).

148

Chapitre 3

Discussion

The objective of this study was to test for the effects of geomorphology on genetic structure in a groundwater organism. Our results show (i) that genetic differentiation was explained by the number of canyons rather than by IBD alone, (ii) genetic differentiation between sites within mountains parts was not significantly stronger than within plains parts but a trend to higher differentiation was detected and was corroborated by clustering approaches, (iii) patterns of genetic diversity differed for the three rivers, with only one river showing the expected pattern of increasing allelic richness from upstream to downstream. We also found surprisingly low overall levels of genetic differentiation considering the life history traits of P. walteri (small size and limited known dispersal ability).

Deviation from HWE and null alleles

The presence of null alleles can be responsible for the deficit in heterozygotes found in our dataset, because such phenomenon is likely to be encountered in populations with a large effective size (Chappuis & Estoup 2007). This hypothesis was confirmed by analysis with MICRO-CHECKER (Van Oosterhout et al. 2004; results not shown), corroborating with previous studies (Pabijan & Babik 2006, Emaresi et al. 2011). The impact of microsatellite null alleles on the estimates of population differentiation has been investigated using simulations by Chapuis and Estoup (2007). The authors concluded that FST estimates in the presence of null alleles were unbiaised in the absence of population substructure and overestimated in cases of significant population differentiation. Given our low global FST values on the three rivers (Drôme = 0.074, Roubion = 0.216 and Ouvèze = 0.111), we considered that although suffering from some limitations, the information provided by the whole set of loci remained relevant.

Effect of waterway distance and canyons on genetic differentiation between sites

Canyons explained more genetic differentiation than waterway distance alone. The pattern of IBD evidenced by simple Mantel tests indicated that effectively gene flow occurs primarily between neighboring populations. However, and as expected, the results of partial Mantel tests suggest that canyons are the major determinant of genetic differentiation in P. walteri in the three rivers. Amongst aquatic taxa, geomorphic features such as cascades and canyons have been found to inhibit gene flow in fishes (Currens et al. 1990, Costello et al. 2003, Taylor et al. 2003, Crispo et al. 2006, Burridge et al. 2007). This study showed that canyons can lead to the same genetic pattern in porous aquifers. Genetic differentiation is the result of the multivariate nature of habitat connectivity for animal species (Manel et al. 2003, Cushman 2006,

149

Chapitre 3

Holderegger & Wagner 2006, Storfer et al. 2007, Segelbacher et al. 2010) and includes landscape configuration and matrix quality. In this study we used the number of kilometers of rivercourse featuring canyons as a very simple measure of riverscape connectivity. Precise alluvial thickness and sediment composition in longitudinal and vertical dimensions across rivers should provide more accuracy for future analyses. While longitudinal and cross sections of the rivers are available, precise information on pore size and sedimentary quality (matrix viscosity) that would be biologically more relevant are yet missing.

Genetic differentiation

No significant difference in genetic differentiation between sites in plains and sites in mountains parts were detected. However, we detected a trend in mean genetic differentiation which appears stronger between two sites when located in mountains parts. Our design comprised four or five sampling sites in mountains parts, i.e. three or four measures of genetic differentiation; this number might be too low to detect any significant effect. However more intensive sampling might not be feasible due to the difficulty inherent to Bou-Rouch sampling (i.e. time, budget, accessibility of gravel bars).

In addition to higher mean differentiation, the number of clusters detected in mountains parts with the optimal K approach pointed towards more structured populations than in plains parts. Individuals sampled in the mountains parts sites in the Drôme, the Roubion and the Ouvèze Rivers belonged respectively to two, two and three clusters. Individuals sampled in plains parts belonged to a single genetically homogeneous unit (the Drôme and the Roubion) or two (the Ouvèze). The number of clusters detected in mountains parts which is higher than in plains parts did not however correspond to the number of sampled sites as could have been expected with extreme isolation by canyons between each site.

The optimal K genetic structure observed in the Ouvèze shows that mountains sites Ouv- 5 and Ouv-6 belonged to the same cluster as plains sites Ouv-3 and Ouv-4. However, half of the individuals on Ouv-5 belonged to the same cluster as plains sites Ouv-1 and Ouv-2. This structure is not easily explainable by barriers as no canyons were detected in plains. Conversely, the most downstream located canyon does not seem to act as a barrier. At the moment, we have no convincing hypothesis to explain both facts. Similarly in the Roubion, the strongest barrier occurred between Rou-5 and Rou-6 which are the most downstream located mountains sites. The maximum K approach displayed additional barriers showing separating Ouv-5 and Ouv-6 from Ouv-3 and Ouv-4 as well as Ouv-7 and Ouv-8. Similarly in the Roubion, additional barriers were detected between Rou-4 and Rou-5 and between Rou-3 and Rou-4. This result shows that

150

Chapitre 3 canyons while important in explaining genetic differentiation are probably not the only barriers to dispersal in P.walteri.

Genetic diversity

Different patterns of genetic diversity were found in the three rivers. In the Roubion, we observed an increasing genetic diversity from the headwaters towards the most downstream located sites. This pattern is consistent with the typical asymmetric gene flow encountered in dendritic networks, and suggests that dispersal (whatever its level) is happening primarily in a downstream direction (Hughes 2007, Hughes et al. 2009, Morissey & de Kerckhove 2009). Gene flow is driven by the river’s flow as shown in numerous aquatic taxa such as fishes (Hanfling & Weetman 2006, Crispo et al. 2006, Watanabe et al. 2008), invertebrates (Alp et al. 2012) or macrophytes (Pollux et al. 2009). Such patterns of increasing genetic diversity in downstream direction are often found in poor dispersers (Zickovitch & Bohonak 2007, Alp et al. 2012) and are supposed to be the consequence of passive dispersal (Hughes 2007). However, no such downstream patterns of enrichment were observed for the Drôme and the Ouvèze, suggesting that the observed pattern on the Roubion may be not due to passive dispersal but to stronger barriers to dispersal than in the two other rivers. Indeed it seems that connectivity in the Drôme and the Ouvèze may promote other type of genetic distribution. For these two rivers, we found a pattern of allelic richness indicating a major allelic richness in the middle parts of rivers. This pattern may evoke a “mid-domain effect” pattern comparable to those found in community ecology (Colwell & Less 2000). In this mechanistic phenomenon, if the ranges of species are randomly placed within the span of an area (to which the species are endemic), then by chance, more species ranges will include the center than the edges of that span. Consequently, species numbers are higher in the middle of the span, where a central hump is observed, than near its edges. In our case, the two sides of the allelic richness distribution correspond to the edges of the sedimentary continuity. Upstream and downstream parts in each river studied are respectively bounded by their spring and the confluence with the Rhône River for which no genetic data is available for the hyporheic zone linking up the three rivers.

Moreover, what we observed was only an incomplete part of a dendritic network to which each river belongs. The difference in the number of tributaries may also explain genetic diversity (Labonne et al. 2008). The Drôme and the Ouvèze present more tributaries than the Roubion; this could lead to the pattern of gradual change in genetic composition, as observed in the Drôme and the allelic peak occurring at Ouv-5, but not to the strong change in genetic structure reported in the Roubion. Nevertheless, it seems that high movement of dispersal between populations is possible on the Drôme and the Ouvèze, as corroborated by the low 151

Chapitre 3

values of FST between the middle populations of these rivers. Genetic diversity is also under the dependency of population sizes. Number of alleles is positively correlated to population size and should follow the same pattern (larger population sizes in downstream parts of rivers). We previously demonstrated (Capderrey et al. submitted) that effective population size could be large (> 1000 individuals) in plains part and that differences between sites existed. Site Dro-1 showed lower effective population sizes than in Dro-3. However, we only considered two sites located in the most downstream part of the Drôme River.

Geomorphology effectively structures genetic diversity, but these results also suggest that P. walteri is not a weak disperser given the low FST levels found on the Drôme and the Ouvèze, while in Roubion its dispersal might be impeded by an overall low quantity of sediments. Indeed, the Roubion, among many braided rivers has been experiencing man- induced incision phenomena for the latest two centuries, resulting in a strong sedimentary deficit (Liébault & Piégay 2002, Piégay et al. 2009)

Conclusion

Geomorphology structures genetic differentiation and genetic diversity in the three rivers studied. Genetic differentiation is mainly under the influence of physical barriers due to canyons and differentiation in mountains parts trends to be higher than in plains parts. However, the patterns observed in the three rivers studied are not identical; the Drôme and the Ouvèze present stronger connectivity whereas the Roubion reflects low dispersal probably due to an overall low sediment quantity. To confirm if dispersal is really impeded by this riverscape, other types of rivers displaying the same incision degree should be tested.

Acknowledgements This research was funded by the French Water Agency Rhône-Méditerranée-Corse; the Agence Nationale de la Recherche (ANR-08-JCJC-0120- 01, "DEEP"); the Institut Universitaire de France; and the European Commission (7th EU Framework Programme, Contract No. 226874, BioFresh). We thank T. Lefébure, P. Charrier, P. Jean and D. Eme who helped to collect specimens. We also thank J. Prunier for his helpful coments.

152

Chapitre 3

Literature cited

Alp M., Keller I., Westram A.M. & Robinson C.T. (2012). How river structure and biological traits influence gene flow: a population genetic study of two stream invertebrates with differing dispersal abilities. Freshwater Biology 57: 969-981.

Baguette, M., Blanchet, S., Legrand D., Stevens V.M. & Turlure C. (2012). Individual dispersal, landscape connectivity and ecological networks. Biological Reviews doi: 10.1111/brv.12000.

Belkhir K., Borsa P., Chikhi L., Raufaste N. & Bonhomme F. 1996-2004. GENETIX 4.05, logiciel sous Windows TM pour la génétique des populations. Laboratoire Génome, Populations, Interactions, CNRS UMR 5171, Université de Montpellier II, Montpellier, France.

Blanchet S., Rey O., Etienne R., Lek S. & Loot G. (2010). Species-specific responses to landscape fragmentation: implications for management strategies. Evolutionary Applications 3: 291-304.

Bilton D.T., Freeland J.R. & Okamura,B. (2001). Dispersal in freshwater invertebrates. Annual Review of Ecology and Systematics 32: 159–181.

Bohonak A.J. & Jenkins D.G. (2003). Ecological and evolutionary significance of dispersal by freshwater invertebrates. Ecology Letters 6: 783-796.

Bolker B.M, Brooks M.E., Clark C.J., Geange S.W., Poulsen J.R., Stevens M.H.M. & White J-S. (2009). Generalized linear mixed models: a practical guide for ecology and evolution. Trends in Ecology & Evolution 24: 127-135.

Bou C. & Rouch R. (1967). Un nouveau champ de recherches sur la faune aquatique souterainne. Comptes Rendus de l’Academie des Sciences Paris 265: 369-370.

Buhay J.E., Moni G., Mann N. & Crandall K.A. (2007). Molecular taxonomy in the dark: evolutionary history, phylogeography, and diversity of cave crayﬁsh in the subgenus Aviticambarus, genus Cambarus. Molecular Phylogenetics and Evolution 42:435–448.

Bonnet E. & Van de Peer Y. (2002). zt: a software tool for simple and partial Mantel tests, Ghent University.

Buhay J.E. & Crandall K.A. (2005). Subterranean phylogeography of freshwater crayﬁshes shows extensive gene ﬂow and surprisingly large population sizes. Molecular Ecology 14:4259–4273.

153

Chapitre 3

Burridge C. P., Craw D., Jack D.C., King T.M. & Waters J.M. (2008). Does fish ecology predict dispersal across a river drainage divide? Evolution 62: 1484-1499.

Burridge P.B., Craw D. & Waters J.M. (2007). An empirical test of freshwater vicariance via river capture. Molecular Ecology 16: 1883-1895.

Caldera E.J. & Bolnick D.I. (2008). Effects of colonization history and landscape structure on genetic variation within and among threespine stickelback (Gasterosteus aculeatus) populations in a single watershed. Evolutionary Ecology Research 10:575-598.

Campbell Grant, E.H., Lowe, W.H. & Fagan W.F. (2007). Living in the branches: population dynamics and ecological processes in dendritic networks. Ecology Letters 10: 165–175.

Capderrey C., Kaufmann B., Jean P., Malard F., Konecny-Dupré L., Lefébure T. & C.J. Douady. Microsatellit development and first population size estimates for the groundwater isopod Proasellus walteri. (submitted).

Carrea C., Cussac V.E. & Ruzzante E. (2013). Genetic and phenotypic variation among Galaxias maculatus populations reflects contrasting landscape effects between northern and southern Patagonia. Freshwater Biology 58: 36-49. Casquet J., Thebaud C., Gillespie R.G. (2012). Chelex without boiling, a rapid and easy technique to obtain stable amplifiable DNA from small amounts of ethanol-stored spiders. Molecular Ecology Resources 12: 136-141.

Castric V., Bonney F. & Bernatchez L. (2001). Landscape structure and hierarchical genetic diversity in the brook charr, Salvelinus fontinalis. Evolution 55:1016-1028.

Chapuis M.P. & Estoup A. (2007). Microsatellite null alleles and estimation of population differentiation. Molecular Biology and Evolution 24: 621-631.

Chaput-Bardy A., Lemaire C., Picard D. & Secondi J. (2008). In-stream and overland dispersal across a river network influences gene flow in a freshwater insect, Calopteryx splendens. Molecular Ecology 17: 3496-3505.

Colwell R.K. & Lees D.C. (2000).The mid-domain effect: geometric constraints on the geography of species richness. Trends in Ecology & Evolution 15: 70-76.

154

Chapitre 3

Cook B.D., Kennard M.J., Real K., Pusey B.J. & Hughes J.M. (2011). Landscape genetic analysis of the tropical freshwater fish Mogurnda mogurnda (Eleotridae) in a monsoonal river basin: importance of hydrographic factors and population history. Freshwater Biology 56:812-827.

Costello A.B., Down T.E., Pollard S.M., Pacas C.J. &Taylor E.B. (2003).The influence of history and contemporary stream hydrology on the evolution of genetic diversity within species: an examination of microsatellite DNA variation in bull trout, Salvelinus confluentus (Pisces: Salmonidae). Evolution 57: 328–344.

Crawley M. J. (2005). Statistics. An introduction using R. Chapter 7, Nested Analysis & Split Plot Designs. John Wiley & Sons, Ltd. The Atrium. Southern Gate, Chichester, West Sussex, England.

Crispo E., Bentzen P., Reznick D.N., Kinnison M.T. & Hendry A.P. (2006). The relative influence of natural selection and geography on gene flow in guppies. Molecular Ecology 15: 49–62.

Currens K.P., Schreck C.B. & Li HW. (1990). Allozyme and morphological divergence of rainbow trout (Oncorhynchus mykiss) above and below waterfalls in the Deschutes River, Oregon. Copeia 1990: 730–746.

Cushman S.A. (2006). Effects of habitat loss and fragmentation on amphibians: A review and prospectus. Biological Conservation 128: 231-240.

Dionne M., Caron F., Dodson J.J. & Bernatchez L. (2008). Landscape genetics and hierarchical genetic structure in Atlantic salmon: the interaction of gene flow and local adaptation. Molecular Ecology 17:2382-2396.

Earl D.A. & vonHoldt B.M. (2012). STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conservation Genetics Resources 4: 359-361.

Emaresi G., Pellet J., Dubey S., Hirzel A.H. & Fumagalli L. (2011). Landscape genetics of the Alpine newt (Mesotriton alpestris) inferred from a strip-based approach. Conservation Genetics 12: 41-50.

Evanno G., Regnaut S. & Goudet J. (2005). Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Molecular Ecology 14: 2611-2620.

Excoffier L., Laval G. & Schneider S. (2008). Arlequin ver 3.1: An Integrated Software Package for Population Genetics Data Analysis. 2005. Computational and Molecular Population Genetics Lab (CMPG), 3. 155

Chapitre 3

Fahrig L. (2003). Effects of habitat fragmentation on biodiverstiy. Annual Review of Ecology Evolution and Systematics 34: 487-515.

Falush D., Stephens M. & Pritchard J.K. (2003). Inference of population structure using multilocus genotype data: linked loci and correlated allele frequencies. Genetics 164: 1567–1587.

Findlay S. (1995). Importance of surface-subsurface exchange in stream ecosystems: the hyporheic zone. Limnology and Oceanography 40:159-164.

Finlay J., Buhay J. & Crandall K. (2006). Surface to subsurface freshwater connections: phylogeographic and habitat analyses of Cambarus tenebrosus, a facultative cave-dwelling crayﬁsh. Animal Conservation 9:375–387.

Finn D.S., Theobald D.M., Black W.C. & Poff L. (2006). Spatial population genetic structure and limited dispersal in a Rocky Mountain alpine stream insect. Molecular Ecology 15: 3553-3566.

Frissel, C.A., W.J. Liss, C.E. Warren & M.D. Hurley. (1986). A Hierarchical Framework for Stream Habitat Classification: Viewing Streams in a Watershed Context. Environmental Management 10: 199-214.

Genz A., Bretz F., Miwa T., Mi X., Leisch F., Scheipl F. & Hothorn T. (2012). mvtnorm: Multivariate Normal and t Distributions. R package version 0.9-9993.

Gouin N., Souty-Grosset C., Borquez J., Bertin A. & Grandjean F. (2011). Disentangling the impact of demographic factors on population differentiation of an endangered freshwater crayfish (Austropotamobius pallipes) using population density and microsatellite data. Freshwater Biology 56: 2105-2118.

Gregory S.V., Swanson F.J., McKee W.A. & Cummins K.W. (1991). An ecosystem perspective of riparian zones. Bioscience 8: 540-551.

Henry J-P. (1976). Recherches sur les Asellidae hypogés de la lignée cavaticus (Crustacea Isopoda Asellota). Ph.D. thesis, University of Dijon, France.

Habersack, H. & H. Piégay, (2008). River restoration in the Alps and their surroundings: past experience and future challenges.In H. Habersack, H. Piégay and M. Rinaldi (eds), Gravel-bed River 6: From Process Understanding to River Restoration, Elsevier, Amsterdam. pp. 703–737.

156

Chapitre 3

Hanfling B. & Weetman D. (2006). Concordant genetic estimators of migration reveal anthropogenically enhanced source-sink population structure in the river sculpin, Cottus gobio. Genetics 173: 1487- 1501.

Holderegger R. & Wagner H.H. (2006). A brief guide to landscape genetics. Landscape Ecology 21: 793-796.

Horreo J. L., Martinez J. L., Ayllon F., Pola I. G., Monteoliva J. A., Héland M. & Garcia-Vazquez E. (2011). Impact of habitat fragmentation on the genetics of populations in dendritic landscapes. Freshwater Biology 56: 2567-2579.

Hothorn T., Bretz F. & Westfall P. (2008). Simultaneous inference in general parametric models. Biometrical Journal 50: 346-363.

Hughes J.M. (2007). Constraints on recovery; using molecular methods to study connectivity of aquatic biota in rivers and streams. Freshwater Biology 52: 616-631.

Hughes J.M., Schmidt D.J. & Finn D. (2009). Genes in streams: using DNA to understand the movement of freshwater fauna and their riverine habitat. Bioscience 59: 573-583.

Hughes J.M., Bunn S.E., Hurwood D.A. Choy S. & Pearson R.G. (1996). Genetic differentiation among populations of Caridina zebra (Decapoda: Atyidae) in tropical rainforests streams, northern Australia. Freshwater Biology 36: 289-296.

Hurwood D.A. & Hughes J.M. (2001). Nested clade analysis of the freshwater shrimp, Caridina zebra (Decapoda Atyidae), from north-eastern Australia. Molecular Ecology 10: 113-125.

Kane T.C., Culver D.C. & Jones R.T. (1992). Genetic structure of morphologically differentiated populations of the amphipod Gammarus minus. Evolution 46:272–278.

Kalinowski S.T. (2005). HP-RARE 1.0 : a computer program for performing rarefaction on measures of allelic richness. Molecular Ecology Notes 5: 187-189.

Kawecki, T. J. & Holt, R. D. (2002). Evolutionary consequences of asymmetric dispersal rates. The American Naturalist 160: 333–347.

Keyghobadi N. (2007). The genetic implications of habitat fragmentation for animals. Canadian Journal of Zoology 85: 1049-1064.

157

Chapitre 3

Labonne J., Ravigné V., Parisi B. & Gaucherel C. (2008). Linking dendritic network strucures to population demogenetics: The downside of connectivity. Oikos 117: 1479-1490.

Leclerc E., Mailhot Y., Mingelbier M., Bernatchez L. (2008). The landscape genetics of yellow perch (Perca flavescens) in a large fluvial ecosystem. Molecular Ecology 17:1702-1717.

Legendre P., Dale M.R.T., Fortin M.J, Gurevitch J., Hohn M. & Myers D. (2002). The consequences of spatial structure for the design and analysis of ecological ﬁeld surveys. Ecography 25: 601–615.

Leopold L. B. & Wolman M.G. (1957). River channel patterns: braiding, meandering and straight. U.S. Geological Survey Professional Papers, 262: 39-85.

Liébault, F. & H. Piégay, (2002). Causes of 20th century channel narrowing in mountain and piedmont rivers and streams of Southeastern France. Earth Surfaces Processes and Landforms 27: 425–444.

Malmqvist B. (2002). Aquatic invertebrates in riverine landscapes. Freshwater Biology 47:679-694.

Manel S., Schwartz M.K., Luikart G. & Taberlet P. (2003). Landscape genetics: combining landscape ecology and population genetics. Trends in Ecology & Evolution 18: 189-197.

Mantel N. (1967). The detection of disease clustering and a generalized regression approach. Cancer Research 27: 209-220.

Meffe G.K. & Vrijenhoek R.C. (1988). Conservation genetics in the management of desert fishes. Conservation Biology 2:157-169.

Monaghan M.T., Spaak P., Robinson C.T. & Ward J.V. (2002). Population genetic structure of 3 alpine stream insects: influences of gene flow, demographics, and habitat fragmentation. Journal of the North American Society 21: 114-131.

Monaghan M.T., Spaak P. & Robinson C.T. (2001). Genetic differentiation of Baetis alpinus Pictet (Ephemeroptera: Baetidae) in fragmented alpine streams. Heredity 86: 395-403.

Morrissey, M. B. & de Kerckhove, D. T. (2009). The maintenance of genetic variation due to asymmetric gene ﬂow in dendritic metapopulations. The American Naturalist 174: 875–889.

158

Chapitre 3

Morvan, C., F. Malard, E. Paradis, T. Lefébure, L. Konecny-Dupré & C. J. Douady, (2013). Timetree of Aselloidea reveals species diversification dynamics in groundwater. Systematic Biology doi: 10.1093/sysbio/syt015.

Neraas L.P. & Spruell P. (2001). Fragmentation of riverine systems: the genetic effects of dams on bull trout (Salvelinus confluentus) in the Clark Fork River system. Molecular Ecology 10:1153-1164.

Orghidan T. (1959). Ein neuer Lebensraum des unterirdischen Wassers, der hyporheische Biotop. Archiv für Hydrobiologie 55: 392–414.

Pabijan M. & Babik W. (2006). Genetic structure in northeastern populations of the Alpine newt (Triturus alpestris): evidence for post-Pleistocene differentiation. Molecular Ecology 15: 2397-2407.

Piégay, H., Alber A., Slater L. & Bourdin L. (2009). Census and typology of braided rivers in the French Alps. Aquatic Sciences 71: 371-388.

Pinheiro J.C. & Bates D.M. (2000). Mixed-effects models in S and S-PLUS. Springer.

Pinheiro J.C., Bates D.M., DebRoy S., Sarkar D. & the R Development Core Team. (2012). nlme: Linear and Nonlinear Mixed Effects Models. R package version 3.1-105.

Pollux, B. J. A., Luteijn, A., Van Groenendael, J. M. & Ouborg, N. J. (2009). Gene ﬂow and genetic structure of the aquatic macrophyte Sparganium emersum in a linear unidirectional river. Freshwater Biology 54: 64–76.

Pritchard J.K., Stephens M. & Donnelly P. (2000). Inference of population structure using multilocus genotype data. Genetics 155: 945–959.

Raeymaekers J.A.M., Maes G.E., Geldof S., Hontis I., Nackaerts K. & Volckaert F.A.M. (2008). Modeling genetic connectivity in sticklebacks as a guideline for river restoration. Evolutionary Applications 1:475-488.

Raymond M. & F. Rousset, (1995). GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. Journal of Heredity 86: 248-249.

Rousset F. (2008). Genepop'007: a complete reimplementation of the Genepop software for Windows and Linux. Molecular Ecology Resources 8: 103-106.

159

Chapitre 3

Sbordoni V., Alegrucci G. & Cesaroni D. (2000). Population genetic structure, speciation and evolutionary rates in cave dwelling organisms. In: Wilkens H, Culver DC, Humphreys WF (eds) Subterranean ecosystems, vol 30. Elsevier, Oxford, United Kingdom, pp 453–477.

Rice W. (1989). Analyzing tables of statistical tests. Evolution 43: 223–225.

Rousset F. (1997). Genetic differentiation and estimation of gene ﬂow from F-statistics under isolation by distance. Genetics 145:1219–1228.

Schmidt S.K., Hughes J.M. & Bunn S.E. (1995). Gene flow among conspecific populations of Baetis sp. (Ephemeroptera): adult flight and larval drift. Journal of the North American Benthological Society 14: 147-157.

Slatkin M. (1993). Isolation by distance in equilibrium and non-equilibrium populations. Evolution 39:53– 65.

Segelbacher G., Cushman S.A., Epperson B.K., Fortin M-J, Francois O., Hardy O.J., Holderegger R., Taberlet P., Waits L.P. & Manel S. (2010). Applications of landscape genetics in conservation biology: concepts and challenges. Conservation Genetics 11: 375-385.

Smouse P.E., Long J.C. & Sokal R.R. (1986). Multiple regression and correlation extensions of the Mantel test of matrix correspondence. Systematic Zoology 35: 627–632.

Stanford J.A. & Ward J.V. (2003). An ecosystem perspective of alluvial rivers: connectivity and the hyporheic corridor. Journal of the North American Benthological Society 12: 48-60.

Stanford, J.A., & Ward, J.V. (1993). An ecosystem perspective of alluvial rivers: connectivity and the hyporheic corridor. Journal of the North American Benthological Society 12: 48-60.

Stoch F. & Galassi D.M.P. (2010) Stygobiotic crustacean species richness: a question of numbers, a matter of scale. Hydrobiologia 653: 217-234.

Storfer A., Murphy M.A., Evans J.S., Goldberg C.S., Robinson S., Spear S.F., Dezzani R., Delmelle E., Vierling L. & Waits L.P. (2007). Putting the ‘landscape’ in landscape genetics. Heredity 98: 128-142.

160

Chapitre 3

Stutz H.L., Shiozawa D.K. & Evans R.P. (2010). Inferring dispersal of aquatic invertebrates from genetic variation: a comparative study of an amphipod and mayfly in Great Basin springs. Journal of the North American Benthological Society 29: 1132-1147.

Taylor P., Fahrig L. & With K. A. (2006). Landscape connectivity: back to the basics. In Connectivity Conservation (eds K. Crooks and M. A. Sanjayan), pp. 29–43. Cambridge University Press, Cambridge.

Taylor E.B., Stamford M.D. & Baxter J.S. (2003). Population subdivision in westslope cutthroat trout (Oncorhynchus clarki lewisi) at the northern periphery of its range: evolutionary inferences and conservation implications. Molecular Ecology 12: 2609–2622.

Taylor P.D., Fahrig L., Henein K. & Merriam G. (1993). Connectivity is a vital element of landscape structure. Oikos 68: 571–573.

Vannote R.L., Minshall G.W., Cummins K.W., Sedell J.R. & Cushing C.E. (1980). The river continuum concept. Canadian Journal of Fisheries and Aquatic Sciences 37: 130 – 137.

Van Oosterhout, C., W. F. Hutchinson, D. P. M. Wills & P. Shipley, (2004). MICRO-CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Resources 4: 535-538.

Venarsky M.P, Anderson F.E. & Wilhelm F.M. (2009). Population genetic study of the U.S. federally listed Illinois cave amphipod, Gammarus acherondytes. Conservation Genetics 10:915-921.

Verovnik R., Sket B. & Trontelj P. (2004). Phylogeography of subterranean and surface populations of water lice Asellus aquaticus (Crustacea: Isopoda). Molecular Ecology 13:1519–1532.

Watanabe K, Monaghan M. T., Takemon Y. & Omura T. (2010). Dispersal ability determines the genetic effects of habitat fragmentation in three species of aquatic insect. Aquatic conservation: Marine and Freshwater ecosystems 20: 574-579.

Watanabe K., Monaghan M.T. & Omura T. (2008). Longitudinal patterns of genetic diversity and larval density of the riverine caddisfly Hydropsyche orientalis (Trichoptera). Aquatic Sciences 70:377–387.

Weir B.S., Cockerham C.C. (1984). Estimating F-Statistics for the analysis of population structure Evolution 38: 1358-1370.

161

Chapitre 3

White S.D. (1993). Perspectives on defining and delineating hyporheic zones. Journal of the North American Benthological Society 12: 61-69.

Wilmer J.W., Elkin C., Wilcox C., Murray L., Niejalke D. & Possingham H. (2008). The influence of multiple dispersal mechanisms and landscape structure on population clustering and connectivity in fragmented artesian spring snail populations. Molecular Ecology 17:3733-3751.

Wright S. (1943). Isolation by distance. Genetics 28: 114–138.

Zickovich J.M. & Bohonak A.J. (2007).Dispersal ability and genetic structure in aquatic invertebrates: a comparative study in southern California streams and reservoirs. Freshwater Biology 52: 1982- 1996.

162

Conclusions et perspectives

L’Eygues au niveau des Pilles

(photo : C. Capderrey)

163

Conclusions et perspectives

CONCLUSIONS ET PERSPECTIVES

L’objectif général de ce travail comprenait deux points principaux :

Dans un premier temps, il s’agissait d’analyser les effets des écoulements hyporhéiques, induits par des caractéristiques géomorphologiques des rivières en tresses à plusieurs échelles spatiales, sur la richesse et l'abondance des communautés d’invertébrés. Dans un deuxième temps, il était question d’évaluer le lien entre la structuration génétique de populations souterraines et la fragmentation de la zone hyporhéique par la géomorphologie. Afin de répondre à ce dernier objectif, une étape de développement de l’outil moléculaire microsatellite et de quantification de la taille des populations a permis d’établir les bases nécessaires pour répondre à la question de l’impact de la géomorphologie sur la structuration génétique de l'isopode P. walteri.

Ce travail a permis de montrer que la géomorphologie des rivières en tresses influençait la distribution des communautés ainsi que la connectivité entre les populations hyporhéiques. A la généralité de ce résultat, viennent s'ajouter des spécificités propres à chacune des rivières étudiées qui soulignent des histoires probablement différentes d’une rivière à l’autre.

164

Conclusions et perspectives

Principaux résultats : effets de la géomorphologie des rivières en tresses

Sur les communautés d’invertébrés aquatiques :

- Les écoulements hyporhéiques à l’échelle des bancs de graviers et de la vallée, induits par

la géomorphologie des rivières en tresses, conditionnent fortement les caractéristiques physico-chimiques de l’eau souterraine et dans une moindre mesure celles de l'eau de surface. - Ces écoulements à différentes échelles sont hiérarchisés, interactifs et ont un effet

structurant sur les communautés d'invertébrés hyporhéiques, comprenant une certaine proportion de taxons épigés. Ils n'ont cependant pas d'effets en surface sur les communautés d'invertébrés benthiques. Le maximum de diversité pour les insectes présents dans la zone hyporhéique a été observé dans les têtes de bancs de graviers situés dans les parties aval des plaines alluviales (zones locales d’infiltration d’eau de surface

localisées au sein d’une exfiltration générale d’eau). - La pénétration des taxons épigés dans la profondeur des sédiments et la distribution verticale des taxons hypogés dans la zone hyporhéique sont également influencées par les

écoulements hyporhéiques à l’échelle de la vallée.

Sur les populations souterraines de P. walteri :

- P. walteri présente des tailles de populations efficaces importantes (> 500 individus par site

(et vraisemblablement bien plus)). Par ailleurs, le faible niveau de différenciation génétique mesuré sur au moins deux des trois rivières étudiées suggère de fortes capacités de

dispersion de cette espèce, et confirme la possibilité pour les organismes souterrains interstitiels d’utiliser les corridors hyporhéiques des rivières pour disperser sur de longues distances. - Les discontinuités sédimentaires engendrées par les resserrements de vallées (canyons), participent davantage à la différentiation génétique de P. walteri que le seul effet de l’isolement par la distance. - La structure génétique des populations de P. walteri reflète d’avantage les cassures produites par les transitions plaine-montagne que les discontinuités au sein des parties montagneuses des rivières en tresses.

165

Conclusions et perspectives

1. Synthèse des résultats

1.1. Effets de la géomorphologie des rivières en tresses sur les communautés d’invertébrés aquatiques D’un point de vue physico-chimique, les différents types d’écoulement constituent des filtres différentiels qui agissent de manière variable sur les invertébrés. Les résultats montrent que la matière organique particulaire s’accumule préférentiellement dans les têtes de bancs de graviers et ce, surtout dans les parties contraintes à l’aval des plaines. L'enfouissement de cette matière organique est lié à l'infiltration d'eau de surface qui intervient préférentiellement à l’échelle locale dans les têtes de bancs de graviers. Par contre, cette matière organique est probablement d’origine allochtone: sa plus forte abondance dans les parties aval des plaines est liée à la proximité de la ripisylve. Il n’y a pas, a priori, de plus forte production primaire dans les parties aval puisque la concentration en chlorophylle est identique dans les secteurs amont et aval des plaines étudiées. En revanche, aucune différence dans la qualité de la matière organique n’a été mise en évidence (aucun effet significatif sur le rapport C/N de la matière organique). Par ailleurs, les différences de température de l’eau souterraine entre têtes et queues de bancs de graviers sont d’autant plus accusées que l’on se situe en aval de plaine. Il y a par conséquent un effet croisé des écoulements kilométriques et hectométriques puisque ces écoulements se superposent pour créer des "zones d'eau froide" au niveau des queues de bancs de graviers à l’aval des plaines. Les différences de température entre les têtes et les queues de bancs de graviers dans les parties en aval de plaine peuvent atteindre 5 °C sur certains sites.

D’un point de vue faunistique, la distribution de nombreux taxons dans la zone hyporhéique semble influencée par l'interaction des échanges d’eau qui se produisent à ces différentes échelles spatiales. Au contraire, aucun effet des différents écoulements pris isolément ou en interaction n’a été observé dans la zone benthique. En effet, au sein de la zone hyporhéique, la richesse taxonomique totale, la densité totale d’invertébrés, la richesse taxonomique des taxons aquatiques permanents, la densité des insectes et en particulier celle des EPT (Ephémères- Plécoptères-Trichoptères) et des Chironomidae montrent toutes un patron de distribution dépendant de l’interaction entre les écoulements ayant lieu à l’échelle de la plaine et ceux ayant lieu à l’échelle du banc de graviers. Cette interaction des écoulements se traduit pour de nombreux taxons par une abondance maximale dans les têtes de bancs de graviers situés en aval de plaine. Les modèles de régression utilisés et l’analyse de covariance suggèrent que les variations de densité des insectes entre les différentes plaines et au sein d’un banc de graviers semblent être contrôlées par l’influence conjointe des écoulements interstitiels hectométriques 166

Conclusions et perspectives et kilométriques sur la température et le carbone organique particulaire. Les « hotspots d'abondance » pour les larves d’insectes tels que les EPT et les Chironomidae sont localisés dans les têtes de bancs de graviers des avals de plaine car ces habitats reçoivent d’avantage de matière organique et d’oxygène provenant de l’infiltration locale d’eau de surface. Dans les queues de bancs de graviers des avals de plaines, les températures plus faibles, résultant d’écoulements kilométriques, suffisent à réduire drastiquement la densité des jeunes stades d’insectes. Ce résultat traduit l’importance primordiale de la température dans le développement des insectes aussi bien aquatiques que terrestres (Gilooly et al. 2002). L'importance des interactions entre les écoulements engendrés par des formes géomorphologiques à différentes échelles spatiales est cohérente avec les conclusions d’études précédentes qui ont documenté séparément les effets des écoulements hectométriques (Franken et al. 2001, Olsen & Townsend 2003, Davy-Bowker et al. 2006) et kilométriques sur la distribution des invertébrés dans les sédiments des rivières (Creuzé des Châtelliers & Reygrobellet 1990, Malard et al. 2003). L’importance des interactions sur les invertébrés révélée dans cette étude corrobore celle démontrée dans l’étude de Baxter & Hauer (2000) sur les pontes de Salmonidés, qui a notre connaissance était la seule jusqu’à ce jour à avoir pris en compte simultanément les deux types d’écoulement.

L’abondance de taxons aquatiques permanents, incluant les Copépodes et les Oligochètes, répond positivement à l’effet des écoulements kilométriques car elle est plus élevée dans les avals de plaines. L'explication la plus probable met en avant le rôle des écoulements kilométriques sur la permanence des habitats aquatiques. Les parties amont des plaines alluviales sont plus sensibles aux assèchements que les parties avals. Dans ces dernières, les remontées d'eau souterraine liées au resserrement de la vallée favorisent la pérennité des habitats aquatiques (Stanley et al. 1997, Malard et al. 2002). Parmi tous les taxons hyporhéiques étudiés, seuls les Ostracodes présentent une réponse qui correspond exclusivement aux échanges hyporhéiques hectométriques induits par les bancs de graviers. Une identification à l'espèce des Ostracodes (réalisée par Pierre Marmonier) a permis de mettre en évidence une répartition spatiale des Ostracodes à l’échelle du banc de graviers. Les espèces stygobies (i.e. strictement inféodées aux eaux souterraines) sont significativement plus abondantes dans les queues de bancs de graviers (p=0.012) alors qu’il n’y a aucun effet sur les espèces stygophiles (i.e. espèces présentant des populations dans les eaux de surface et les eaux souterraines). Les espèces stygobies pourraient sélectionner préférentiellement les queues de bancs de graviers en raison d'une plus faible compétition pour les ressources trophiques à ces endroits et de leur tolérance aux températures plus froides. Dans cette étude, la majorité des Ostracodes identifiés

167

Conclusions et perspectives comme possédant des traits d’histoire de vie stygobies se sont avérés appartenir à de nouvelles espèces de la sous-famille des Candoninae (Pierre Marmonier, communication personnelle).

La distribution verticale des taxons épigés et hypogés est également influencée par les écoulements à l’échelle kilométrique. La densité moyenne des taxons épigés tend à décroître avec la profondeur et celle des épigés tend à augmenter avec la profondeur, et ce avec d’autant plus d’intensité que l’on se rapproche de l’aval de plaine.

Cette étude n’a en revanche pas permis de mettre en évidence un quelconque effet seul ou cumulé des écoulements hyporhéiques sur les taxons benthiques. En effet, parmi toutes les variables taxonomiques mesurées dans le benthos (richesse des invertébrés, des insectes, des taxons aquatiques permanents, abondance des invertébrés, des insectes, du groupe des Ephémères-Plecoptères-Trichoptères, des Chironomidae et des taxons aquatiques permanents), aucune ne présente de différence entre amont et aval de plaine, ou entre tête et queue de banc. Une explication à cette absence d'effet pourrait être double : soit les écoulements, notamment les apports d'eau hyporhéique au chenal, ne sont pas suffisamment prononcés pour influencer les conditions abiotiques dans la zone benthique (e.g., production primaire; température), soit le milieu de surface est soumis à une telle variabilité spatio-temporelle dans les rivières en tresses que les communautés sont avant tout structurées par des processus stochastiques et par les capacités de dispersion des organismes. Une récente étude menée sur de multiples sites dans des rivières en tresses de Nouvelle Zélande par Gray & Harding (2011) a montré que les principaux déterminants de la composition des communautés d'invertébrés benthiques étaient d’ordre hydrologique. Les facteurs hydrologiques intervenant à l’échelle du bassin versant montrent une forte colinéarité avec les facteurs environnementaux intervenant à des échelles spatiales plus petites (à l’échelle de la plaine et de l'habitat local). Les communautés d’invertébrés présentes dans tous les types d’habitats au sein d’une plaine (e.g. chenal principal, annexe fluviale sans connexion amont avec le chenal principal, étangs) sont influencées par l’hydrologie générale du bassin versant qui régule l’influence de multiples autres facteurs à des échelles plus fines (Gray & Harding 2011). Dans notre étude, l'effet du basin versant est considéré comme un facteur aléatoire non contrôlé (facteur site): nous n'avons donc pas cherché à déterminer si les différences entre amonts et avals de plaine et têtes et queues de bancs dépendaient avant tout de l'hydrologie du bassin versant.

Les rivières en tresses sont des systèmes particulièrement dynamiques au sein desquels les habitats de surface et les conditions abiotiques correspondantes restent stables pendant des périodes de temps très courtes, souvent inférieures à quelques mois (Arscott et al. 2002, Tockner et al. 2003, Gray & Harding 2007). Les crues sont des perturbations qui réinitialisent 168

Conclusions et perspectives très fréquemment le développement de successions au sein des communautés d’invertébrés. Au sein de chaque habitat, la composition et la richesse des communautés sont régulées par l’intensité et la fréquence des perturbations successives qui affectent tout ou une partie de la mosaïque d’habitats (Ward et al. 2002, Malard et al. 2002, van der Nat et al. 2003). A l'évidence, ces perturbations affectent d'avantage les communautés benthiques car dans la zone hyporhéique les variations sont amoindries (par tamponnage). Ce contraste explique au moins en partie notre incapacité à rendre compte de la distribution spatiale des taxons benthiques à partir d'un plan d'échantillonnage qui considère uniquement une variation spatiale des échanges entre eau de surface et eau souterraine.

Cette étude contribue à une meilleure compréhension de la nature hiérarchique des échanges hyporhéiques produits par les différentes structures géomorphologiques composant un paysage aquatique. Les résultats obtenus s'ajoutent à ceux déjà publiés sur le rôle des écoulements hyporhéiques spatialement imbriqués sur les processus biogéochimiques (Dent et al. 2001, Poole et al. 2006, Doering et al. 2012), la température (Poole et al. 2008), et la distribution des pontes de Salmonidae (Baxter & Hauer 2000) et d’invertébrés (Creuzé des Châtelliers & Reygrobellet 1990). Au cours de ce travail, les différences entre amont et aval de plaine et tête et queue de bancs de graviers ont pu être généralisées à partir d'un plan d'échantillonnage comprenant 12 sites répartis sur plusieurs rivières distantes géographiquement. Longtemps, les études relatives à l’étude des effets des écoulements hyporhéiques se sont concentrées sur une seule portion de rivière (Creuzé des Châtelliers 1990, Pepin & Hauer 2002, Malard et al. 2003, Doering et al. 2012). Dans de telles études ne comprenant qu'une seule plaine, les écoulements hyporhéiques ont souvent été définis précisément grâce à des approches de modélisation hydrologique ou à des traçages. Cette quantification très précise des écoulements hyporhéiques s’est avérée impossible, pour des contraintes de temps et de moyens l'étude, sur un total de 12 sites. Néanmoins, les études précédentes présentent un problème de pseudo-réplication vis-à-vis des écoulements plurikilométriques, dès lors que les échantillons sont collectés dans les parties amont et aval d'une seule et même plaine. Par souci de généralisation, nous avons donc cherché à éliminer cette pseudo-réplication en travaillant sur de multiples plaines.

169

Conclusions et perspectives

1.2. Effets de la géomorphologie des rivières en tresses sur la structuration génétique des populations du crustacé P. walteri Une étape de mise au point de marqueurs microsatellite et de quantification de taille des populations a été nécessaire pour aborder la question générale de l’effet de la géomorphologie sur la structuration génétique. Malgré les avancées remarquables de ces dernières années en matière de séquençage haut débit, ce travail a souligné la difficulté toujours présente, du développement et de la mise au point de marqueurs, puisqu’avec un pool initial de 4518 loci microsatellites identifiés dans l’ADN de P. walteri, seulement sept marqueurs polymorphes ont pu être mis au point au cours de ce travail de thèse. Ils ont cependant permis d’obtenir un jeu de données largement exploitable. Le résultat de ce travail montre par ailleurs que la taille efficace des populations peut être très grande (Ne > 500 individus estimés sur Livron et Ne > 1000 individus estimés sur Aouste) et ce, quelque soit la méthode de calcul, qu’elle soit basée sur le déséquilibre de liaison (logiciel LDNE) ou la méthode « Approximate Bayesian Computation » (logiciel ONeSAMP). Pourtant, nous avons trouvé une différence assez marquée entre les deux sites. Sur Aouste et Livron, des tailles de population, vraisemblablement très grandes, combinées à un nombre limité de loci (respectivement sept et six loci utilisés) semblent empêcher LDNE d’estimer précisément la borne maximale de l’intervalle de confiance (il la place alors à l’infini), et ne permet pas non plus à ONeSAMP, dans le cas d’Aouste, de converger vers un seul et même ordre de grandeur pour l’estimation maximale (Luikart et al. 2010). En revanche, ONeSAMP semble fournir des valeurs congruentes de taille efficace sur Livron et les deux approches suggèrent des tailles de populations plus grandes sur Aouste. Globalement, et malgré ces problèmes de convergence, ces estimations restent du même ordre de grandeur que celles mis en avant pour certains organismes aquatiques tels que des copépodes (Ne > 1000, Zeller et al.

5 2008), des amphipodes Gammarus minus (Ne = 2x10 , Kane et al. 1994) et des poissons Astyanax fasciatus (Ne = 9x104, Kane et al. 1994).

Peu d’informations sont disponibles dans la littérature sur la taille des populations en milieu souterrain, les résultats de cette thèse apportent donc des éléments de compréhension mais il subsiste encore un défi à relever en termes d’améliorations méthodologiques pour l’estimation des tailles efficaces. Néanmoins, l’issue de cette étude permet de remettre en cause l’idée reçue concernant les populations souterraines, selon laquelle ces populations ne présenteraient pas de forte diversité génétique, seraient petites et regroupées dans des patchs favorables entourés d’un milieu imaginé comme extrêmement hostile.

De manière très claire ce travail a souligné l’importance de la géomorphologie sur la structuration génétique des populations de P. walteri. Par la présence de canyons, la

170

Conclusions et perspectives géomorphologie des rivières en tresses explique mieux la différenciation génétique entre sites échantillonnés sur les trois rivières que ne le ferait le simple effet d’isolement par la distance. Par référence avec le milieu de surface, les caractéristiques géomorphologiques telles que les canyons et les cascades avaient déjà été répertoriés comme inhibiteurs du flux de gènes chez des poissons (Currens et al. 1990, Costello et al. 2003, Taylor et al. 2003, Crispo et al. 2006, Burridge et al. 2007).

Les secteurs montagneux des rivières étudiées présentent une plus forte différentiation génétique entre leurs sites et une plus forte structuration génétique que les secteurs de plaine. Cette structuration génétique, légèrement supérieure en montagne, ne reflète pas systématiquement une rupture due à un canyon alors qu’en cas d’isolement extrême en montagne, un patron plus structuré génétiquement aurait pu être attendu. Au lieu de cela, la structure génétique sur les trois rivières étudiées reflète plutôt une transition plaine montagne, plutot qu’une configuration de type population unique dans les secteurs de plaine (en raison de plus de connectivité) et populations multiples dans les secteurs de montagne.

Les résultats ont montré que la diversité allélique sur les trois rivières étudiées présentait des patrons différents. Le Roubion présente une diversité allélique qui suit les patrons classiques d’isolement par barrières, telle que celle que l’on peut retrouver dans les eaux de surface soutenue par une faible dispersion par les individus et/ou de fortes barrières à la dispersion. En revanche, la Drôme et l’Ouvèze présentent des patrons de diversité génétique qui laissent penser à une plus forte dispersion dans les sédiments de ces rivières avec peu de barrières.

De manière surprenante, au moins deux des trois rivières étudiées (Drôme et Ouvèze) présentent des niveaux de différentiation génétique relativement faibles sauf dans les extrêmes amonts. Une faible structuration génétique peut être le résultat d’importants flux de gènes et peut témoigner de la perméabilité du milieu hyporhéique à la dispersion. Une hypothèse alternative pour expliquer les faibles niveaux de différentiation génétique observés peut également être soulevée ; même si les flux de gènes actuels sont interrompus, les flux de gènes ancestraux sont toujours visibles du fait de la grande taille des populations initiales de P. walteri (comme nous avons pu l’observer dans la Drôme sur les sites de Livron et Aouste) et permettent ainsi de limiter l’action de la dérive génétique et par conséquent d’éviter la fixation d’allèles au sein de chacune des populations. De grandes populations séparées depuis peu de temps peuvent apparaître génétiquement homogènes même en l’absence de flux de gènes contemporains. Ce paradoxe a été démontré par exemple chez la morue d’Atlantique Nord dans un environnement a priori homogène (Hauser & Carvalho, 2008). Egalement en milieu marin, des populations de 171

Conclusions et perspectives chinchard, (Trachurus trachurus, poisson) restent actuellement génétiquement homogènes en dépit de toutes les autres informations fournies par les données morphologiques, les traits d’histoire de vie et les données parasitaires qui suggèrent une subdivision des populations (Abaunza et al. 2008).

Sur le Roubion, les niveaux de différentiation entre chaque site sont deux fois plus élevés que sur les deux autres rivières et semblent compatibles avec la géomorphologie générale de la rivière qui est incisée et présente de faibles accumulations sédimentaires (Liébault & Piégay 2002). Ceci suggère que lorsque l’épaisseur de sédiment le permet, P. walteri peut présenter une forte capacité de dispersion.

2. Implications en termes de gestion

La gestion des corridors fluviaux est intimement liée à la représentation conceptuelle que nous avons de leur structure et de leur fonctionnement. Cette représentation conceptuelle a longtemps été fondée sur une approche longitudinale des cours d'eau (Vannote et al. 1980), puis plus récemment sur une approche transversale de ces mêmes cours d'eau qui intègre les multiples habitats latéraux de la plaine alluviale (Gregory et al. 1991, Ward et al. 2002, Amoros & Bornette 2002). De manière non surprenante, la gestion des rivières a successivement conduit à leur endiguement (la rivière perçue comme un conduit, Bencala 2000), puis plus récemment des pratiques dites de restauration ont permis de ré-établir au moins en partie la connectivité latérale entre le chenal principal et ses annexes fluviales (Olivier et al. 2009, Paillex et al. 2013).

La reconnaissance de la dimension verticale des rivières (les échanges entre la rivière et sa nappe) et le lien intime entre ces échanges et la géomorphologie des vallées est une représentation conceptuelle du fonctionnement des cours d'eau qui s'est imposée au cours de ces 20 dernières années seulement. Ces trois représentations conceptuelles (longitudinale, transversale et verticale) ne s'excluent pas mutuellement mais elles conduisent à des sectorisations des cours d'eau en matière de gestion qui peuvent être très différentes. La représentation longitudinale conduit à distinguer les amonts des avals de bassins versants, la représentation latérale conduit à séparer les secteurs dans lesquels la rivière divague (tressage, anastomose, et méandres) des secteurs contraints latéralement alors que la dimension verticale conduit à identifier des secteurs au sein desquels les échanges d'eau entre la rivière et son bassin versant sont particulièrement prononcés comme par exemple des zones de convergence hydrologique (Poole 2010). 172

Conclusions et perspectives

En termes de gestion, la sectorisation des rivières en tresses à partir d'une analyse de l'organisation des échanges d'eau à l'échelle de la vallée est d'autant plus appropriée que ces échanges influencent fortement la diversité des habitats, la diversité des communautés et l'intensité des processus biogéochimiques, notamment la capacité d'autoépuration du cours d'eau. Cette sectorisation est aujourd'hui réalisable (Buffington & Tonina 2009), mais elle nécessité que le gestionnaire puisse s’approprier les concepts en écologie, en géomorphologie et en hydrogéologie qui sous-tendent le fondement d’un découpage de la vallée en unités géomorphologiques qui génèrent des échanges hyporhéiques aux différentes échelles spatiales. Les perspectives de ce travail de recherche doivent donc comprendre des efforts en matière de transfert de connaissances vers les gestionnaires qui seront élaborés collectivement au sein d’une plaquette par les membres du projet « Rivières en tresses ».

Au terme de ce travail, il apparaît clairement que les avals de plaine alluviale où la bande active est contrainte par un resserrement latéral et/ou vertical du lit rocheux représentent des ‘points chauds de biodiversité’ notamment pour les insectes présents dans la zone hyporhéique et les taxons aquatiques permanents. En termes de gestion de la biodiversité, dans les secteurs en tresses, les parties aval des plaines doivent être considérées comme des réservoirs de biodiversité, non seulement pour des espèces hypogées, mais aussi pour des espèces épigées « en devenir » qui utilisent la zone hyporhéique. La zone hyporhéique est utilisée par les taxons benthiques comme zone de refuge lors de perturbations (Schwoerbel 1964, Hynes 1974, Dole- Olivier & Marmonier 1992, Palmer et al. 1992) comme nurserie par les jeunes stades d’insectes pour permettre leur protection pendant leur développement et incubation (Schwoerbel 1961, Puig et al. 1990, Ward 1994). Elle permet aussi à certaines larves d’échapper à une trop forte pression de prédation en surface (Stead et al. 2005). Une implication de ce travail pourrait consister à cartographier à l’aide d’un système d’information géographique ces « hotspots de biodiversité » en utilisant des photos aériennes et des couvertures topographiques, géomorphologiques et hydrogéologiques.

La biodiversité est généralement appréhendée à trois niveaux ; la diversité des écosystèmes, la richesse spécifique et la diversité génétique au sein des populations. Très souvent, les écosystèmes sont qualifiés par leur biodiversité spécifique, car bonne indicatrice de la stabilité des communautés et facile à récolter. Cependant, il existe une biodiversité « cachée » : la diversité génétique dont la connaissance renseigne sur les forces à l’œuvre sur le devenir des espèces (extinction, spéciation, adaptation locale...).

Il est en réalité très probable que les effets des perturbations anthropiques se fassent en premier lieu ressentir à l’échelle des populations. En particulier, l’incision d’une rivière peut modifier la 173

Conclusions et perspectives diversité et la structure génétique de populations d’espèces interstitielles en modifiant les possibilités de dispersion au sein des sédiments. Dans cette étude, les populations de l’isopode P. walteri de la rivière du Roubion, dont le lit a subi une très forte incision (Liébault & Piégay 2002), présentent effectivement la plus faible diversité génétique mais elles sont aussi plus fortement différenciées génétiquement. L’étude de la structuration génétique de populations interstitielles dans des rivières ayant subi des niveaux variables d’incision pourrait constituer un meilleur indicateur des effets sur la biodiversité, notamment d’un point de vue évolutif, que la seule étude des modifications induites par l’incision sur les communautés. Après le travail développé au cours de cette thèse, ce type d’étude est plus facilement envisageable, puisque les marqueurs moléculaires sont désormais disponibles pour des espèces interstitielles des rivières en tresses du bassin du Rhône tels que les isopodes Proasellus walteri et Proasellus synaselloides (sur le bassin de la Durance)

3. Perspectives

Les perspectives de recherche présentées ci-dessous visent, non seulement à renforcer les résultats obtenus au cours de cette thèse, mais également à étendre leur portée à d’autres indicateurs de diversité ou à d’autres taxons.

3.1. Vers une meilleure quantification des écoulements hyporhéiques Les gradients hydrauliques verticaux et de la conductivité électrique des eaux sont deux indicateurs qui permettent d’obtenir une vision très partielle des échanges entre les eaux de surface et les eaux souterraines. Une quantification plus précise des masses d’eau en présence, notamment les nappes de versant et le sous-écoulement de la rivière, de leur mélange en différents endroits de la plaine, et de la variation des temps de transit de l’eau au sein des sédiments permettrait de préciser les liens entre écoulements, filtres abiotiques et distribution des peuplements au sein des rivières en tresses. Cette quantification nécessite d’utiliser des approches spécifiques telles que la modélisation des écoulements à partir de la mesure des pressions hydrauliques (niveaux piézométriques) et de l’estimation des perméabilités (Poole et al. 2008), l’utilisation de marqueurs physico-chimiques naturels de l’origine des eaux (Malard et al. 1999), et l’estimation des temps de résidence des eaux souterraines à partir de marqueurs isotopiques (Bethke & Johnson 2008).

174

Conclusions et perspectives

3.2. Vers une meilleure résolution taxonomique L’étude des relations entre la diversité des communautés et les écoulements hyporhéiques gagnerait également en précision si les différentes espèces appartenant aux groupes taxonomiques considérés dans cette étude pouvaient être identifiées. L’identification morphologique des espèces n’est pas réalisable sur les jeunes stades des larves d’insectes mais elle est actuellement envisagée pour les taxons aquatiques permanents tels que les Oligochètes, les Copépodes et les Amphipodes. Cette identification permettrait non seulement d’aborder les relations entre écoulements et diversité à partir de groupes écologiques (stygobies/stygophiles ; Claret et al. 1999), de traits biologiques (Resh et al. 1994, Dolédec et al. 2010) et de traits fonctionnels (Paillex et al. 2007) mais également de définir des espèces indicatrices d’échanges.

3.3. Autres mesures de la diversité L’identification des espèces permettrait également de quantifier : 1) les différences de richesse « gamma » entre les parties amont et aval des plaines alluviales ; 2) les différences de composition des communautés (diversité beta) entre les têtes et les queues de bancs de gravier entre les parties amont et avals des plaines alluviale. Enfin, le plan d’échantillonnage réalisé se prête particulièrement bien à une partition hiérarchique de la richesse (Lande 1996) qui permettrait de définir la contribution relative des sites, des parties amont et aval de plaine et des têtes et des queues de bancs de gravier à la richesse totale. Cette partition est particulièrement appropriée pour définir les unités spatiales sur lesquelles doivent se concentrer les efforts de conservation (Malard et al. 2009).

3.4. Effets des écoulements hyporhéiques sur les processus de l’écosystème La première partie de cette thèse était consacrée à l’étude de l’influence des écoulements hyporhéiques sur les communautés d’invertébrés. Or ces mêmes écoulements influencent également de nombreux processus tels que la respiration aérobie, la dénitrification et la nitrification (Jones & Mulholland 2000). Les sites sélectionnés lors de cette étude fournissent un cadre idéal pour déterminer quelle est l’influence des écoulements interstitiels à différentes échelles spatiales et leurs interactions sur les processus de l’écosystème. L’intensité de ces processus dépend de l’abondance et de l’activité du biofilm dans les sédiments. L’abondance des biofilms microbiens dans les sédiments peut être estimée à partir de la mesure du carbone organique sédimentaire, de la quantité de protéines et de carbohydrates, et de comptage bactérien par microscopie à épifluorescence (Foulquier 2009). L’activité de ce biofilm est quantifiable à partir des mesures d’activités hydrolitique et déshydrogénasique, la respiration sédimentaire peut être mesurée par microcatharométrie et de nombreuses approches 175

Conclusions et perspectives moléculaires (e.g. DDGE, Muyzer et al. 1993) permettent de caractériser la diversité et la structure des communautés bactériennes.

3.5. Variabilité des tailles de populations entre plaine et montagne Dans ce travail, la taille des populations a été appréhendée sur seulement deux sites situés à l’aval de la Drôme. Cette approche n’a donc pas intégré l’hétérogénéité pouvant exister entre plaine et montagne. Pour tester cette hypothèse un reste de matériel provenant de l’échantillonnage en transect sur chaque rivière est disponible. En effet, dans le cadre de l’objectif 3, sur chaque rivière 90 individus ont été prélevés sur un site de plaine et un site de montagne. Pour chaque site, 30 individus ont été prélevés au niveau de 3 bancs de graviers. Trente de ces 90 individus ont été utilisés dans le cadre de l’objectif 3. Le grand nombre d’individus récoltés (30 individus x 3 bancs de graviers x 2 sites x 3 rivières) pourrait permettre de réaliser plus d’analyses via les méthodes basées sur le déséquilibre de liaison ou d’estimation bayésiennes et d’établir des degrés de convergences plus fiables que ceux que nous avons trouvés pour les tailles de population estimées sur deux sites seulement d’une même rivière. Les 60 individus supplémentaires pour mener à bien ce projet sont d’ores et déjà sexés et génotypés, cette approche peut permettre aussi, entre autres, de lever le voile sur d’éventuels comportements de dispersion liés au sexe et sur l’hétérogénéité qu’il peut exister au sein d’un site.

3.6. Histoire démographique Sur la Drôme et l’Ouvèze par exemple, on ne sait pas si les patrons de faible différenciation génétique observés sont le résultat d’une forte connectivité ou bien l’effet de la grande taille des populations. Le flux de gène est une mesure centrale dans les études de génétique des populations, mais dans tous les cas, utiliser une mesure simple via le FST peut compliquer la distinction entre les effets du paysage sur la taille efficace (via la dérive génétique) et les effets du paysage sur la dispersion (flux de gènes). Pour surmonter ces effets confondants, de nouvelles méthodes de génétique des populations ont été développées, c’est notamment le cas des approches coalescentes comme celles développées dans les logiciels Migrate (Beerli & Palczewski 2010), ou MIMAR (Becquet & Przeworski 2007). Le cadre Bayésien est également très employé, soit pour détecter des évènements récents de dispersion en utilisant des tests d’assignement (ce qui été fait dans ce travail par le logiciel STRUCTURE, Pritchard et al. 2000), soit pour reconstruire des scenarios plus complexes utilisant les méthodes ABC (approximate Bayesian computations). Ces dernières méthodes permettent d’inférer des paramètres tels qu’un jeu de données microsatellites, de créer des scénarios plus ou moins complexes avec ces

176

Conclusions et perspectives données et de les comparer au jeu de données échantillonné (Cornuet et al. 2008, Beaumont et al. 2010).

Dans notre cas, sur les trois rivières étudiées, des patrons de structuration génétique différents sont apparus d’une rivière à l’autre. Si on effectue une analyse de la structuration génétique par tests d’assignement sous STRUCTURE à partir de la totalité des sites de l’objectif 3, on observe des patrons qui reflètent probablement des histoires démographiques différentes. Cette analyse montre que le Roubion présente une structuration génétique totalement différente de celle de la Drôme qui lui est géographiquement adjacente. La Drôme apparait comme une rivière assez homogène génétiquement. On constate qu’un groupe de sites présente une structuration génétique similaire celle observée en aval de l’Ouvèze alors que la Drôme est plus proche géographiquement du Roubion, et que l’amont de l’Ouvèze semble similaire à l’aval du Roubion (Figure 18). L’observation de cette structure peut faire émerger plusieurs scénarios sur des histoires sédimentaires qui auraient pu mettre les rivières en relation à un moment donné. Y’a-t- il par exemple eu une connexion ancienne entre l’Ouvèze et le Roubion ? Dans quelle mesure le grand écoulement latéral du Rhône aurait-il pu permettre d’établir des connexions ? L’utilisation des méthodes ABC dans ce cas semble particulièrement pertinente pour comprendre la structuration actuelle des populations. Par ailleurs, en complément de l’utilisation des microsatellites, l’utilisation de l’ADN mitochondrial via les gènes 16 S et CO1 pourrait permettre d’observer des évènements plus anciens (Chenuil 2006) et de dégager des scenarios phylogéographiques sur les potentielles connexions entre rivières. L’utilisation de l’ADN mitochondrial, marqueur évoluant moins vite que les microsatellites, permettrait également de s’écarter des problèmes d’allèles nuls souvent fréquents dans un jeu de microsatellites appliqué à une vaste aire où par conséquent la probabilité que les populations ne soient plus en contact depuis un certain temps est plus forte ; car en effet, la fréquence des allèles nuls est d’autant plus importante dans un jeu de données génétique que les individus sont distants de ceux ayant servi à la création de la banque microsatellites (Chapuis & Estoup 2007).

177

Conclusions et perspectives

Figure 18 : Structure génétique globale observée pour l’ensemble des 25 sites échantillonnés sur les rivières Drôme, Roubion et Ouvèze. STRUCTURE identifie un nombre optimal de groupes pour K=3.

3.7. Evaluation de la dispersion pour d’autres organismes souterrains Assez intuitivement, une autre piste de recherche consisterait à évaluer le niveau de dispersion d’autres espèces souterraines. Pour l’instant, les patrons observés chez P. walteri dans ce contexte de rivière ne permettent pas de proposer de généralisation sur une grande capacité de dispersion de tous les organismes souterrains. Des marqueurs microsatellites ont récemment été développés pour des Syncarides Parabathynellidae (Asmyhr et al. 2012), et des marqueurs pour l’amphipode Niphargus rhenorhodanensis sont actuellement disponibles au laboratoire sous forme de banque de séquences microsatellites. Ces derniers pourraient être développés et utilisés dans le même plan d’échantillonnage, puisque Niphargus rhenorhodanensis est présent sur l’aire d’étude de ce travail.

178

179

Littérature citée

Abaunza P., Murta A.G., Campbell N., Cimmarute R., Comesana A.S., Dahle G., Garcia-Santamaria M.T., Gordo L.S., Iversen S.A., MacKenzie K., Magoulas A., Mattiucci S., Molloy J., Nascetti G., Pinto A.L., Quinta R., Ramos P., Sanjuan A., Santos A.T, Stransky C. & Zimmermann C. (2008). Stock identity of horse mackerel (Trachurus trachurus) in the Northeast Atlantic and Mediterranean Sea: integrating the results from different stock identiﬁcation approaches. Fisheries Research 89: 196-209.

Abdelkrim J., Robertson B.C., Stanton J.A.L., Gemmell N.J. (2009). Fast, cost-effective development of species-specific microsatellite markers by genomic sequencing. Biotechniques 46: 185-191.

Allen K.R. (1951). The Horokiwi stream: a study of a trout population. New Zealand Marine Department Fisheries Bulletin 10.

Alonso D., Etienne R.S. & McKane A.J. (2006). The mertis of neutral theory. Trends in Ecology and Evolution 21: 451-457.

Amoros C. & Bornette G. (2002) Connectivity and complexity in waterbodies of riverine floodplains. Freshwater Biology 47: 761-776.

Anderson C.D., Epperson B.K., Fortin M.J., Holderegger R., James P.M.A., Rosenberg M.S., Scribner K.T. & Spear S. (2010). Considering spatial and temporal scale in landscape genetic studies of gene flow. Molecular Ecology 19: 3565-3575.

Araguas R.M., Vidal O., Pla C. & Sanz N. (2012). High genetic diversity of the endangered Iberian three- spined stickleback (Gasterosteus aculeatus) at the Mediterranean edge of its range. Freshwater Biology 57: 143-154.

Arden W.R. & Kapuscinski A.R. (2003). Demographic and genetic estimates of effective population size (Ne) reveals genetic compensation in steelhead trout. Molecular Ecology 12: 35-50.

Arscott D.B., Tockner K., Van der Nat D. & Ward J.V. (2002). Aquatic habitat dynamics along a braided Alpine River ecosystem (Tagliamento River, Northeast Italy). Ecosystems 5: 802-814.

Arscott D.B., Tockner K., Ward J.V. (2005). Lateral organization of aquatic invertebrates along the corridor of a braided river floodplain. Journal of the North American Benthological Society 24:934–954.

Ashmore P.E. (1991). How do gravel bed rivers braid? Canadian Journal of Earth Sciences 28: 326-341.

Asmyhr M.G., Stow A.J. & Hose G. (2012). The first set of microsatellite markers developed for the ancient Parabathynellidae (Syncarida, Malacostraca) and their utility for other groundwater fauna. Conservation Genetics Resources 4: 587-589.

Avise J.C. (2000). Phylogeography: The History and Formation of Species. Cambridge, MA: Harvard University Press.

180

Avise J.C. & Selander R.K. (1972). Evolutionary genetics of cave-dwelling fishes of the genus Astyanax. Evolution 26: 1-19.

Baguette M., Blanchet S., Legrand D., Stevens V.M. & Turlure C. (2012). Individual dispersal, landscape connectivity and ecological networks. Biological Reviews. doi: 10.1111/brv.12000

Baxter C.V. & Hauer F.R. (2000). Geomorphology, hyporheic exchange and selection of spawning habitat by bull trout (Salvelinus confluentus). Canadian Journal of Fisheries and Aquatic Sciences 57: 1470-1481.

Beaumont M.A. (2010). Approximate Bayesian Computation in Evolution and Ecology. Annual Review of Ecology Evolution and Systematics 41: 379-406.

Becquet, C., & Przeworski, M. (2007). A new approach to estimate parameters of speciation models with application to apes. Genome Research 17: 1505-1519.

Beebee T.J.C. (2007). Population structure and its implications for conservation of the great silver beetle Hydrophilus piceus in Britain. Freshwater Biology 52: 2101-2111.

Beerli, P., & Palczewski, M. (2010). Unified framework to evaluate panmixia and migration direction among multiple sampling locations. Genetics 185:, 313-326.

Bell G. (2001). Neutral macroecology. Science 293: 2413:2418.

Belletti B., Dufour S. & Piégay H. (2012). Regional variability of aquatic pattern in braided reaches (example of the French Rhône basin). Hydrobiologia doi: 10.1007/s10750-012-1279-6.

Bencala K.E. (2005). Hyporheic exchange flows. In Encyclopedia of Hydrological Sciences; Anderson, M., Ed.; John Wiley & Sons Ltd.: New York; Vol. 3, Part 10, pp 1733-1740.

Bencala K. E. (2000). Hyporheic zone hydrological processes. Hydrological Processes 14: 2797-2798.

Benda L., Poff N.L., Miller D., Dunne T., Reeves G., Pess G. & Pollock, M. (2004). The network dynamics hypothesis: how channel networks structure riverine habitats. Bioscience 54: 413-427.

Bethke, C. M., & Johnson, T. M. (2008). Groundwater age and groundwater age dating. Annual Review of Earth and Planetary Sciences 36: 121-152.

Bilton D.T., Freeland J.R. & Okamura,B. (2001). Dispersal in freshwater invertebrates. Annual Review of Ecology and Systematics 32: 159–181.

Blanchet S., Rey O., Etienne R., Lek S. & Loot G. (2010). Species-specific responses to landscape fragmentation: implications for management strategies. Evolutionary Applications 3: 291-304.

Bohonak A.J. & Jenkins D.G. (2003). Ecological and evolutionary significance of dispersal by freshwater invertebrates. Ecology Letters 6: 783-796.

181

Bonnet E. & Van de Peer Y. (2002). zt: a software tool for simple and partial Mantel tests, Ghent University.

Borowsky R.L. & Vidthayanon C. (2001). Nucleotide diversity in populations of balitorid cave fishes from Thailand. Molecular Ecology 10: 2799-2805.

Botosaneanu L. (1986). Stygofauna Mundi: a Faunistic, Distributional, and Ecological Synthesis of the World Fauna inhabiting Subterranean Waters (Ed. Botosaneanu, L.). Brill Academic Publishers, Leiden.

Bou C. & Rouch R. (1967). Un nouveau champ de recherches sur la faune aquatique souterainne. Comptes Rendus de l’Academie des Sciences Paris 265: 369-370.

Boulet M., Couturier S., Côté S.D., Otto R. & Bernatchez L. (2007). Integrative use of spatial, genetic, and demographic analyses for investigating genetic connectivity between migratory, montane, and sedentary caribou herds. Molecular Ecology 16: 4223-4240.

Boulton A.J., Datry T., Kasahara T., Mutz M. & Stanford J.A. (2010). Ecology and management of the hyporheic zone: stream-groundwater interactions of running waters and their floodplains. Journal of the North American Benthological Society 29: 26-40.

Boulton, A. J., Findlay, S., Marmonier, P., Stanley, E. H. & Valett, H. M. (1998). The functional significance of the hyporheic zone in streams and rivers. Annual Review of Ecology, Evolution and Systematics 29: 59-81.

Bravard J.P. (2002). Les réponses des systèmes fluviaux à une réduction des flux d’eau et de sédiments sous l’effet du reboisement en montagne. La houille blanche 3 : 68-71.

Bravard J.P., Landon N., Peiry J.L. & Piégay H. (1999). Principles of engineering geomorphology for managing channel erosion and bedload transport, examples from French rivers. Geomorphology 31: 291-311.

Bravard J.P. & Gilvear D.J. (1996). Hydrological and geomorphological structure of hydrosystems. In: The Fluvial Hydrosystems (pp. 98-116). Springer

Bravard J.P. (1986) Le Rhône, du Léman à Lyon. La Manufacture, Lyon, 451 p.

Bravard J.P., Roux A.L., Amoros C., Richardot-Coulet M., Reygrobellet J.L., Bournaud M. & Pautou, G. (1986). Evolution spatio-temporelle des systèmes fluviaux aménagés : recherches méthodologiques sur le Haut Rhône français. La Houille Blanche 18: 1-8.

Bridge J.S. (1993). The interaction between channel geometry, water flow, sediment transport and deposition in braided rivers. Geological Society, London, Special Publications 75: 13-71.

Brodie C.R., Leng M.J., Casford J.S.L., Kendrick C.P., Lloyd J.M., Yongqiang Z. & Bird M.I. (2011). Evidence for bias in C and N concentrations and δ13C composition of terrestrial andaquatic organic materials due to pre-analysis acid preparation methods. Chemical Geology 282: 67-83.

Broquet T. & Petit E.J. (2009). Molecular Estimation of Dispersal for Ecology and Population Genetics. In: Annual Review of Ecology Evolution and Systematics, pp. 193-216. Annual Reviews Palo Alto.

182

Broquet T., Johnson C.A., Petit E., Thompson I., Burel F. & Fryxell J.M. (2006). Dispersal and genetic structure in the American marten, Martes americana. Molecular Ecology 15: 1689-1697.

Brown B.L., Swan C.M., Auerbach D.A., Campbell Grant E.H., Hitt N.P., Maloney K.O. & Patrick C. (2011). Metacommunity theory as a multispecies, multiscale framework for studying the influence of river network structure on riverine communities and ecosystems. Journal of the North American Benthological Society 30: 310-327.

Brown B.L. & Swan C.M. (2010). Dendritic network structure constrains metacommunity properties in riverine ecosystems. Journal of Animal Ecology 79: 571–580.

Brunke M., Hoehn E. & Gonser T. (2003). Patchiness of river–groundwater interactions within two floodplain landscapes and diversity of aquatic invertebrate communities. Ecosystems 6: 707- 722.

Brunke M. & Gonser T. (1999). Hyporheic invertebrates –the clinal nature of intersticial communities structured by hydrological exchange and environmental gradients. Journal of the North American Benthological Society 18: 344-362.

Brunke M. & Gonser T. (1997). The ecological significance of exchange processes between rivers and groundwater. Freshwater Biology 37: 1-33.

Buffington J.M. & Tonina D. (2009). Hyporheic exchange in mountain rivers II: Effects of channel morphology on mechanics, scales, and rates of exchange.Geography Compass 3: 1038-1062.

Buffington J.M., Woodsmith R.D., Booth D.B. & Montgomery D.R. (2003). Fluvial processes in Puget Sound rivers and the Pacific north-west, in Restoration of Puget Sound Rivers, edited by Montgomery D.R. et al., pp. 46–78, Univ. of Wash. Press, Seattle.

Buhay J., Moni G., Mann N. & Crandall K.A. (2007). Molecular taxonomy in the dark: Evolutionary history, phylogeography, and diversity of cave crayfish in the subgenus Aviticambarus, genus Cambarus. Molecular Phylogenetics and Evolution 42: 435-448.

Buhay J.E. & Crandall K.A. (2005). Subterranean phylogeography of freshwater crayﬁshes shows extensive gene ﬂow and surprisingly large population sizes. Molecular Ecology 14:4259–4273.

Burgherr P., Ward J.V. & Robinson C.T. (2002). Seasonal variation in zoobenthos across habitat gradients in an alpine glacial floodplain Val Roseg, Swiss Alps. Journal of the North American Benthological Society 21: 561-575.

Burridge C. P., Craw D., Jack D.C., King T.M. & Waters J.M. (2008). Does fish ecology predict dispersal across a river drainage divide? Evolution 62: 1484-1499.

Burridge P.B., Craw D. & Waters J.M. (2007). An empirical test of freshwater vicariance via river capture. Molecular Ecology 16: 1883-1895.

183

Calvignac S., Konecny L., Malard F. & Douady C.J. (2011). Preventing the pollution of mitochondrial datasets with the nuclear mitochondrial paralogs (numts). Mitochondrion 11: 246-254.

Campbell Grant E.H., Lowe W.H. & Fagan W.F. (2007). Living in the branches: population dynamics and ecological processes in dendritic networks. Ecology Letters 10: 165–175.

Capderrey C., Kaufmann B., Jean P., Malard F., Konecny-Dupré L., Lefébure T. & C.J. Douady. Microsatellite development and first population size estimates for the groundwater isopod Proasellus walteri. (submitted).

Carreras-Carbonell J., Macpherson E. & Pascual M. (2008). Utility of pairwise mtDNA genetic distances for predicting cross-species microsatellite amplification and polymorphism success in fishes. Conservation Genetics 9: 181-190.

Casquet J., Thebaud C., Gillespie R.G. (2012). Chelex without boiling, a rapid and easy technique to obtain stable amplifiable DNA from small amounts of ethanol-stored spiders. Molecular Ecology Resources 12: 136-141.

Castric V., Bonney F. & Bernatchez L. (2001). Landscape structure and hierarchical genetic diversity in the brook charr, Salvelinus fontinalis. Evolution 55:1016-1028.

Caswell H. (1976). Community structure: a neutral model Analysis. Ecological Monographs. 46: 327-354.

Ceballos G. & Ehrlich P.R. (2002). Mammal population losses and the extinction crisis. Science 296: 904– 907.

Chapman D.D., Abercrombie D.L., Douady C.J., Pikitch E.K., Stanhope M.J. & Shivji M. S. (2003). A streamlined, bi-organelle, multiplex PCR approach to species identification: Application to global conservation and trade monitoring of the great white shark, Carcharodon carcharias. Conservation Genetics 4:415-425.

Chapuis M.P. & Estoup A. (2007). Microsatellite null alleles and estimation of population differentiation. Molecular Biology and Evolution 24: 621-631.

Charlesworth B. (2009). Effective population size and patterns of molecular evolution and variation. Nature Reviews Genetics 10: 195–205.

Chase J.M. & Leibold M.A. (2002). Spatial scale dictates the productivity–biodiversity relationship. Nature 416: 427-430.

Chave, J., & Leigh E. G. (2002). A Spatially Explicit Neutral Model of β-Diversity in Tropical Forests. Theoretical population biology 62: 153-168.

Chenuil A. (2006). Choosing the right molecular genetic markers for studying biodiversity: from molecular evolution to practical espacts. Genetica 127: 101-120.

184

Chui T.F.M., Low S.Y. & Liong S.Y. (2011). An ecohydrological model for studying groundwater-vegetation interactions in wetlands. Journal of Hydrology 409:291-304.

Claret, C., Marmonier, P., Dole-Olivier, M. J., & Castella, E. (1999). Effects of management works on the interstitial fauna of floodplain aquatic systems (River Rhône, France). Biodiversity & Conservation 8: 1179-1204.

Clemento A.J., Anderson E.C., Boughton D., Girman D. & Garza J.C. (2009). Population genetic structure and ancestry of Oncorhynchus mykiss populations above and below dams in south-central California. Conservation Genetics 10: 1321-1336.

Clobert J., Baguette M., Benton T.G. & Bullock, J.M. (Eds.). (2012).Dispersal ecology and evolution. Oxford University Press.

Cobolli Sbordoni, M., DeMatthaeis E., Mattocia M., Berti R. & Sbordoni V. (1996). Genetic variability and differentiation of hypogean Cyprinid fishes from Somalia. Journal of zoological systematic and evolutionary research 34:75-84.

Colwell R.K. & Lees D.C. (2000).The mid-domain effect: geometric constraints on the geography of species richness. Trends in Ecology & Evolution 15: 70-76.

Cook B.D., Bunn S.E. & Hughes J.M. (2002). Genetic structure and dispersal of Microbrachium autraliense (Decapoda: Palaemonidae) in western Queensland, Australia. Freshwater Biology 47: 2098- 2112.

Cooper A.C. (1965). The effect of transported stream sediments on the survival of sockeye and pink salmon eggs and alevins. Int. Pacific Salmon Fish. Comm. Bull. 18, 23 pp.

Cooper S.D., Walde S.J. & Peckarsky B.L. (1990). Prey exchange rates and the impact of predators on prey populations in streams. Ecology 71:1503–1514.

Cornuet, J. M., Santos, F., Beaumont, M. A., Robert, C. P., Marin, J. M., Balding, D. J & Estoup, A. (2008). Inferring population history with DIY ABC: a user-friendly approach to approximate Bayesian computation. Bioinformatics 24: 2713-2719.

Costello A.B., Down T.E., Pollard S.M., Pacas C.J. & Taylor E.B. (2003).The influence of history and contemporary stream hydrology on the evolution of genetic diversity within species: an examination of microsatellite DNA variation in bull trout, Salvelinus confluentus (Pisces: Salmonidae). Evolution 57: 328–344.

Cottenie K. (2005). Integrating environmental and spatial processes in ecological community dynamics. Ecology Letters 8: 1175-1182.

Cox M.H., Su G.W. & Constantz J. (2007). Heat, chloride, and specific conductance as groundwater tracers near streams. Ground Water 45: 187-195.

Crawley M. J. (2005). Statistics. An introduction using R. Chapter 7, Nested Analysis & Split Plot Designs. John Wiley & Sons, Ltd. The Atrium. Southern Gate, Chichester, West Sussex, England.

185

Creuzé des Châteliers M. & Reygrobellet J.L. (1990). Interaction between geomorphological processes, benthic and hyporheic communities : first results on a by-passed canal of the French Upper- Rhône River. Regulated Rivers: Research and Management 5: 139-158.

Creuzé des Chatelliers M. (1991). Geomorphological processes and discontinuities in the macrodistribution of the interstitial fauna. A working hypothesis. Verhandlungen des Internationalen Verein Limnologie 24: 1609-1612.

Crida A. & Manel S. (2007). WOMBSOFT: an R package that implements the Wombling method to identify genetic boundary. Molecular Ecology Notes 7: 588-591.

Crispo E., Bentzen P., Reznick D.N., Kinnison M.T. & Hendry A.P. (2006). The relative influence of natural selection and geography on gene flow in guppies. Molecular Ecology 15: 49–62.

Crist T.O., Veech J.A., Gering J.C. & Summerville K.S. (2003). Partitioning species diversity across landscapes and regions: a hierarchical analysis of alpha, beta, and gamma diversity. The American Naturalist 162:734–743.

Culver D.C. & White W.B. (2004). Encyclopaedia of caves (Eds. Culver D. & White W.B.). Elsevier Academic Press, Amsterdam.

Culver D.C., Christman M.C., Sket B. & Trontelj P. (2004). Sampling adequacy in an extreme environment: species richness patterns in Slovenian caves. Biodiversity and Conservation 13: 1209-1229.

Currens K.P., Schreck C.B. & Li HW. (1990). Allozyme and morphological divergence of rainbow trout (Oncorhynchus mykiss) above and below waterfalls in the Deschutes River, Oregon. Copeia 730– 746.

Cushman S.A. & Landguth E.L. (2010). Spurious correlations and inference in landscape genetics. Molecular Ecology 19: 3592-3602.

Cushman S.A., McKinley K.S., Hayden J. & Schwartz M.K. (2006). Gene flow in complex landscapes: Testing multiple hypotheses with causal modeling. The American Naturalist 168: 486-499.

Dahm C.N. & Valett H.M. (1996). Hyporheic Zones. Pages 107-119 in F. R. Hauer, and G. A. Lamberti (editors). Methods in Stream Ecology. Chapter 6. Academic Press, Inc.

Danielopol D.L., Creuzé des Châtelliers M., Moeszlacher F., Pospisil P. & Popa R. (1994). Adaptation of crustacea to intersticial habitats : a practical agenda for ecological studies. In Groundwater Ecology (Eds. Gibert J., Danielopol D. & Stanford J.A.), pp. 217-243. Academic Press, San Diego.

Darwin C. (1859). On the origin of species by means of natural selection, or the preservation of favoured races in the struggle for life. John Murray. London, UK.

Datry T. (2012). Benthic and hyporheic invertebrate assemblages along a flow intermittence gradient: effects of duration of dry events. Freshwater Biology 57: 563-574.

Datry T., Malard F. & Gibert J. (2005). Response of invertebrate assemblages to increased groundwater recharge rates in a phreatic aquifer. Journal of the North American Benthological Society 24: 461- 477.

186

Davy-Bowker J., Sweeting W., Wright N., Clarke R.T.& Arnott S. (2006). The distribution of benthic and hyporheic macroinvertebrates from the heads and tails of riffles. Hydrobiologia 563: 109-123.

Dawnay N., Dawnay L., Hughes R.N., Cove R. & Taylor M.I. (2011). Substantial genetic structure among stocked and native populations of the European grayling (Thymallus thymallus, Salmonidae) in the United Kingdom. Conservation Genetics 12: 731-744. del Rosario R. & Resh V.H. (2001). Intersticial invertebrate assemblages associated with small-scale subsurface flowpaths in perennial and intermittent California streams. Archiv fuer Hydrobiologie 150: 629-640.

Delucchi C.M. (1989). Movement patterns of invertebrates in temporary and permanent streams. Oecologia 78: 199–207.

Dent C.L., Grimm N.B, & Fisher S.G. (2001). Multiscale effects of surface–subsurface exchange on stream water nutrient concentrations. Journal of the North American Benthological Society 20:162-181.

Dillman C. B., Wagner B.K., Wood R.M. (2007). Systematics of Species of Special Concern in the Genus Orconectes from the Ozark Highlands. Case Studies from Species Pairs: Orconectes neglectus neglectus, Orconectes neglectus chaenodactylus and Orconectes macrus, Orconectes nana. Arkansas Wildlife Action Plan. T20-2.

Djuikwo-Teukeng F.F., Njiokou F., Nkengazong L., De Meeus T., Ekobo A.S. & Dreyfuss G. (2011). Strong genetic structure in Cameroonian populations of Bulinus truncatus (Gastropoda: Planorbidae), intermediate host of Schistosoma haematobium. Infection Genetics and Evolution 11: 17-22.

Doering M., Uehlinger U. & Tockner K. (2012). Vertical hydrological exchange, and ecosystem properties and processes at two spatial scales along a floodplain river (Tagliamento, Italy). Freshwater Science 32: 12-25.

Dolédec, S., Olivier, J. M., & Statzner, B. (2000). Accurate description of the abundance of taxa and their biological traits in stream invertebrate communities: effects of taxonomic and spatial resolution. Archiv für Hydrobiologie 148: 25-43.

Dole-Olivier M.J. (2011). The hyporheic refuge hypothesis reconsidered: a review of hydrological aspects. Marine and Freshwater Research 62: 1281-1302.

Dole-Olivier M.J., Marmonier P. & Beffy J.L. (1997). Response of invertebrates to lotic disturbance: is the hyporheic zone a patchy refugium ? Freshwater Biology 37:257-276.

Dole-Olivier M.J. & Marmonier P. (1992). Patch distribution of interstitial communities: prevailing factors. Freshwater Biology 27: 177-191.

Dollar E.S.J., James C.S., Rogers K.H. & Thoms M.C. (2007). A framework for interdisciplinary understanding of rivers as ecosystems. Geomorphology 89: 147 – 162.

Donnelly P. & Tavare S. (1995). Coalescents and genealogical structure under neutrality. Annual review of genetics 29:401-421.

187

Duff J.H. & Triska F.J. (2000). Nitrogen biogeochemistry and surface-subsurface exchange in streams. Streams and ground waters 197-220.

Earl D.A. & vonHoldt B.M. (2012). STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conservation Genetics Resources 4: 359-361.

Emaresi G., Pellet J., Dubey S., Hirzel A.H. & Fumagalli L. (2011). Landscape genetics of the Alpine newt (Mesotriton alpestris) inferred from a strip-based approach. Conservation Genetics 12: 41-50.

Erwin T.L. (1982) Tropical forests: their richness in Coleoptera and other arthropod species. Coleopterists Bulletin 36: 74-75.

Evanno G., Regnaut S. & Goudet J. (2005). Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Molecular Ecology 14: 2611-2620.

Ewing, G. & Rodrigo A.G. (2006). Coalescent-based estimation of population parameters when the number of demes changes over time. Molecular Biology and Evolution 23:988-995.

Fahrig L. (2003). Effects of habitat fragmentation on biodiverstiy. Annual Review of Ecology Evolution and Systematics 34: 487-515.

Faircloth B.C. (2008). MSATCOMMANDER: detection of microsatellite repeat arrays and automated, locus- specific primer design. Molecular Ecology 8:92–94.

Falush D., Stephens M. & Pritchard J.K. (2003). Inference of population structure using multilocus genotype data: linked loci and correlated allele frequencies. Genetics 164: 1567–1587.

Ferguson R.I. (1987). Hydraulic and sedimentary controls on channel pattern. In : Richards K. (ed.), River Channels: Environment and Process. Blackwell Ldt., U.K., pp. 129–158.

Ferreira D. (2005). Biodiversité aquatique souterraine de France: bases de données, patrons de distribution et implications en termes de conservation. Thèse de doctorat, Université Claude Bernard Lyon 1, France.

Ficetola G.F., Padoa-Schioppa E., Wang J. & Garner T.W.J. (2010). Polygyny, census and effective population size in the threatened frog, Rana latastei. Animal Conservation 13: 82-89.

Findlay S. (1995). Importance of surface-subsurface exchange in stream ecosystems: the hyporheic zone. Limnology and Oceanography 40:159-164.

Findlay S., Strayer D., Goumbala C. & Gould K. (1993). Metabolism of streamwater dissolved organic carbon in the shallow hyporheic zone. Limnology and Oceanography, 1493-1499.

188

Finlay J.B., Buhay J.E. & Crandall K.A. (2006). Surface to subsurface freshwater connections: phylogeographic and habitat analyses of Cambarus tenebrosus, a facultative cave-dwelling crayfish. Animal Conservation 9: 375-387.

Finn D.S., Khamis K. & Milner A.M. (2013). Loss of small glaciers will diminish beta diversity in Pyrenean streams at two levels of biological organization. Global Ecology and Biogeography 22: 40-51.

Finn D.S, Bonada N., Murria C. & Hughes J.M. (2011). Small but mighty: headwaters are vital to stream network biodiversity at two levels of organization. Journal of the North American Benthological Society 30: 963-980.

Finn D.S. & Poff N.L (2011). Examining spatial concordance of genetic and species diversity patterns to evaluate the role of dispersal limitation in structuring headwater communities. Journal of the North American Benthological Society 30: 273-283.

Finn D.S., Blouin M.S. & Lytle D.A. (2007). Population genetic structure reveals terrestrial affinities for a headwater stream insect. Freshwater Biology 52: 1881-1897.

Finn D.S., Theobald D.M., Black W.C. & Poff L. (2006). Spatial population genetic structure and limited dispersal in a Rocky Mountain alpine stream insect. Molecular Ecology 15: 3553-3566.

Fisher S. G. & Welter J.R. (2005). Flowpaths as integrators of heterogeneity in streams and landscapes. Pages 311-328 in G. M. Lowett, C. G. Jones, M. G. Turner and, K. C. Weathers (editors) Ecosystem Function in Heterogeneous Landscapes. Springer, New York, New York.

Fisher S.G., Grimm N.B. & Gomez R. (1998). Hierarchy, spatial configuration, and nutrient cycling in a desert stream. Australian. Journal of Ecology 23: 41-52.

Foulquier A., Malard F., Mermillod-Blondin, F., Montuelle, B., Dolédec, S., Volat, B., Gibert, J. (2011). Surface water linkages regulate trophic interactions in a groundwater food web. Ecosystems 14: 1339- 1353.

Foulquier A. (2009). Ecologie fonctionnelle dans les nappes phréatiques : liens entre flux de matière organique, activité et diversité biologiques. Thèse de Doctorat Université Lyon 1.

Franken R.J.M., Storey R.G. & Williams D.D. (2001). Biological, chemical and physical characteristics of down-welling and up-welling zones in the hyporheic zone of a north-temperate stream. Hydrobiologia 444: 183-195.

Frankham R., Ballou J.D. & Briscoe D.A. (2009). An Introduction to Conservation Genetics. 2nd edition. Cambridge University Press, Cambridge, UK.

Fraser D.J., Lippé C., Bernatchez L. (2004). Consequences of unequal population size, asymmetric gene flow and sex-biased dispersal for population structure in brook charr (Salvelinus fontinalis). Molecular Ecology 13: 67–80.

Freeze R.A. & Cherry J.A. (1979). Groundwater, 604 pp., Prentice-Hall, Englewood Cliffs, New Jersey.

Frissell C.A., Liss W.J., Warren C.E. & Hurley M.D. (1986). A Hierarchical Framework for Stream Habitat Classification: Viewing Streams in a Watershed Context. Environmental Management 10: 199- 214.

189

Gandy C.J., Smith J.W.N. & Jarvis A.P. (2007). Attenuation of mining-derived pollutants in the hyporheic zone: a review. Science of the Total Environment. 373: 435–446.

Genz A., Bretz F., Miwa T., Mi X., Leisch F., Scheipl F. & Hothorn T. (2012). mvtnorm: Multivariate Normal and t Distributions. R package version 0.9-9993.

Gibert J. & Deharveng L. (2002). Subterranean Ecosystems: A Truncated Functional Biodiversity: This article emphasizes the truncated nature of subterranean biodiversity at both the bottom (no primary producers) and the top (very few strict predators) of food webs and discusses the implications of this truncation both from functional and evolutionary perspectives. BioScience 52: 473-481.

Gibert J. (2001). Basic attributes of groundwater ecosystems. In: Groundwater ecology: a tool for management of water resources (Eds. Griebler C., Danielopol D.L., Gibert J., Nachtnebel H.P. & Notenboom J.), pp. 39-52. Office for Official Publications of the European Communities, Luxembourg.

Gibert J., Dole-Olivier M.J., Marmonier P. & Vervier P. (1990). Surface water - groundwater ecotones. The ecology and management of aquatic-terrestrial ecotones (R. J. Naiman & H. Décamps eds), pp. 199-225. Man and the Biosphere series, UNESCO, Paris & Parthenon Publishing group, Carnforth

Gibert J., Stanford J.A., Dole-Olivier M.J. & Ward J.V. (1994). Basic attributes of groundwater ecosystems and prospects for research. Pages 7-40 in Gibert J., Danielopol D.L. & Stanford J.A. (editors). Groundwater Ecology. Academic Press, San Diego, California.

Gillooly J.F., Charnov E.L., West G.B, Savage V.M. & Brown J.H. (2002). Effects of size and temperature on developmental time. Nature 417: 70-73.

Ginet R. & Decou V. (1977). Initiation à la biologie et à l'écologie souterraines. J.P. Delarge.

Goodwin B.J. (2003). Is landscape connectivity a dependent or independent variable? Landscape ecology 18: 687-699.

Gossmann T.I., Woolfit M. & Eyre-Walker A. (2011). Quantifying the variation in the effective population size within a genome. Genetics 189: 1389-1402.

Gow J.L., Tamkee P., Heggenes J., Wilson G.A. & Taylor E.B. (2011). Little impact of hatchery supplementation that uses native broodstock on the genetic structure and diversity of steelhead trout revealed by a large-scale spatio-temporal microsatellite survey. Evolutionary Applications 4: 763-782.

Gray D. & Harding J.S. (2011). Multi-scaled environmental determinism of benthic invertebrate communities in braided rivers: evidence for complex hierarchical controls on local communities. Fundamental and Applied Limnology 179: 3-15.

Gray D. & Hardin J.S. (2009). Braided river benthic diversity at multiple spatial scales: a hierarchical analysis of B diversity in complex floodplain systems. Journal of the North American Benthological Society 28: 537-551.

190

Gray, D. P., & Harding, J. S. (2007). Braided river ecology: a literature review of physical habitats and aquatic invertebrate communities. Science & Technical Pub., Department of Conservation.

Gray D., Scarsbrook M.R. & Harding J.S. (2006). Spatial biodiversity patterns in a large New Zealand braided river. New Zealand. Journal of Marine and Freshwater Research 40: 631-642.

Gray D.P. (2005). Braided river springs: distribution, benthic ecology, and the role in the landscape. Unpublished MSc thesis, University of Canterbury, Christchurch, New Zealand.

Gregory S.V., Swanson F.J., McKee W.A. & Cummins K.W. (1991). An ecosystem perspective of riparian zones. Bioscience 8: 540-551.

Grinnell J. (1917). The niche relationship of the California trasher. The Auk. 34:427-433. (Cité dans « Les mondes Darwinniens », chapitre : La niche écologique: histoire et controverses récentes”, (Eds Syllepse 2009).

Gurnell A., Surian N. & Zanoni L. (2009). Multi-thread river channels: A perspective on changing European alpine river systems. Aquatic Sciences 71: 253-265.

Guzik M.T., Cooper S.J.B., Humphreys W.F. & Austin D. (2009). Fine-scale comparative phylogeography of a sympatric sister species triplet of subterranean diving beetles from a single calcrete aquifer in Western Australia. Molecular Ecology 18: 3683-3698.

Habersack H. & Piégay H. (2008) River restoration in the Alps and their surroundings: past experience and future challenges. In Habersack H., Piégay H. & Rinaldi M. (eds). Gravel-bed River 6: From Process Understanding to River Restoration, Elsevier, Amsterdam. 703-737.

Hanski I. (1998) Metapopulation dynamics. Nature 396 : 41-49.

Hanski I. & Simberloff, D. (1997). The metapopulation approach: its history, conceptual domain, and application to conservation. pp. 5-26 in Hanski, IA; Gilpin, ME (Eds): Metapopulation biology: ecology, genetics, and evolution.

Hanski, I. & Gilpin, M.E. (1991). Metapopulation Dynamics: Empirical and Theoretical Investigations. Academic Press, London.

Harvey J. W. & Wagner B.J. (2000). Quantifying hydrological interactions between streams and their subsurface hyporheic zones. Pages 3-44 in J. B. Jones and P. J. Mulholland (editors). Streams and Ground Waters. Academic Press, San Diego, California.

Harvey, J. W., and K. E. Bencala.(1993). The effect of streambed topography on surface-subsurface water exchange in mountain catchments. Water Resources Research 29: 89-98.

Hauer F.R., Dahm C.N., Lamberti G.A., & Stanford J.A. (2003). Landscapes and ecological variability of rivers in North America: factors affecting restoration strategies. Strategies for Restoring River Ecosystems: Sources of Variability and Uncertainty in Natural and Managed Systems 81-105.

191

Hauser L., Carvalho G.R. (2008). Paradigm shifts in marine ﬁsheries genetics: ugly hypotheses slain by beautiful facts. Fish and Fisheries 9:333-362.

Hendricks S. P. (1993). Microbial ecology of the hyporheic zone: a perspective integrating hydrology and biology. Journal of the North American Benthological Society 12:70- 78

Hendricks S.P. & White D.S. (1991). Physicochemical patterns within a hyporheic zone of a northern Michigan river, with comments on surface water patterns. Canadian Journal of Fisheries and Aquatic Sciences 48: 1645-1654.

Henry J.P. (1980). Un Asellide interstitiel de France: Proasellus rouchi n. sp. (Isopoda, Asellota) et considérations sur les espèces de la lignée cavaticus. Crustaceana 38: 183-193.

Henry J.P. & Magniez G. (2003). Isopodes aselloïdes d'Espagne, III-le genre Prosellus: B –Espèces anophtalmes. Beaufortia 53, 129-157.

Henry J.P. (1977). Sur un asellide aberrant d’une grotte de Suisse : Proasellus maleri n. sp. (Crustacea Isopoda Asellota). Revue Suisse de Zoologie 84 : 481-490.

Henry J.P. (1976). Recherches sur les Asellidae hypogés de la lignée cavaticus (Crustacea Isopoda Asellota). Ph.D. thesis, University of Dijon, France.

Hermoso V., Linke S., Prenda J. & Possingham H.P. (2011) Addressing longitudinal connectivity in the systematic conservation planning of fresh waters. Freshwater Biology 56: 57–70.

Hill W.G. (1981). Estimation of effective population size from data on linkage disequilibrium. Genetical Research 38: 209-216.

Hinaux H., Poulain J., Da Silva C., Noirot C., Jeffery W.R., Casane D. & Retaux S. (2013). De novo sequencing of Astyanax mexicanus surface fish and Pachón cavefish transcriptomes reveals enrichment of mutation in cavefish putative eye genes. PLoS ONE 8(1): e53553.

Hohenlohe P.A., Bassham S., Etter P.D., Stiffler N., Johnson E.A. & Cresko W.A. (2010). Population genomics of parallel adaptation in threespine stickleback using sequenced RAD tags. PLoS Genetics 6: e1000862.

Holderegger R. & Wagner H.H. (2008). Landscape genetics. Bioscience 58: 199-207.

Holderegger R. & Wagner H.H. (2006). A brief guide to landscape genetics. Landscape Ecology 21: 793-796.

Holsinger K.E., Weir B.S. (2009). Genetics in geographically structured populations: defining, estimating and interpreting Fst. Nature Reviews Genetics 10: 639-650.

Hothorn T., Bretz F. & Westfall P. (2008). Simultaneous inference in general parametric models. Biometrical Journal 50: 346-363.

Huang X. & Madan A. (1999). CAP3: A DNA sequence assembly program. Genome Research 9: 868-877.

Hubbell S.P. (2001). The uniﬁed neutral theory of biodiversity and biogeography. Princeton University Press, Princeton, New Jersey, USA.

192

Hughes J.M., Huey J.A. & Schmidt D.J. (2013). Is realized connectivity among populations of aquatic fauna predictable from potential connectivity? Freshwater Biology doi:10.1111/fwb.12099

Hughes J.M., Schmidt D.J. & Finn D. (2009). Genes in streams: using DNA to understand the movement of freshwater fauna and their riverine habitat. Bioscience 59: 573-583.

Hughes J.M. (2007). Constraints on recovery; using molecular methods to study connectivity of aquatic biota in rivers and streams. Freshwater Biology 52: 616-631.

Hurwood D.A. & Hughes J.M. (2001). Nested clade analysis of the freshwater shrimp, Caridina zebra (Decapoda Atyidae), from north-eastern Australia. Molecular Ecology 10: 113-125.

Hurwood D.A., Hughes J.M. (1998). Phylogeography of the freshwater ﬁsh, Mogurnda adspersa, in streams of northeastern Queensland, Australia: evidence for altered drainage patterns. Molecular Ecology 7: 1507–1517.

Hutchinson G.E. (1957). Population studies – animal ecology and demography , concluding remarks. Cold Spring Harbor Symposia on Quantitaive Biology 22: 415-427.

Hynes H.B.N. (1974). Further studies on the distribution of stream animals within the substratum. Limnology and Oceanography 19: 92–99.

Illies J. & Botosaneanu L. (1963). Problèmes et méthodes de la classification et de la zonation écologique des eaux courantes, considérées surtout du point de vue faunistique. E. Schweizerbartsche.

Jehle R., Wilson G.A., Arntzen J.M. & Burke T. (2005). Contemporary gene flow and the spatio-temporal genetic structure of subdivided newt populations (Triturus cristatus, T-marmoratus). Journal of Evolutionary Biology 18: 619-628.

Jombart T., Devillard S., Dufour A.B., Pontier D. (2008). Revealing cryptic spatial patterns in genetic variability by a new multivariate method. Heredity 101: 92-103.

Jones J.W. (2009). Genetics, demography and modeling of freshwater mussel (Bivalvia : Unionidae) populations in the Clinch River, U.S.A. Ph.D. Dissertation. Virginia State University. 218pp.

Jones, J. B., & Mulholland, P. J. (2000). Streams and ground waters. Ecology,88, 727-731.

Juberthie C. & Decu V. (1994). Structure et diversité du domaine souterrain: particularités des habitats et adaptations des espèces. In: Encyclopaedia Biospeologica I (Eds. Juberthie C. & Decu V.), pp. 5- 22. Société de Biospéléologie, Moulis-Bucarest.

Juberthie C.& Decu V. (1994). Encyclopaedia Biospeologica I (Eds. Juberthie, C. and Decu, V.). Société de Biospéléologie, Moulis-Bucarest.

193

Kalinowski S.T. (2005). HP-RARE 1.0: a computer program for performing rarefaction on measures of allelic richness. Molecular Ecology Notes 5: 187-189.

Kane T.C., Culver D.C & Mathieu J. (1994). Biotic fluxes and gene flow. In J. Gibert, D. L. Danielopol & J. A. Stanford (eds), Groudwater Ecology, Academic Press 245-270.

Kane T.C., Culver D.C. & Jones R.T. (1992). Genetic structure of morphologically differentiated populations of the amphipod Gammarus minus. Evolution 46:272–278.

Karaus U., Alder L. & Tockner K. (2005). ‘‘Concave islands’’: habitat heterogeneity of parafluvial ponds in a gravel-bed river. Wetlands 25:26-37.

Kawecki, T. J. & Holt, R. D. (2002). Evolutionary consequences of asymmetric dispersal rates. The American Naturalist 160: 333–347.

Keyghobadi N. (2007). The genetic implications of habitat fragmentation for animals. Canadian Journal of Zoology 85: 1049-1064.

Kimura M. (1983). The neutral theory of molecular evolution. Cambridge University Press, Cambridge, UK.

Kimura, M. (1968). Evolutionary rate at the molecular level. Nature 217:624–626.

Kingman J.F.C. (2000). Origins of the coalescent: 1974-1982. Genetics 156: 1461-1463.

Kingman J.F.C. (1982). On the Genealogy of Large Populations. Journal of Applied Probability 19: 27-43.

Kondolf G.M., H. Piégay & Landon N. (2002). Channel response to increased and decreased bedload supply from land use change: contrasts between two catchments. Geomorphology 45: 35-51.

Krause S., Hannah D.M., Fleckenstein J.H., Heppell C.M., Kaeser D., Pickup R., & Wood P. J.(2011). Inter-disciplinary perspectives on processes in the hyporheic zone. Ecohydrology 4: 481-499.

Kuhner M.K. (2006). LAMARC 2.0: maximum likelihood and Bayesian estimation of population parameters. Bioinformatics 22: 768-770.

Kylafis G. & Loreau M. (2011). Niche construction in the light of niche theory. Ecology Letters 14: 82-90.

Labonne J., Ravigné V., Parisi B. & Gaucherel C. (2008). Linking dendritic network strucures to population demogenetics: The downside of connectivity. Oikos 117: 1479-1490.

Lancaster J. & Downes B. (2010). Linking the hydraulic world of individual organisms to ecological processes: putting ecology into ecohydraulics. River Research and Applications 26: 385-403.

Lance S.L., Light J.E., Jones K.L., Hagen C. & Hafner J.C. (2010). Isolation and characterization of 17 polymorphic microsatellite loci in the kangaroo mouse, genus Microdipodops (Rodentia: Heteromyidae). Conservation Genetics Resources 2: 139-141.

Lande, R. (1996). Statistics and partitioning of species diversity, and similarity among multiple communities. Oikos 76 : 5-13.

Landon N. (1996). L’évolution du profil en long des affluents du Rhône moyen : du constat aux principes de gestion. Revue de géographie de Lyon 71: 363-376.

194

Leberg P. (2005). Genetic approaches for estimating the effective size of populations. Journal of Wildlife Management 69: 1385–1399.

Leclerc E., Mailhot Y., Mingelbier M., Bernatchez L. (2008). The landscape genetics of yellow perch (Perca flavescens) in a large fluvial ecosystem. Molecular Ecology 17:1702-1717.

Lee D.R. & Cherry J.A. (1978). A field exercise on groundwater flow using seepage meters and mini- piezometers. Journal of Geological Education 27: 6-10.

Legay J.M. & Debouzie D. (1985). Introduction à une biologie des populations. Masson, Paris.

Legendre P., Fortin M.J. (2010). Comparison of the Mantel test and alternative approaches for detecting complex multivariate relationships in the spatial analysis of genetic data. Molecular Ecology Resources 10: 831-844.

Legendre P., Dale M.R.T., Fortin M.J, Gurevitch J., Hohn M. & Myers D. (2002). The consequences of spatial structure for the design and analysis of ecological ﬁeld surveys. Ecography 25: 601–615.

Leibold M.A., Holyoak M., Mouquet N., Amarasekare P., Chase J.M., Hoopes M.F., Holt R.D., Shurin J.B., Law R., Tilman D., Loreau M. & Gonzalez A. (2004). The metacommunity concept: a framework for multi-scale community ecology. Ecology Letters 7: 601-613.

Leopold L.B. & Wolman M.G. (1957). River channel patterns: braiding, meandering and straight. U.S. Geological Survey Professional Papers 262: 39-85.

Levin S.A. (1992). The problem of Pattern and Scale in Ecology: The Robert H. MacArthur Award Lecture. Ecology 73:1943-1967.

Levins R. (1969). Some demographic and genetic consequences of environmental heterogeneity for biological control. Bulletin of the Entomological Society of America 15: 237–240.

Lewis D. B., Grimm N.B., Harms T.K. & Schade J.D. (2007). Subsystems, flowpaths, and the spatial variability of nitrogen in a fluvial ecosystem. Landscape Ecology 22: 911-924.

Lewontin, R.C. (1978). Adaptation. Scientific American 239: 212–219.

Liébault F. & Piégay H. (2002). Causes of 20th century channel narrowing in mountain and piedmont rivers of Southeastern France. Earth Surface Processes and Landforms 27: 425-444.

Lorenzen C.J. (1965). Determination of chlorophylls and phaeopigments: spectrophotometric equations. Limnology and Oceanography 12: 343-346.

Lowe W.H. & Allendorf F.W. (2010). What can genetic tell us about population connectivity? Molecular Ecology 19: 1038-3051.

Lowe W.L., Likens G.E. & Power M.E. (2006). Linking scales in stream ecology. Bioscience 56:591-597.

Lowe A., Harris S., Ashton P. (2004). Ecological genetics: Design, analysis and application. Blackwell Publishing.

Luikart G., Ryman N., Tallmon D.A., Schwartz M.K. & Allendorf F.W. (2010). Estimation of census and effective population sizes: the increasing usefulness of DNA-based approaches. Conservation Genetics Resources 11: 355-373.

M 195

Malard F., Tockner K. & Ward J.V. (1999). Shifting dominance of subcatchment water sources and flow paths in a glacial floodplain, Val Roseg, Switzerland. Arctic, Antarctic, and Alpine Research 31: 135-150.

Malard F. & Hervant F. (1999). Oxygen supply and the adaptations of animals in groundwater. Freshwater Biology 41: 1-30.

Malard F., Tockner K., Ward J.V. (2000). Physico-chemical heterogeneity in a glacial riverscape. Landscape Ecology 15: 679-695.

Malard F., Lafont M., Burgherr P. & Ward J.V. (2001). A comparison of longitudinal patterns in hyporheic and benthic oligochaete assemblages in a glacial river. Arctic, and Alpine Research 33: 457-466.

Malard F., Tockner K., Dole-Oliver M.J. & Ward J.V. (2002). A landscape perspective of surface-subsurface hydrological exchanges in river corridors. Freshwater Biology 47:621-640.

Malard F., Galassi D., Lafont M., Dolédec S. & Ward J.V. (2003). Longitudinal patterns of invertebrates in the hyporheic zone of a glacial river. Freshwater Biology 48: 1709-1725.

Malard, F., Boutin, C., Camacho, A. I., Ferreira, D., Michel, G., Sket, B., & Stoch, F. (2009). Diversity patterns of stygobiotic crustaceans across multiple spatial scales in Europe. Freshwater Biology 54(4), 756-776.

Malcolm I. A., Coulsby C., Youngson A.F. & Hannah D.M. (2005). Catchment-scale controls on groundwater- surface water interactions in the hyporheic zone: Implications for salmon embryo survival. River Research and Applications 21: 977–989.

Malcolm I.A., Youngson A .F. & Soulsby C. (2003). Survival of salmonid eggs in a degraded gravel-bed stream: effects of groundwater-surface water interactions. River Research and Applications 4: 303-316.

Malmqvist B. (2002). Aquatic invertebrates in riverine landscapes. Freshwater Biology 47:679-694.

Manel S., Conord C., Despres L. (2009). Genome scan to assess the respective role of host-plant and environmental constraints on the adaptation of a widespread insect. BMC Evolutionary Biology 9.

Manel S., Schwartz M.K., Luikart G. & Taberlet P. (2003). Landscape genetics: combining landscape ecology and population genetics. Trends in Ecology & Evolution 18: 189-197.

Mangin A. (1975). Contribution à l'étude hydrodynamique des aquifères karstiques (Doctoral dissertation, Laboratoire souterrain du Centre national de la recherche scientifique).

Mantel N. (1967). The detection of disease clustering and a generalized regression approach. Cancer Research 27: 209-220. Marmonier P., Vervier P., Gibert J., Dole-Olivier M.J. (1993). Biodiversity in groundwaters: a research field in progress. Trends in Ecology and Evolution 8: 392-395

Massa-Gallucci A., Coscia I., O'grady M., Kelly-Quinn M. & Mariani S. (2010). Patterns of genetic structuring in a brown trout (Salmo trutta L.) metapopulation. Conservation Genetics 11: 1689-1699.

May R.M. (1990). How many species? Philosophical Transactions of the Royal Society, London, B 330: 293–304.

196

Meffe G.K. & Vrijenhoek R.C. (1988). Conservation genetics in the management of desert fishes. Conservation Biology 2:157-169.

Miall A.D. (1977). Lithofacies and vertical profile models in braided river deposit: a summary. Earth Science Reviews 13: 1-62.

Monaghan M.T., Spaak P. & Robinson C.T. (2001). Genetic differentiation of Baetis alpinus Pictet (Ephemeroptera: Baetidae) in fragmented alpine streams. Heredity 86: 395-403.

Morin P.J. (2011). Community Ecology 2nd edition. Blackwell, Oxford, United Kingdom and Malden, Massachusetts.

Morrice J.A., Dahm C.N., Valett H.M., Unnikrishna P.V. & Campana M.E. (2000). Terminal electron accepting processes in the alluvial sediments of a headwater stream. Journal of the North American Benthological Society 19: 593-608.

Morrissey M.B. & de Kerckhove D.T. (2009). The maintenance of genetic variation due to asymmetric gene flow in dendritic populations. The American Naturalist 174: 875-889.

Morvan C., Malard F., Paradis E., Lefébure T., Konecny-Dupré L. & Douady C.J. (2013). Timetree of Aselloidea reveals species diversification dynamics in groundwater. Systematic Biology doi: 10.1093/sysbio/syt015.

Mouquet N. & Loreau M. (2002). Coexistence in metacommunities: the regional similarity hypothesis. The American Naturalist 159 : 420-426.

Muyzer G., de Waal E.C., Uitterlinden A.G. (1993) Profiling of complex microbial populationsby denaturing gradient gel electrophoresis analysis of polymerase chain reaction amplified genes encoding for 16S rRNA. Applied and Environmental Microbiology 59, 695-700.

Nei M. (1973). Analysis of gene diversity in subdivided populations. Proceedings of the National Academy of Sciences 70: 3321-3323.

Nei M. & Tajima F. (1981). Genetic drift and estimation of effective population size. Genetics 98: 625-640.

Neigel J.E. (2002). Is FST obsolete? Conservation Genetics 3: 167-173.

Neraas L.P. & Spruell P. (2001). Fragmentation of riverine systems: the genetic effects of dams on bull trout (Salvelinus confluentus) in the Clark Fork River system. Molecular Ecology 10:1153-1164.

Odling-Smee F.J., Laland K.N. & Feldman M.W. (1996). Niche construction. The American Naturalist 147: 641-648.

Odling-Smee F.J., Laland K.N. & Feldman M.W. (2003). Niche Construction, The Neglected Process in Evolution. Princeton University Press, Princeton, NJ.

197

Olivier J-M., Carrel G., Lamouroux, N., Dole-Olivier M-J., Malard F., Bravard J-P. & Amoros C. (2009). The Rhône River Basin, In Rivers of Europe. Chpt 7, pp 247-295., Academic Press, London.

Olsen D.A. & Townsend C.R. (2003). Hyporheic community composition in a gravel-bed stream: influence of vertical hydrological exchange, sediment structure and physicochemistry. Freshwater Biology 48: 1363-1378.

Orghidan T. (1959). Ein neuer Lebensraum des unterirdischen Wassers, der hyporheische Biotop. Archiv für Hydrobiologia 55: 392-414.

Osborne M.J., Davenport S.R., Hoagstrom C.W. & Turner T.F. (2010). Genetic effective size, Ne, tracks density in a small freshwater cyprinid, Pecos bluntnose shiner (Notropis simus pecosensis). Molecular Ecology 19: 2832-2844.

Ostergaard S., Hansen M.M., Loeschcke V. & Nielsen E.E. (2003). Long-term temporal changes of genetic composition in brown trout (Salmo trutta L.) populations inhabiting an unstable environment. Molecular Ecology 12: 3123-3135.

Pabijan M. & Babik W. (2006). Genetic structure in northeastern populations of the Alpine newt (Triturus alpestris): evidence for post-Pleistocene differentiation. Molecular Ecology 15: 2397-2407.

Paillex A., Dolédec S., Castella E., Mérigoux S. & Aldridge D.C. (2013). Functional diversity in large river floodplain: anticipating the response of native and alien macroinvertebrates to the restoration of hydrological connectivity. Journal of Applied Ecology 50: 97–106.

Paillex A., Dolédec S, Castella E. & Mérigoux S. (2009). Large river floodplain restoration: predicting species richness and trait responses to the restoration of hydrological connectivity. Journal of Applied Ecology 46: 250-258.

Paillex A., Castella E. & Carron G. (2007) Aquatic macroinvertebrate response along a gradient of lateral connectivity in river ﬂoodplain channels. Journal of the North American Benthological Society 26: 779–796.

Palmer M A., Allan J.D. & Butman C.A. (1996). Dispersal as a regional process affecting the local dynamics of marine and stream benthic invertebrates. Trends in Ecology and Evolution 11:322–326.

Palmer M.A., Bely A.E. & Berg K.E. (1992). Response of invertebrates to lotic disturbance: a test of the hyporheic refuge hypothesis. Oecologia 89: 182-194.

Palumbi, S. R., (1996). Chapter 7: Nucleid Acids II: The Polymerase Chain Reaction. In Hillis, D. M., C. Moritz & B. K. Mable (eds), Molecular Systematics. Sinauer Associates, Sunderland, MA: 205-248.

Parsons M. & Thoms M.C. (2007). Hierarchical patterns of physical-biological associations in river ecosystems. Geomorphology 89: 127-146.

Pepin D.M. & Hauer F.R. (2002). Benthic responses to groundwater–surface water exchange in 2 alluvial rivers in northwestern Montana. Journal of the North American Benthological Society 21:370- 383.

Percival E. (1932). On the depreciation of trout fishing in the Oreti (or New River), Southland, with remarks on conditions in other parts of New Zealand. New Zealand Fisheries 5: 48.

198

Petts G.E., Moeller H. & Roux A.L. (1989). Historical change of large alluvial rivers : Western Europe. Petts G.E, Moeller H. & Roux A.L. (eds). New York, NY (US); John Wiley and Sons.

Phillipsen, I C., Funk W.C., Hoffman E.A., Monsen K.J. & Blouin M.S. (2011). Comparative analyses of effective population size within and among species: ranid frogs as a case study. Evolution 65: 2927-2945.

Piégay H., Alber A., Slater L. & Bourdin L. (2009). Census and typology of braided rivers in the French Alps. Aquatic Science 71: 371-388.

Pinheiro J.C. & Bates D.M. (2000). Mixed-effects models in S and S-PLUS. Springer.

Pinheiro J.C., Bates D.M., DebRoy S., Sarkar D. & the R Development Core Team. (2012). nlme: Linear and Nonlinear Mixed Effects Models. R package version 3 1-105.

Pocheville, A. (2010). La niche écologique: concepts, modèles, applications (Doctoral dissertation, Ecole Normale Supérieure de Paris-ENS Paris).

Poff N. L. & Ward J. V. (1990). Physical habitat template of lotic systems: recovery in the context of historical pattern of spatiotemporal heterogeneity. Environmental Management 14: 629-645.

Poff N.L. (1997). Landscape filters and species traits: towards mechanistic understanding and prediction in stream ecology. Journal of the North American Benthological Society 16: 391-409.

Pollux B.J.A., Luteijn A., Van Groenendael J.M. & Ouborg N.J. (2009). Gene ﬂow and genetic structure of the aquatic macrophyte Sparganium emersum in a linear unidirectional river. Freshwater Biology 54: 64–76.

Poole G.C. (2010). Stream geomorphology as a physical science basis for advances in stream ecology. Journal of the North American Benthological Society 29:12-25.

Poole G.C., O’Daniel S.J, Jones K.L, Woessner W.W, Bernhardt E.S., Helton A.M., Stanford J.M., Boer B.R. & Beechie T.J. (2008). Hydrologic spiraling: the role of multiple interactive flow paths in stream ecosystems. River Research and Applications 24: 1018-1031.

Poole G.C., Stanford J.A, Running S.W. & Frissell C.A. (2006). Multiscale geomorphic drivers of groundwater flow paths: subsurface hydrologic dynamics and hyporheic habitat diversity. Journal of the North American Benthological Society 25:288-303.

Poole G.C., Stanford J.A., Running S.W., Frissell C.A., Woessner W.W. & Ellis B.K. (2004). A patchy hierarchy approach to modeling surface and subsurface hydrology in complex flood-plain environments. Earth Surface Processes and Landforms 9: 1259-1274.

Primmer C.R., Painter J.N., Koskinen M.T., Palo J.U. & Merilä J. (2005). Factors affecting avian cross-species microsatellite amplification. Journal of Avian Biology 36: 348-360.

Pritchard J.K., Stephens M. & Donnelly P. (2000). Inference of population structure using multilocus genotype data. Genetics 155: 945–959.

Puig M.A., Sabater F. & Malo J. (1990). Benthic and hyporheic faunas of mayflies and stoneflies in the Ter River basin (NE Spain). In ‘Mayflies and Stoneflies’. (Ed. I. C. Campbell) pp. 255–258. (Kluwer Academic Publishers: Dordrecht, The Netherlands.)

199

R Development Core Team (2011) R: a language and environment for statistical computing.

R Foundation for Statistical Computing, Vienna, Austria. http://www.R-project.org.

Racovitza E.G. (1922). Description de trios Asellus cavernicoles nouveaux. Bulletin of the Science Society of Cluj 1: 401-410.

Raymond M. & F. Rousset, (1995). GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. Journal of Heredity 86: 248-249.

Renschler C.S., Doyle M.W. & Thoms M. (2007) Geomorphology and ecosystems: challenges and keys for success in bridging disciplines. Geomorphology 89: 1-8

Resh V.H., Hildrew A.G., Statzner B., & Townsend C.R. (1994). Theoretical habitat templets, species traits, and species richness: a synthesis of long-term ecological research on the Upper Rhône River in the context of concurrently developed ecological theory. Freshwater Biology 31: 539-554.

Rice W. (1989). Analyzing tables of statistical tests. Evolution 43: 223–225.

Ricklefs R.E. & Schluter D. (1993). Species diversity in ecological communities: historical and geographical perspectives. University of Chicago Press.

Rissler L.J., Wilbur H.M., Taylor D.R. (2004). The influence of ecology and genetics on behavioral variation in salamander populations across the Eastern Continental Divide. The American Naturalist 164: 201–213.

Rousset F. (2008). Genepop'007: a complete reimplementation of the Genepop software for Windows and Linux. Molecular Ecology Resources 8: 103-106.

Rousset F. (1997). Genetic differentiation and estimation of gene ﬂow from F-statistics under isolation by distance. Genetics 145:1219–1228.

Rust B.R. (1978). A classification of alluvial channel systems. In: Miall A.D. (ed.), Fluvial Sedimentology, Canadian Society of Petroleum Geologists, Calgary, Alberta, pp. 187–198.

Safner T., Miller M.P., McRae B.H., Fortin M.J. & Manel S. (2011). Comparison of Bayesian Clustering and Edge Detection Methods for Inferring Boundaries in Landscape Genetics. International. Journal of Molecular Sciences 12: 865-889.

Sbordoni V., Allegrucci G. & Cesaroni D. (2005). Population structure of cave organisms. In Culver, D. & W. White (eds), The encyclopedia of Caves. Elsevier Academic Press: 447-455.

Schumm S.A. & Khan H.R. (1971) Experimental study of channel patterns. Nature 233: 407–409.

Schumm S.A. & Litchy R.W. (1965) Time, space and causality in geomorphology. American Journal of Science 263: 110-119.

Schwartz M.K., Tallmon D.A. & Luikart G. (1999). DNA-based methods for estimating population size: many methods, much potential, unknown utility. Animal Conservation 2:321–323.

Schwoerbel J. (1964). Die ßedeutung des hyporheals für die benthische lebensgemeinschaft der fließgewässer. Verhandlungen der Internationalen Vereinigung fuer theoretische und angewandte Limnologie XV, 215–226.

Schwoerbel J. (1961). Uber die lebensbedingungen und die besiedlung des hyporheischen lebensraumes. Archiv für Hydrobiologie Supplementband 25: 182-214.

Scribner K.T., Arntzen J.W. & Burke T. (1997). Effective number of breeding adults in Bufo bufo estimated from age-specific variation at minisatellite loci. Molecular Ecology 6: 701-712.

Scrimgeour G.J., Winterbourn M..J. (1989). Effects of floods on epilithon and benthic macroinvertebrate populations in an unstable New Zealand river. Hydrobiologia 171: 33-44.

Serbezov D., Jorde P.E., Bernatchez L., Olsen E.M. & Vollestad L.A. (2012). Short-term genetic changes: evaluating effective population size estimates in a comprehensively described brown trout (Salmo trutta) population. Genetics 191: 579-592.

Shama L.N.S., Kubow K.B., Jokela J. & Robinson C.T. (2011). Bottlenecks drive temporal and spatial genetic changes in alpine caddisfly metapopulations. BMC Evolutionary Biology 11: 278.

Sket B. (1999). The nature of biodiversity in hypogean waters and how it is endangered. Biodiversity and Conservation 8: 1319-1338.

Sket B. (1965). Taxonomische problematik der Art Asellus aquaticus, mit besonderer rücksicht auf die populationen Sloweniens. Slovenian Academy of Sciences and Arts of Ljubljana 4: 1-45.

Slatkin M. (2008). Linkage disequilibrium – understanding the evolutionary past and mapping the medical future. Nature Reviews Genetics 9: 447-485.

Slatkin M. (1993). Isolation by distance in equilibrium and non-equilibrium populations. Evolution 39:53– 65.

Slatkin M. (1985). Gene flow in natural-populations. Annual Review of Ecology and Systematics 16: 393- 430.

Smouse P.E., Long J.C. & Sokal R.R. (1986). Multiple regression and correlation extensions of the Mantel test of matrix correspondence. Systematic Zoology 35: 627–632.

Sophocleous M. (2002). Interactions between groundwater and surface water: the state of science. Hydrogeology Journal 10: 52-67.

201

Spear S.F., Balkenhol N., Fortin M.J., McRae B.H., Scribner K. (2010). Use of resistance surfaces for landscape genetic studies: considerations for parameterization and analysis. Molecular Ecology 19: 3576-3591.

Spear S.F., Peterson C.R., Matocq M.D. & Storfer A. (2005).Landscape genetics of the blotched tiger salamander. Molecular Ecology 14: 2553–2564.

Stanford J.A., Lorang M.S & Hauer F.R. (2005). The shifting habitat mosaic of river ecosystems. Verhandlungen der Internationalen Vereinigung für theoretische und angewandte Limnologie 29:123-136.

Stanford J.A. (1998). Rivers in the landscape: introduction to the special issue on riparian and groundwater ecology. Freshwater Biology 40: 402-406.

Stanford J.A. & Ward J.V. (1993). An ecosystem perspective of alluvial rivers: connectivity and the hyporheic corridor. Journal of the North American Benthological Society 12: 48-60.

Stanford J.A. & Ward J.V. (1988). The hyporheic habitat of river ecosystems. Nature 335, 64-66.

Stanley E.H., Fisher S.G. & Grimm N.B. (1997). Ecosystem expansion and contraction in streams. Bioscience 47: 427-435.

Stead T.K., Schmid-Araya J.M. & Hildrew A.G. (2005). Secondary production of a stream metazoan community: does the meiofauna make a difference? Limnology and Oceanography 50: 398–403.

Stoch F. & Galassi D.M.P. (2010) Stygobiotic crustacean species richness: a question of numbers, a matter of scale. Hydrobiologia 653: 217-234.

Storfer A., Murphy M.A., Spear S.F., Holderegger R. & Waits L.P. (2010) Landscape genetics: where are we now? Molecular Ecology 19: 3496-3514.

Strayer D.L., May S.E., Nielsen P., Wollheim W. & Hausam S. (1997). Oxygen, organic matter, and sediment granulometry as controls on hyporheic animal communities. Archiv für Hydrobiologie 140: 131- 144.

Strommer J.L. & Smock L.A. (1989). Vertical distribution and abundance of invertebrates within the sandy substrate of a low-gradient headwater stream. Freshwater Biology 22: 263-274.

Stubbington R. (2012). The hyporheic zone as an invertebrate refuge: a review of variability in space, time, taxa and behavior. Marine and Freshwater Research 63: 293-311.

Tallmon D.A., Koyuk A., Luikart G. & Beaumont M.A. (2008). ONeSAMP: a program to estimate effective population size using approximate Bayesian computation. Molecular Ecology Resources 8: 299– 301.

202

Taylor E.B., Harris L.N., Spice E.K. & Docker M.F. (2012). Microsatellite DNA analysis of parapatric lamprey (Entosphenus spp.) populations: implications for evolution, taxonomy, and conservation of a Canadian endemic. Canadian Journal of Zoology 90: 291-303.

Taylor P.D., Fahrig L., Henein K. & Merriam G. (1993). Connectivity is a vital element of landscape structure. Oikos 68: 571–573.

Thibodeaux L.J. & Boyle J.O. (1987). Bed-form generated convective transport in bottom sediments. Nature 325: 341-343.

Thompson R. & Townsend C. (2006). A truce with neutral theory: local deterministic factors, species traits and dispersal limitation together determine patterns of diversity in stream invertebrates. Journal of Animal Ecology 75: 476-484.

Thorp J.H., Thoms M.C. & Delong M.D. (2006). The riverine ecosystem synthesis: biocomplexity in river networks across space and time. River Research and Applications 22: 123-147.

Tockner K., Lorang M.S. & Stanford J.A. (2010). River flood plains are model ecosystems to test general hydrogeomorphic and ecological concepts. River Resarch and Applications 26: 76-86.

Tockner, K., Ward, J. V., Arscott, D. B., Edwards, P. J., Kollmann, J., Gurnell, A. M., ... & Maiolini, B. (2003). The Tagliamento River: a model ecosystem of European importance. Aquatic Sciences 65: 239-253.

Tonina D. & Buffington J.M. (2009). Hyporheic exchange in mountain rivers I: Mechanics and environmental effects. Geography Compass 3: 1063-1086.

Toone J (2009). Geomorphological discontinuities and ecological organisation: a case study of the River Drome. Thèse de doctorat, 288 pp.

Toth J. (1963). A theoretical analysis of groundwater flow in small drainage basins. Journal of Geophysical Research 68: 4795-4812.

Townsend C.R., Dolédec S., Norris R., Peacock K. & Arbuckle C. (2003). The influence of scale and geography on relationships between stream community composition and landscape variables: description and prediction. Freshwater Biology 48: 768-785.

Townsend, C. R. (1989). The patch dynamics concept of stream community ecology. Journal of the North American Benthological Society 8: 36-50.

Triska F.J., Duff J.H. & Avanzino R.J. (1993). The role of water exchange between a stream channel and its hyporheic zone in nitrogen cycling at the terrestrial—aquatic interface. In Nutrient Dynamics and Retention in Land/Water Ecotones of Lowland, Temperate Lakes and Rivers (pp. 167-184). Springer Netherlands.

203

Trontelj P., Douady C.J., Fiser C., Gibert J., Goricki S., Lefébure T., Sket B. & Zaksek V. (2009). A molecular test for cryptic diversity in ground water: how large are the ranges of macro-stygobionts? Freshwater Biology 54: 727-744.

Trouve, S., Degen L. & Goudet J. (2005). Ecological components and evolution of selfing in the freshwater snail Galba truncatula. Journal of Evolutionary Biology 18: 358-370.

UNESCO, 1986. Pollution et protection des aquifères, UNESCO.

Valett H.M., Fisher S.G., Grimm N.B. & Camill P. (1994). Vertical hydrologic exchange and ecological stability of a desert stream ecosystem. Ecology 75: 548-560.

Van der Nat D., Tockner K., Edwards P.J., Ward J.V. & Gurnell A.M. (2003) Habitat change in braided flood plains (Tagliamento, NE-Italy). Freshwater Biology 48: 1799-1812.

Van Oosterhout C., Hutchinson W.F., Wills D.P.M. & Shipley P. (2004). MICRO-CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Resources 4: 535-538.

Vandewoestijne S. & Baguette M. (2004). Demographic versus genetic dispersal measures. Population Ecology 46: 281-285.

Vannote R.L., Minshall G.W., Cummins K.W., Sedell J.R. & Cushing C.E. (1980). The river continuum concept. Canadian Journal of Fisheries and Aquatic Sciences 37: 130 – 137.

Vaux W.G. (1962). Interchange of stream and intra- gravel water in a salmon spawning rifﬂe. US Fish and Wildlife Service Special Scientiﬁc Report Fisheries No. 405. US Fish and Wildlife Service, Washington,DC.

Vellend M. (2010). Conceptual synthesis in community ecology. The Quarterly Review of Biology 85: 183- 206.

Venarsky M.P, Anderson F.E. & Wilhelm F.M. (2009). Population genetic study of the U.S. federally listed Illinois cave amphipod, Gammarus acherondytes. Conservation Genetics 10:915-921.

Verovnik R., Sket B. & Trontelj P. (2004). Phylogeography of subterranean and surface populations of water lice Asellus aquaticus (Crustacea: Isopoda). Molecular Ecology 13:1519–1532.

Vervier P. (1988). Hydrologie et dynamique des peuplements aquatiques souterrains. Thèse de doctorat. Université Claude Bernard Lyon1.

Vitousek, P.M., Mooney H.A., Lubchenco J. & Melillo J.M. (1997). Human domination of earth’s ecosystems. Science 277:494–499.

Wang J. (2005). Estimation of effective population sizes from data on genetic markers. Philosophical Transactions of the Royal Society Biological Sciences 360: 1395-1409.

204

Wang J. & Whitlock M.C. (2003). Estimating effective population size and migration rates from genetic samples over space and time. Genetics 163: 429-446.

Wang J. (2001). A pseudo-likelihood method for estimating effective population size from temporally spaced samples. Genetical Research 78: 243-257.

Waples R.S. & Do C. (2010). Linkage disequilibrium estimates of contemporary Ne using highly variable genetic markers: a largely untapped resource for applied conservation and evolution. Evolutionary Applications 3: 244-262.

Waples R.S. & Do C. (2008). LDNE: a program for estimating effective population size from data on linkage disequilibrium. Molecular Ecology Resources 8: 753–756.

Waples R.S. (2006). A bias correction for estimates of effective population size based on linkage disequilibrium at unliked gene loci. Conservation Genetics 7: 167-184.

Waples R.S. (2002). Evaluating the effect of stage-specific survivorship on the Ne/N ratio. Molecular Ecology 11:1029-1037.

Waples R.S. (1989). A generalized approach for estimating effective population size from temporal changes in allele frequency. Genetics 121: 379–391.

Ward J.V. Tockner K., Arscott D. B. & Claret C. (2002). Riverine landscape diversity. Freshwater Biology 47: 517-539.

Ward J.V., Tockner K. & Schiemer, F. (1999). Biodiversity of floodplain river ecosystems: ecotones and connectivity. Regulated Rivers-Research & Management 15: 125-139.

Ward J.V. (1994). The structure and dynamics of lotic ecosystems, In ‘Limnology Now: a Paradigm of Planetary Problems’. (Ed. Margalef R.) pp. 195–218. (Elsevier Science: Amsterdam.)

Ward J.V. (1989). The four-dimensional nature of lotic ecosystems. Journal of the North American Benthological Society 8: 2-8.

Ward J.V. & Stanford J.A. (1982). Thermal responses in the evolutionary ecology of aquatic insects. Annual Review of Entomology 27: 97-117.

Water Agency. (2013). L’eau dans le basin Rhône-Méditerannée. Alluvions de la Durance aval et moyenne et de ses affluents. Masse d’eau n°6302. http://www.rhone-mediterranee.eaufrance.fr/milieux- continentaux/eaux-souterraines/db_mesout/ (accessed date: March 2013).

Waters J.M., Craw D., Youngson J.H. & Wallis G.P. (2001) Genes meet geology: ﬁsh phylogeographic pattern reﬂects ancient, rather than modern, drainage connections. Evolution 55: 1844–1851.

Watterson G. A. (1975). On the number of segregating sites in genetical models without recombination. Theories in Population Biology 7: 256–276.

205

Watts P.C., Saccheri I.J., Kemp S.J. & Thompson D.J. (2007). Effective population sizes and migration rates in fragmented populations of an endangered insect (Coenagrion mercuriale: Odonata). Journal of Animal Ecology 76: 790-800.

Weigelhofer G. & Waringer J. (2003).Vertical distribution of benthic macroinvertebrates in riffles versus deep runs with differing contents of fine sediments (Weidlingbach, Austria). International Review of Hydrobiology 88: 304-313.

Weir B.S., Cockerham C.C. (1984). Estimating F-Statistics for the analysis of population structure Evolution 38: 1358-1370.

Weissmann G.S., Zhang Y., LaBolle E.M. & Fogg G.E. (2002). Dispersion of groundwater age in an alluvial system. Water Resources Research 38: 1-14.

White S.D. (1993). Perspectives on defining and delineating hyporheic zones. Journal of the North American Benthological Society 12: 61-69.

Wiens J.A. (1989). The Ecology of Bird Communities, Vol. 1. Foundations and Patterns. Cambridge University Press, Cambridge.

Williams D.D. & Hynes H.B.N. (1974). The occurrence of benthos deep in the substratum of a stream. Freshwater Biology 4: 233-256.

Wilson D.S. (1992). Complex interactions in metacommunities, with implications for biodiversity and higher levels of selection. Ecology 73: 1984-2000.

Wondzell S M. (2006). Effect of morphology and discharge on hyporheic exchange flows in two small streams in the Cascade Mountains of Oregon, USA. Hydrological Processes 20 :267-287.

Wondzell S M. & Swanson F.J. (1999). Floods, channel change, and the hyporheic zone. Water Resources Research 35: 555-567.

Wright S. (1943). Isolation by distance. Genetics 28: 114–138.

Wright S. (1931). Evolution in Mendelian populations. Genetics 16: 97–159.

Wright-Stow A.E., Collier K.J. & Smith B.J. (2006). Hyporheic production is substantially greater than benthic production for a common New Zealand caddisfly. Hydrobiologia 560: 295-310.

Wyatt K.H., Hauer F.R & Pessoney G.F. (2008). Benthic algal response to hyporheic-surface water exchange in an alluvial river. Hydrobiologia. 607: 151-161.

Zah R. & Uehlinger U. (2001). Particulate organic matter inputs to a glacial stream ecosystem in the Swiss Alps. Freshwater Biology 46: 1597-1608.

Zaksek V. (2009). A molecular test for cryptic diversity in ground water: how large are the ranges of macro-stygobionts? Freshwater Biology 54: 727-744.

206

Zeller M., Reusch T.B.H. & Lampert W. (2008). Small effective population sizes in two planktonic freshwater copepod species (Eudiaptomus) with apparently large census sizes. Journal of Evolutionary Biology 21: 1755-1762.

207

ANNEXE

Chapitre 2: Supplementary File 3

96 loci selected using the nature, purity and number of repetitions as criteria and tested for the development of microsatellite markers in P. walteri

208

ES M_ 3 96 loci selected using the nature, the purity and the number of repetitions as criteria and tested for the development of the 7 microsatellite markers for P. walteri Contig / Sequence name Marker_name Repeat motif pair_product_size Primer name F Primer sequence F (5' - 3') Primer name R Primer sequence R (5' - 3') Amplification Roubion - Soyans Drôme - Livron Roubion - Sauzet Ouveze - Vaison Loue - Belmont Drôme - Les Pres Polymorphism Fluro labelled Pertinent Allele size range (bp) GRLGHDE03GD3DP μPwalt_Di_1 (AG)14 80 F_μPwalt_Di_1 AACAACGTCCATGGAAGAATCTG R_μPwalt_Di_1 TTGTACGTAGAGATGTTGCTGC yes + + + + + yes [pet]-AACAACGTCCATGGAAGAATCTG no GRLGHDE04H8685 μPwalt_Di_2 (AG)13 85 F_μPwalt_Di_2 GAACAACGCCAGTGGAAGTATC R_μPwalt_Di_2 CTGTACGTAGAGATGTTGCTGC no + + + + + + GRLGHDE04JMEOX μPwalt_Di_3 (AC)19 85 F_μPwalt_Di_3 TGTCTGCGTTCATATGTGCATG R_μPwalt_Di_3 GCGAGAATCAATTAAGCCAAGG yes + + + non GRLGHDE03HIKI2 μPwalt_Di_4 (AG)12 86 F_μPwalt_Di_4 CGAGCTGGCACCTATTCTA TCC R_ μPwalt _ Di_ 4 TCGTA A CGGGTTGGA CAAATAC no + + + + GRLGHDE03GTII7 μPwalt_Di_5 (AG)17 87 F_μPwalt_Di_5 TCAGAGACTTCCAATCTTTAGGG R_μPwalt_Di_5 CTCAGAGGCATCAAGAAGAAGG no + + Contig_3533 μPwalt_Di_6 (AG)12 89 F_μPwalt_Di_6 CCTGCCCTCTCTCTGTACTTAG R_μPwalt_Di_6 TCGAACAATGTCCATGGAAGTATC yes + + + + + + yes [hex]-CCTGCCCTCTCTCTGTACTTAG no GRLGHDE03GCXNT μPwalt_Di_7 (AG)12 90 F_μPwalt_Di_7 CAGCAGACTCATCCGAACAAC R_μPwalt_Di_7 GCTGTACGTAGATATGTTGCTGC yes + + + + + + yes [ned]-CAGCAGACTCATCCGAACAAC no GRLGHDE04IRAPA μPwalt_Di_8 (AC)20 90 F_μPwalt_Di_8 ACATAACGGTTTGATTCA GGGC R_ μPwalt _ Di_ 8 GA GCGA GCGA A GTA CA CA GG n o GRLGHDE03GTT7M μPwalt_Di_9 (AC)16 92 F_μPwalt_Di_9 AACTGCATAGGAATACACGCA C R_ μPwalt _ Di_ 9 A GGTA GCTGTA GA TGTTGA GGG n o + + + + GRLGHDE04H53NP μPwalt_Di_10 (AG)12 95 F_μPwalt_Di_10 AGACAATTGACAAGAGCAGAAGG R_μPwalt_Di_10 TCCCTCTGTGAAGTCTTCTATTCC no + + + GRLGHDE04H5NDI μPwalt_Di_11 (AC)13 97 F_μPwalt_Di_11 ACAATCATCCAGTGGCTAATAAAC R_μPwalt_Di_11 TGAGCATCTCCCTACTCTTCAG no GRLGHDE03GUX83 μPwalt _ Di_ 12 (A G)12 102 F_ μPwalt _ Di_ 12 CGGA GTGGTGTGTGAAATCTTC R_μPwalt_Di_12 TTCCAGGCAGAACGAATTGC yes + + + + + + yes [ned]-CGGA GTGGTGTGTGA A A TCTTC y es 89 - 209 GRLGHDE04H52GQ μPwalt_Di_13 (AG)13 103 F_μPwalt_Di_13 AGTCTGTCGCACACCTTTAATG R_μPwalt_Di_13 CATGCGTAGAGATGTTGCACC no + + + GRLGHDE03G1YG7 μPwalt _ Di_ 14 (A G)14 105 F_ μPwalt _ Di_ 14 TCTA CA GA GCTA A A CAGTACTTCAC R_μPwalt_Di_14 GTCACTTTGTTCTGCCTCTTTG no + + + + GRLGHDE04JQ4FZ μPwalt_Di_15 (AC)15 106 F_μPwalt_Di_15 TCATTTATTACAATCA TCCA GTGGC R_ μPwalt _ Di_ 15 A TGA A TGGA A GGTGTGTTA A TGC n o ++ GRLGHDE03GODN1 μPwalt_Di_16 (AG)16 106 F_μPwalt_Di_16 AGAAAGAGAGCACCTTGAAGATTC R_μPwalt_Di_16 CTAAGACCACTACTCTGAGGCG no + GRLGHDE03FLI8V μPwalt _ Di_ 17 (A G)13 107 F_ μPwalt _ Di_ 17 A CGGA GGTGGTA TA ATCTGTCC R_μPwalt_Di_17 GATAGCCTCCATCCTCTAGCTG yes + + + + + + yes [pet]-ACGGA GGTGGTA TA A TCTGTCC n o Contig_1548 μPwalt_Di_18 (AC)15 107 F_μPwalt_Di_18 CACACAGAAGTTTCCTCAGTGC R_μPwalt_Di_18 GTAAGAAGCATCAGGAACCGAC no + + + + GRLGHDE03GJNG4 μPwalt_Di_19 (AG)12 108 F_μPwalt_Di_19 GCCAAGTCCGTATTTGAAGAGG R_μPwalt_Di_19 CCCTCGTTGTCAGACTTAACAAC no GRLGHDE04IH0I7 μPwalt_Di_20 (AG)17 108 F_μPwalt_Di_20 AGAAAGAGAGCACCTTGAAGATTC R_μPwalt_Di_20 CTAAGACCACTACTCTGAGGCG no + Contig_3184 μPwalt_Di_21 (AG)12 110 F_μPwalt_Di_21 AACGTCGAATACCcACTCAGAG R_μPwalt_Di_21 TCTCTCTAAGTGGATCGGCAAG yes + + + + + + yes [hex]-AACGTCGAATACCcACTCAGAG yes 99 - 143 GRLGHDE03G4ONM μPwalt_Di_22 (AG)12 110 F_μPwalt_Di_22 CGTCAGTTTATTGGATGAAATTTGC R_μPwalt_Di_22 CTTAATTGCATGGGA GGTGGTC n o + + + GRLGHDE03F3VZA μPwalt_Di_23 (AG)19 117 F_μPwalt_Di_23 TTAGTGTCGTTCGCAAATTTCG R_μPwalt_Di_23 TATAAACGAAGCGAGCGAAGTC no + GRLGHDE04IJGYG μPwalt_Di_24 (AC)24 120 F_μPwalt_Di_24 AACTGACCCAATCTTGACCCAC R_μPwalt_Di_24 CGTAACAAAGTTTACGTTTGGTTTG no GRLGHDE04JWN9A μPwalt_Di_25 (AG)19 125 F_μPwalt_Di_25 ATGCAATCTACCAGGA GA CCTC R_ μPwalt _ Di_ 25 GTA A GGA A GTA GTTGGTCGTGC y es + + + + + + y es [6FA M ]-ATGCAATCTACCAGGAGACCTC no GRLGHDE04I3Q84 μPwalt_Di_26 (AG)24 126 F_μPwalt_Di_26 GATCCTTCGTCGTGTATATAGAGAG R_μPwalt_Di_26 TAACGACCTTACCTTACCTTCG no GRLGHDE04H90N8 μPwalt_Di_27 (AC)22 147 F_μPwalt_Di_27 ACACATTACAGACTCGCTCTCG R_μPwalt_Di_27 ATAAACGAAGCGAGCGAAGTAC no + GRLGHDE03FWRSD μPwalt_Di_28 (AC)17 148 F_μPwalt_Di_28 ATACAAATCAGCACCACTCGAG R_μPwalt_Di_28 ATAAACGAAGCGAGCGAAGTAG no ++ GRLGHDE03FPT5I μPwalt_Di_29 (AG)13 150 F_μPwalt_Di_29 CGTCCATGGAAGTATGTGTAGAAG R_μPwalt_Di_29 CGTGCATGCATACTGATCTCTG no + + + + GRLGHDE03G13LL μPwalt_Di_30 (AG)13 159 F_μPwalt_Di_30 GGAGACAATGAAGGTTA A GGTGTC R_ μPwalt _ Di_ 30 A TTA CTGTGA TGGCCTTA A CCC n o + + + Contig_54 μPwalt_Di_31 (AG)12 161 F_μPwalt_Di_31 TTCGTTGCAGAGACGATGAA TG R_ μPwalt _ Di_ 31 CGTA A GGTCTCTGTGA A GTCTTC y es + + + + + + y es [p et ]-TTCGTTGCAGAGACGATGAATG yes 152 - 192 GRLGHDE04JHAO8 μPwalt_Di_32 (AC)12 165 F_μPwalt_Di_32 TGATCTTGCTGTTGAATGCGAC R_μPwalt_Di_32 GCGAGCGAAGTAATTCCTAGTG no + + + Contig_1629 μPwalt_Di_33 (AG)15 167 F_μPwalt_Di_33 GAACAACGTCCATGGAAATATCTG R_μPwalt_Di_33 ACGAACACACTATATATGGCgTC no + + + Contig_2256 μPwalt_Di_34 (AG)30 168 F_μPwalt_Di_34 AACGCCTTGGGA TA TGTCAAAC R_μPwalt_Di_34 CCGACCGACCGTAACGTAAC yes + + + non GRLGHDE04JF85Q μPwalt_Di_35 (AG)13 170 F_μPwalt_Di_35 TTGAAAGTTGGCTGGAAGATTG R_μPwalt_Di_35 TAACGGATGCACAATGTTCGAC yes + + + + yes [ned]-TTGAAAGTTGGCTGGAAGATTG no GRLGHDE04JD1P9 μPwalt_Di_36 (AG)12 171 F_μPwalt_Di_36 GTTGGTGTTTGCTGCAACTC R_μPwalt_Di_36 TACTGCACTGCCGCTATACAAG yes + + + + + + yes [hex]-GTTGGTGTTTGCTGCAACTC yes 162 - 182 GRLGHDE03G0JZR μPwalt_Di_37 (AG)19 171 F_μPwalt_Di_37 GGCAGTGATGGATTAGCTTTCG R_μPwalt_Di_37 GTTCAGCCAACGTTACAACATC no + + + GRLGHDE04I220Y μPwalt_Di_38 (AG)14 174 F_μPwalt_Di_38 TGAACTTTGATGTTAGCGTGGC R_μPwalt_Di_38 AGCGAGCGAAGTATGCGTTC no + + + GRLGHDE04IBFUH μPwalt_Di_39 (AG)19 176 F_μPwalt_Di_39 ACGCAACGCTTAATAGTCAATG R_μPwalt_Di_39 CGAGCGAGCAGTCAATTAATTTAAG no GRLGHDE04JCZW7 μPwalt_Di_40 (AG)42 215 F_μPwalt_Di_40 TTGTTTATGTAGCACCCACGAG R_μPwalt_Di_40 GTACTCGTACGTCTCTCCTCG no + + + + Contig_1591 μPwalt_Di_41 (AC)12 230 F_μPwalt_Di_41 GGTATCTTGGAATGGATGTCGC R_μPwalt_Di_41 ACAAGGGAAGTATGTGTCaACC no + + + + + + GRLGHDE03GKT4K μPwalt_Di_42 (AG)15 232 F_μPwalt_Di_42 CTGAACTCTCTGGAAACTGCAC R_μPwalt_Di_42 CGAGCGAAGTACTCCTGAATTG yes + + + + + + yes [ned]-CTGAACTCTCTGGAAACTGCAC no GRLGHDE03G73TT μPwalt_Di_43 (AG)12 238 F_μPwalt_Di_43 GAATAAGAGCCCTGCAAAGACC R_μPwalt_Di_43 AGACATTGAATGAGTGAGTAGCAAG no + + + + + GRLGHDE03G4545 μPwalt_Di_44 (AC)12 238 F_μPwalt_Di_44 TGATGCCTGCGTAGTA A TCA TC R_ μPwalt _ Di_ 44 GTGGGTGTA GA GCA A GTGTTA G y es + + + + y es [p et ]-TGA TGCCTGCGTAGTAATCATC no GRLGHDE04IH3AD μPwalt_Di_45 (AG)13 240 F_μPwalt_Di_45 TGAATGGTGAATCAGAGCAACC R_μPwalt_Di_45 CATCACGACAGCCATAGAGAAG no GRLGHDE03GYPF3 μPwalt_Di_46 (AG)12 245 F_μPwalt_Di_46 ATGCAATCTACCAGGAGACCTC R_μPwalt_Di_46 GAGTCATATTCGCTCCAGATGG yes + + + + + yes [6FAM]-A TGCAATCTACCAGGAGACCTC no Contig_3328 μPwalt_Di_47 (AG)12 255 F_μPwalt_Di_47 TCAGGTGGCAAAGAAATGGAAG R_μPwalt_Di_47 ATGTAAACTGAAACGAGCGAGC no + + GRLGHDE03GGVA0 μPwalt_Di_48 (AG)12 288 F_μPwalt_Di_48 AGTATGATACAAGCTGCGTTCG R_μPwalt_Di_48 CGACCGACCGTAACGTTAAAC no + + GRLGHDE04H5VKQ μPwalt_Te_1 (ACTC)8 91 F_μPwalt_Te_1 ACTGACTGACTGACTTCGCTC R_μPwalt_Te_1 GAGCGAAGTACCTAGAGCTTTG no + + + GRLGHDE04H5VKQ μPwalt_Te_2 (ACTG)24 91 F_μPwalt_Te_2 ACTGACTGACTGACTTCGCTC R_μPwalt_Te_2 GAGCGAAGTACCTAGAGCTTTG no + + + + GRLGHDE03GD0JK μPwalt_Te_3 (ATCC)9 106 F_μPwalt_Te_3 TTTCTCAACCCACCCTCCTA TC R_ μPwalt _ Te_ 3 A A TGGA TA GA TGGGTGGGTA GG n o + + + + GRLGHDE04IUEEP μPwalt_Te_4 (AATG)10 109 F_μPwalt_Te_4 CTTTCCCTTCGTCCTTCATTCG R_μPwalt_Te_4 GAGCGAGCGAAAGTACTCTATC yes + + + non GRLGHDE04ILHSS μPwalt_Te_5 (ACAG)9 140 F_μPwalt_Te_5 ACTGCAGCATATTTACCAGCAC R_μPwalt_Te_5 CGTAGTCTCTGTCTTGCCTCG no + + + Contig_48 μPwalt_Te_6 (AATC)10 140 F_μPwalt_Te_6 GTTCTTGGTCTGATACGTGACG R_μPwalt_Te_6 CGAGCGAGCGAAGTAATTGTAG no + GRLGHDE04JE6LL μPwalt_Te_7 (AAGT)9 143 F_μPwalt_Te_7 TGCCTAAATGTGAGACTGA CTG R_ μPwalt _ Te_ 7 A GTA GCGA GGA A GTGA GTA TGC y es + + + + + n o n GRLGHDE04JE6LL μPwalt_Te_8 (ACTC)11 143 F_μPwalt_Te_8 TGCCTAAATGTGAGACTGACTG R_μPwalt_Te_8 AGTAGCGAGGAAGTGAGTATGC yes + + + + + non GRLGHDE04JE6LL μPwalt_Te_9 (AAGT)9 143 F_μPwalt_Te_9 TGCCTAAATGTGAGACTGA CTG R_ μPwalt _ Te_ 9 A GTA GCGA GGA A GTGA GTA TGC y es + + + + + n o n GRLGHDE04JE6LL μPwalt_Te_10 (ACTC)11 143 F_μPwalt_Te_10 TGCCTAAATGTGAGACTGACTG R_μPwalt_Te_10 AGTAGCGAGGAAGTGAGTATGC yes + + + + + + non GRLGHDE03FR7GO μPwalt_Te_11 (AGAT)8 146 F_μPwalt_Te_11 ACACATTGTCTACTGCA CA TCC R_ μPwalt _ Te_ 11 TTGGTGTTGGGCA TA TA TA GGC y es + + y es [6FA M ]-A CA CATTGTCTACTGCACATCC no Contig_3452 μPwalt_Te_12 (AGAT)28 160 F_μPwalt_Te_12 TTGtAGGTTCGAATGAGTGCAC R_μPwalt_Te_12 GTACTAACGAGACGAGCGAAG no + + + Contig_2833 μPwalt_Te_13 (AGAT)9 163 F_μPwalt_Te_13 ACAACTCCAGTCAACCTCCTC R_ μPwalt _ Te_ 13 A A GA GGA GGTGCA TA GGA A GTG n o + + + + Contig_237 μPwalt_Te_14 (AGAT)13 165 F_μPwalt_Te_14 TGTCACATGAAGCATCTGAAGC R_μPwalt_Te_14 TCCGTCCTGTCCTTCTGTAATG no Contig_237 μPwalt_Te_15 (AGAT)15 165 F_μPwalt_Te_15 TGTCACATGAAGCATCTGAAGC R_μPwalt_Te_15 TCCGTCCTGTCCTTCTGTAATG no + GRLGHDE03GIDUX μPwalt_Te_16 (AAAG)9 167 F_μPwalt_Te_16 AAATCAGCCTTGGTTCAGTCAC R_μPwalt_Te_16 CTGTCTTGCATTCCCTTTGACC no + GRLGHDE04IEWF1 μPwalt_Te_17 (AGAT)19 169 F_μPwalt_Te_17 CCCGTTGGTATGTTCTCTTGTC R_μPwalt_Te_17 TTTCCGACAGCAGAAGAAAGAC no + + + Contig_486 μPwalt_Te_18 (AGAT)12 175 F_μPwalt_Te_18 GAAACAAATTGCACTGTGGAGC R_μPwalt_Te_18 AGTCATTCTTCATTCTGGCATAGC no GRLGHDE04JEXJM μPwalt_Te_19 (AGAT)10 177 F_μPwalt_Te_19 AAGAGCTGCTTCACTTCTGTTC R_μPwalt_Te_19 GAGCGAGCGAAGTACACCAG no + + + GRLGHDE04JVO8D μPwalt _ Te_ 20 (A GA T)14 185 F_ μPwalt _ Te_ 20 TGGA TGTCTGGCCTGAAATTAC R_μPwalt_Te_20 GAAGTACCTTGCCGTGACTTC no Contig_1025 μPwalt_Te_21 (AGAT)9 187 F_μPwalt_Te_21 GGTTAGCTGCCGATCACA A TA C R_ μPwalt _ Te_ 21 GCA GA TA GTTA TGTA GA TA GGGTGG n o Contig_175 μPwalt_Te_22 (AGAT)13 205 F_μPwalt_Te_22 ACTTTGCCAGAAGAGTCA A TGG R_ μPwalt _ Te_ 22 GGTTGA TA GGGTGTTGCTA TGC n o + + + GRLGHDE04I5CR8 μPwalt_Te_23 (AGAT)23 206 F_μPwalt_Te_23 CAACTGCAAGCAATGGTATCAC R_μPwalt_Te_23 GAGACGAGCGAAGTACCTAGTC no Contig_2440 μPwalt_Te_24 (AGAT)10 209 F_μPwalt_Te_24 CACTTCCATCCTCAGTCGAATC R_μPwalt_Te_24 AGTCACTAGTCACCAATGGATG no + GRLGHDE03GWO6C μPwalt_Te_25 (AGAT)17 209 F_μPwalt_Te_25 TGCCATAAGAACAGCATTGCAG R_μPwalt_Te_25 GGAAGTGGACCTGTAGACTTTG yes + + + + non Contig_265 μPwalt_Te_26 (AAGT)9 213 F_μPwalt_Te_26 GAGGAAGTGAGTATGCGAGTTAG R_μPwalt_Te_26 GGGTTCGCGATTCTAGAAAGAC no + Contig_2660 μPwalt_Te_27 (AGAT)8 218 F_μPwalt_Te_27 AATTTGTGTCAaTACCCAGCCC R_μPwalt_Te_27 ATGGAGTGAACGGACAGACAG yes + + + + non GRLGHDE04H9DZB μPwalt_Te_28 (ACAG)8 220 F_μPwalt_Te_28 CTCCAGTACAAGGACAAGTTGC R_μPwalt_Te_28 CTGAATGCTGTGGAAAGAGACC no + + + + GRLGHDE04H2WKU μPwalt_Te_29 (AGAT)18 221 F_μPwalt_Te_29 TAGGCACATATAGA A GGGTGGG R_ μPwalt _ Te_ 29 CTCTGA CA CA TCTCTCA CA TCC n o + + + + GRLGHDE04IGL2Y μPwalt_Te_30 (ACAG)8 226 F_μPwalt_Te_30 AAATTGACAAAGTCCAGTTCCG R_μPwalt_Te_30 ATTCTGCTTCTTTATTCCATCGTG yes + + + + + + yes [hex]-AAATTGACAAAGTCCAGTTCCG yes 190 - 258 GRLGHDE04IPJRJ μPwalt_Te_31 (ACTC)12 226 F_μPwalt_Te_31 CCTATATGAAGTGGA GCA TGGC R_ μPwalt _ Te_ 31 CGA A GTTGA GTA A GTGGGTGA G y es + + + + n o n GRLGHDE03GU3DD μPwalt_Te_32 (ATCC)13 243 F_μPwalt_Te_32 TGCTGTCCTCTACCCAGTAATG R_μPwalt_Te_32 CCACATTTACTAGGACCCAACG no + + + + GRLGHDE04H46TL μPwalt_Te_33 (ACAG)9 249 F_μPwalt_Te_33 ACCCTTTACCTTTGAGAGATTGC R_μPwalt_Te_33 GTATAAACGAGCGAGGCGAAG yes + + + Contig_3742 μPwalt_Te_34 (AGAT)40 251 F_μPwalt_Te_34 ACAAGGAAGCAAATGACTGTTAG R_μPwalt_Te_34 AGGTGGTTGCTTGTTTAATTTACC no GRLGHDE03FYSDC μPwalt_Te_35 (AAGT)9 256 F_μPwalt_Te_35 GAGGAAGTGAGTATGCGAGTTAG R_μPwalt_Te_35 TCGGCGTACTTTATAACTGCAG no + + GRLGHDE03GXJIM μPwalt_Te_36 (AGAT)21 264 F_μPwalt_Te_36 TGGTTATCTAGACAGCAGACTAATC R_μPwalt_Te_36 GACATGTCAGAGGCAGTGAAAC no + + + + GRLGHDE04ISCB7 μPwalt_Te_37 (ACAG)11 267 F_μPwalt_Te_37 ACCACTGCAAGCTATCTGTCTG R_μPwalt_Te_37 AGCGAGCGAAGTAATTCTCATG no GRLGHDE04IAG3B μPwalt_Te_38 (ACAG)12 269 F_μPwalt_Te_38 GCGCAACTTCCTAAATGCAATC R_μPwalt_Te_38 AGCGAGCGAAGTACTATACGAG yes + + + + non GRLGHDE04ITU6G μPwalt_Te_39 (ACTC)9 272 F_μPwalt_Te_39 GAGCTGAACAACTACTGGCTTC R_μPwalt_Te_39 GAAGTTATTCGTCGTCAGCTCC yes + + + + + + yes [6FAM]-GAGCTGAACAACTACTGGCTTC yes 218 - 298 GRLGHDE03GJI9E μPwalt_Te_40 (ACAG)13 284 F_μPwalt_Te_40 CTCCAGTACAAGGACAAGTTGC R_μPwalt_Te_40 AGCGAGCGAAGTAATTCTCATG yes + + non GRLGHDE03FN8OM μPwalt_Te_41 (AGAT)9 290 F_μPwalt_Te_41 CAGTTGGTTATCTAGACAGCAGAC R_μPwalt_Te_41 GTGAGAGGAGAATAATGGATCAAGG no + GRLGHDE04JXAG4 μPwalt_Te_42 (ACAG)9 295 F_μPwalt_Te_42 CCTAGTCGACCATACCATAGGC R_μPwalt_Te_42 GCGCAACTTCCTAAATGCAATC no + + + GRLGHDE04JOE7A μPwalt_Te_43 (ACAG)9 295 F_μPwalt_Te_43 GCGCAACTTCCTAA A TGCA A TC R_ μPwalt _ Te_ 43 CCTGTTTCTA CTTGTGGA TCGC n o ++ 209 GRLGHDE04JWQ2L μPwalt_Te_44 (ACAG)13 316 F_μPwalt_Te_44 CTCCAGTACAAGGA CA A GTTGC R_ μPwalt _ Te_ 44 GA A CTGCA TTTGGTCCA A TGTG y es + + + + y es [n ed ]-CTCCAGTACAAGGACAAGTTGC no GRLGHDE04ISZOD μPwalt_Te_45 (ACTC)8 319 F_μPwalt_Te_45 AGTCAATTGCGATCCCTTGTTG R_μPwalt_Te_45 CTACTTCTCGTCTGTCTGTCCG no + GRLGHDE03HC5NB μPwalt_Te_46 (ACTC)11 333 F_μPwalt_Te_46 ACATTTGTTCTTTGGTGGAGGC R_μPwalt_Te_46 TGCTAAATTTCATCGTTCTAGCATC yes + + + + + + yes [hex]-ACATTTGTTCTTTGGTGGAGGC yes 300 - 410 Contig_2860 μPwalt_Te_47 (AGAT)18 370 F_μPwalt_Te_47 GGCCAACTGTCATTTACCAGTC R_μPwalt_Te_47 CACACTGGACtACAACTTTAGCC no GRLGHDE04JKM53 μPwalt_Te_48 (ACTC)32 378 F_μPwalt_Te_48 ACATTTGTTCTTTGGTGGA GGC R_ μPwalt _ Te_ 48 GCGA A GTTGA GTGA GTGA GC y es + + + + + + y es [h ex]-A CA TTTGTTCTTTGGTGGA GGC n o

Titre Effets de la géomorphologie des rivières en tresses sur les communautés d’invertébrés aquatiques et sur la structuration génétique des populations du crustacé isopode souterrain Proasellus walteri. Résumé Les rivières en tresses sont des grandes rivières alluviales de piémont montagneux à forte dynamique spatio-temporelle et à géomorphologie particulière. Leur cours traverse alternativement de vastes plaines et des rétrécissements de vallées ou canyons. Cette géomorphologie influence fortement les échanges d’eau entre la rivière avec sa nappe souterraine et sur l’épaisseur sédimentaire. Les échanges d’eau entre la rivière et sa nappe se produisent à différentes échelles allant de la vallée jusqu’à des bancs de graviers et peuvent créer des filtres biotiques et abiotiques qui influencent les communautés d’invertébrés. Les canyons créent des zones de moindre épaisseur sédimentaire voire d’absence de sédiments et peuvent représenter de fortes barrières à la dispersion pour des organismes inféodés au milieu sédimentaire souterrain. Ce travail de thèse a cherché à évaluer dans quelle mesure la géomorphologie pouvait donc structurer les communautés d’invertébrés de surface et souterraines et pouvait jouer sur la dispersion d’un organisme souterrain Proasellus walteri. Les différents résultats obtenus ont permis de montrer que la géomorphologie structurait les communautés d’invertébrés en mettant en évidence une forte réponse des communautés souterraines mais pas de surface et créait des zones de forte biodiversité à l’aval des plaines. Les résultats de cette étude ont également permis de conclure sur un effet positif de la géomorphologie des rivières en tresses sur la structuration génétique de P. walteri et de mettre en évidence de grandes tailles de populations ainsi que de fortes capacités de dispersion, permettant d’écarter certaines idées reçues sur le milieu souterrain. Mots clés : géomorphologie ; rivières en tresses ; eau souterraine ; invertébrés ; communautés ; structuration génétique ; taille efficace de populations

Title Geomorphology of large braided rivers as driver of biodiversity; how it can shape patterns of aquatic invertebrate communities and populations structure Abstract Braided rivers are large alluvial rivers found in piedmont mountainous areas. These rivers are very dynamic systems in space and time and exhibit particular geomorphology. The river flows alternatively into large alluvial plains or narrowing parts (also defined as canyons). This geomorphology impacts groundwater-surface water exchanges and sedimentary thickness. Groundwater-surface water exchanges occur at different scales, then interacting to shape biotic and abiotic filters for invertebrate communities. Canyons can reduce sedimentary continuity or interrupt it and may represent strong barriers to dispersal for sedimentary-dwelling organisms. This present work aimed at evaluating the effects of geomorphology in invertebrate community structure and as a potential barrier to dispersal in the subterranean organism Proasellus walteri. The different results obtained have shown that geomorphology structured invertebrate communities, highlighting a strong response in groundwater communities but not in surface communities and have shown that downstream parts of alluvial plains were hotspots of biodiversity. The results of this study also concluded on a positive effect of geomorphology in braided rivers on the genetic structure of P. walteri and underlined large effective population size and high dispersal ability, then removing some misconceptions about subterranean environment. Keywords: geomorphology, braided rivers, groundwater, invertebrates, communities, genetic structure, effective population size.

210