Molecular Taxonomy and Evolution of Freshwater Crayfish of the Genus Cherax (Decapoda: Parastacidae) from Northern Australia and New Guinea

Molecular Taxonomy and Evolution of Freshwater Crayfish of the Genus Cherax (Decapoda: Parastacidae) from northern Australia and New Guinea

Rury Eprilurahman, B.Sc.

A thesis submitted in fulfilment of the requirements for the degree of Master by Research

Research Institute for the Environment and Livelihoods

Charles Darwin University, Northern Territory, Australia

Submitted August 2014 Accepted December 2014 ii

Candidate Declaration

I hereby declare that the work herein, now submitted as a thesis for the degree of Master by

Research of the Charles Darwin University, is the result of my own investigations, and all references to ideas and work of other researchers have been specifically acknowledged. I hereby certify that the work embodied in this thesis has not already been accepted in substance for any degree, and is not being currently submitted in candidature for any other degree.

Full Name : Rury Eprilurahman

Signature

Date : ...... 06/01/2015...... iii

Abstract

Taxonomic and evolutionary research of freshwater crayfish of the genus Cherax from tropical Australia and New Guinea (Papua-Indonesia and Papua New Guinea) is limited.

The objective of this research is to place these Cherax species into a taxonomic and evolutionary framework following on from studies on Australian species using molecular genetic data with a special focus on species from Papua, Indonesia.

This research presents an analysis of two data sets, one consisting of mt16S rRNA sequences from 134 samples and the second a combination of four genes (12S rRNA, 16S rRNA, COI, GAPDH) from a subset of these samples to test species boundaries and establish phylogenetic hypotheses for New Guinean and selected northern Australian species. These data supports the recognition of 25 Cherax species, including three recently described species and five new species discovered in this study from Papua, Indonesia.

Two main clades were identified based on phylogenetic analyses. The New Guinean crayfish does not form a monophyletic group but share relationships with northern

Australian species at different evolutionary depths, which is consistent with the geological history of the region. The diverse highland Cherax fauna of the Wissel Lakes form a well support monophyletic lineage but show minimal molecular divergence, which is at odds with their high morphological diversity. The results of this study fill a major gap in the understanding of the systematics and evolution history of the genus Cherax, one of the most diverse and widespread genera of freshwater crayfish. iv

Contents

Candidate Declaration ...... ii Abstract ...... iii Contents ...... iv List of Tables ...... vi Table of Figures ...... vii Dedication ...... ix Acknowledgements ...... x CHAPTER 1 ...... 1 General Introduction ...... 1 1.1. Background ...... 1 1.2. Evolutionary History of Freshwater Crayfish ...... 4 1.2.1. Family Parastacidae ...... 5 1.2.2. Genus Cherax ...... 8 1.2.3. Northern Australian Cherax ...... 12 1.2.4. New Guinean Cherax ...... 13 1.3. Molecular Systematics ...... 18 1.3.1. DNA sequencing ...... 19 1.3.2. Choices of molecular markers for phylogenetic inference ...... 20 1.3.3. Phylogenetics...... 22 1.4. Geological History of Northern Australia and New Guinea Region...... 25 1.4.1. Fluctuation of the sea levels and ancient river systems ...... 26 1.4.2. Climate and geography of New Guinea and Australia ...... 28 1.4.3. Freshwater Habitats of New Guinea and northern Australia ...... 33 1.4.3.1. Ayamaru and Aitinjo Lakes ...... 34 1.4.3.2. Wissel Lakes ...... 36 1.4.3.3. Lake Habbema, Baliem and Ibele Rivers ...... 38 1.4.3.4. Fakfak and Bomberai Peninsula ...... 40 1.4.3.5. Northern Australia ...... 41 1.5. Research problem statement and aims ...... 42 1.6. Thesis format ...... 43 CHAPTER 2 ...... 44 Evolution elevated: A phylogenetic analysis of New Guinean high land crayfish (Cherax: Decapoda: Parastacidae) reveals a decoupling of morphological and molecular evolution ...... 44 2.1. Introduction ...... 44 2. 2. Materials and methods ...... 48 2.2.1. Samples and sequences ...... 48 2.2.2. DNA extraction, PCR amplification, and sequencing ...... 50 2.2.3. Phylogenetic analyses...... 51 2.2.4. Taxonomic analyses ...... 52 2. 3. Results ...... 61 v

2.3.1. Sequences ...... 61 2.3.2. Phylogenetic analysis ...... 61 2.3.3. Molecular taxonomy...... 66 2.3.4. Molecular clock analysis ...... 72 2. 4. Discussion ...... 75 2.4.1. Molecular taxonomy...... 75 2.4.2. Molecular phylogeny ...... 81 2.4.3. Zoogeography and divergence times ...... 86 2. 5. Conclussion ...... 91 CHAPTER 3 ...... 93 General Discussion ...... 93 3.1. Significance of research findings ...... 93 3.1.1. Cherax diversity – an overview ...... 98 3.2. Further study ...... 104 BIBLIOGRAPHY ...... 106

List of Tables

Table 1.1. The recognised genera of the Parastacidae ...... 6 Table 1.2. The classifications of the northern Australia species of Cherax essentially after Riek (1969), Short (1991; 1993), Short & Davie (1993), Austin (1996), Munasinghe et al. (2004b) and Baker et al. (2008) ...... 13 Table 1.3. The classifications of the southern New Guinea species of Cherax essentially after Nobili (1899), Calman (1911), Roux (1991), Clark (1936) Holthuis (1949; 1950; 1996), Lukhaup & Pekny (2006; 2008), and Lukhaup & Herbert (2008) ...... 14 Table 2.1. Geographic origin of specimens sequenced and NCBI Genbank accession numbers for four gene regions ...... 53 Table 2.2. Primer used for amplification and sequencing in this study ...... 59 Table 2.3. Summary of phylogenetic relationships and species group designations for northern Australia and New Guinea Cherax ...... 84 Table 3.1. Summary of the status of Cherax species with reference to molecular genetic studies ...... 100

vii

Table of Figures

Figure 1.1. Distribution map of freshwater crayfish representing two superfamilies: Parastacoidea (family Parastacidae, solid black), and Astacoidea (families Astacidae, gray and Cambaridae, horizontal line) (modified from Hobbs 1988)...... 4 Figure 1.2. Native distribution of freshwater crayfish of the genus Cherax in Australia and New Guinea (Schultz et al. 2009 with modification) ...... 8 Figure 1.3. Morphological variation of eight species of Wissel lakes Cherax (Austin collection and Holthuis 1949) ...... 16 Figure 1.4. Hypotheses proposed by Riek (1969), Austin (1995), and Munasinghe et al. (2004b) for the phylogenetic relationship within genus Cherax ...... 23 Figure 1.5. Principal geographic features of the region covered in South-East Asia reconstruction (Hall 2002) ...... 25 Figure 1.6. Map of pleistocene sea levels in South-East Asia and Austral-Asia (Voris, 2000) .. 26 Figure 1.7. New Guinea topography showing wide range elevation of the region (http://en.wikipedia.org/wiki/file:new_guinea_topography.png) ...... 29 Figure 1.8. Areas of Australia above 600 m in elevation (after Steffan et al. 2009) ...... 30 Figure 1.9. Region comprising the wet-dry tropics of northern Australia (Warfe et al. 2011) .... 31 Figure 1.10. Map of freshwater ecoregions (Abell et al. 2008 with modification) ...... 33 Figure 1.11. Ayamaru and Aitinjo lakes, West Papua, Indonesia ...... 35 Figure 1.12. Wissel lakes, Papua, Indonesia ...... 37 Figure 1.13. Lake Habbema, Baliem river and Ibele river, Papua, Indonesia ...... 39 Figure 1.14. Bomberai peninsula region, West Papua, Indonesia ...... 40 Figure 2.1. Sample collection sites for Cherax with distribution lineage in respect of Munasinghe et al. (2004b) ...... 60 Figure 2.2. Phylogenetic relationships among Cherax spp. from northern Australia and New Guinea based on a Bayesian analyses of 134 rRNA 16S sequences ...... 62 Figure 2.3. Expanded view of the lineage A – first of the two major clades for the tree presented in Figure 2.1 showing relationships among the New Guinean Cherax ...... 63 Figure 2.4. Expanded view of the lineage B – second of the two major clades for the tree presented in Figure 2.1 showing relationships among northern Australian Cherax species and two of the low land New Guinea Cherax ...... 64 Figure 2.5. Bayesian analysis for concatenated data of four gene regions (16S, 12S, COI and GAPDH) among Cherax spp. from northern Australia and New Guinea ...... 65

viii

Figure 2.6. MDS plot of uncorrected genetic similarity among red claw clades (C. albertisii, C. quadricarinatus, C. bicarinatus, C. sp.nov.1., C. lorentzi, C. nucifraga, C. barretti, and C. rhynchotus)...... 67 Figure 2.7. MDS plot of uncorrected genetic similarity among Fakfak, Bird‟s Head, and Misool Island clades (C. holthuisi, C. boesemani, C. misolicus, C. sp.nov.2., C. sp.nov.3., C. sp.nov.4., and C. sp.nov.5.) ...... 69 Figure 2.8. MDS plot of uncorrected genetic similarity among highland crayfish of the genus Cherax (Wissel Lakes species complex and C. monticola from Wamena) and one lowland, C. peknyi ...... 72 Figure 2.9. Bayesian tree and molecular clock estimates for Cherax lineages based on analysis of mitochondrial 16S rRNA...... 74 Figure 2.10. The type series (A) and holotype (B) of C. bicarinatus from the British Museum and comparison of samples of C. bicarinatus (Blue Mud Bay – C), C. rhynchotus (Jardine River – D) and C. quadricarinatus (Rocky pools, Arnhem land – E); see Austin (1996) for locality details for D and E ...... 81

Dedication

To my supervisors, my mother, my wife, my beloved daughters, my family and my friends

Without whose helps and supports this project could not have been undertaken nor completed

Acknowledgements

I wish to acknowledge DIKTI (Directorate General of Higher Education), Ministry of

National Education, Republic of Indonesia for granting me the scholarship to carry out this study. I was supported by a DIKTI scholarship for Indonesian lecturers (Year 2009).

Financial support for this research was also provided by Charles Darwin University, grants awarded to Professor Chris Austin and Faculty of Biology Universitas Gadjah Mada. This study would not have been possible without support and encouragement of many people.

Firstly, I would like to sincere gratitude to my supervisor, Professor Chris Austin, for his patience, great support, guidance, invaluable advice and proper direction given to me during this study. His wide knowledge and his logical way of thinking has been of great value for me to understand molecular systematics. I am also grateful to Dr. Nu-Wei Vivian

Wei and Dr. Mark Schultz, my associate supervisors, for their great support, valuable advices and guidances during laboratory works and data analyzing of this study.

Appreciations and my warm thanks are due to Dr. Mark Schultz, Dr. Nu-Wei Vivian Wei,

Tuty Arisuryanti, Chelzie C. Darussalam, Ratna Susandarini, Maïa Berman, Shane Penny,

Florencia Cerruti, and Emma Francis for their assistance and support in relation to laboratory work and discussions on scientific papers. My sincere thanks extend to

Antonius F. Wagner for providing specimens from his crayfish farm; Felyanto for the kind help to send Sorong specimens; Nikolas Djemris Imunuplatia and all Gemapala members and the generous help of the people of the Bomberai region; Burhan Tjaturadi for the information on Papuan research; New Guinea Expedition team member of Wissel Lakes -

Dr. Thomas Von Rittelen, Dr. Mark Schultz, Christian Lukhaup, Gita Kasthala, Dr.

Alexander Riedel, Christoph Grunewald, Andreas Karge, Dr. Rainer O. Masche, Dr.

Suriani Surbakti and her students for their assistance in collecting samples; Dr. Sarah A.

Smith and Dr. Mark B. Schultz for helping with sequences from museum samples; Carol

Palmer for Cherax barretti sample; and Dr. Daisy Wowor (LIPI-Indonesian Institute of

Sciences) for Papuan Cherax samples, the departments and all people helping with permits.

I warmly thank Jayshree Mamtora and all CDU library staff for their valuable advice and friendly help in finding all the references needed in this study. My sincere thanks extend to

Dr. Jim Mitroy as a manager of Research and Post Graduate Office; Brigitte Kane,

Elizabeth Lycett, Kristen Barnes and Lee-Ann Coles for all their help; and Vibeke Foss,

Chureerat Haq and all International Support Staffs for their great work and supports.

My warm thanks are due to Tatiana Porter, Fergal Flemming, John Logan, Sarah Middlin and ACL (Australian Centre of Languages) staffs who help me settle in at CDU and supported my learning of English to allow me carry out this study. My warm thanks also extend to Ruth Warwick and all academic support staff for providing excellent training for writing skills.

I would like to extend my gratitude to Dr. Penny Wurm, Dr. Bronwyn Myers, Dr. Kiki

Detmers, Prof. Karen Edyvane, Sam Pickering, Rohan Fisher, Sarah Hobgen, Yowana

Podin, Wajid Javed, Saqib Mumtaz, M. Salman Quddus and Wajahat Mahmood for their friendship and all help given to me while I am undertaking this study and during my staying period in Darwin, Australia.

I use this opportunity to acknowledge Dr. Retno Peni Sancayaningsih, Dr. Suwarno

Hadisusanto, Dr. Siti Sumarmi, Prof. Dr. Sukarti Moeljopawiro, M.App.Sc., Prof. Dr.

Mammed Sagi, M.S., Drs. Trijoko, M.Si and all staff members of Faculty of Biology,

Universitas Gadjah Mada, Indonesia for their supports.

xii

My special gratitude is due to my mother and my families in Indonesia for their prayer and loving support. I owe my special loving thanks to my beautiful daughters Salamah and

Rahmah. They have lost a lot due to my study abroad. I also owe a special thanks to my wife, Laksmindra Fitria, who never stop encourages me and providing support and help during my hard time. Without their prayer, encouragement and understanding it would have been impossible for me to finish this study.

I also extend my special thanks to all my friends in Darwin: Tuty Arisuryanti, Ria Fitriana,

Umi C. Rasmi, Yusuf Benyamin, Dwi Rudi S., Fishta Fidiana, Kussudiarsono, Indrawati

Y. Asmara, Ratna D. Suryaratri, Muammaroh, Meika Kurnia, Deasyanti Adil, Abdul

Razaq C., Warintan Evi S., Indonesian Custom Officers for Darwin, Australia (Ichan,

Romy, Didik, Fery, Trubus, Rubiyantara, Tri and Wachid), all Indonesian students in

Darwin, all UMS visiting scholar groups of 2010 and 2011, Big family of North Flinders

International House/ International House Darwin, and Indonesian Community in Darwin.

They let me own a happy family in Australia. I also thank Dita Cahyani and all Indonesian

Biodiversity Research Center (IBRC) research fellow for the opportunity and discussion about understanding phylogenetics. I also thank J. S. Edy Yuwono for helping generating maps for this study. My special thanks also delivered to my best friends in Indonesia:

Donan Satria Yudha, Bowo Nurcahyo, and Arif „Joe‟ Harsoyo.

Finally, I thank all members of the Austin Laboratory Groups, Charles Darwin University,

Darwin and people whom I did not mention here but assisted me in many ways during my study period.

CHAPTER 1

General Introduction

1.1. Background

Indonesia, Australia and Papua New Guinea are among the most biodiverse countries in the world (Mittermeier et al. 1997; Williams et al. 2001; Anonymous

2003). Accordingly, these countries have been classified as megabiodiverse based on the total number of species in a country and the degree of endemism at the species and higher taxonomic levels (Williams et al. 2001). Conservation International (2000), places Indonesia as second in the world behind Brazil for the highest number of endemic plants and animals. Australia leads the world in having the highest number of endemic animals (excluding fish). Such a status means that scientists and governments of these nations have an obligation to discover, document, understand and protect the unique biodiversity of their country. This is of special significance for Indonesia and

Australia as eastern Indonesia (Wallacea) and Papua represent zones of merger or transition between two of the great flora and fauna regions of the world (e.g. Bowman et al. 2010).

Historically, both Indonesia and Australia have seen a range of explorers, naturalists and biologists attracted to the high diversity of these countries and who have contributed to the discovery and description of many of their extraordinary plants and animals. These scientists include luminaries such as Charles Darwin, Alfred R. Wallace,

Joseph Banks, and Thomas Huxley in the 19th century and more recently members of the Archbold expeditions, which focussed on inland New Guinea. Other notable scientists of more recent times who spent time in New Guinea documenting its natural

2 history are Ernst Mayr, Jarred Diamond and Tim Flannery. However, these researchers, as with most others, focussed largely on terrestrial vertebrate diversity, and with the exception of some insect groups, much work still remains to be undertaken on invertebrate animal diversity especially freshwater aquatic species.

In Australia, the collections of John Gilbert, who collected for John Gould and joined Ludwig Leichhardt‟s expedition to cross northern Australian, are especially noteworthy. He obtained the first specimens of Cherax to be described by Gray as

Cherax quinquecarinatus and Cherax bicarinatus. The latter being the first species of crayfish to be recorded from tropical Australia or New Guinea with a type locality of

Port Essington, an ill-fated early attempt to establish a settlement by the British in what is now the Northern Territory (Leichhardt 1847; Gray 1845).

The best known early explorations of biodiversity in the Indonesian region were conducted by the remarkable naturalist Alfred Russel Wallace (1823-1913). He travelled and collected intensively in the region including Papua in the period of 1854-

1862. He developed his own conceptualisation of the theory of evolution by natural selection in his famous letter from “Ternate” (1958) and the Wallace line concept on the basis of his collecting and observations, which divides the animal diversity within

Indonesia into two very distinctive biogeographic groups. One group, the Indo-Oriental fauna is more related to Asian animal taxa and the Indo-Australian group is more related to the Australian fauna (Wallace 1869). His work in the region represents the first systematic and considered study of animal and plant distributions, a field we now call biogeography. Thus, based on his pioneering methods and insights he is often referred to as the „Father of Biogeography‟. In total Wallace collected about 125,000 specimens of plants and animals in his explorations of the Malay Archipelago but he

3 made no contribution to the understanding of the biodiversity or biogeography of aquatic species in his collections or writings.

The most significant exploration of aquatic biodiversity in New Guinea was from the results of the Dutch New Guinea Expedition lead by Boschma in 1939.

Freshwater decapods collected on this expedition were studied by the eminent Dutch carcinologist Lipke B. Holthuis. Supplemented from his own collecting expeditions

(1954-1955) to eastern Indonesia to what is now known as Papua, Holthuis described almost all the known species of New Guinea freshwater crayfish (Holthuis 1949;

Holthuis 1950; Holthuis 1986 and Holthuis 1996). His most intensive collecting was in the Wissel Lakes region in the central highlands and the 8 species of Cherax he described from this cluster of interconnected lakes and surrounding drainage system represent at level of local diversity that is unprecedented for freshwater crayfish globally.

Based on his detailed knowledge of the freshwater decapods of the region,

Holthuis not only made important contributions to our knowledge of the diversity of tropical freshwater crayfish but also to the biogeography of the region, stating that freshwater crayfishes are ideal animals for zoogeographical studies because their distributions show logical geographic patterns due to their low vagility (Holthuis 1986).

The distribution of Cherax in New Guinea is clearly demarcated by the central dividing range with all species restricted to southern New Guinea. For Holthuis this was decisive in linking the origin of New Guinea‟s freshwater crayfish to the Australian fauna

(Holthuis 1958). We now know that this biogeographic relationship is understandable in the context of the tectonic history of southern New Guinea and Australia and the formation of the ancient continent of Sahul, a single land mass comprising New Guinea, mainland Australia and Tasmania that resulted from the collision of the Australian

4 continental plate with the islands to be become New Guinea and its subsequent emergence several times during the Pleistocene at periods of lowered sea levels (Voris

2000).

1.2. Evolutionary History of Freshwater Crayfish

Freshwater crayfishes are widely spread throughout the world with the exception of the African mainland, the Indian sub-continent, Antarctica and the northern parts of central Asia (Figure 1.1). It is thought that freshwater crayfish evolved from a marine ancestor, which invaded freshwater habitats on the ancient continent of Pangaea. The hypothesis is consistent with phylogenetic analyses (Crandall et al. 2000a) and the age of crayfish fossil evidence from northern America (Hasiotis & Mitchell 1993),

Antarctica (Babcock et al. 1998) and Australia (Martin et al. 2008).

The fossil records, morphological and molecular studies of Jamieson (1991),

Scholtz (1993), Crandall et al. (2000a), Crandall et al. (2000b), and Porter et al. (2005) support the hypothesis of Ortmann (1902) that freshwater crayfish are monophyletic.

This result rejects the previous hypothesis of Huxley (1880) who thought that there may have been two separate freshwater crayfish invasions based on the two present centres of diversity in the northern hemisphere (south-eastern United States) and the southern hemisphere (south-eastern Australia).

Within the northern hemisphere the study by Crandall et al. (2000b) suggests that neither the Astacidae nor the Cambaridae are monophyletic, with the East Asian cambarids (genus Cambaroides) being more closely related to the astacids than to the

North American cambarid crayfish. The relationship among the parastacoidean (Family

Parastacidae) genera, restricted to the southern hemisphere continental landmasses of

Australia and South America and the islands of Madagascar, New Guinea and New

Zealand, have been the subject of a number of studies focussed at a range of taxonomic levels and geographic scales using a variety of kinds of data. These studies are reviewed in detail below.

1.2.1. Family Parastacidae

The Parastacidae is the single family of the Superfamily Parastacoidea established by Huxley (1878) and is now considered to be represented by 15 genera

(Riek 1969; Riek 1972; Hansen & Richardson 2006) although a recent study by Schultz et al. (2009) suggested that the highly divergent Engaeus lyelli, warrants recognition as a new genus. Of the 15 formally recognised genera, 9 are found in Australia, 3 in South

America and one in each of Madagascar, New Zealand, and Australia and New Guinea

(Table 1.1).

Table 1.1 The recognised genera of the Parastacidae

Approximate Genus number of Country Recent and key taxonomic References species Astacopsis 3 Australia Hamr 1992; Horwitz 1994; Sinclair et al. 2004, Sinclair et al. 2011

Cherax 45 Australia, Riek 1969; Holthuis 1949; Holthuis 1950; Indonesia Holthuis, 1996; Munasinghe et al. 2003, (Papua), Papua 2004a, 2004b; Lukhaup & Pekny (2006 New Guinea &2008); Lukhaup & Herbert 2008

Euastacus 50 Australia Morgan 1986, 1988, 1989, 1991, 1997; Shull et al. 2005; Coughran and McCormack 2011

Engaeus 35 Australia Horwitz 1990; Schultz et al. 2007; 2009 Engaewa 5 Australia Horwitz 1995; Schultz et al. 2009 Tenuibranchiurus 1 Australia Riek 1969; Schultz et al. 2009 Geocharax 2 Australia Riek 1969; Schultz et al. 2007; 2009 Gramastacus 1 Australia Riek 1972; Schultz et al. 2007; 2009 Ombrastacoides 11 Australia Hansen and Richardson 2006 Spinastacoides 3 Australia Hansen and Richardson 2006 Paranephrops 2 New Zealand Hopkins 1970; Apte et al. 2007 Astacoides 6 Madagascar Hobbs 1987; Toon et al. 2010 Virilastacus 3 South America Crandall et al. 2000b; Rudolph and Crandall 2007; Toon et al. 2010

Parastacus 8 South America Hobbs 1989; Crandall et al. 2000b; Toon et al. 2010 Samastacus 2 South America Riek 1971; Crandall et al. 2000b; Toon et al. 2010

The family has its greatest species (177) and generic level (10) diversity in

Australia and New Guinea (156 species). Across this region several centres of diversity can be identified, viz. the south-western of Western Australia, central and south eastern

Australia, and northern Australia and southern New Guinea (Indonesian provinces of

Papua and West Papua and south-western Papua New Guinea). The extreme south east of Australia, consisting of the states of Victoria and Tasmania has by far the highest diversity at both the generic and species levels (Riek, 1972; Crandall et al. 1999;

Schultz et al. 2009; Toon et al. 2010).

The Parastacidae is highly diverse, both morphologically and ecologically, in comparison to the northern hemisphere crayfish. The largest crayfish species in the world is Astacopsis gouldi, which inhabits streams and rivers in northern Tasmania. The highly evolved freshwater crayfish of the genera Engaeus and Engaewa, can complete their life cycle underground (Riek 1969; Suter 1977a; Suter 1977b; Horwitz &

Richardson 1986; Horwitz 1988; Horwitz 1990b; Horwitz & Adams 2000). Members of the genus Cherax are known for their tolerance of poor water quality, higher temperatures and brackish water, which is thought to have contributed to their wide distribution (Morissey 1978; Mills and Geddes 1980; Bryant & Papas 2007; Williams

1981; and Williams & Allen 1987).

Australian freshwater crayfish diversity is dominated by three speciose genera:

Cherax (smooth crayfish), Euastacus (spiny crayfish) and Engaeus (land crayfish). The most geographically widespread of these genera is Cherax, which has an extensive distribution in Australia and also extends into southern New Guinea including the

Misool and Aru Islands (Figure 1.2). The other genera with a more limited number of species distributions within the Parastacidae are: Engaewa, Tenuibranchiurus,

Geocharax, Gramastacus, Astacopsis, Ombrastacoides, and Spinastacoides (Australia);

Paranephrops (New Zealand); Astacoides (Madagascar); Virilastacus, Parastacus and

Samastacus (South America) (Riek 1969; Hobbs 1988; Hobbs 1991; Horwitz & Austin

1995a; Crandall et al. 1999; Richardson et al. 2006; Hansen & Richardson 2002;

Hansen & Richardson 2006).

There have been a number of molecular genetic studies of parastacid crayfish genera using a range of data sets and taxon sampling (Crandall et al. 1995; Crandall et al. 1999; Munasinghe et al. 2004a and 2004b; Shull et al. 2005; Schultz et al. 2009; and

Toon et al. 2010). The most recent of these is by Toon et al. (2010), who rejects a

8 biogeographic hypothesis of geographically-based speciation and evolution within the family. Toon et al‟s study along with others (Schultz et al. 2007, 2009; Crandall et al.

1999) provides support for monophyly of all parastacid genera with the exception of

Engaeus with respect to E. Lyelli (Schultz et al. 2009). All phylogenetic studies of

Cherax have consistently recovered representatives of the genus as monophyletic and sister to a clade containing Gramastacus, Geocharax, Engaeus, Engaewa and

Tenuibranchiurus (Crandall et al. 1999; Schultz et al. 2009; Toon et al. 2010). While relationships among the more closely related genera are better understood, the deep branches of the parastacid evolutionary tree still require further study to resolve a number of uncertain relationships (Toon et al. 2010).

Figure 1.2. Native distribution of freshwater crayfish of the Genus Cherax in Australia and New Guinea (after Schultz et al. 2009 with modification)

1.2.2. Genus Cherax

The first two species of Cherax were described by Gray (1845) and placed in the

Genus Astacus based on specimens collected from the southwest (Cherax quinquecarinatus (Gray)) and north of Australia (Cherax bicarinatus (Gray)). Cherax

9 was first proposed as subgenus of Astacus by Erichson (1846) based on a specimen from the southwest of Western Australia (Cherax preissii Erichson). However, there was uncertainty over the spelling of Cherax for several years after the publication of

Erichson (1846). Erichson himself used both Cherax and Cheraps in the same publication. Since Erichson (1846) a number of authors have applied a range of alternative generic designation or spellings to one or more species now included in the genus. In chronological order these are: Astacoides (Hess 1865), Chaeraps (Huxley

1878), Astacopsis (Haswell 1882), Astaconephrops (Nobili 1899), Parachaeraps (Smith

1912), and Paracheraps (Baer 1945). Since Riek‟s publications (Riek 1967, 1969,

1972) there has been no dispute regarding the nomenclature or generic level concept for

Cherax.

In the most recent taxonomic treatments of the genus Cherax, most new species have been described from northern Australia, Papua (eastern Indonesia) and Papua New

Guinea. Over the last two decades four species have been described from Indonesia

(Papua and Papua Barat) and Papua New Guinea (Holthuis 1996; Lukhaup & Pekny

2006; Lukhaup & Pekny 2008; Lukhaup & Herbert 2008) and three species from northern Australia (Short 1991; 1993; Short & Davie 1993). These more recently described species brings the total of described species from Northern Australia and New

Guinea to 26, which mean that northern Australia and New Guinea should now be considered the centre of diversity for Cherax rather than southern or eastern Australia

(Toon et al. 2010).

External morphological character analysis is still the predominant method used by taxonomists to delineate and describe species of freshwater crayfish including

Cherax and related Australian genera (e.g. Riek 1969; Holthuis 1949; Hobbs 1974;

Horwitz 1990a; Holthuis 1996; Coughran 2005a and 2005b; Hansen & Richardson

2006; Lukhaup & Pekny 2006; Lukhaup & Pekny 2008; and Lukhaup & Herbert 2008).

Morphological variation associated with the rostrum, antennal scale, chelae, carapace, eye size, body shape and sternal keel are commonly used to distinguish and identify species of Cherax (Riek 1969; Holthuis 1949; Holthuis 1950; Holthuis 1996; Lukhaup

& Herbert 2008; Austin & Ryan, 2002). For Australian Cherax, the most substantial morphologically-based taxonomic reviews, including descriptions of new species and keys to most Australian species are by Riek (1951; 1956; 1967; 1969; and 1972).

Whereas for New Guinean Cherax most species descriptions and keys are given by

Holthuis (1949; 1950; and 1996). Both of these treatments need revision as a result of more recently discovered species, suggested synonymies and because, with the exception of Clark (1936), there have been no taxonomic studies that have considered

Cherax species from the two regions jointly, despite the close biogeographic relationships between New Guinea and northern Australia. There is now the need for revised species descriptions and comprehensive taxonomic keys for all species within the genus.

Morphologically-based taxonomies are increasing being supplemented with, or tested using molecular data sets to better understand taxonomic boundaries and phylogenetic relationships (Crandall et al. 1999; 2000a; Austin & Ryan 2002;

Munasinghe et al. 2003; 2004a; 2004b; Austin et al. 2003; Rudolph & Crandall 2007;

Schultz et al. 2007; 2009; Toon et al. 2010). In fact a number of studies have demonstrated that reliance on morphological data alone can be misleading for defining species boundaries and establishing evolutionary relationships in both Cherax and other parastacid crayfishes (e.g. Austin 1996; Austin & Ryan 2002; Munasinghe et al. 2004b;

Schultz et al. 2009).

An increasing number of taxonomic-related investigations of Cherax over more recent years have substantially relied on molecular data (Austin 1996; Austin & Knott

1996; Crandall et al. 2000a; Austin & Ryan 2002; Austin et al. 2003; Munasinghe et al.

2003; 2004a; 2004b) and have provided important new information on species boundaries and the evolutionary history and biogeography of the genus. However, to date, very few of the northern Australian and New Guinea representatives of the genus have been included in molecular genetic and evolutionary studies (Munasinghe et al.

2004b; Toon et al. 2010). Given that the molecular systematics of Cherax in southern and eastern Australia have been relatively well studied, the high diversity of species in northern Australia and New Guinea there is a clear need for this deficiency to be addressed, specifically for northern Cherax species including New Guinean species, to allow a complete systematic treatment of Cherax throughout its distribution and to address important and interesting question relating to the evolution and biogeography of the genus.

Molecular genetic studies to date support the existence of three geographically correlated lineages within Cherax comprising a south western, an eastern and a northern lineage. While the former 2 lineages are well established with comprehensive taxon sampling, the northern lineages has only been represented by very modest sampling and

DNA sequences have only been published for one endemic New Guinea species

(Munasinge et al. 2004b). While the support for the three major lineages within Cherax is strong, the relationships among them are inconsistent and unresolved (Munasinghe et al. 2004b; Schultz et al. 2009). Nevertheless, there is strong support for endemic and regionalised patterns of speciation in Cherax and local adaptation to a variety of habitats leading to a high degree of morphological divergence among related species at a local

12 or regional level, which includes habitat related convergent evolution within and among regions (Austin and Knott 1996; Austin 1996; Munasinge et al. 2003; 2004a).

1.2.3. Northern Australian Cherax

Based on classical morphology-based treatments, Riek (1969) recognised 19 species of Cherax from northern and eastern Australia. Nine of these species are found exclusively in northern Australia (north of the Tropic of Capricorn). These studies have been revised by Austin (1996) who re-examined Cherax species from northern and eastern Australia using both electrophoretic and morphological characters and found support for only 4 of Riek‟s 9 species. Three new species of Cherax from northern

Australia and not studied by Austin (1996) were described by Short (1991, 1993) and

Short & Davie (1993).

The molecular systematics of several Cherax species were further examined by

Munasinghe et al. (2004b) using DNA nucleotide data, however they only examined two species from northern Australia (C. quadricarinatus and C. rhynchotus) and an undescribed species from Papua New Guinea. Baker et al. (2008) undertook a population genetic study of Cherax quadricarinatus from northern Australia and southern Papua New Guinea. They concluded that C. quadricarinatus comprised two species in Australia and applied the name C. bicarinatus to a form from the Northern

Territory, following Riek‟s (1969) nomenclature.

A summary of the taxonomic treatments and conclusions of Riek (1969), Austin

(1996), Munasinghe et al. (2004b) and Baker et al. (2008) is given in Table 1.2, together with the three new species recently described by Short (1991, 1993) and Short & Davie

(1993) from northern Australia. In total, there are nine species of Cherax currently recognised in northern Australia, of which five species have been included in molecular

13 genetic studies (C. cairnsensis, C. quadricarinatus, C. bicarinatus, C. rynchotus and C. parvus).

Table 1.2 A summary of studies on the northern Australia species of Cherax and new classifications where relevant essentially after Riek (1969), Short (1991, 1993), Short & Davie (1993), Austin (1996), Munasinghe et al. (2004b), and Baker et al. (2008)

After Short After (1991, 1993), After Austin After Baker et al. After Riek (1969) Munasinghe et al. and Short & (1996) (2008) (2004b) Davie (1993) C. bicarinatus - C. quadricarinatus C. quadricarinatus C. bicarinatus C. barretti - - - - C. quadricarinatus - C. quadricarinatus C. quadricarinatus C. quadricarinatus C. rhynchotus - C. rhynchotus C. rhynchotus - C. wasselli - C. wasselli - - C. cairnsensis - C. cairnsensis C. cairnsensis - - C. cartalacoolah - - - - C. nucifraga - - - - C. parvus - - -

1.2.4. New Guinean Cherax

New Guinean species of Cherax are only found in southern New Guinea, including most of southern Papua, Misool Island and Aru Island (Indonesia) and the southwest of Papua New Guinea. This distribution largely correlates with the leading edge of the Australian tectonic plate, which collided with the Asian tectonic plate forming New Guinea region about 5-15 million years ago (Jennings 1972; Holthuis

1986; Voris 2000; Heinsohn 2011). There are no Cherax species found in the Malay

Archipelago beyond the western edge of the Australian-New Guinean continental slope boundary (Holthuis 1958) or north of the New Guinean central mountain range other than by deliberate translocation.

Our knowledge of the diversity of New Guinean Cherax species commenced with the descriptions of species by Von Martens (1868), Nobili (1899), Calman (1911),

Roux (1911), Smith (1912) and the seminal papers by Holthuis (1949; 1950; 1982;

1986; 1996); more recently, single species descriptions by Lukhaup & Pekny (2006,

2008) and Lukhaup & Herbert (2008) bringing the total number of New Guinean

Cherax to 18 species and 1 subspecies (Table 1.3). Tabel 1.3. The classifications of the southern New Guinea species of Cherax essentially after Von Martens (1868); Nobili (1899); Calman (1911); Roux (1911); Smith (1912); Clark (1936); Holthuis (1949; 1950; 1996); Lukhaup & Pekny (2006, 2008); and Lukhaup & Herbert (2008)

After Calman (1911), After Von Martens (1868), Nobili (1899), After Lukhaup &Pekny (2006; 2008), and Smith (1912), Clark After Holthuis (1949;1950; 1996) Calman (1911), Roux (1911) Lukhaup & Herbert (2008) (1936)

Astacus quadricarinatus (Von Martens 1868) Cherax quadricarinatus C. (A) quadricarinatus - Astaconephrops albertisii (Nobili 1899) Cherax quadricarinatus C. (A) albertisii - Cheraps aruanus (Roux 1911) Cherax quadricarinatus C. (A) lorentzi - Cheraps lorentzi (Roux 1911) Cherax quadricarinatus C. (A) lorentzi aruanus - - - C. (A) misolicus Holthuis 1949 - - - C. (C) papuanus Holthuis 1949 - - - C. (C) pallidus Holthuis 1949 - - - C. (C) murido Holthuis 1949 - - - C. (C) buitendijkae Holthuis 1949 - - - C. (C) longipes Holthuis 1949 - - - C. (C) communis Holthuis 1949 - - - C. (C) boschmai Holthuis 1949 - - - C. (C) paniaicus Holthuis 1949 - - - C. (C) solus Holthuis 1949 - - - C. (C) divergens Holthuis 1950 - - - C. (A) monticola Holthuis 1950 - - - C. (A) minor Holthuis 1996 - - - - C. (C) holthuisi Lukhaup & Pekny 2006 - - - C. (A) boesemani Lukhaup & Pekny 2008 - - - C. (C) peknyi Lukhaup & Herbert 2008

15 16

Of special significance is the extraordinary diversity and morphological divergence of the Wissel Lakes crayfish fauna from the Papuan highlands (Figure 1.3).

According to Holthuis (1949), the complex of Wissel Lakes are inhabited by eight species of freshwater crayfish of the genus Cherax. Six species are known from Lake

Paniai i.e. C. communis, C. murido, C. pallidus, C. buitendijkae, C. boschmai, and C. paniaicus and three species from Lake Tigi i.e. C. communis, C. longipes, and C. solus.

No species were recorded from Lake Tage, the third lake in the Wissel Lakes complex.

Each species is endemic to a single lake with the exception of C. communis which occurs in both lakes and nearby rivers. This level of intra-generic local diversity and endemism is unprecedented for crayfish anywhere in the world.

Figure 1.3. Morphological variation of eight species of Wissel Lakes Cherax. Upper, left to right: C. paniaicus, C. pallidus, C. communis, C. boschmai. Lower, left to right: C. longipes, C. buitendijkae, C. murido, C. solus (Austin collection and after Holthuis 1949) 17

Holthuis (1949; 1950; and 1996) divided the New Guinean Cherax into two subgenera distinguished largely on the basis of the rostral and median carinae and the possession of decalcified areas on the ventral margin of the propodal palm of the chelae in adult males. The two subgenera: „Astaconephrops’ (well developed rostral, and postorbital carinae and presence of decalcified area) and „Cherax’ (reduced or absence of rostral, median and post post-orbital carinae or very little developed and absence of decalcified area) groups have not been subsequently used for the classification of

Cherax species outside of New Guinea, although recently Lukhaup & Pekny (2006),

Lukhaup & Pekny (2008), Lukhaup & Herbert (2008) have revived the use of the subgenus designation for their descriptions of three new New Guinean Cherax species.

Two of these species, C. holthuisi and C. peknyi, are placed in the subgenus Cherax and one species, C. boesemani, in the subgenus Astaconephrops.

This treatment of species groupings and use of subgenus designations contrasts with Riek (1969) who divided Australian Cherax into five groups based on a qualitative assessment of morphological relationships. There has been no effort to reconcile these contrasting treatments and it is noteworthy that Munasinghe et al. (2004b) rejected

Riek‟s species groups in favour of a pattern of regional speciation and a model of convergent morphological evolution. These different approaches to the establishment of relationships within the New Guinean and Australian Cherax and the significance of the morphological features distinguishing the Cherax and Astaconephrops subgenera, such as the presence and absence of the uncalcified patch on the claws of male crayfish, would clearly benefit by being placed within a phylogenetic framework using DNA sequence (molecular) data. 18

1.3. Molecular Systematics

It is now widely agreed that taxonomic classifications should reflect evolutionary history to ensure consistency and stability in taxonomy (Hillis et al. 1996;

Mayr 2000; Mayr & Bock 2002). Nevertheless there is still disagreement on how this goal should be achieved (De Quiros & Gauthier 1990; Hillis et al. 1996; Mayr 2000;

Schuh 2000; Mayr & Bock 2002). Generally it is now not considered sufficient to build a taxonomic classification based only on a study of morphological characteristics due to difficulties in interpreting and coding morphological traits and the lack of a known direct genetic basis to character variation. Nowadays, molecular genetic data are considered a fundamental requirement for reviewing and constructing taxonomic classifications and investigating evolutionary and biogeographic relationships.

Systematists have also increasingly been able to access nucleotide data as costs have decreased and the methods become routine (Hillis et al. 1996; Page & Holmes 1998).

The genus Cherax has been found to be a taxonomically „complex‟ taxon based on the high degree of variation of morphological and taxonomic characters (Austin

1996). The understanding of taxonomic boundaries and systematic relationships has been greatly aided by the use of molecular genetic data (Austin & Knott 1996;

Munasinghe et al. 2004b). This has led to the identification of cryptic species and recommended synonymy of a number of species of Cherax (Austin 1996; Austin &

Ryan 2002; Austin et al. 2003).

Other parastacid genera that also have also benefitted from a molecular approach are Euastacus, Geocharax and Engaeus. Using combined data of mitochondrial (16S,

COI and 12S) and nuclear genes (28S), Shull et al. (2005) found that all Euastacus species are monophyletic except two species viz. E. fleckeri and E. robertsi and supported the recognition of at least one new species. Schultz et al (2007; 2009) tested 19 taxonomic and phylogenetic relationship among Engaeus, Engaewa, Geocharax,

Gramastacus and Tenuibranchiurus using data from the 16S and GAPDH genes. While monophyly of most genera was supported, the species E. lyelli was sufficiently divergent to warrant placement in a separate genus and cryptic species were apparent within Geocharax, Gramastacus and E. lyelli. It was also found that a molecular phylogenetic approach was critical to understanding the dispersal history of species and biogeographic relationships (Shull et al. 2005; Munasinghe et al. 2004b; Nguyen et al.

2004; Ponniah & Hughes 2006; and Schultz et al. 2009).

The value of molecular data in defining species boundaries, uncovering cryptic diversity and establishing reliable phylogenies is now well established in zoology and has already been used for many groups of freshwater crayfish from the southern and northern hemispheres (Crandall et al. 1999; Munasinghe et al. 2003; Munasinghe et al.

2004b; Shull et al. 2005; Schultz et al. 2009; Braband et al. 2006; Buhay et al. 2007;

Crandall et al. 2000a; Crandall et al. 2000b; Rudolph & Crandall 2007; Grandjean et al.

2000; Trontelj et al. 2005; Fratini et al. 2005; Sinclair et al. 2004; Toon et al. 2010).

1.3.1. DNA sequencing

Polymerase chain reaction (PCR) and DNA sequencing based on the Sanger method are now routine methods in molecular biology and it is now feasible to obtain sequences for multiple genes without major technical or cost limitations (Hillis et al.

1996; Crandall et al. 1999). Nucleotide sequences have a number of advantages for establishing and testing evolutionary relationship and monophyly of taxonomic groups compared with morphological and other phenotypic and molecular characters (Hillis et al. 1996).

DNA data can be used to infer phylogenetic relationship among samples with a high degree of confidence. Nevertheless there have been a range of controversies in 20 relation to methods of data analysis and the best sampling strategies (e.g. is it better to maximise taxon sampling or to maximise character sampling) (Hillis 1998; Wiens 2005;

Hillis et al. 2003; Hedtke et al. 2006). Some claim it is better to increase the numbers of taxa in the analysis to ensure phylogenetic accuracy (Hillis 1996; Hillis 1998; Graybeal

1998; Swofford et al. 1996; Zwickl & Hillis 2002; Rosenberg & Kumar 2003; Wiens

2005). Others opine it is more efficient and reliable to use fewer taxa to reduce inconsistent branches and increasing sequence length (Kim 1996; Graur et al. 1996;

Rosenberg & Kumar 2001; 2003). Taxonomic sampling can have important consequences for phylogenetic analysis but how to best sample taxa to estimate relationships within the tree of life is yet to be determined and depends on the particular situation being examined (Hillis 1998; Hillis et al. 2003). A directed strategy of adding taxa to a phylogenetic analysis is found to be one of the most profitable uses of time and resources (Hillis 1998; Pollock et al. 2002).

Another contentious area of molecular systematics is how to convert a well supported phylogeny into a classification (Schuh 2000; Mayr and Bock 2002; Page &

Holmes 1998). This latter problem is influenced by several factors such as taxonomic philosophy and the complexity of relationship between gene trees and species trees

(Mayr 1969; Page & Holmes 1998; Schuh 2000). Mayr (1969) indicated that consideration should be given to factors including distinctiveness, evolutionary role, degree of difference, size of taxon, and equivalence of ranking in related taxa to which can be added the necessity that any defined taxonomic group is also monophyletic

(Schuh 2000).

1.3.2. Choices of molecular markers for phylogenetic inference

The molecular marker most commonly used for freshwater crayfish phylogenetic studies has been from the mitochondrial 16S rRNA gene (Crandall et al.

1995; Crandall & Fitzpatrick 1996; Lawler & Crandall 1998; Ponniah & Hughes 1998;

Munasinghe et al. 2004b; Baker et al. 2008; Schultz et al. 2009). The first study using this gene region was by Crandall et al. (1995) and several researchers have adopted his approach using the 16S gene region (e.g. Nguyen et al. 2002a; Munasinghe et al. 2003;

2004a; 2004b; Schultz et al. 2007; 2008; 2009). Although the 16S gene region has been shown to have wide utility for freshwater crayfishes and other organisms, additional gene regions have now been used for phylogenetic and population studies of freshwater crayfish (Munasinghe et al. 2003; Nguyen et al. 2002a, Shull et al. 2005; Schultz et al.

2007; 2009; Toon et al. 2010).

The advantage of using a range of gene regions is that not only does it increase the character sampling (nucleotides), but as different gene regions usually differ in evolutionary rate, this increases the reliability of phylogeny estimated throughout the tree (Hillis et al. 1996). Several additional mitochondrial gene regions that have already been tested for freshwater crayfishes include 12S rRNA, Cytochrome b (Cyt b),

Cytochrome Oxidase I (COI), Cytochrome Oxidase III (COIII), ATPase6/8 from mitochondrial DNA (Nguyen et al. 2002a; Munasinghe et al. 2003; 2004a; 2004b;

Nguyen & Austin 2005; Shull et al. 2005). Other nuclear gene regions include

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 18S and 28S have also been successfully used for phylogenetic studies of a number of freshwater crayfish (Crandall et al. 2000; Munasinghe 2003; Schultz et al. 2009; Toon et al. 2010). The 16S rRNA has been found to be the least variable amongst the six mitochondrial genes and ATP6/8 the most variable amongst the mitochondrial gene regions (Nguyen & Austin 2005).

Cyt-b is also variable but inconsistent and is subject to nuclear translocations and therefore should be avoided (Nguyen et al. 2002b). Phylogenetic analysis of the 16S rRNA, 12S rRNA and COI gene fragments have been shown to generated consistent

22 and reliable results for Cherax species (Munasinghe et al. 2003; Nguyen & Austin

2005). The 18S rRNA and 28S rRNA have also been found valuable for freshwater crayfish studies at deeper evolutionary levels (Crandall et al. 2000a; Toon et al. 2010).

More recently the nuclear gene GAPDH was found to be useful for determining relationship in phylogenetic studies of the Genus Engaeus, Engaewa, Geocharax,

Gramastacus and Tenuibranchiurus (Schultz et al. 2009).

Another reason for using sequence information from more than one gene region is the problem that estimating gene trees may not always be a good proxy for inferring species trees (Moritz & Hillis 1996; Page & Holmes 1998). This problem occurs when ancestral alleles or haplotypes persist through speciation events and then become fixed in different species although it is less likely for mitochondrial genes than nuclear genes

(Page & Holmes 1998). Sampling more than one mitochondrial gene does not overcome this difficulty because of the non-recombining nature of this organelle‟s genome

(Maddison 1997; Page & Holmes 1998).

Another problem that can confound molecular phylogenetic analysis is gene duplication. This can happen for not only nuclear genes but also for mtDNA genes when translocated to the nuclear genome and these mitochondrial like genes (numts) are being found in increasing numbers of organisms (Zhang & Hewitt 1996; Bensasson et al. 2001; Schizas 2012) including crustaceans (Bucklin et al. 1999; Williams &

Knowton 2001; Nguyen et al. 2002b; Munasinghe et al. 2003; Song et al. 2008).

1.3.3. Phylogenetics

Phylogenetic analysis aims to reconstruct evolutionary relationships amongst organisms. The ready availability of DNA nucleotide sequencing has meant that the most common approach to phylogeny reconstruction uses this kind of data. However 23 access to nucleotide information still requires a number of important considerations in order to ensure that reliable and robust phylogenetic hypotheses are generated.

Some of the more important considerations include: choice of gene regions, the sampling strategy (e.g. taxon sampling versus gene sampling), alignment methods, models of evolution, tree reconstruction procedures, evaluation of trees and methods, choice of outgroups and the use of molecular clocks (Hillis et al. 1996; Felsenstein

2004; Barton et al. 2007; Hall 2011). The most important step is the choice of method of phylogenetic reconstruction and this can be controversial as many different methods have been developed over the years including distance-based, maximum parsimony, maximum likelihood and Bayesian methods. Each approach has their own strength and weakness and the choice of method can depend on a number of factors including taxonomic philosophy and the dimensions of the data set (Page & Holmes 1998;

Crandall et al. 1999; Barton et al. 2007; Hall 2011).

The first relatively comprehensive study of phylogenetic relationshipof Cherax was by Riek (1969) who established species groups based on a qualitative analysis of morphology and habitat preferences (Fig.1.4.A). Austin (1995) undertook a preliminary phylogenetic analysis of Cherax relationship based on morphology and allozyme data

(Fig.1.4.B) and in contrast, proposed a model of endemic speciation and convergent morphological evolution between geographical regions. Austin‟s study was then extended and tested by Munasinghe et al. (2004b) who investigated the biogeographical relationships of Cherax throughout Australia based on nucleotide data consisting of two genes, 12S rRNA and 16S rRNA (Fig.1.4.C). Munasinghe et al. (2004b)‟s study also strongly supported the model of endemic speciation for Cherax across its wide distribution in Australia. Schultz et al. (2009) also included a number of Cherax species in their study, which incorporated sequences from the nuclear gene GAPDH and which

24 also recovered the same three geographically-based lineages recovered by Austin

(1995) and Munasinghe et al. (2004b).

(A) (B)

(C)

Figure 1.4. Hypotheses proposed by (A) Riek (1969), (B) Austin (1995), and (C) Munasinghe et al. (2004b) for the phylogenetic relationship within Genus Cherax. 25

1.4. Geological History of Northern Australia and New Guinea Region

The biological relationships among taxa from the Indonesian islands, Australia and Papua New Guinea reflect their contrasting geological histories and associations.

These three countries have special and complex relationships in term of their animal and plant diversity as together they represent a zone of merger between 2 of the most distinct biotas on earth (Crisp et al. 1995; Williams et al. 2001; Heinsohn 2011).

Geologically, Indonesia was formed by the collision of two large tectonic plates

(Figure 1.5) representing the Sunda Shelf (Eurasian Plate) and Sahul Shelf (Indian-

Australian Plate) together with the added complexity of tectonic elements contributed from Australia (e.g. south eastern part of Sulawesi) (Voris 2000; Hall 2002). New

Guinea is a composite of several tectonic elements including the southern part, which forms part of the Australian tectonic plate. While Australia is current separated from

New Guinea by the Arafura and Timor seas, these are shallow water bodies, and the two land masses have been connected by land over the last 500,000 years and as recently as the Pleistocene. Based on the Pleistocene maps of South East Asia proposed by Voris

(2000), sea levels were at their minima (maximum lows) for relatively short periods of time and this is very likely to be an important factor in limiting the dispersal of animals of the region.

Figure 1.5. Principal geographic features of the region covered in South East Asia reconstruction. The light shade areas are the continental shelves of Eurasia and Australia drawn at the 200 m isobath (Hall 2002)

Crisp et al. (1995) found there were at least two independent histories for taxa endemic to the tropics in relation to New Guinea and Australia. One appears as a close relationship among the monsoons tropical areas, including southern New Guinea, and the other is a track (a group of areas with a common biological history) of successive differentiation along the east and south coasts. The Australian wet tropics (the Atherton area), although geographically adjacent to the monsoon tropics, is part of the east coast track. Crisp et al. (1995) considered plants but not animals in their study.

1.4.1. Fluctuation of the sea levels and ancient river systems

Information on geological history and terrains of the Indo-Australian region during periods of the Pleistocene when sea levels were below present day is provided by

Voris (2000). Voris developed a series of maps showing the effects of the fluctuations of sea level during Pleistocene times. During lowered sea levels, existing drainage 27 systems developed into a number of ancient river systems on both the Sunda and Sahul shelves that would have connected freshwater faunas that are now isolated and fragmented. One of Voris‟ (2000) maps (Figure 1.6.), showed major river systems and the massive freshwater Lake Carpentaria, that was formerly situated in the current gulf of Carpentaria and would have connected river systems draining both northern

Australian and southern New Guinea.

Figure 1.6. Map of Pleistocene sea levels in south-east Asia and Austral-Asia. Light grey shading indicates -75 m sea level contour, dark lines show freshwater catchments at this time and (LC) Lake Carpentaria (Voris, 2000).

Lake Carpentaria is thought to have existed during quaternary low sea-level stands. While salinities are thought to have fluctuated in Lake Carpentaria during the

Pleistocene suggesting a complex estuarine embayment (Torgersen et al. 1983;

Torgersen et al. 1985; Torgersen et al. 1988; Voris 2000), studies by De Deckker et al.

(1988) support Lake Carpentaria as a freshwater lake based on Mg/Ca ratios inferred

28 from ostracod shell chemistry; thus, it is likely that the lake was fresh or slightly saline between 13,000 and 40,000 years ago.

Evidence of the ancient rivers is also provided by the shallow and narrow straits of the Aru Islands and there is good evidence to support the presence of Pleistocene rivers draining west from New Guinea to the edge of the Sahul Shelf (Umbgrove 1949;

Voris 2000). Even though rising sea level would have increased the salinity of low lying lakes, New Guinea has remained largely connected to Australia through the Torres

Straits while sea levels were 10 m below present levels (Jennings 1972; Bowler et al.

1976). Voris concluded that sea levels minima occured for relatively short periods of time but were at or below median levels for more than half of each of the time periods considered. These conditions were thought to be important factors in the dispersal of plant and animals, notably freshwater crayfishes (Holthuis 1958; Baker et al. 2008).

1.4.2. Climate and Geography of New Guinea and Australia

Australia and much of New Guinea were formed from the same tectonic plate.

Although they share the same geological history, they have contrasting climates relating to geographical position and topography of their respective region. New Guinea is an equatorial island, which is largely a northern extension of Australian continental plate

(Prentice & Hope 2007). In contrast, Australia is a continent centred at about latitude

30° south and lies directly to the south of the island of New Guinea (Steffen et al. 2009).

Together, New Guinea and Australia create a massive oceanic barrier, which prevent the surface water being transported from the western Pacific to Indian Oceans (Prentice &

Hope 2007).

New Guinea (comprising of most easterly Indonesian provinces and country of

Papua New Guinea) is known as the largest, highest, and wettest tropical island in the 29 world (Holthuis 1974; Hope 2007). A series of mountain chains shape the core of New

Guinea trending NW-SE alignment (Figure 1.7) and often exceed 3500 m (Menzies

2006; Hope 2007; Prentice & Hope 2007). This Central Range is 1300 km long, 150 km-wide belt with rugged topography and deeply incised valleys.

Typical of mountain ranges, orographic rain from the South East Trades and easterlies affects both sides of the ranges but some of the inter-montane valleys are drier and it is here that intensive agriculture occurs. At higher altitudes rainfall totals may level off but the tops are always cloudy and wet right to the highest peaks above 4,750 meters (Prentice & Hope 2007).

Figure 1.7. New Guinea topography showing wide range elevation of the region (http://en.wikipedia.org/wiki/File:New_Guinea_Topography.png).

In contrast, Australia is a flat continent, which has less than 5% of the land more than 600 m above sea level (asl) (Figure 1.8). Australia‟s highest mountain is less than

2,300 m and it only has three mountains over 2,000 m. This means that topographic barriers are not a significant impediment to species dispersal over most of Australia

(Steffen et al. 2009). Australia as a whole experiences very low average annual rainfall but among all the main regions, northern, and eastern Australia have slightly higher 30 annual rainfall but is usually highly seasonal or episodic (Steffen et al. 2009; Pusey

2011). The northern region has a tropic climate with two seasons the “dry” and the

“wet” (Warfe et al. 2011; Pusey 2011). The region is also characterised by a tropical climate that regulates the distinctive character of river flow regimes across the region.

There is marked hydrological seasonality, with most flow occurring over only a few months of the year during the summer wet season. Flow is also characterised by high variability between years, and in the degree of flow cessation, or intermittency, over the dry season (Warfe et al. 2011; Pusey 2011).

Figure 1.8. Areas of Australia above 600 m in elevation (red) (after Steffan et al. 2009).

The wet–dry tropics in northern Australia (Figure 1.9) stretch from Broome in the northwest of Western Australia, eastwards to the northeast Queensland coast excludes the wet tropics of eastern Australia, south of Cairns (Woinarski et al. 2007;

Warfe et al. 2011). Some areas (Kimberley, Arnhem Land and Cape York Peninsula) are generally of low topographical relief (under 400 m altitude). The wet–dry tropics of northern Australia encompasses a diversity of freshwater and coastal marine ecosystems including rivers, mangroves, salt-marsh flats, floodplain wetland complexes, ephemeral 31 waterbodies and upland groundwater-fed wetlands (Pusey & Kennard 2009). Some of

Australia‟s largest and most diverse wetlands occur in northern Australia, in Kakadu

National Park and Arafura Swamp (both east of Darwin, Northern Territory), and the

Southern Gulf region where several large rivers merge during major floods and vast areas are inundated (Pusey & Kennard 2009).

Figure 1.9. Region comprising the wet-dry tropics of northern Australia. Catchments drain into the Timor Sea, the Gulf of Carpentaria or the Coral Sea. Major townships are identified (black circles), as are catchments (labelled in white) mentioned in text. The dotted lines are lines of latitude (Warfe et al. 2011)

Temperature in both Australia and New Guinea also shows wide variation.

Some locations at lowland elevation (Darwin with 30 m asl) has air temperature between 16.4 - 35 °C and water temperature between 23 - 34.5 °C over the year with the humidity reaching 81% (www.bom.gov.au). It is slightly cooler in the Papua lowlands

(eg. Fakfak, West Papua and Merauke-Papua) with the air temperature between 20 - 32

°C and the humidity can reach between 84.4% - 92% (www.bmkg.go.id). In contrast in the highlands viz. Wamena, Enarotali, and some others location within the central 32 mountain range (more than 1000 m asl) the temperatures are significantly lower and the humidity higher. Water temperatures are mostly between 16-18°C, the air temperature between 14-24 °C and the humidity could reach 100% in the forest area but is mostly between 60-96% (www.bmkg.go.id; Holthuis 1974). Examples of the extreme temperature range that can be tolerated by Cherax species inhabiting the desert regions of Australia (e.g. Finke River) where air temperatures can range from below zero to 40

°C to the alpine regions of eastern Australia (e.g. Armidale-NSW, and Snowy River) where waters temperatures can be below 10 °C for extended periods.

New Guinea offers freshwater crayfish a far more rugose freshwater environment in comparison to Australia. The New Guinean freshwater habitats range from large permanent river systems, including almost continuous permanent swamps in lowlands to large lakes at high altitudes. While some of the savannah lowlands and coastal swamp environments are also duplicated in northern Australia (the Arafura

Swamp), the climate of Australia is highly seasonal and the topography has a very low relief with the exception of the Great Dividing Range which reaches a maximum altitude of just in excess of 2,200 m. The contrasts are most marked by comparing the topography and climate of northern Australia and New Guinea (Papua-Indonesia and

Papua New Guinea). While tropical northern Australia has a monsoon season, the climate is highly seasonal and annual rainfall rarely exceeds 3.0 m. In contrast, the highlands of New Guinea are one of the wettest places on earth, where rainfall exceeds

5.0 m in many places (Prentice & Hope 2007). One of the highest land forms in northern Australia, the Arnhem Plateau does not exceed 500 m, and in contrast the central mountain range of New Guinea is over 3,000 km in length and exceeds 4,500 m in altitude in several places and gives the island great topographical complexity. The highest parts of the central range still support glaciers and significant alpine meadows

(Gressitt 1981). Not surprisingly New Guinea is recognised as having a number of distinct freshwater and terrestrial ecoregions, where as northern Australia for a comparable area is recognised as having only one (Abell et al. 2008; Olson &

Dinerstein 2002; Figure 1.10).

Figure 1.10. Map of freshwater ecoregions. 805. Arafura-Carpentaria (pink); 812. Vogelkop- Bomberai (yellow); 813. New Guinea North Coast (blue); 814. New Guinea Central Mountains (white); 815. Soutwest New Guinea-Trans Fly lowland (green); and 816. New Guinea Peninsula (grey) (after Abell et al. 2008 with modification)

1.4.3. Freshwater Habitats of New Guinea and Northern Australia

Freshwater habitats exploited by freshwater crayfish include rivers, lakes, billabongs, wetlands, ponds, streams or creeks and their often semi-permanent drainages

(Riek 1969 and 1972; Williams 1981; Austin & Knott 1996). In Australia, the freshwater crayfish fauna is dominated by burrowing species that are able to survive in semi-permanent freshwater environments due to the prevalence of droughts and 34 seasonally hot and dry climates. Relatively few Australian species exploit large permanent freshwater bodies other than river systems because of the scarcity of large permanent freshwater lacustrine systems (Williams 1981).

In contrast, Cherax species as members of the only freshwater cayfish genus found in New Guinea were provided with the opportunity to adapt and exploit radically different, more abundant and more diverse freshwater environments to those in

Australia. These included highly pristine freshwater lakes and streams in cool subalpine environments and large and complex river systems in a highly dissected topography. As a result New Guinean has developed a highly distinctive suite of freshwater crayfish species especially in highland areas that include some of the least known and most remote in the world (Holthuis 1949; 1950; 1958; 1986).

Descriptions of some of the distinctive freshwater habitats, which are known to harbour freshwater crayfishes in New Guinea, are described below.

1.4.3.1. Ayamaru and Aitinjo Lakes

A description of Ayamaru and Aitinjo Lakes region (Figure 1.11.) was given by

Boeseman (1963) in his publication on the fishes of Western New Guinea. According to

Boeseman, the Ayamaru Lakes are actually widened parts of the west-east flowing

Ayamaru River, situated about in the centre of the Vogelkop Peninsula. From west to east the first lake, called Jow, has a length of 7 km and a width of 2 km; the second called Semitoe or Maroemega, a length of 2 km and width of 1.5 km; the third, Jate or

Hain a length of 3 km and a width of even not 1 km. The lakes are surrounded by a low marshy plain with various widths and beyond the plain, by hills and mountains reaching heights up to 1,500 meters, covered with forest. Several small streams enter the lakes, which have an altitude of about 250 meters above sea level with depth of rarely more than 3 meters. The water is clear and almost stagnant except near entering rivers and

35 outlets with pH approximately 6.4. A soft muddy bottom mostly covered with secondary vegetation consisting primarily of grasses and low shrubs. The whole complex belongs to Kais River drainage systems, which empties on the south-western coast of the peninsula into Seram Sea (Boeseman 1963; Lukhaup & Pekny 2008). Only one species of freshwater crayfish is currently known from the lakes, which is the recently described Cherax boesemani (Lukhaup & Pekny 2008).

Figure 1.11. Ayamaru and Aitinjo Lakes, West Papua, Indonesia. A. Ayamaru Lake complex (1. Jow; 2. Semitoe or Maroemega; 3. Jate or Hain.), B. Aitinjo Lake, C. Ayamaru River and D. Kais River

Aitinjo Lake, located on the south-east of Ayamaru Lake, is described by

Boeseman (1963) as follows: A widened river, flowing southeast with a length of 4 km and strongly varying width with a maximum of about 350 m. At the north-western, end the principal river widens to become a lake which consist of two parts separated by considerable rapids and small cataracts; at the south-eastern end the lake abruptly stops, but a subterranean connection with Kais river is supposed to exist here. The mountains at the most places closely surround the lake, which has steep and rocky shores, almost perpendicular at some places but elsewhere allowing some wider marshy bank. The

36 water is clear with pH 6.5, flowing rather strongly only at the narrower part of the lake, including the upper reaches. The bottom is rocky, at most places covered with sand, stones or large rocks, but muddy at some places. Both aquatic and terrestrial vegetation are dense, at least where the stony substratum allows growth (Boeseman 1963; Lukhaup

& Pekny 2006). There is only one species of freshwater crayfish described from this area - Cherax holthuisi named in honour of Lipke B. Holthuis by Lukhaup & Pekny

(2006).

1.4.3.2. Wissel Lakes

One of the most remarkable communities of freshwater crayfish in the world inhabits the Wissel lakes (see section 1.2.4), located in the central mountain area of

Papua Province, Indonesia (Figure 1.12). The lakes were named after F. J. Wissel, a

Dutch entrepreneur who was the first to fly above the lakes in 1930‟s. The three mountain lakes: Paniai (1742 m asl), Tage (1752 m asl) and Tigi (1640 m asl) were described by Wissel as meren or meer (lakes) (Holthuis 1958; Yogi et al. 2008; Yogi et al. 2009). The Wissel lakes are classified as ancient lakes (more than one or two million years old) formed by tectonic events. Tage is in the position of a geological sincline,

Paniai at a combination of anticline and sincline with the broad wetland in the eastern part, and Tigi is surrounded by wetland (Hehanussa et al. 2005; Yogi et al. 2009). 37

Figure 1.12. Wissel Lakes, Papua, Indonesia: A. Lake Paniai, B. Lake Tage, C. Lake Tigi

The largest lake is Paniai which is 9 by 16 km in dimensions and roughly rectangular shaped and surrounded by strongly folded sediments and intrusive rocks. It is also surrounded by massive swamplands in the eastern part (Yogi et al. 2009;

Holthuis 1958; Hope 2007). Paniai is connected to its adjoining sister lake, Tage, which is perched above Paniai by approximately 10 m. Tage lies to the south of Paniai and is elongate east to west and is approximately 8 by 3 km wide. Paniai and Tage are connected by a partial solution of the limestone bed, which forms a 40 meter long subterranean river to the north of Tage. The water from Tage appears suddenly flowing into the Paniai Lake and is named the Demiya River (Holthuis 1958). The third lake is

Tigi situated to the south at distance of 6 km. Tigi Lake has roughly triangular shape with a maximum width of 8 km. The depths of the lakes are uncertain, but considered

“deep”. Holthuis (1958) stated that Paniai has a depth of 30-50 meters, with Tage being deeper than Paniai and Tigi. Hehanussa et al. (2005) stated that Paniai and Tage as an

38 adjoining sister lakes which have the maximum depth of 54 and 52 meters. During the field work conducted for this thesis, local people suggested that the depth of the lake is between 70 meters to 300 meters.

Lake Paniai drains into the Yawey River, which in turn drains into the Arafura

Sea via the Uta River some 81 km to the south (in a straight line based on a measurement using Google Earth). Tigi Lake is also connected by an underground stream to the Yawey River located in the south-east end of the lake (Yogi et al. 2009;

Holthuis 1958).

1.4.3.3. Lake Habbema, Baliem and Ibele Rivers

In the eastern part of the Puncak Jaya (Mt. Jaya) lies the Baliem Valley with its nearby lake and river systems (Figure 1.13.). The region was formed from glacial activity around 20,000 years ago (Hope 2007). These lake and rivers are the habitat of

Cherax monticola as described by Holthuis (1950). The holotype was taken from

Baliem River, east of Lake Habbema at an altitude of 1,700 meters in 1938. Other samples were taken from Ibele River, a part of Baliem River which flowing south-west towards the Lake Habbema at an altitude of 2,250 meters. Some of these crayfishes were also taken from pools in the upper Baliem basin, slightly west of Lake Habbema at an altitude of approximately 3,300 meters. This locality is slightly higher than Baliem

River, where the specimens were collected during the Third Archbold Expedition. A photograph of a “crayfish pool” is given in Kremer‟s publication in 1923 but no specimens were taken from this site (Holthuis 1950).

Cherax monticola is thought to be native to the Baliem and Ibele Rivers and inhabits river pools but no crayfish were recorded from Lake Habbema until 1994.

According to Holthuis (1950), the information about the lack of fish or crayfishes in

Habbema Lake could be found in Kremer (1923), Toxopeus (1939) and Archbold et al. 39

(1942). Although these authors state that there were no crayfishes in Lake Habbema, we obtained Cherax monticola tissue from Leiden Museum collections labelled as Lake

Habbema, 1994 (Holthuis 1950).

Holthuis (1950) stated: “The Baliem River at the localities where the crayfishes were found is actually on the north side of the central mountain range of New Guinea.

East of the summit of Mt. Wilhelmina, however, it breaks through this range and joins the Eilanden River, which empties into the Arafura Sea on the southwest coast of New

Guinea”. Thus the river systems concerned are hydrologically part of the southerly draining river systems. No crayfish are known naturally from northerly draining systems in New Guinea.

Figure 1.13. Lake Habbema (A), Baliem River (B), and Ibele River (C), Papua, Indonesia.

1.4.3.4. Fakfak and Bomberai Peninsula

Fakfak is a small port town with mostly hilly and undulating topography (Figure

1.14). It is situated in the western part of the Bomberai Peninsula. The peninsula is separated from the Birds Head Peninsular by Berau and Bintuni Bay in the north and to the south lays Kamrau Bay. The town is in the eastern part of the peninsula with several river streams flowing into the hilly part of northern and southern region of the peninsula. Some of the bigger river systems are the Sareena, Degen, Wuriwur, Bedida and Bomberai rivers. Formed in the middle of peninsula, two rivers (Bedida and

Bomberai) flow to the North West and drained into the Berau Coast. The eastern region of the peninsula is of lower relief than the western part with a savannah community and numerous small streams and inlet rivers can be found across the floodplain. There are no records of freshwater crayfish reported by Holthuis (1950) or anybody else from this region. For this project we conducted the first recorded systematic sampling expedition for freshwater crayfish to this region.

Figure 1.14. Bomberai Peninsula Region, West Papua, Indonesia: Fakfak (yellow pin) and Sampling locations (yellow flags). 41

1.4.3.5. Northern Australia

The northern region of Australia consists of three states or territories: Western

Australia, Northern Territory and Queensland. The region has limited topographic relief and therefore there are few barriers to species dispersal (Steffen et al. 2009). Most of northern Australia species were found in low altitude, in peaty sand and floodplain area.

The first freshwater crayfish described from northern Australia was Cherax bicarinatus (formerly described as Astacus bicarinatus), which collected from Port

Essington, Northern Territory (Gray 1845; Riek 1969). A species described by Clark

(1941a) as Cherax barretti from the remote Wessel islands in the Northern Territory is of unknown status as it is only known from the type specimen, which is presumed lost.

Until the studies of Riek only two species of Cherax were thought to occur in northernly or easterly draining rivers in northern Australia, Cherax quadricarinatus and C. bicarinatus and there were doubts over the accuracy of the location for the latter species

(Leichhardt 1847; Gray 1845). Cherax rhynchotus (Riek 1951) and Cherax wasselli

(Riek 1969) were described by Riek and represent species thought to be endemic to

Cape York, northern Queensland. The type locality for C. rynchotus is Mapoon, on the western side of Cape York, Queensland. Cherax wasselli has the type locality as Bridge

Spring, between Rocky River and Scrubby Creek, Cape York, Queensland. Riek also described Cherax cairnsensis with the type locality as a swampy area in Cairns, North

Queensland. Three new species of Cherax were described from northern Australia in

1991 and 1993. Cherax nucifraga was recorded from the Palm Springs region in the

Northern Territory, from low lying floodplain (Short 1991). Cherax parvus was described by Short & Davie (1993), with the type specimen recorded from upper Tully

River, north Queensland. A third species, C. cartalacoolah, was described from Cape

Flattery, northeast Queensland with a distribution that possibly extends to Cape Bedford

42 and Lookout Point (Short 1993). There are now a total of nine species of Cherax recorded only from north Australia, north of the Tropic of Capricorn. None of these species has been subject to detailed molecular taxonomic studies using nucleotide data prior this research except C. quadricarinatus, C. cairnsensis and C. rhynchotus and for these species sampling has been generally very limited (Munasinghe et al. 2004b).

1.5. Research problem statement and aims

This study examines the molecular genetics and evolution of freshwater crayfish of the Genus Cherax, specifically focussing on species from northern Australia and

New Guinea including highland species. The principal aim of this project is to place these poorly known species of the Genus Cherax into a taxonomic and evolutionary framework using nucleotide data and to address questions relating to patterns of speciation and historical biogeography. This will not only greatly extend our understanding of the biodiversity of one of the mostly widely distributed but poorly known freshwater crayfish faunas, but also provide a basis for comparison with the better studied species of south-western and eastern Australia. To this end, DNA nucleotide data from mitochondrial and nuclear genes were used to investigate:

1. the taxonomy and evolution of New Guinean and northern Australian species of

Cherax and

2. the evolutionary and biogeographic relationship of these species to Cherax

species from eastern and southern Australia using sequences from GenBank,

unpublished sequences and new sequences generated as part of this study. 43

1.6. Thesis format

The thesis consists of a single research chapter focusing on the genetic and phylogenetic analysis of Cherax samples from New Guinea and northern Australia. The sequenced used include a significant number collected as part of this study, combined with sequences available on GenBank and some that were collected by other members of Professor Austin‟s research group over a period of several years. The origin of the sequences used are appropriately indicated and acknowledged.

The first part of the study uses sequences from the 16S rRNA mitochondrial gene region to test or establish species boundaries and develop phylogenetic hypotheses for New Guinean and selected northern Australian species using comprehensive sampling. The second part of the study uses a reduced number of samples sequenced for three additional gene regions (12S and COI mithocondrial genes and GAPDH nuclear gene) to complement and extend the 16S data set.

This study adds significantly to the molecular data set for Cherax species from both New Guinea region and Australia. Prior to this study there was only a limited number of specimens of Cherax from New Guinea and northern Australia with sequences available on Genbank. Further, excessive reliance on data from a single, or at best two genes,which has typified much of the work on Cherax is being overcome with new data from multiple gene regions from an increasing number of species.

CHAPTER 2

Evolution elevated: A phylogenetic analysis of New Guinean high land crayfish (Cherax: Decapoda: Parastacidae) reveals a decoupling of morphological and molecular evolution

2.1. Introduction

The island of New Guinea has a flora and fauna that is highly diverse, remote and, for the most part, poorly studied (Petocz 1987; Polhemus & Polhemus 1998;

Allison 2007; Takeuchi 2007). It is also characterised by extreme environments ranging from hot humid lowland tropical forests to snow capped peaks of Puncak Jaya (4,884 meters) the rugged central mountain range with its deeply incised valleys and annual rainfall measured in metres creating an extraordinary array of terrestrial and freshwater ecosystems (Menzies 2006; Prentice & Hope 2007; Hope 1976).

Papua and Papua Barat, the western portion of New Guinea island, contains an estimated fifty percent of Indonesia‟s biodiversity, with Indonesia as a whole supporting an estimated fifteen percent of global species diversity (Ministry of Environment 1998).

As a relatively young island with a complex geological history and adjacent to the megadiverse Wallacea and Australian bio-regions, Papua and New Guinea as a whole invites investigation by biogeographers and evolutionary biologists (Petocz 1987;

Flannery 1995; Polhemus et al. 2004; Menzies 2006).

Not surprisingly the fauna of New Guinea and the island‟s human diversity has attracted many eminent evolutionary biologists and biogeographers such as Alfred

Wallace, Ernst Mayr, Jared Diamond and Tim Flannery (Diamond 1972; Diamond &

LeCroy 1979; Beehler et al. 1986; Mayr & Diamond 2001; Flannery 1987; Flannery

44 45

1995; Helgen 2005; Wallace 1863). While the vertebrate fauna is relatively well known

(although remarkable new species are still being discovered – Rittmeyer et al. 2012) much less attention has been paid to aquatic species and invertebrates and much work remains to be done, especially as the island‟s fauna is not immune to the threatening processes that bedevil the conservation of flora and fauna worldwide.

Research on Australian freshwater crayfish (Parastacidae) has advanced significantly in recent decades with all genera being subject to either morphological revision or molecular investigation or both (Holthuis 1949; Riek 1969; Austin & Ryan

2002; Munasinghe et al. 2004; Schultz et al. 2009; Toon et al. 2010). One of the most diverse, commercially and ecologically important, and evolutionarily interesting are the representatives of the genus Cherax. The genus is placed in the Parastacidae, the southern hemisphere family of crayfish with a largely Gondwana Land distribution with its major centre of diversity in the extreme south east of mainland Australia (Riek 1972;

Crandall et al. 2000a; Schultz et al. 2009). Cherax is considered the most adaptable genus in the family as it has the largest distribution which encompasses the temperate south west and south east of mainland Australia, the desert rivers and drainage regions of central Australia and the tropical north of the country and both lowlands and high lands of southern New Guinea from the Kikori river in Papua New Guinea in the east to the western tip of the Bird‟s Head Peninsula in the Indonesian province of West Papua

(Riek 1967; Riek 1969; Austin & Knott 1996; Austin 1996; Holthuis 1949; Holthuis

1986; Munasinghe et al. 2004b). The northern distribution largely correlates with the leading edge of the Australian tectonic plate, which collided with the Asian tectonic plate forming New Guinea region about 5-15 million years ago (Jennings 1972;

Holthuis 1986; Voris 2000; Heinsohn 2011). 46

The New Guinea representatives of Cherax are thought to have had a southern origin (Holthuis 1986) that resulted from an initial invasion of Australia‟s northerly draining rivers, which in turn allowed the colonisation of New Guinea‟s large southerly flowing river systems and associated wetlands during periods of lower sea levels when the two regions merged and their rivers systems were interconnected (Voris 2000).

Consequently, the understanding of the evolutionary radiation of Cherax into the diverse freshwater environments of New Guinea, ranging from large tropical rivers and swamps in the lowlands to frigid water bodies and lakes in the highlands, which contrast dramatically from those found in Australia, is a logical extension to the previous studies of the genus and will allow a more complete evolutionary and biogeographic analysis of this extraordinary group of crayfish.

The understanding of taxonomic boundaries, phylogeographic relationships and geographic patterns of speciation in Cherax have been greatly aided by the application of molecular data (Austin 1996; Austin & Knott 1996; Crandall et al. 2000a; Austin &

Ryan 2002; Austin et al. 2003; Munasinghe et al. 2003; 2004a; and 2004b). However the focus of these studies has been almost exclusively on Australian species with very limited sampling of New Guinean representatives of Cherax.

As a result our knowledge of the diversity of New Guinean Cherax species is based on classical taxonomic studies starting with the descriptions of species by Nobili

(1899); Calman (1911); Roux (1911) and followed by the seminal papers by Holthuis

(1949; 1950; 1984; 1996). More recently single species descriptions by Lukhaup &

Pekny (2006; 2008) and Lukhaup & Herbert (2008) bringing the total number of New

Guinean Cherax to 18 species and one subspecies (refer to Table 1.3 given in

Introduction). These studies indicate that a number of Cherax species are widespread across southern New Guinea, have successfully invaded cool high land environments

47 exceeding 1,000 meters asl (Table 2.1.) and display an extraordinary morphological diversity ranging from one of the smallest in the genus (C. minor) to one of the largest

(C. monticola) and extreme morphologies typified by species inhabiting the Wissel

Lakes in the Papuan highlands (refer to Figure 1.3 given in introduction showing morphology). The Wissel Lakes Cherax fauna, is arguably the most remarkable in the crayfish world in terms of local endemicity, high diversity and because they provide the principal source of protein for the large indigenous communities in the region (Hothuis

1949; 1958).

The aim of this study is to investigate the evolutionary origins, molecular taxonomy and patterns of speciation in New Guinean species of Cherax with a principal focus on the highland species including the first sampling of crayfish from the Wissel

Lakes since the 1950‟s. Samples were obtained from two field trips to Papua, including the highlands and previously unsampled lowland regions near Fakfak in southern West

Papua, Indonesia. Tissue samples were also obtained for a number of species collected by Holthuis and others held in the Leiden Museum, by fishermen and commercial operations buying and selling crayfish. Molecular genetics relationships among samples were investigated using two data sets. The first data set sought to maximise taxon sampling and utilises sequences from the mitochondrial 16S gene, which has proved to be very robust in crayfish studies across a range of divergence levels (Crandall et al.

1995; Crandall & Fitzpatrick 1996; Lawler & Crandall 1998; Ponniah & Hughes 1998;

Nguyen et al. 2002a; Austin et al 2003; Munasinghe et al. 2004b; Baker et al. 2008;

Schultz et al. 2009; Toon et al. 2010). This data set makes maximum use of the museum samples, many of which had to be studied using ancient DNA techniques due to the high level of DNA degradation. The second data set makes use of the more recently collected samples, which allowed greater gene sampling consisting of the 16S gene 48 region and 3 other gene fragments viz. 12S, COI, and including a nuclear gene -

GAPDH (Glyceraldehyde-3-phosphate dehydrogenase) (Munasinghe et al. 2003;

Schultz et al. 2009).

2. 2. Materials and methods

2.2.1. Samples and sequences

Tissue samples were obtained from representatives of 32 putative species from

Papua and northern Australia focussing on locations on river systems draining into the

Arafura-Timor Seas and the Gulf of Carpentaria and water bodies in the Papuan highlands. A total of 124 specimens were sequenced for the 16S gene representing 20 putative species and a number of samples of unknown or uncertain status (Table 2.1).

These data were supplemented by sequences obtained by Baker et al. (2008) in their population genetic study which they identified as belonging to C. quadricarinatus and

C. bicarinatus and sequences obtained by Munasinghe et al. (2004b). For comparative purposes, 16S sequences were included from selected Cherax species from eastern and western Australia available from GenBank. Outgroups were selected from other

Australian Parastacidae genera from Schultz et al. (2007 and 2009).

Samples collected in the field were identified on the basis of taxonomic keys, descriptions and collecting localities given for northern Australian and New Guinean species (Riek 1969; Short 1991; Short 1993; Short & Davie 1993; Austin 1996; Nobili

1899; Calman 1911; Roux 1911; Clark 1936; Holthuis 1949; Holthuis 1950; Holthuis

1996; Lukhaup & Pekny 2006; Lukhaup & Pekny 2008; and Lukhaup & Herbert 2008).

Samples consistent with new undescribed species are labelled as „sp. nov.‟ based on preliminary morphological assessment and the molecular taxonomic and phylogenetic analyses. For tissues taken from museum samples the taxonomic name under which the

49 specimens was identified by museum staff was used. Similarly, sequenced used from other studies were given the names applied in that study unless otherwise stated.

The samples used in the second data set, consisted of a subset of samples used for the 16S gene-based analyses in the first part of the study. These sequences were combined with sequences from three additional gene regions viz. 12S, COI and GAPDH obtained from the same specimens collected as part of the field-based sampling in this study, together with a limited number obtained from recently collected museum samples with non-degraded DNA or from tissue collections obtained as part of previous studies

(eg. Munasinghe et al. 2003; 2004a; and 2004b).

Samples from the field were obtained from local and own effort by dip-net, bait trap or by excavating burrows. Live specimens or pereopod tissue samples were placed in labelled plastic vials, zip-lock bags, or plastic fishing tackle boxes and chilled during transport, when possible and then frozen at -80 °C on return to the laboratory. A hand- held GPS was used to obtain positional data for all field sites or retrospective georeferencing was used (see Geoscience Australia [www.ga.gov.au], Google Maps

[www.maps.- google.com] and Google Earth [version 4.2.0198.2451 beta]) as described by Schultz et al.(2009).

Museum collections were obtained from the Museum Victoria Melbourne

(Australia), Nationaal Natuurhistorisch Museum, Leiden (The Netherlands), Museum and Art Gallery of Northern Territory (Australia), and Museum Zoologicum Bogoriense

(Indonesia). The outgroup sequences comprised appropriate species from other

Australian crayfish genera on the basis of the findings of Schultz et al. (2007 and 2009).

A summary of all samples and sequences used is given in Table 2.1.

2.2.2. DNA extraction, PCR amplification, and sequencing

The first set of analyses is based on DNA sequence data from the mitochondrial

16S gene. DNA was extracted from muscle or pereopod tissue that had been stored frozen or in ethanol using the DNeasy kit (Qiagen). In most cases, minimum of 532 base pairs of 16S as a single fragment using the 1471 and 1472 primers of Crandall and

Fitzpatrick (1996) was amplified and sequenced from each sample. However, as the

DNA from most museum samples was too degraded to be amplifiable using these primers they were amplified as a series of short overlapping fragments using primers developed by Schultz et al (2009). The second data set uses sequences from two additional mt DNA fragments - the 12S (288 bp), COI (600 bp) and the nuDNA

GAPDH (648 bp). All primer sequences used in the study are given in Table 2.2.

PCRs were carried out in a 25 µL volumes and contain the following components: 1× PCR buffer, 2 mM magnesium chloride, 0.2 mM dNTP, 0.5 µM each primer, 0.5 unit of Taq DNA polymerase and 2.5 µL of genomic DNA. All PCR reactions were carried out using a Biorad MyCyclerTM Thermal Cycler (Cat. No.170-

9703). PCR was performed with standard three step denaturation at 94 ºC, annealing at

50ºC and extension at 72ºC. Negative controls were run for all amplifications. Two microlitres of the PCR product then electrophoresised on an agarose gel mixed with

BIOTIUM Gelred Nucleic Acid Stain (Cat:41003:0.5mL) and visualized under UV light to verify product size and estimate concentration against the Promega DNA/HaeIII marker. The remaining products were purified using a VIOGENE PCR purification kit.

The samples were sequenced following standard protocols for ABI 3130XL automated sequencer using ABI big dye terminator kit (Perkin-Elmer). For each sample, sequence reactions were performed using primers. Chromatograms were viewed and edited using

SEQMAN (DNASTAR). GenBank accession numbers are provided in table 2.1.

2.2.3. Phylogenetic analyses

Ribosomal RNA sequences were aligned using MUSCLE implemented in

Geneious 6.2.1 (www.geneious.com) and manually inspected after alignment.

Alignment of protein coding gene fragments used amino acids translation and checked using MEGA 5.05 (Tamura et al. 2011). The sequences of the 16S, 12S, COI and

GAPDH were concatenated to form a super-matrix and divided into four partitions, one for each rRNA gene and two for each protein coding region comprising one for 1st and

2nd codon positions and one for the 3rd positon. The jModelTest v0.1.1 program

(http://darwin.uvigo.es/software/software.html) was used to select the best fitting substitution model for each partition according Akaike Information Criterion (AIC).

Bayesian analyses of the 16S and concatenated data was inferred with MrBayes v3.1.2 (http://mrbayes.sourceforge.net/). The 16S data used a HKY+I+G model of evolution. The tree was based on a 50% majority rule consensus of 27000 post-burnin trees from 8 combined BEAST runs. Burnin was 100 trees from each run. Each run ran for 13.5 million cycles and was sampled every 1000 cycles. Log of runs were examined in Tracer v1.5 (http://tree.bio.ed.ac.uk/software/tracer).

For the concatenated super-matrix, eight runs were conducted with 4.5 million to

7.5 million cycles per run. Burnin was 450,000 cycles. Logs of runs were inspected in

Tracer. Effective Sample Size (ESS) post burnin of combined run was >8000. Bayes

Factor was used to test for differences in log likelihoods of the eight runs before combining. As there were no significant differences between runs, all 8 runs were combined. Partitioned model used are as follow: 16S (HKY+I+G), 12S (GTR+I+G),

COI (SRD06) (i.e., HKY+G, for codon position 1+2 combined, with codon 3 allowed a different rate), and GAPDH as per COI. All genes unlinked from one another, but trees linked so as to allow a summary with a single tree (despite the potential for each gene 52 having a different topology). Number of trees in the Mesquite 50% majority rules consensus is 39500.

Characters within concatenated sequence sets were partitioned by gene, allowing each partition to evolve at different rates. MrBayes searches were conducted with trees sampled every 1000 generations. Analyses were run for three million generations.

Convergence between runs and the choice of an appropriate burn-in value were assessed by comparing traces using Excel.

2.2.4. Taxonomic analyses

To complement the phylogenetic analyses genetic divergence within and between putative species was summarised using Multidimensional Scaling (MDS) based on the 16S data set. Three separate analyses were conducted largely on the 3 major groups identified in the phylogenetic analyses. MDS analyses were performed using XLSTATS (http://www.xlstat.com/en/) based on the percentage uncorrected genetic similarity (1 - p-distance) calculated using Geneious 7.0.1.

. Table 2.1. Geographic origin of specimens sequenced and NCBI GenBank accession numbers for four gene regions (see Figure 2.1). Origin codes: LM - Nationaal Natuurhistorisch Museum, Leiden, the Netherland; MAGNT-Museums and Art Galleries of the Northern Territory, Darwin, Australia; MZB -Museum Zoologicum Bogoriense, Bogor, Indonesia;QM -Queensland Museum, Brisbane, Australia; Field - collected by authors of this study unless otherwise acknowledged; Farm – obtained from a crayfish aquaculture farm, Surabaya, Indonesia; Commercial – obtained from an enterprise involved with either the wild harvesting or selling of crayfish for the ornamental industry; Genbank – retrieved from Genbank Accession Combined ID Sample Elevation Accession Accession Accession Taxon Locality1 Origin No. analysis No. Code (m) No. 16S No. 12S No. COI GAPDH (4 genes) Australia 1 C. barretti Wessel Island, Australia WES Carol Palmer 0 KJ920752 n/a n/a n/a no 2 C. bicarinatus Blue Mud Bay, Arnhem Land, Northern Territory BMB1 Field 175 KJ920753 n/a n/a n/a no 3 Blue Mud Bay, Arnhem Land, Northern Territory BMB2 Field 175 KJ920754 n/a n/a n/a no 4 Blue Mud Bay, Arnhem Land, Northern Territory BMB3 Field 175 KJ920755 KJ920862 KJ950502 KJ950559 yes 5 Blue Mud Bay, Arnhem Land, Northern Territory BMB4 Field 175 KJ920756 n/a n/a n/a no 6 Blyth River, Arnhem Island, Northern Territory BLY MAGNT 175 KJ920757 n/a n/a n/a no 7 Maningrida, Arnhem Land, Northern Territory MAN1 Field 18 KJ920758 KJ920863 KJ950503 KJ950560 yes 8 Maningrida, Arnhem Land, Northern Territory MAN2 Field 18 KJ920759 KJ920864 KJ950504 KJ950561 yes 9 C. nucifraga Melville Island, Northern Territory MEL MAGNT 0-100 KJ920760 n/a n/a n/a no 10 C. quadricarinatus Flinders River, Queensland FLI Genbank - EU244885 n/a n/a n/a no 11 Georgina River, Queensland GRG Genbank 117 EF493080 n/a n/a n/a no 12 Gregory River, near Doomadgee, Queensland DOO1 QM 47 KJ920761 n/a n/a n/a no 13 Gregory River, near Doomadgee, Queensland DOO2 QM 47 KJ920762 n/a n/a n/a no 14 McArthur River, Northern Territory MCA1 Genbank - EU244882 n/a n/a n/a no 15 McArthur River, Northern Territory MCA2 QM 146 KJ920763 n/a n/a n/a no 16 McArthur River, Northern Territory MCA3 QM 146 KJ920764 n/a n/a n/a no 17 Mitchell River, Queensland MIT Genbank - EU244887 n/a n/a n/a no 18 C. rhynchotus Jardine River, Queensland JAR Genbank 55 AY191774 n/a n/a n/a no 19 Lake Wicheura, Cape York, Queensland WIC QM 42 KJ920765 n/a n/a n/a no 20 Cherax sp. nov. 1 Howard Springs, Northern Territory HOS MAGNT 45 KJ920766 n/a n/a n/a no 21 (C. cf quadricarinatus) Howard River, Northern Territory HOR Genbank - EU244880 n/a n/a n/a no 53 22 Ord River, Western Australia ORD Genbank - EU244879 n/a n/a n/a no 23 Rapid Creek, Darwin, Northern Territory RAC1 Field 11 KJ920767 KJ920865 KJ950505 KJ950562 yes 24 Rapid Creek, Darwin, Northern Territory RAC2 Field 11 KJ920768 KJ920866 KJ950506 KJ950563 yes New Guinea 25 C. albertisii Bensbach River, Papua New Guinea BEN1 Genbank 13 EU244890 n/a n/a n/a no 26 Bensbach River, Papua New Guinea BEN2 QM 13 KJ920769 n/a n/a n/a no 27 Bensbach River, Papua New Guinea BEN3 QM 13 KJ920770 n/a n/a n/a no 28 Mt. Bosavi, Papua New Guinea MTB Genbank 2,345 EU244893 n/a n/a n/a no 29 Oriomo River, Papua New Guinea ORI Genbank 15 EU244889 n/a n/a n/a no 30 Tanah Merah, Papua, Indonesia TAM1 LM 88 KJ920771 n/a n/a n/a no 31 Tanah Merah, Papua, Indonesia TAM2 LM 88 KJ920772 n/a n/a n/a no 32 Tanah Merah, Papua, Indonesia TAM3 LM 88 KJ920773 n/a n/a n/a no 33 C. boesemani 20km SE of Lake Ayamaroe, Bird‟s Head, Papua, Indonesia LAY1 LM 200-400 KJ920774 n/a n/a n/a no 34 Crayfish Farm, Surabaya, Indonesia FAR1 Farm - KJ920775 n/a n/a n/a no 35 Lake Ayamaroe, Bird‟s Head, Papua, Indonesia LAY2 LM 200-400 KJ920776 n/a n/a n/a no 36 Lake Ayamaroe, Bird‟s Head, Papua, Indonesia LAY3 LM 200-400 KJ920777 n/a n/a n/a no 37 Lake Ayamaroe, Bird‟s Head, Papua, Indonesia LAY4 LM 200-400 KJ920778 n/a n/a n/a no 38 Lake Ayamaroe, Bird‟s Head, Papua, Indonesia LAY5 LM 200-400 KJ920779 n/a n/a n/a no 39 Lake Ayamaroe, Bird‟s Head, Papua, Indonesia LAY6 LM 200-400 KJ920780 n/a n/a n/a no 40 Lake Ayamaroe, Bird Head‟s, Papua, Indonesia LAY7 LM 200-400 KJ920781 n/a n/a n/a no 41 Unknown, Bird Head, Papua, Indonesia BIH Commercial 200-400 KJ920782 n/a n/a n/a no 42 Unknown, south-east of Sorong, Papua, Indonesia SOR1 Commercial 200-400 KJ920783 KJ920867 KJ950507 KJ950564 yes 43 C. boschmai Lake Paniai, Enarotali, Papua, Indonesia PAN1 LM >1,700 KJ920784 n/a n/a n/a no 44 C. buitendijkae Lake Paniai, Enarotali, Papua, Indonesia PAN2 LM >1,700 KJ920785 n/a n/a n/a no 45 C. communis Yawey River, Enarotali, Papua, Indonesia YAW LM 1,700 KJ920786 n/a n/a n/a no 46 Lake Paniai, Enarotali, Papua, Indonesia PAN3 LM 1,700 KJ920787 n/a n/a n/a no yes 47 Lake Paniai, muddy substrate, Papua, Indonesia PAN4 Field 1,769 KJ920788 KJ920868 KJ950508 KJ950565 54 48 Lake Paniai, muddy substrate, Papua, Indonesia PAN5 Field 1,769 KJ920789 KJ920869 KJ950509 KJ950566 yes 49 Cape Bobairo, Lake Paniai, Papua, Indonesia PAN6 Field 1,763 KJ920790 KJ920870 KJ950510 KJ950567 yes 50 Cape Bobairo, Lake Paniai, Papua, Indonesia PAN7 Field 1,763 KJ920791 KJ920871 KJ950511 KJ950568 yes 51 Lake Paniai, rocky substrate, Papua, Indonesia PAN8 Field 1,762 KJ920792 KJ920872 KJ950512 KJ950569 yes 52 Lake Paniai, rocky substrate, Papua, Indonesia PAN9 Field 1,762 KJ920793 KJ920873 KJ950513 KJ950570 yes 53 Lake Tigi, Papua, Indonesia TIG1 Field 1,724 KJ920794 KJ920874 KJ950514 KJ950571 yes 54 Lake Tigi, Papua, Indonesia TIG2 Field 1,724 KJ920795 n/a n/a n/a no 55 Lake Tigi, Papua, Indonesia TIG3 LM >1,700 KJ920796 n/a n/a n/a no 56 2 km north of Lake Tigi, Papua, Indonesia TIG4 Field 1,728 KJ920797 KJ920875 KJ950515 KJ950572 yes 57 2 km north of Lake Tigi, Papua, Indonesia TIG5 Field 1,728 KJ920798 KJ920876 KJ950516 KJ950573 yes 58 Wagethe market near Lake Tigi, Papua, Indonesia WAG1 Field 1,726 KJ920799 KJ920877 KJ950517 KJ950574 yes 59 Wagethe market near Lake Tigi, Papua, Indonesia WAG2 Field 1,726 KJ920800 KJ920878 KJ950518 KJ950575 yes 60 C. holthuisi 20km SE Lake Ayamaroe, Bird‟s Head, Papua, Indonesia LAY8 LM 200-400 KJ920801 n/a n/a n/a no 61 20km SE of Lake Ayamaroe,Bird‟s Head, Papua, Indonesia LAY9 LM 200-400 KJ920802 n/a n/a n/a no 62 Crayfish Farm, Surabaya, Indonesia FAR2 Farm - KJ920803 KJ920879 KJ950519 KJ950576 yes 63 Unknown, south-east of Sorong, Papua, Indonesia SOR2 Commercial 200-400 KJ920804 KJ920880 KJ950520 KJ950577 yes 64 Unknown, south-east of Sorong, Papua, Indonesia SOR3 Commercial 200-400 KJ920805 KJ920881 KJ950521 KJ950578 yes 65 C. longipes Lake Tigi, Papua, Indonesia TIG6 LM >1,700 KJ920806 n/a n/a n/a no 66 Lake Tigi, Papua, Indonesia TIG7 LM >1,700 KJ920807 n/a n/a n/a no 67 C. lorentzi west of Kaukenau, Timika, Papua, Indonesia KAU1 LM 0-100 KJ920808 n/a n/a n/a no 68 west of Kaukenau, Timika, Papua, Indonesia KAU2 LM 0-100 KJ920809 n/a n/a n/a no 69 west of Kaukenau, Timika, Papua, Indonesia KAU3 QM 0-100 KJ920810 n/a n/a n/a no 70 Wamia River, near Timika, Papua, Indonesia WAI1 QM 0-100 KJ920811 n/a n/a n/a no 71 Wamia River, near Timika, Papua, Indonesia WAI2 QM 0-100 KJ920812 n/a n/a n/a no 72 C. misolicus Misool Island, south of Papua, Indonesia MIS LM 0-200 KJ920813 n/a n/a n/a no 73 C. monticola Lake Habbema, Wamena, Papua, Indonesia LHA1 LM 3,327 KJ920814 n/a n/a n/a no no 74 Lake Habbema, Wamena, Papua, Indonesia LHA2 LM 3,327 KJ920815 n/a n/a n/a 55 75 Wamena, Papua, Indonesia WAM1 Field 1,500-2,000 KJ920816 KJ920882 KJ950522 KJ950579 yes 76 Wamena, Papua, Indonesia WAM2 Field 1,500-2,000 KJ920817 KJ920883 KJ950523 KJ950580 yes 77 Wamena, Papua, Indonesia WAM3 Field 1,500-2,000 KJ920818 KJ920884 KJ950524 KJ950581 yes 78 Wamena, Papua, Indonesia WAM4 Field 1,500-2,000 KJ920819 KJ920885 KJ950525 KJ950582 yes 79 Crayfish Farm, Surabaya, Indonesia FAR4 Farm - KJ920820 n/a n/a n/a no 80 Crayfish Farm, Surabaya, Indonesia FAR5 Farm - KJ920821 n/a n/a n/a no 81 C. murido Lake Paniai, Enarotali, Papua, Indonesia PAN10 LM >1,700 KJ920822 n/a n/a n/a no 82 Lake Paniai, Enarotali, Papua, Indonesia PAN11 LM >1,700 KJ920823 n/a n/a n/a no 83 North of Cape Bobairo, Lake Paniai, Papua, Indonesia PAN12 Field 1,762 KJ920824 KJ920886 KJ950526 KJ950583 yes 84 North of Cape Bobairo, Lake Paniai, Papua, Indonesia PAN13 Field 1,762 KJ920825 KJ920887 KJ950527 KJ950584 yes 85 C. pallidus Lake Paniai, Enarotali, Papua, Indonesia PAN14 LM >1,700 KJ920826 n/a n/a n/a no 86 Lake Paniai, Enarotali, Papua, Indonesia PAN15 LM >1,700 KJ920827 n/a n/a n/a no 87 Lake Paniai, Enarotali, Papua, Indonesia PAN16 MZB >1,700 KJ920828 n/a n/a n/a no 88 C. paniaicus Lake Paniai, Papua, Indonesia PAN17 LM >1,700 KJ920829 n/a n/a n/a no 89 Lake Tage, Papua, Indonesia TAG1 Field 1,763 KJ920830 KJ920888 KJ950528 KJ950585 yes 90 Lake Tage, Papua, Indonesia TAG2 Field 1,763 KJ920831 KJ920889 KJ950529 KJ950586 yes 91 Lake Tage, Papua, Indonesia TAG3 Field 1,780 KJ920832 KJ920890 KJ950530 KJ950587 yes 92 Lake Tage, Papua, Indonesia TAG4 Field 1,780 KJ920833 KJ920891 KJ950531 KJ950588 yes 93 Lake Tage, Papua, Indonesia TAG5 Field 1,783 KJ920834 KJ920892 KJ950532 KJ950589 yes 94 C. peknyi German Petshop, originating near Merauke, Papua NEG Genbank 0-20 AY191775 AY191747 KJ950533 EU977416 yes 95 Merauke, Papua, Indonesia MER Commercial - KJ920835 n/a n/a n/a no 96 C. solus Lake Tigi, Papua, Indonesia TIG8 LM >1,700 KJ920836 n/a n/a n/a no 97 Cherax sp. nov. 2 Musunggu (river), Bomberay, Fakfak, West Papua ASM1 Field 20 KJ920837 KJ920893 KJ950534 KJ950590 yes 98 Warisa Mulya, Spring 1, Bomberay, Fakfak, West Papua WMU1 Field 14 KJ920838 KJ920894 KJ950535 KJ950591 yes 99 Warisa Mulya, Spring 2, Bomberay, Fakfak, West Papua WMU2 Field 14 KJ920839 KJ920895 KJ950536 KJ950592 yes 100 Warisa Mulya, Spring 3, Bomberay, Fakfak, West Papua WMU3 Field 15 KJ920840 KJ920896 KJ950537 KJ950593 yes yes 101 Tomage Village, Bomberay, Fakfak, West Papua, Indonesia TOM1 Field 31 KJ920841 KJ920897 KJ950538 KJ950594 56 102 Tomage Village, Bomberay, Fakfak, West Papua, Indonesia TOM2 Field 31 KJ920842 KJ920898 KJ950539 KJ950595 yes 103 Unknown, Bomberay, Fakfak, West Papua, Indonesia BOM1 Field - KJ920843 KJ920999 KJ950540 KJ950596 yes 104 Cherax sp. nov. 3 Kryawaswas (river), Fakfak, West Papua, Indonesia KRY1 Field 91 KJ920844 KJ920900 KJ950541 KJ950597 yes 105 Kryawaswas (river), Fakfak, West Papua, Indonesia KRY2 Field 91 KJ920845 KJ920901 KJ950542 KJ950598 yes 106 Nambukteb (river), Fakfak, West Papua, Indonesia NAM1 Field 402 KJ920846 KJ920902 KJ950543 KJ950599 yes 107 Nambukteb (river), Fakfak, West Papua, Indonesia NAM2 Field 402 KJ920847 KJ920903 KJ950544 KJ950600 yes 108 Cherax sp. nov. 4 Warisa Mulya (river), Bomberay, Fakfak, West Papua WMU4 Field 17 KJ920848 n/a n/a n/a no 109 Warisa Mulya (river), Bomberay, Fakfak, West Papua WMU5 Field 17 KJ920849 KJ920904 KJ950545 KJ950601 yes 110 Musunggu (river), Bomberay, Fakfak, West Papua ASM2 Field 20 KJ920850 KJ920905 KJ950546 KJ950602 yes 111 Unknown, Bomberay, Fakfak, West Papua, Indonesia BOM2 Field - KJ920851 KJ920906 KJ950547 KJ950603 yes 112 Waremo River, Bomberay, Fakfak, West Papua, Indonesia WAR Field 21 KJ920852 KJ920907 KJ950548 KJ950604 yes 113 Cherax sp. nov. 5 Unknown, south-east of Sorong, West Papua, Indonesia SOR4 Commercial 200-400 KJ920853 KJ920908 KJ950549 KJ950605 yes 114 (C. cf. holthuisi) Unknown, south-east of Sorong, West Papua, Indonesia SOR5 Commercial 200-400 KJ920854 KJ920909 KJ950550 KJ950606 yes 115 Crayfish farm, Surabaya, Indonesia FAR3 Farm - KJ920855 KJ920910 KJ950551 KJ950607 yes 116 Unknown, south-east of Sorong, West Papua, Indonesia SOR6 Commercial 200-400 KJ920856 n/a n/a n/a no 117 Unknown, south-east of Sorong, West Papua, Indonesia SOR7 Commercial 200-400 KJ920857 KJ920911 KJ950552 KJ950608 yes 118 Unknown, south-east of Sorong, West Papua, Indonesia SOR8 Commercial 200-400 KJ920858 n/a n/a n/a no Cherax Outgroups 119 C. cairnsensis South-west of Rockhampton, Queensland, Australia STO Genbank 10 AY191761 AY191732 KJ950553 KJ950609 yes 120 C. dispar Oxley Creek, Queensland, Australia OXL Genbank 100 AY191771 AY191736 KJ950554 KJ950610 yes 121 C. destructor Finke River, Northern Territory, Australia FIN Genbank 400 AY191765 AY191738 KJ950555 EU977406 yes 122 C. preissii Lower Kalgan River, Western Australia, Australia LKA Field 32 KJ920859 KJ920912 KJ950556 KJ950611 yes 123 C. quinquecarinatus McGregor Rd., Western Australia, Australia MCG Field 30 KJ920860 KJ920913 KJ950557 KJ950612 yes 124 C. tenuimanus Margaret River, Western Australia, Australia MAR Field 76 KJ920861 KJ920914 KJ950558 KJ950613 yes Primary Outgroups 125 Engaeus lyelli Enfield, Victoria, Australia - Genbank - EF493073 n/a n/a n/a no 126 Engaeus sericatus Penshurst, Victoria, Australia - Genbank - EF493125 n/a n/a n/a no 57 127 Engaewa subcoerulea Walpole, Western Australia, Australia - Genbank - EU977395 n/a n/a n/a no 128 Geocharax falcata First Wannon Creek, Victoria, Australia - Genbank - EF493076 n/a n/a n/a no 129 Geocharax gracilis Boggy creek, Victoria, Australia - Genbank - EF493046 n/a n/a n/a no 130 Geocharax sp. nov.1 Penola Consvtn Park, South Australia, Australia - Genbank - EF493122 n/a n/a n/a no 131 Geocharax sp. nov.2 Penshurst, Victoria, Australia - Genbank - EF493126 n/a n/a n/a no 132 Gramastacus insolitus Dwyers Creek, Victoria, Australia - Genbank - EF493066 n/a n/a n/a no 133 Gramastacus sp. Myall lakes, New South Wales, Australia - Genbank - AY223716 n/a n/a n/a no 134 Tenuibranchiurus glypticus Eumundi, Queensland, Australia - Genbank - EF493132 n/a n/a n/a no

58 59

Table 2.2. Primers used for amplification and sequencing in this study

Gene Primer Sequence (5’-3’) Reference name

16S 1471 CCTG TTTANCAAAAACAT Crandall and Fitzpatrick 1996, Crandall et al. 1995

1472 AGATAGAAACCAACCTGG Crandall and Fitzpatrick 1996, Crandall et al., 1995

SASp3-16SF GAATTTAACTTTTAAGTG Schultz et al. 2009

SASp4-16sR TCAACATCGAGGTCGCAAAC Schultz et al., 2009

16S.73-74H ACTTTATAGGGTCTTATCGTC Schultz et al. 2009

16S.73-74L GGGACGATAAGACCCTATAAA Schultz et al. 2009

16S.74-89H TTACGCTGTTATCCCTAAAGTAA Schultz et al. 2009

16S.74-89L TTACTTTAGGGATAACAGCGTAA Schultz et al. 2009

12S H1478F GRAAGCGACGGGCGATATG This study

L1085R TWTAAAACARGATTAGATACC This study

COI CAF CTACAAATCATAAAGATATTG Folmer 1994

CABR CTTCAGGGTGACCAAAAAAATC Folmer 1994

GAPDH G3PCq157F TGACCCCTTCATTGCTCTTGACTA Buhay et al. 2007

G3PCq981R ATTACACGGGTAGAATAGCCAAACTC Buhay et al. 2007 60

Figure 2.1. Sample collection sites for Cherax with the geographic regions defined on the basis of the phylogenetic analysis of Munasinghe et al. (2004b) and superimposed on a map from Source Terrain Basemap, ESRI (2013) (map generated by J.S.E. Yuwono, Department of Archaeology, Faculty of Cultural Sciences, Universitas Gadjah Mada). 61

2. 3. Results

2.3.1. Sequences

A total of 1101 new 16S rRNA sequences (KJ920752 - KJ920861) representing

28 putative Cherax species from northern Australia and New Guinea were used for the 16S data set excluding outgroup samples. All but 10 of these sequences, available from GenBank, were obtained by this study. The multigene data set was made up of sequences representing 58 individuals (including six for Cherax outgroup samples) representing 11 putative species from northern Australia and New Guinea. This data set includes; 53 new 12S rRNA sequences (KJ920862 - KJ920914); 57 new COI sequences (KJ950502 - KJ950558); and 55 new GAPDH sequences (KJ950559 -

KJ950613)2 as detailed in Table 2.1 including NCBI GenBank accession numbers for all nucleotide sequences used in this study.

2.3.2. Phylogenetic analyses

From Figure 2.2, which gives the Bayesian estimation of phylogenetic relationship using the 16S data, there is strong support for the monophyly of the genus Cherax with respect to the northern Australia and New Guinea samples and representatives of species from eastern Australia and the south west of Western

Australia with a Bayesian posterior probability (Pp=1.0). The northern Australian and New Guinea species form a well supported clade (Pp=1.0) relative to the southern Australia samples, indicating that these samples are appropriate as outgroups for the multigene data set. The reduced support for the outgroup lineage

1Of the 110 sequences I obtained 66, the remainder were either from GenBank or were obtained by members of Professor Austin‟s laboratory. 2Of these 165 sequences I obtained 163, the remainder were similarly from GenBank or were obtained by members of Professor Austin‟s laboratory 62

(Pp=0.78) indicates that the relationships among the eastern, western and northern

(including New Guinea) Cherax lineage are unresolved.

Lineage A

Lineage B

Figure 2.2. Phylogenetic relationships among Cherax spp. from northern Australia and New Guinea based on a Bayesian analyses of 16S rRNA sequences (n=134). Lineage A: New Guinea and Lineage B: northern Australia and two species from lowland New Guinea. See Table 2.1 for detailes of codes and sample locations. 63

The two Bayesian analyses support two major clades for both the 16S and multigene data sets and labeled as A and B (Figures 2.2 to 2.5). While the Bayesian posterior probabilities (Pp) for these 2 clades is less that 0.95 (0.88 and 0.92) for the

16S tree, they receive strong support for the multigene data set (0.98 and 1.00) albeit with more limited taxon sampling. One of these clades comprises exclusively New

Guinea species including all the highland species (lineage A). The second clade contains all the northern Australian species and lowland New Guinea species from central and eastern Papua (lineage B). Additional features of these two clades and taxonomic implications are highlighted below in more detail.

Figure 2.3 Expanded view of the lineage A - first of the two major clades for the tree presented in Figure 2.1 showing relationships among the New Guinean Cherax spp. 64

Figure 2.4. Expanded view of the lineage B- the second of the two major clades for the tree presented in Figure 2.1 showing relationships among northern Australian Cherax species and two of the low land New Guinea Cherax spp. Lineage B

Lineage A

Figure 2.5. Bayesian analyses for concatenated data of four gene regions (16S, 12S, COI and GAPDH) among Cherax spp. from northern Australia and New 65 Guinea 66

2.3.3. Molecular taxonomy

The phylogenetic relationships and degree of divergence among samples in the New Guinea clade (A) provide strong support for the distinctiveness of 10 species comprising: C. boesemani, C. peknyi, C. misolicus, C. holthuisi, C. monticola, and a minimum of four new species from western Papua (western Bird‟s

Head and Fakfak region). Surprisingly, no support was found for the eight nominal highland species of Cherax (C. communis, C. murido, C. solus, C. paniaicus, C. pallidus, C. longipes, C. buitendijkae and C. boschmai) described from the Wissel

Lakes region. Both trees recovered a single highly divergent clade containing all samples from the three lakes and the nearby Yawey River, with individuals showing minimal divergence for the 16S sequences (average divergence = 0.65%, maximum divergence = 2.4%). Two somewhat divergent clades were identified from the Wissel

Lakes specimens in the multigene analyses, however these 2 clades did not correlated with named species or lake of origin (Figure 2.5).

The other highland lineage consists of eight samples of C. monticola from the

Wamena region. While this lineage was well supported (Pp=1.0) the samples were further split into two groups, one comprising samples form Lake Habbema and the other from the nearby Baliem River. While the degree of divergence between group is not high (1.56%) it may be taxonomically significant given the close proximity of the two locations.

A plot of the relationship between samples for the species placed in the clade containing the putative highland species and C. peknyi (Figures 2.2 and 2.3) using multidimensional scaling is provided in Figure 2.6. It can be seen from this analysis that while the samples of C. monticola and C. peknyi form discrete and isolated 67

clusters, all the samples of the Wissel lakes species group together without clear separation of any of the putative species from this region.

Figure 2.6. MDS plot of uncorrected genetic similarity among highland crayfish of the genus Cherax (Wissel Lakes species complex and C. monticola from Wamena) and one lowland species, Cherax peknyi. Species selected based on the relationships depicted in Fig. 2.3. Individual sample codes for each species are given in Table 2.1.

Three of the 5 putative new species come from a small region to the north east of Fakfak that had not previously been surveyed before for crayfish. All species were highly divergent from one another (range of divergence: 6.75% - 7.76%) and either clade with other species from the Bird‟s Head region or are placed in a basal position. One of these species, Cherax sp.nov.4 consists of 2 divergence lineages that may be also be taxonomically distinct from each other (average divergence=3.92%).

The 4th new species appears to be a sister species to C. holthuisi and it is also morphologically distinctive with respect to its colour pattern with average divergence between two clades of 3.68%. One other sample FAR1, while clustering with the other C. boesemani samples, is also quite divergence (average divergence= 2.29%) and may be of taxonomic significance. As this sample originated from an aquaculture farm it‟s geographic origin is unknown. The morphologically similar C. boesemani from the western Bird‟s Head peninsular and C. misolicus known only from the island of Misool and placed as sister to one another are closely related with a divergence level of 4.84%.

A second multidimensional scaling analysis including all other New Guinea samples in Lineage A is provided in Fig. 2.7. From this analysis, the samples of the putative species C. holthuisi and C. boesemani and the single sample of C. misolicus are distinct and isolated from the other samples. Similarly, the samples of the new species identified as Cherax sp.nov.2, 3, and 5 are distinct from each other and the other 3 recognised species. It can also been seen that while the samples of Cherax sp.nov.4 are also distinct there is significant variation within this species as discussed above.

In general the deeper relationships within the New Guinea clade are unresolved. However, there is some strong support for phylogenetic relationships between some of the more closely related species. For example C. holthuisi and its sister species (Bird‟s Head specimens - Cherax sp.nov.5) are always consistently sister to Cherax sp.nov.2, Cherax sp.nov.3 and Cherax sp.nov.4 from the Fakfak region; and C. boesemani (Bird‟s Head), C. misolicus and Cherax sp.nov.4 are resolved as close relatives by one or more of the analyses. 69

The only other consistency between the single gene and multigene data sets is that the species C. peknyi (eastern Papua) and the two highland clades from the

Wissel Lakes and Wamena are consistently placed together, although these relationships only receive low Pp values (0.58-0.67).

Figure 2.7. MDS plot of uncorrected genetic similarity among Fakfak, Bird‟s Head, and Misool Island clades (C. holthuisi, C.boesemani, C. misolicus, C. sp.nov.2., C. sp.nov.3, C. sp.nov.4, and C.sp.nov.5). Individual sample codes for each species are given in Table 2.1.

The second main lineage (B) consisting of Australian species and lowland

New Guinea species from central and eastern Papua and the far south west of Papua

New Guinea shows relationshsips among samples that also have significant taxonomic implications. Three distinct lineages are apparent: the C. nucifraga lineage represented by a single sample from the Darwin region; the C. bicarinatus lineage, which includes samples assigned to the species C. barretti and C. rhynchotus and the “red claw” lineage, which is a complex of related species and cryptic species characterised by adult males with a reddish red uncalcified patch on the outer margin 70

of each their major claws. The average divergence amongst these three distinct lineages ranges from 7.88% to 9.46%. While the analysis clearly supports the distinctiveness of C. nucifraga, it is apparent that several species have been confused within the otherwise distinct lineage recognised in this study as C. bicarinatus. This lineages comprises a set of samples that show limited divergence across a relatively wide distribution across the most northern part of Australia (average divergence among samples= 0.21 %; maximum divergence= 0.70 %). The multidimensional scaling analysis of the samples making up lineage B (Fig 2.8) illustrates both the distinctiveness of the species, C. nucifraga and the C. bicarinatus species complex, with the degree of variation with the latter typical of that normally observed within species. The samples of the C. bicarinatus complex include recently discovered crayfish with a white semi-calcified patch on the claws of adult males from the

Northern Territory, a sample from the Wessel Islands, the type locality and the only known locality of C. barretti and samples of C. rhynchotus from the northern most part of the Cape York Peninsular, Queensland.

Within the red claw clade there is a primary division between the lineage that supports the recognition of C. lorentzi as a distinct and well defined species from the central lowlands of Papua and it‟s sister lineage, a complex of samples from both

Australia and central New Guinea (average divergence between the two clades =

4.71%). This sister clade to C. lorentzi includes samples putatively identified as C. quadricarinatus and C. albertisii, and may represent as many as five species. The

Cherax quadricarinatus samples, as conventionally recognised from central and eastern northern Australia form a distinct cluster (Pp=1.0), however this lineage also includes samples, that show only limited divergence, identified as C. albertisii from

southern New Guinea west of Daru (BEN). This is in contrast to samples also identified as C. albertisii from three separate locations (TAM, ORI and MTB) each of which are sufficiently divergent to potentially represent separate, undescribed taxa. Further, a group of samples putatively identified as C. quadricarinatus from the western part of its distribution in the Northern Territory (RAC, HOS, ORD, and

HOR) form a well defined lineage (Cherax sp.nov.1 – Table 2.1) that is quite distinct from the more easterly samples of this species (C. quadricarinatus sensu stricto) with an average divergence of 3.30% between the two species. The complexity of the relationships within the red claw lineages and levels of divergence with and between putative species is effectively summarised by the multidimensional scaling analysis

(Fig 2.8). The samples of C. lorentzi, C. quadricarinatus sensu stricto and Cherax sp. nov.1 each form discrete clusters well separated from each other. It can also be seen that the samples of C. abertisii from New Guinea are highly heterogenous, with some samples (BEN) clustering with the Australian samples of C. quadricarinatus sensu stricto and others (TAM, ORI and MTB) showing various levels of divergence from each other and the other members of the redclaw species complex. As with the New

Guinea lineage A, the deeper level relationships among the three lineages within lineage B are unresolved. 72

Figure 2.8. MDS plot of uncorrected genetic similarity among red claw clades (C. albertisii, C. quadricarinatus, C. bicarinatus, C. sp.nov.1., C. lorentzi, C. nucifraga, C. barretti, and C. rhynchotus). Individual sample codes for each species are given in Table 2.1.

2.3.4. Molecular Clock Analysis

Figure 2.9 shows the BEAST tree from a dating analysis using a strict clock with the maximum-clade-credibility phylogeny overlain with the 95% highest posterior density (HPD) intervals of divergence times and Bayesian Posterior probabilities (Pp). The parameter estimates for the ucld.stdev and the coefficient of variation were 0.33 and 0.32, respectively, indicating that the data were close to clock-like with only low rate-heterogeneity among lineages. Branching order for Fig.

2.9 was almost entirely congruent with Fig. 2.2 (the MrBayes tree from the 16S analysis); however, there were some notable differences. 73

In the BEAST analysis of the 16S rRNA partition, node bars in Fig. 2.9 are highly variable (i.e. 95% HPD intervals are large), but are reduced towards the terminal nodes of the tree i.e. further from the root. Estimates of divergence times were not statistically valid for some nodes in the phylogeny, shown as nodes without node bars. As the 95% HPD intervals are large and mostly overlapping, these estimates of divergence times should be considered as approximate only. The divergence of the three main lineages within Cherax most likely occurred between

15-10 Ma (mid Miocene). The separation of the two main lineages within the northern Australia and New Guinea clade is estimated to have happened between 10-

5 Ma (late Miocene). Most speciation within the northern and New Guinea species appears to have occured between the late Miocene and Pliocene (7 – 2.5 Ma). The two highland lineages (C. monticola and Wissel Lakes species) are relatively deep and extend well into the early Pliocene and possibly late Miocene. Recent diversification within both lineages is estimated to have been restricted to the

Pleistocene. This estimation also applies for the red claw lineage which consist of

Cherax quadricarinatus, C. albertisii, C. bicarinatus, C. lorentzi, C. barretti,

C. rhynchotus, C. nucifraga and Cherax sp.nov.1 (C. cf. quadricarinatus). 74

Figure 2.9. Bayesian tree and molecular clock estimates for Cherax lineages based on analysis of mitochondrial 16S rRNA. Horizontal bar represents the 95% highest posterior density ranges. 75

2. 4. Discussion

This study presents the first comprehensive molecular taxonomic and phylogenetic review of the diverse and remotely located Cherax fauna of northern

Australia and New Guinea, including the diverse and enigmatic highland species from the New Guinea central mountain range. Sequence data were obtained for a total of 20 putative species from the region, which represents the first sequence data for all but three of these species. The level of taxonomic sampling includes all but 4 putative species with efforts to obtain sequences from C. minor, C. papuanus,

C. aruanus (New Guinea) and C. wasselli (Australia) unsuccessful for this study. The implications of these finding for the taxonomy of Cherax and the understanding of the evolution and biogeography of the genus in northern Australia and New Guinea are discussed below.

2.4.1 Molecular Taxonomy

The results of this study contribute significant new information or perspectives on several aspects of the current taxonomy of Cherax. These include strong evidence for cryptic speciation in relatively well studied taxa, resolution of some long standing taxonomic issues involving some of the earliest described species of Cherax, significant undocumented species diversity in poorly sampled areas and lack of evidence to support a number of species amongst both the distinctive highland lake species of Papua and Australian species.

The most surprising result is the failure to find any support for more than a single species within the Wissel Lakes complex in the highlands of Papua, Indonesia.

The data set included at least one fragment of the 16S gene from all putative species, 76

together with sequences from fresh samples for Lake Paniai and the previously unsampled Lake Tage, that were screened for variation at four loci. Based on

Holthuis‟ work (1949) the Wissel Lakes have eight putative species and while several of these species are morphologically similar there are several that have extreme phenotypes (Figure 1.3) nowhere else reported for the genus and south hemisphere crayfish in general. This level of local species richness within a single genus is also unprecedented for both south and northern hemisphere crayfish. There are several possible explanations for the disconnect between morphological and molecular divergence. Based on the molecular clock analysis and geological history

(see below) it is clear that the Wissel Lakes fauna originated from a single invasion of a quite divergent species that became established more than 1 million years ago.

Firstly, the Wissel lakes crayfish may be polytypic as a result of habitat differences within the lakes and associated subterran environments and local adaptation. The lakes are relative deep (~100 m) and fed by subterranean fluvial systems in what is largely a karst system. Further there are number of distinct shallow water habitats including rocky and pebble-based, riparian and dense algal rafts, and soft and fine sediments. Given the size of the lake coupled with the generally limited dispersal ability of crayfish it is thus possible that the populations have become established that are adapted to local environments.

An expectation would that crayfish from different environments would be able to interbreed. A similar model was proposed by Austin & Knott (1996) to account for high levels of habitat related diversity between allopatric populations of

Western Australian Cherax species. Alternatively, it maybe that a similar scenario has applied, but has led to reproductive isolation and incipient speciation, but without 77

substantial sequence divergence due to the relatively short time crayfish have been within the lake system. This model would be similar to those proposed for other young large lake or lake systems with high diversity among closely related species

(Salzburger & Meyer 2004; von Rintelen et al. 2007; Macdonald III et al. 2005).

Significant taxonomic disputation and confusion has surrounded the number and identity of species that is referred to as the C. quadricarinatus – C. albertisii complex, which are identifiable on the basis of red soft membraneous outer margin of the propodus of the claw. The earliest taxonomic reviewers of the genus Cherax,

(Smith 1912; Calman 1911; and Clark 1936), considered there was no justification in considering C. quadricarinatus, a large freshwater crayfish, described by von

Martens (1868) from northern Australia to be taxonomically distinct from C. albertisii described by Nobilli (1899) from southern New Guinea. This view also extended to the species C. lorentzi and C. aruanus described by Roux (1911) from

Papua. In contrast, Holthuis (1949; 1950; 1982) considered C. quadricarinatus, C. albertisii and C. lorentzi to be taxonomically distinct, with the former species restricted to Australia and the later two species occurring in New Guinea.

My results support the position of Holthuis in that C. lorentzi appears to be specifically distinct based on the phylogenetic analysis and the degree of divergence.

There is also evidence to support the recognition of C. quadricarinatus and C. albertisii, however there is much greater taxonomic diversity within this complex than previously realised. The recognition of two species within C. quadricarinatus, consisting of a western form from the Northern Territory and eastern form from northern Queensland and extending into southern New Guinea is supported by the findings of Baker et al. (2008). These authors examined 16S rRNA variation (their 78

sequences were used in this study) and also microsatellite variation and considered the two forms were behaving as separate species. Their findings were also consistent with Austin (1996) in that the eastern form from northern Australia also extended its distribution into southern New Guinean in at least the vicinity of Daru. Baker et al.

(2008) erroneously followed Riek (1969) by applying the name C. bicarinatus to the western form of “C. quadricarinatus”. Cherax bicarinatus represents an entirely different species of crayfish which is broadly sympatric with “C. quadricarinatus” across the Northern Territory (see below) which has only recently been rediscovered, but is clearly taxonomic distinct based on the results of this study. Thus the western form of the C. quadricarinatus – C. albertisii complex is an undescribed new species, based on the assumption that the original description of C. quadricarinatus by von Martens most likely applies to the eastern form from Queensland, which is reasonable as the type locality is given as Cape York (von Martens, 1868).

The results indicate that previously conceptualisation of Cherax albertisii as a close relative of C. quadricarinatus from south central New Guinea cannot be maintained. Some samples (BEN) of what were previously identified as C. albertisii clearly represent C. quadricarinatus. However, another sample (ORI) from within

200 km of the BEN samples, is sufficiently divergent to be consistent with a separate taxon, identifiable as C. albertisii. In additional, two other samples, collected from several 100 km apart and putatively identified as C. albertisii are also highly divergent from each other and the ORI sample. It is also possible that one of these forms (TAM or MTB) may be consistent with the species C. divergence described by

Holthuis (1950), but considered latter by him to be a synonym of C. albertisii (1982).

The sample ORI most likely represents C. albertisii as this location (the Oriomo 79

River near Daru) is adjacent to the Katau River, the type locality given by Nobili

(1899) which is within 15 km to the northwest of Daru.

The taxonomic complexity and the wide range of taxonomic opinions of this group has generated are not surprising, given the taxonomic issues that have plague the members of the genus Cherax. Austin & Knott (1996) and Austin (1996) found high levels of morphological variation, including taxonomic characters, within and between species of Cherax. This made the definition of species based on purely morphological data problematic especially for widespread taxa, which are able to exploit a range of environments and frequently display geographic variation. The characters used to differentiate C. quadricarinatus, C. albertisii and related taxa focus predominately on a suite of attributes that are often highly variable, including the number of rostral spines, the length and degree of development of the rostral carinae and the size and shape of the propodus. Thus it is obvious that a more detailed molecular and morphological study of variation with the C. quadricarinatus–albertisii group is required with more intensive sampling in both northern Australia and southern New Guinea to confirm the number of taxa and identify, if possible, diagnostic morphological traits for these species.

The identity, of Cherax bicarinatus, one of the first described species of

Cherax has long been perplexing (Clark 1936; Riek 1969; Short 1991; Short & Davie

1993). Described by Gray (1845) as Astacus bicarinatus with a type locality of Port

Essington (central northern of Northern Territory) it has been variously associated with entirely different species from central and eastern Australia and also from the south west of Western Australia. Riek (1969) applied the name to a large crayfish from the Northern Territory closely related C. quadricarinatus. Austin (1996)

following Riek considered these two forms belong to the same species but recommended the name C. quadricarinatus be used due to the uncertainty with regard to the identity of C. bicarinatus and the validity of the type locality. Baker et al. (2008) provide convincing evidence that there are western and eastern forms of

“C. quadricarinatus” that likely valid species, a position supported by the results of this study. However the application of the name C. bicarinatus is not considered appropriate, now that an additional species of Cherax has been found in the Northern

Territory that is widespread and consistent with the description and diagram of C. bicarinatus and the type material located in the British Museum (examined by Chris

M. Austin). Cherax bicarinatus as identified in this study is also largely indistinguisable from Cherax rhynchotus described by Riek (1951) from Cape York and samples of C. barrettii, obtained from its type locality (Wessel Islands, Northern

Teritory) based on 16S sequences. Figure 2.10 gives photographs of the type specimens of C. bicarinatus, a specimens from Blue Mud Bay in the Northern

Territory and a specimen of “C. cf. quadricarinatus” from the Northern Territory. It is clear from these images that the type specimens show a close resemblance to the

Blue Mud Bay specimens as the rostrum is broad relative to the distance between the postorbital spines and the rostral carina barely extend onto the cephalon compared to the C. quadricarinatus specimen. Thus the names for these two species,

“bicarinatus” and “quadricarinatus” are entirely appropriate and highlight the main distinguishing features for these species.

A B

C D E

Figure 2.10. The type series (A) and holotype (B) of C. bicarinatus from the British Museum and comparison of samples of C. bicarinatus (Blue Mud Bay – C), C. rhynchotus (Jardine River – D) and C. quadricarinatus (Rocky Pools, Arnhem Land – E); see Austin (1996) for locality details for D and E.

2.4.2. Molecular Phylogeny

The inferred phylogeny supports a monophyletic origin for the northern

Australia and New Guinea species of Cherax that is consistent with the molecular genetic and phylogenetic studies of Munasinghe et al. (2004) and Austin (1996a; and

1996b) who identified three geographically-based lineages within Cherax. These consisted of a southwestern group, an eastern group and a northern group. Support for the latter group however was based on only very limited sampling (eg. single samples of C. quadricarinatus, C. rhynchotus and C. peknyi in Munasinghe et al.‟s study). Thus the much more extensive sampling in this study greatly strengthens

support for these three geographically-based lineages. Nevertheless, complete confidence in this hypothesis can only be fully tested with complete taxon sampling and it should be noted that there are still a number of species from both Australia and

New Guinea for which data is yet to be obtained.

The phylogenetic relationships recovered in this study are generally at odds with earlier views defining relationships within Cherax based on morphology and using species group designations (Holthuis 1949; 1950; 1982; 1986; 1996; Lukhaup

& Pekny 2006; 2008; Lukhaup & Herbert 2008; Riek 1969; and Short 1991) which are summarized in Table 2.3. Holthuis (1949) in his major treatise on the New

Guinea Cherax considered species could be placed into two groups. One with the rostral and median carine absent or only feebly developed and refered to as the

Cherax group following the characteristics of the type species, C. preissii (Erichson) from the southwest of Australia. The other group contains species that have rostral and sometimes the median carina well developed and refered to as the Astaconeprops group with Nobili‟s (1899) Astaconeprops albertisii acting as the type3. While

Holthuis (1949 and 1950) did not formally use subspecific designations, in his biogeographic papers he indicated that the New Guinea species could be placed in one of two subgenera and formally applied a subgeneric epithet in his figures, but without a formally description of either subgenus. In his later paper describing a new species, C. minor, Holthuis (1996) formally placed this species in the subgenus

Astaconephrops. Subsequent authors considering New Guinea species followed

Holthuis (1982; 1986; 1996) and placed newly described species into one or other of the two subgenera (Lukhaup & Pekny 2006; Lukhaup & Pekny 2008; Lukhaup &

3 This latter genus was considered identical with Cherax by Roux (1911), Calman (1911) and Holthuis (1949). 83

Herbert 2008). Holthuis‟ concept of the Astaconeprops group changes over time and by the time he described Cherax (A) minor, only noted the presence of an unclacified patch on the claws of males as justification for its placement in the subgenus

Astaconephrops and did not refer to the nature of the postorbital and rostral spines and ridges which are quite reduced in this species. Other authors (Riek 1951; 1967;

1969; and Short 1991) considering Australian species of Cherax appear to have been unaware or ignored Holthuis‟(1949; 1950; 1982; 1986; and 1996) treatment. While

Riek (1969) also refers to an Astaconephrops species group he does not cite Holthuis and only makes passing reference to New Guinea species. Based on a generalised morphological assessment, Riek (1969) placed within his Astaconephrops species group the northern species C. bicarinatus, C. quadricarinatus, C. barretti, C. rhynchotus, and the southwestern species C. tenuimanus and he considered the New

Guinea species C. lorentzi, C. albertisii and C. divergens to be closely related to C. quadricarinatus and therefore by implication part of this species group. Table. 2.3. Summary of phylogenetic relationships and species group designations for northern Australian and New Guinean Cherax

Species group or lineage Munasinghe et al. Holthuis (1949) and othersA Riek (1969) Short (1991) This study Region Species (2004) northern northern Cherax Astaconephrops Astaconephrops quadricarinatus northern Lineage Lineage A Lineage B Australia C. bicarinatus − −  − − -  C. quadricarinatus -     -  C. barretti − −   − -  C. rhynchotus − −    -  C. nucifraga − −   − -  New Guinea C. albertisii -   − − -  C. lorentzi -    − -  C. lorentzi aruanus -    − − − C. misolicus -  −  −  - C. buitendijkae  - − − −  - C. boschmai  - − − −  - C. communis  - − − −  - C. longipes  - − − −  - C. murido  - − − −  - C. pallidus  - − − −  - C. papuanus  - − − − − − C. paniaicus  - − − −  - C. solus  - − − −  - C. divergens -    −  - C. monticola -  −  −  - C. minor -  − − − − − C. holthuisi  - − − −  - C. boesemani -  − − −  - C. peknyi  - − −   - A Holthuis (1949; 1950; 1982; 1986; 1996); Lukhaup & Pekny (2006; 2008), and Lukhaup & Herbert (2008) 84 85

The phylogenetic relationships established in this study together with the results of Munasinghe et al. (2004b) indicate that the division of Cherax into two subgenera, as conceived by Holthuis and subsequent authors dealing with New Guinea has to be abandoned. There is no evidence for a “Cherax” group as species lacking a soft patch are divided across all the major lineages recovered in Cherax with the exception of lineage B in this study. Further, it is clear from this study that the presence of soft patch is not a unifying apomorphic character as suggested by Lukhaup & Herbert (2008).

While all species in lineage B possess this trait, C. misolicus, C. monticola and C. boesemani also have this trait but are placed in Lineage A, together with a number of species lacking this trait. Further both Holthuis (at least in his earlier papers) and Riek‟s conceptualisation of the Astaconephrophs species based on Cherax that have from 4 to

5 distinct ridges is not supported either, as Cherax tenuimanus (5 distinct ridges) is aligned with western Australian species and other species that are phylogenetically aligned with the Cherax quadricarinatus, C. albertisii and C. lorentzi group have reduce development of ridges (C. bicarinatus, C. nucifraga, and C. minor).

Thus the molecular phylogeny is consistent with the concept that C. tenuimanus belongs to the southwest species groups (Austin 1996a; Munasinghe et al. 2004) but exhibits convergent morphological similarities with C. quadricarinatus and it‟s allies.

This arrangement is also very similar to Short‟s (Short 1991) “C. quadricarinatus” species complex in which he also included the newly described C. nucifraga and C. monticola on the basis that all species are united on the basis of a presence of an uncalcified patch. While he surprisingly ommited C. albertisii, lineage B is consistent with his conceptualisation of relationships, with the exception that C. monticola is placed within lineage B. 86

2.4.3 Zoogeography and divergence times

The phylogenetic relationships and associated divergence times estimated in this study both extend and confirm earlier research on Cherax and provides new insights into historical patterns of dispersal and the evolutionary history of the genus Cherax.

Finding that Cherax from northern Australia and New Guinea form a monophyletic group that is distinct from both the southwestern and eastern species is consistent with the findings of Austin (1996a; 1996b) and Munasinghe et al. (2004), that the genus consists of 3 deep geographically-based lineages. Further, the dating estimates in this study (13 Mya with a 95% confidence of 21-7 Mya) are consistent with the views of

Munasinge et al. (2004) that these deep lineages are a result of widespread dispersal and subsequent diversification from a common ancestor in the early to mid Miocene (10-19

Mya). The relationships between the three lineages remains unresolved and requires more data in terms of nucleotides and taxon sampling, but the possibility exists that they represents an essential contemporaneous evolutionary split (Munasinghe et al. 2004).

A number of studies using molecular approaches have found complex patterns of species exchange between Australia and New Guinea for several Australian groups of animals with Gondwanan origins during the late Miocene to the Pliocene that most likely resulted from land bridge connections. These include research on freshwater fish

(McGuigan et al. 2000; Unmack et al. 2013), snakes (Rawlings and Donnellan; 2003;

Kuch et al., 2005; Wüster et al. 2005), bandicoots (Westerman et al., 2012), turtles

(Georges et al. 2014), small birds (Norman et al. 2007; Driskell et al. 2011; Kearns et al.

2013), and arboreal marsupials (Malekian et al. 2010; Meredith et al. 2010). The postulated initial dispersal of Cherax from northern Australia to New Guinea in the late

Miocene is inconsistent with earlier views that Australia and New Guinea were isolated from the early Miocene to the Pleistocene (Flannery 1989), a position that has also been 87 challenged by a number of studies (e.g. Malekian et al. 2010; Meredith et al. 2010,

Westerman et al. 2012). The dating of the establishement of the New Guiena lineage of

Cherax at 6 Mya is similar to the estimated time for the divergence of freshwater turtle species Emydura worrelli (Australian) and E. subglobosa (New Guinea) at 5.4 Mya

(Georges et al. 2013); between Australia and New Guinea lineages within the glider species Petaurus breviceps estimated at 5.8 Mya (5.2-6.5 Mya) (Malekian et al. 2010) and within Australo-Papuan distributed elapid snakes (Acanthophis laevis group) 7.82-

5.60 Mya (Wüster et al. 2005). Geological evidence supports a late Miocene land bridge that would have facilitated dispersal of crayfish through the development of interconnections between northerly and southerly flowing rivers and associated wetlands (Hall 2001; Malekian 2010; Meredith 2010).

Another important geological consideration influencing the biogeography of

Cherax in New Guinea is the presence and timing uplift of the central mountain range.

The island of New Guinea in its current topography is not very old with the central mountain ranges running east to west through the center of New Guinea the result of a major period of uplift from the mid to late Miocene (Loffler 1977; Hill & Gleadow

1989; Georges et al. 2014). This range reached a height close to its current elevation

(3,000 m+) by the end of the Miocene (Baldwin et al. 2012; Johns et al. 2007) and it sharply delineates northern and southern water sheds. The height of these ranges presents a significant faunal barrier to many kinds of organisms, especially those adapted to freshwater and lowland tropical environments (Georges et al. 2014; Unmack et al. 2013). Holthuis (1982) noted that the distribution of Cherax in New Guinea “keep strictly to the [biogeographic] rules” as it mirrors the demarcation by the dividing range of the northern and southern drainages from the Kikori River system in the east to western portion of the Birds‟ Head Peninsula. The fact that the uplift of the central

88 range predates the dispersal of Cherax to New Guinea explains the limitation to the genus‟ distribution and provides the basis for Holthuis‟ observation. Holthuis (1982) concluded that the distribution of Cherax provided evidence for the Sahul land bridge and that the rivers now flowing into the Arafura Sea “once formed a single drainage with northern Australian rivers”

The above scenario does not hold true for other Australian freshwater groups that have dispersed to New Guinea from Australian as both freshwater turtles and rainbow fish have distributions that extend into northern New Guinea (Georges et al.

2014; Le et al. 2013; Unmack et al. 2013). However, molecular dating studies suggest that these groups radiated into New Guinea much earlier than Cherax, nevertheless the subsequent evolution of these groups within New Guinea has been significantly influenced by the biogeographic barrier presented by the central mountain range.

This study also indicates that despite the New Guinea lineage of crayfish being relatively young, the ancestral species that invades New Guinea were able to effectively disperse and exploit a range of aquatic environments. These include the lowland environments of the Bird‟s Head Peninsular which formed at approximately 10 Mya

(Hill & Hall 2002; Unmack et al. 2013) and is now known to contain at least 6 species of Cherax, four of which are new to science, and mostly likely with new species waiting discovery as a result of more systematics sampling. New Guinean also has deep highland lakes and possible subterranean systems and rivers, some at over 3,000 M, with water temperatures below 10°C that are inhabited by Cherax (Holthuis 1949; 1950)

– environments that are radically different from the mostly slow flowing, warm and often turbid aquatic environments from northern Australia.

A second more recent dispersal event from Australia to New Guinea is estimated to have occured during the late Pliocene (3.0 Mya). Such a date coincides relatively

89 close with the earliest Pliocene land connection between southern New Guinea and

Australia at about 3.3 Mya according to Chivas et al. (2001) and Kearns et al. (2013).

This dispersal event involved the common ancestor of the „red claw‟ lineage, which is placed within the second major northern Cherax lineage comprising all the Australian species and low land New Guinea species. While the 2 most basal species in this lineage are Australian (C. nucifraga and C. bicarinatus) the „red claw‟ lineage subsequently became established with C. lorentzi located in the central Papuan lowlands and its sister lineage, which evolved into the C. albertisii-C. quadricarinatus species complex, occuring widely across northern Australia and into southern most portion of New

Guinea in south eastern Papua, Indonesia and south western Papua New Guinea. This species complex contains two putative Australian species, and possibly another three potential taxa from southern New Guinea. The Australia species Cherax quadricarinatus (sensu stricto) together with C. bicarinatus also have populations in the extreme south west of Papua New Guinea indicating there has been a third very recent transfer of crayfish between the two land masses (Austin 1996; Baker et al. 2008).

Baker et al. (2008), whose 16S data was used to augment the data presented in this study, considered two scenarios involving two colonization events to explain the patterns of genetic divergence within the „red claw‟ (C. quadricarinatus–sensu stricto and C. cf. quadricarinatus). They first proposed an intial colonisation in the Miocene to give rise to the New Guinea lineages (exclusive of C. lorentzi which was not sampled by them), followed by a second very recent one (Pleistocene colonization). The second scenario involved the initial „red claw‟ evolution in New Guinea, followed by three back migrations. These hypotheses can be reevaluated with the larger data set available in this study, which includes much greater taxon sampling and reveals another distinct

“red claw lineage” from southern New Guinea from Tanah Merah. Firstly, my dating 90 suggested that the major diversification in the „red claw‟ lineage occurred in the late

Pliocene or early Pleistocene rather than the Miocene in contradistinction to Baker et al.

(2008). Baker et al‟s (2008) second hypothesis is incompatible with the larger data set which indicates that the C. lorentzi-„red claw‟ clade emerged from the major Australian clade. Thus their first hypothesis of an Australian origin for the „red claw‟ clade is both consistent with the new phylogenetic information and is more parsimonius as it requires fewer colonisation events. Although, it should be noted it is also equally plausible that there were one of more reverse migration events from New Guinea.

An alternative approach to explaining the patterns of speciation in the „red claw‟ to speciation scenarios based on occasional dispersal, is a vicariance model. A plausible scenario is that during periods when a land a bridge was present many if not the majority of river systems flowing into the Arafura Sea both within and between New

Guinea and Australia would be linked and allow wide spread dispersal of crayfish within a relatively short geological period of time. This scenario of rising sea levels would not only have isolated crayfish from New Guinea and northern Australia but also between major catchments within each land mass. What makes this scenario compelling is that all the major lineages in the „red claw‟ clade are allopatric and the more divergent clades are from areas which would have had ancestral populations isolated (or the most frequently isolated) earlier as the sea inundated the land bridge from east to west, and lesser extent from west to east. For example C. lorentzi would have been become isolated first, followed by Tanah Merah, and Mount Bosavi, in the west. The last pair to be split would have been the 2 geographically closest, C. quadricarinatus

(sensu stricto) and the Oriomo sample which is closest to where the last land bridge links would be in the shallowest and geographically proximate to the Torres Straight.

As emphasised by Baker et al. (2008) additional studies are required with much more

91 intensive sampling in both southern New Guinea and northern Australia to fully resolve both the evolutionary history of the „red claw‟ lineage and the taxonomy and it is highly likely that additional cryptic lineages may be discovered especially in the large water shed of southern New Guinea.

Like C. quadricarinatus, C. bicarinatus also has a wide distribution across northern Australia and also like C. quadricarinatus has been found in southern New

Guinea just north of the Torres Straight (Austin 1996). Cherax bicarinatus show much less geographic diversity than C. quadricarinatus which may indicate it has greater powers of dispersal. This may be due to exploitation of shallow lentic environments such as large freshwater swamps and the ability to burrow in order to survive seasonal droughts. Lastly it is apparent that dispersal of species between the two countries has been very recent as both the widespread Australian species (C. bicarinatus and C. quadricarinatus sensu stricto) occur in the southern part of Papua New Guinea (Austin

1996; this study). Such dispersal could have occurred as recently as 10 Kya during the last glacial cycle when a land bridge connected northern Australia and southern New

Guinea. Baker et al. (2008) emphasised that evidence for a large freshwater lake – Lake

Carpentaria (Chivas et al. 2001; Reeves et al. 2007; Voris 2000) at this time would have facilitated crayfish dispersal between Australia and New Guinea.

2. 5. Conclussion

This study was the first attempt to review the molecular systematics and construct a robust phylogeny of the New Guinean Cherax genus. This has contributed significant new knowledge about phylogenetic relationships amongst the northern

Australia and New Guinea Cherax using 16S sequences and combination of four gene regions (16S+12S+COI+GAPDH). The New Guinean crayfish do not form a 92 monophyletic group but share relationships with northern Australia species at different evolutionary depths, which is consistent with the geological history of the region. The diverse highland Cherax fauna of the Wissel Lakes form a well support monophyletic group but show minimal molecular divergence, which is at odds with their high morphological diversity. This study also revealed at least five new species of the genus

Cherax from New Guinea and northern Australia based on molecular evidence and highlights the need to reconceptualise species boundaries for a number of long standing species. Lastly, the estimated phylogenies did not support the separation of Cherax into two subgenera as proposed by Holthuis and other recent authors.

hgdfhgdfhdhdfbdff CHAPTER 3

General Discussion

3.1. Significance of Research findings

Our knowledge of the molecular systematics and evolution of crayfish at a range of taxonomic levels has advanced significantly over the last 15 years for both southern and northern hemisphere genera and species (Apte et al 2007; Austin & Ryan 2002;

Austin et al. 2003; Braband et al. 2006; Buhay et al. 2007; Crandall et al. 1999; 2000a;

2000b; Crandall & Buhay 2008; Grandjean et al. 2000a; Grandjean 2002a; Grandjean et al. 2002b; Grandjean et al. 2006; Filipova et al. 2010; Fratini et al. 2005; Ponniah &

Hughes 2006; Nguyen et al. 2004; Nguyen & Austin 2005; Maguire et al. 2014

Munasinghe et al. 2003; 2004a; 2004b; Shull et al. 2005; Schultz et al. 2007; 2008;

2009; Schubart & Huber 2006; Sinclair et al. 2004; Toon et al. 2010; Trontelj et al.

2005; Zaccara et al. 2004). While members of the genus Cherax are one of the best known and best studied crayfish species, a major knowledge gap has been our lack of understanding of the molecular taxonomy and diversity of crayfish of this genus that occur in the remote and difficult to access regions of northern Australia and New

Guinea.

Within this context this thesis largely fills this important knowledge gap in freshwater crayfish diversity. Specifically, I assembled a comprehensive set of samples obtained both from the field and museum collections for the mitochondrial rRNA 16S gene fragment with a subset of these samples also sequenced for the mitochondrial

12SrRNA and COI gene fragments and a nuclear gene fragment (GAPDH). This DNA sequence data were used to examine both systematic and biogeographical questions and

94 expands our understanding of the evolutionary history of Cherax from northern

Australia and New Guinea (Indonesia and Papua New Guinea). This study thus extends and is complementary to studies of Cherax from southern Australia (Austin 1995,

Austin & Knott 1996; Austin 1996; Austin et al. 2003; Munasinghe et al. 2004a;

2004b).

One key finding is that the Cherax fauna of New Guinea is more diverse than previously thought with evidence for a minimum of six and possibly as many as eight new species. Four of these come from what is a still poorly sampled areas of west Papua in the Bird‟s “head” and “neck” region (Fakfak) and two from eastern Papua New

Guinea (sites MTB and TAM). In addition, my study confirms that the “red claw” crayfish most likely consists of two species with a phylogenetically distinct form from the Northern Territory consistent with Baker et al. (2008). This species will required a new description and name as the name applied by Baker et al. (2008) is occupied by a separate and distinct species, C. bicarinatus from the Northern Territory, which is quite distinct and wide spread across northern Australia.

Conversely, my study found that there are several named species that are of doubtful validity, or represent a taxonomic complex of forms that have recently evolved. The most surprising and significant result is that I could not find any genetic evidence for more than a single species from the morphologically diverse Wissel Lakes crayfish fauna. There are several possible factors that may help account for this extraordinary conflict between the results of traditional taxonomy and morphology

(Figure 1.3) on the one hand and molecular genetic data on the other (see Figures 2.3,

2.4 and 2.6). One possibility is incipient or parapatric/sympatric speciation within and between these large lakes have resulted in morphological divergence with only limited genetic divergence such as in European whitefish (Coregonus lavaretus L.) in Lake

Femund, Norway (Østbye et al. 2005) and Chiclids from Lake Malawi, Africa (Shaw et al. 2000). While there is some extreme morphologies presented by species in the Wissel

Lakes, another possibility is that some of the species may not be taxonomic valid with the morphological characters used to distinguish species possibly unreliable. In the field

I examined at least 15 adult specimens of C. communis and C. murido and found them very difficult to distinguish. The two species are morphologically very similar and the distinguishing characters given by Holthuis (1949) with respect to the distribution of tubercles of carapace (C. communis having smaller and dense tubercles and C. murido having bigger and more spaced tubercles) difficult to assess and with character states overlapping. Holthuis (1949) also states that C. murido is also morphologically similar to C. buitendijkae and C. pallidus and differ only with respect to the size and shape of the claws and the degree of tuberculation. In addition, Holthuis (1949) reports high levels of morphological similarity between C. communis and C. paniaicus with the species only distinguished by minor diffrences in the shape of the chelae and rostrum, characters that are known to highly plastic in Cherax (Austin & Knott, 1996). Similarly, there are also high levels of morphological similarities between what can be referred to as species pairs between Lake Tigi and Lake Paniai, viz. C. paniaicus (Lake Paniai) and

C. solus (Lake Tigi) and C. pallidus (Lake Paniai) and C. boschmai (Lake Tigi). Given

C. communis is common to both lakes there has obviously been opportunities for migration and gene flow between these lakes in the relatively recent past. Resolving this conflict of high levels of morphological variation without significant genetic divergence will be one of the most interesting, pressing and challenging condrums for freshwater crayfish systematic and of great interest to evolutionary biologists and speciation specialists more generally. 96

In addition, the genetic analysis of what can be refered to as the “white-claw” crayfish complex from across northern Australia, comprising the putative species,

C. bicarinatus, C. barretti and C. rhynchotus, is consistent with only a single widespread species that also extends into southern New Guinea (Austin 1996). The oldest available name for this species C. bicarinatus originally recorded from Port

Essington, Northern Territory, which resolves, finally, what has been the subject of major confusion and disputation in Cherax nomenclature (Clark 1936; Holthuis 1949;

Riek 1969).

The phylogenetic analysis indicates that the northern Australian and New

Guinean crayfish form a monophyletic clade, distinct from the western and eastern clades established for the genus by previous studies (Munasinghe et al. 2004b; Schultz et al. 2009). This therefore supports Munasinghe et al.‟s model of endemic species within Cherax, that contrasts with earlier evolutionary models and taxonomic hypotheses (Riek 1969; Holthuis 1949; 1982) that implicity require Cherax species to have unrealistic powers of dispersal for a freshwater dependent group (Munasinghe et al. 2004b). In this context it is recommended that the current subgeneric designations for Cherax be abandoned as it is not consistent with the phylogenetic relationships and requires remarkable biogeographic connections between species from southern

Australia and New Guinea. The phylogenetic analysis also indicate that speciation, as in

Australia (Munasinghe et al. 2004b), has largely been on a regional basis within New

Guinea as there is a well supported lineage that contains all the highland and western species. Nevertheless there is also a complex of species form the central lowlands that forms a clade with northern Australian species indicating that close biogeographical connections between these regions.

A biogeographical interpretation of the phylogenetic hypotheses and dating estimates indicated a complex biogeographic history for Cherax spanning the north of

Australia and southern New Guinea region. Given that that the genus Cherax is thought to have evolved in southern Australia (Riek 1969; Riek 1972; Holthuis 1949; Holthuis

1982) the most likely scenario is that a single ancestral Cherax species invaded northern

Australian river systems in the mid to late Miocene (Munasinghe et al. 2004) during flooding events in low relief areas that connected normally southern flowing drainages with northern ones. Subsequently in the later Miocene Cherax would have been able to penetrate into New Guinea river systems during period of lowered sea levels, which would have created a land bridge and the continent of Sahul (Hall 2001; Malekian 2010;

Meredith 2010) with common drainages between northern Australia and New Guinea.

Such a scenario is consistent with other species groups with similar distributions to

Cherax (Wüster et al. 2005; Malekian et al. 2010; Georges et al. 2013). Geological evidence supports a late Miocene land bridge that would have facilitated dispersal of crayfish through the development of interconnections between northerly and southerly flowing rivers and associated wetlands (Hall 2001; Malekian 2010; Meredith 2010).

However it is clear that the elevation of the central New Guinea mountain range predated the arrival of Cherax species in central New Guinea, as Cherax follows the

“biogeographic rules” by not occurring to the north of this range (Holthuis 1982).

Since the original dispersal of Cherax into New Guinea there has been additional exchanges between northern Australia and New Guinea, including most likely the establishment of C. lorentzi and current sharing of the species C. bicarinatus

(as re-defined in this study) and C. quadricarinatus (also as re-defined in this study) between the two regions.

3.1.1. Cherax diversity – an overview

Based on molecular genetic evidence this study support the recognition of a minimum of 14 species of Cherax endemic to New Guinea, consisting of seven named species (C. monticola, C. peknyi, C. holthuisi, C. boesemani, C. misolicus, C. albertisii, and C. lorentzi), six new species (Cherax sp.nov.2, C. sp.nov.3, C. sp.nov.4, C. sp.nov.5, C. cf. albertisii-MTB and C. cf. albertisii-TAM), with the Wissel Lakes crayfish fauna conservatively reduced to a single polytypic species and the status of other four named taxa yet to be examined using molecular data (C. divergens, C. minor,

C. papuanus and C. lorentzi aruanus). Similarly, this and previous molecular studies

(Austin 1996; Baker et al. 2008) supports the recognition of five species of Cherax from northern Australia with two of these species also occurring in the extreme south of New

Guinea (C. bicarinatus and C. quadricarinatus). These results now allow a synthesis of data from molecular systematic studies on Cherax spanning its entire distribution obtained over 15 years (Austin 1995b; Austin 1996; Austin & Knott 1996; Austin &

Ryan 2002; Austin et al 2003; Nguyen et al. 2004; Nguyen & Austin 2005; Munasinghe et al. 2003; 2004a; 2004b).

A summary of all the results and conclusions of all molecular genetic studies on

Cherax is given in Table 3.1 using a list of formally described species for Australia principally after Riek (1969) for Australia and Holthuis (1949, 1950, 1996) for New

Guinea, but inclusive of more recently described species (Lukhaup & Pekny 2006;

Lukhaup & Pekny 2008; Lukhaup & Herbert 2008; Short 1991; 1993; Coughran 2005;

Austin & Ryan 2002). Based on the summary given in Table 3.1 a total of 59 species of

Cherax have been recognized. All but four of these species, C. minor, C. papuanus from

New Guinea and C. cartalacoolah and C. urospinosus (presumed extinct) from

Australia, have been examined using either allozyme or nucleotide data or both (see 99 references above). Assuming these species to be valid, the recognition of an additional

26 species is supported by molecular data. However, no molecular evidence was found to support 18 nominal species, highlighting the difficulties with the use of morphological data and the trend for crayfish taxonomists to distinguish species using only minor morphological differences, often based on an analysis of a limited number of specimens. Conversely, the molecular data has supported the recognition of 10 new species, of which only 3 have been formally described (C. cainii, C. peknyi and mostly likely C. leckii). With the increasing application of molecular data to freshwater crayfish, it is becoming apparent that the occurrence of cryptic species of crayfish is not restricted to Cherax. Cryptic diversity has been found in Engaeus Erichson, Geocharax

Clark and Gramastacus Riek (Schultz et al. 2007; 2009), Paranephrops (Apte et al.

2007) and Astacopsis (Sinclair et al. 2001) in southern hemisphere crayfish and in northern hemisphere groups it has been reported in Orconectes (Filipova et al. 2010),

Pacifastacus (Larson et al. 2012), Austropotamobius (Grandjean et al. 2002a; 2002b) and Astacus (Maguire et al. 2014).

The summary presented in Table 3.1 also highlights that Australia can no longer be considered the center of diversity for Cherax (Riek 1969; Toon et al. 2010). While the distribution of Cherax occurs over a much wider area than in New Guinea, the number of species is now recognized is 22 for New Guinea and 18 for Australia. No doubt the more substantial and diverse hydrological environments and complex topography of New Guinea, compared with the low relief and aridity have contributed these differences. Table 3.1. Summary of the status of Cherax species with reference to molecular genetic studies. Location codes follow the distribution of the principal phylogenetic groups as shown in Figure 2.1.

No. Species/Author(s) Distribution Status/ remark Valid References Northern Australia and New Guinea 1. C. albertisii Nobili (1899) South west PNG Part of red claw complex, may comprise at  This study; Baker et al. least 3 species; Sample from ORI from this (2008) study mostly likely C. albertisii. Requires further study 2. C. sp. nov. cf C. albertissi -1 South west PNG Part of red claw complex; sample MTB  This study; Baker et al. sufficiently distinct to be a new species. (2008) 3. C. sp. nov. cf C. albertissi -2 East Papua, Indonesia Part of red claw complex; sample TAM  This study sufficiently distinct to be a new species. 4. C. aruanus Roux (1911) Aru Island, Indonesia Not examined genetically, considered to be a X Holthuis (1949) subspecies of C. lorentzi, requires re- examination 5. C. barretti Clarke (1941a) Wessel Islands, NT, Not a valid species, not distinguishable from C. X This study Australia bicarinatus, which has priority 6. C. bicarinatus Gray (1845) Port Essington, NT, Valid species, and not distinguishable from C.  This study Australia barretti and C. rhynchotus 7. C. boesemani Lukhaup & Pekny (2008) West Papua, Indonesia Valid species  This study 8. C. boschmai Holthuis (1949) Wissel Lakes, Papua, Not distinguishable from other Wissel Lakes X This study Indonesia species; C. pallidus is the valid species name on the basis of page priority 9. C. buitendijkae Holthuis (1949) Wissel Lakes, Papua, Not distinguishable from other Wissel Lakes X This study Indonesia species; C. pallidus is the valid species name on the basis of page priority 10. C. communis Holthuis (1949) Wissel Lakes, Papua, Not distinguishable from other Wissel Lakes X This study Indonesia species; C. pallidus is the valid species name on the basis of page priority 11. C. divergens Holthuis (1950) Western PNG Not examined, considered a synonym of C. X Holthuis (1996) albertissi by Holthuis (1996) 12. C. holthuisi Lukhaup & Pekny (2006) West Papua, Indonesia Valid  This study 13. C. longipes Holthuis (1949) Wissel Lakes, Papua, Not distinguishable from other Wissel Lakes X This study; Holthuis (1949) Indonesia species; C. pallidus is the valid species name 100 on the basis of page priority 14. C. lorentzi Holthuis (1949) Papua, Indonesia Valid  This study; Holthuis (1949) 15. C. minor Holthuis (1996) Papua, Indonesia Not examined  Holthuis (1996) 16. C. misolicus Holthuis(1949) Misool Island, Valid  This study Indonesia 17. C. monticola Holthuis (1950) Wamena, Papua, Valid  This study Indonesia 18. C. murido Holthuis (1949) Wissel Lakes, Papua, Not distinguishable from other Wissel Lakes X This study Indonesia species; C. pallidus is the valid species name on the basis of page priority 19. C. nucifraga Short (1991) Northern NT, Australia Valid  This study; Schultz et al. (2009) 20. C. pallidus Holthuis (1949) Wissel Lakes, Papua, Not distinguishable from other Wissel Lakes;  This study Indonesia valid on the basis of page priority 21. C. paniaicus Holthuis (1949) Wissel Lakes, Papua, Not distinguishable from other Wissel Lakes X This study; Holthuis (1949) Indonesia species; C. pallidus is the valid species name on the basis of page priority 22. C. papuanus Holthuis (1949) Lake Kutubu, PNG Not examined  23. C. peknyi Lukhaup & Herbert (2008) East Papua, western Valid  This study; Munasinghe et PNG al. (2004b) 24. C. quadricarinatus Von Martens (1868) North eastern NT, Valid, but specifically distinct from western  This study; Austin (1996); north QLD, Australia population in NT Baker et al. (2008); and south western PNG Munasinghe et al. (2004b) 25. C. rhynchotus Riek (1951) Cape York, QLD Not distinguishable from C. bicarinatus and X This study C.barretti; C.bicarinatus has priority 26. C. solus Holthuis (1949) Wissel Lakes, Papua, Not distinguishable from other Wissel Lakes X This study Indonesia species; C. pallidus is the valid species name on the basis of page priority 27. C. wasselli Riek (1969) Cape York, QLD, Valid  Austin (1996) Australia 28. Cherax sp.nov.1 cf C. quadricarinatus Northern NT, Australia New species, specifically distinct from eastern  This study; Baker et al. population of C. quadricarinatus in NT; (2008) requires description as a new species 29. Cherax sp.nov.2 West Papua, Indonesia New species  This study 30. Cherax sp.nov.3 West Papua, Indonesia New species  This study 101 31. Cherax sp.nov.4 West Papua, Indonesia New species  This study 32. Cherax sp.nov.5 cf C. holthuisi West Papua, Indonesia New species  This study  Eastern Australia  33. C. albidus Clark (1936) Western Victoria Part of the C. destructor complex, not a valid X Austin (1996); Austin et al. species and mostly likely does warrant (2003); Munasinghe et al recognition as a subspecies (2004a) 34. C. cairnsensis Riek (1969) Eastern Australia, QLD Valid  Austin (1996); Munasinghe et al. (2004a) 35. C. cartalacoolah Short (1993) Cape York, QLD Not examined  Short (1993) 36. C. cuspidatus Riek (1969) North east NSW Valid  Austin (1996); Munasinghe et al. (2004a) 37. C. davisi Clarke (1941a) Eastern Australia Not distinguishable from C. destructor, which X Austin & Knott (1996); has priority Austin et al. (2003) 38. C. depressus Riek (1951) South east QLD Valid  Austin (1996); Munasinghe et al. (2004a) 39. C. destructor Clark (1936) Eastern and central Valid  Austin et al. (2003); Australia Munasinghe et al (2004a) 40. C. dispar Riek (1951) South east QLD Valid  Austin (1996); Munasinghe et al. (2004a) 41. C. esculus Riek (1956) Eastern Australia Not distinguishable from C. destructor, which X Austin & Knott (1996); has priority Austin et al. (2003) 42. C. gladstonensis Riek (1969) Eastern QLD Not distinguishable from C. cairnsensis, which X Austin (1996); Munasinghe has priority et al. (2004a) 43. C. leckii Coughran (2005) Eastern Australia Valid, mostly likely the same Cherax sp.  Austin (19996); Munasinghe nov.of Austin (1996) and Munasinghe et al et al. (2004b); Coughran (2004b) (2005) 44. C. neopunctatus Riek (1969) North eastern NSW Not distinguishable from C. cuspidatus, which X Austin (1996); Munasinghe has page priority et al. (2004a) 45. C. parvus Short & Davie (1993) Eastern Australia Valid  Munasinghe et al. (2004a) 46. C. punctatus Clark (1936) South east QLD Valid  Munasinghe et al. (2004a) 47. C. robustus Riek (1951) South east QLD Valid  Austin (1996); Munasinghe et al. (2004a) 48. C. rotundus Clarke (1941a) Northern VIC Valid  Austin et al. (2003); Munasinghe et al. (2004a) 102 49. C. setosus Riek (1951) Eastern NSW Valid. Originally recognized as a subspecies of  Austin et al. (2003); C. rotundus Munasinghe et al. (2004a)

50. C. urospinosus Riek (1969) South east QLD Known only from Type locality from inner  Austin (1996) Brisbane. Presumed extinct.

South Western Australia  51. C. cainii Austin & Ryan (2002) Margaret River, WA Valid  Austin & Ryan (2002); Munasinghe et al. (2004b) 52. C. crassimanus Riek (1967) South west WA Valid  Austin & Knott (1996); Munasinghe et al. (2004b) 53. C. glaber Riek (1967) South west WA Valid  Austin & Knott (1996); Munasinghe et al. (2004b) 54. C. glabrimanus Riek (1967) South west WA Not distinguishable from C. quinquecarinatus, X Austin & Knott (1996); which has priority Munasinghe et al. (2004b) 55. C. neocarinatus Riek (1967) South west WA Not distinguishable from C. quinquecarinatus, X Austin & Knott (1996); which has priority Munasinghe et al. (2004b) 56. C. plebejus Hess (1965), Riek (1967) South west WA Not distinguishable from C. preissii X Riek (1967); Austin & Knott (1996); Munasinghe et al. (2004b) 57. C. preissii Erichson (1846) South west WA Valid  Austin & Knott (1996); Munasinghe et al. (2004b) 58. C. quinquecarinatus Gray (1845) South west WA Valid  Riek (1967); Austin & Knott (1996); Munasinghe et al. (2004b) 59. C. tenuimanus Smith (1912) South West WA Valid  Austin & Ryan (1996)

103 104

3.2. Further study

There are three areas of obvious further study that arise from my study. First, the most surprising result, the failure to detect species level differences amongst the samples of crayfish form the Wissel Lakes, presents intriguing questions in relation to factors behind the disconnect between morphological diversity and molecular divergence. It is recommended that a detailed morphological and genetic study be conducted on new samples of crayfish from the Wissel Lakes. The morphological studies should take advantage of multivariate methods for measuring morphological variation and these should aim to look for associations between habitats and phenotypic variation (Austin & Knott 1996). It should also integrate data from the samples examined by Holthuis and held in the Leiden Museum of Natural History (Nationaal

Natuurhistorisch Museum, Leiden, the Netherland). Such a study should also take a population genetic approach to assessing genetic variability and gene flow within and between lakes using rapidly evolving markers such as microsatellites, SNPs or the mitochondrial control region.

Second, the finding of high diversity of new species from a short sampling trip to a relatively restricted geographic region near Fakfak coupled with the recent description of two new species from the Bird‟s Head, and an additional new species from this region discovered from commercial operators from Sorong in this study, and the diversity within the New Guinea red-claw complex suggest that there may be many more undiscovered species of New Guinea Cherax. Thus sampling trips to Bird‟s Head and Bird‟s “neck” and to eastern Papua and southwestern PNG would be a priority and it may not be unreasonable to expect to double the number of Cherax species from New

Guinea as a result of intensive sampling and molecular genetic analyses. 105

Lastly, the combination of the sequences from this study with similar sequences from Australian species of Cherax, offers the opportunity to undertake one of the most geographically wide ranging studies of the evolution and biogeography of a major group of freshwater organisms. The genus Cherax is unique among Australian crayfish

(and other aquatic groups) in the extent of its distribution from the south west to eastern and northern Australia and New Guinea. Such a study would be of special interest to biogeographers specializing in aquatic groups and molecular phylogeneticists in general. This kind of study would also benefit from the wealth of new nucleotide data being generated by next generation sequencing, including the rapid sequencing of complete mitogenomes (Gan et al. 2014). 106

BIBLIOGRAPHY

Abell, R., Thieme, M.L., Revenga, C., Bryer M., Kottelat M., Bogutskaya, N., Coad, B.,

Mandrak N., Balderas S.C., Bussing W., Stiassny M. L. J., Skelton P., Allen G.

A., Unmack P., Naseka A., Ng R., Sindorf N., Robertson J., Armijo E., Higgins

J. V., Heibel T. J., Wikramanayake E., Olson D., López H. L., Reis R. E.,

Lundberg J. G, Sabaj Pérez M. H., and Petry P. (2008). Freshwater Ecoregions

of the World: A New Map of Biogeographic Units for Freshwater Biodiversity

Conservation. Bioscience 58(5), 403-414.

Allison, A. (2007). Introduction to the fauna of Papua In „The Ecology of Indonesia

Series Volume VI- The Ecology of Papua Part one.’ (Eds. A.J. Marshall and

B.M. Beehler).pp.479-494. (Periplus Edition (HK) Ltd).

Anonymous. (2003). „Indonesia Biodiversity Strategy and Action Plan 2003-2020.

IBSAP. National Document the Republic of Indonesia.‟ (National Development

Planning Agency (Bappenas). Jakarta.)

Apte, S., Smith, P.J., and Wallis, G.P. (2007). Mitochondrial phylo-geography of New

Zealand freshwater crayfishes, Paranephrops spp. Molecular Ecology 16, 1897-

1908. Doi:10.1111/j.1365-294X.2007.03224

Austin, C. M. (1995a). The definition and phylogenetic position of the genus Cherax

(Decapoda: Parastacidae). Freshwater Crayfish 8, 12-31. 107

Austin, C. M. (1995b). Evolution in the Genus Cherax (Decapoda: Parastacidae) in

Australia: A Numerical Cladistic Analysis of Allozyme and Morphological

Data, Freshwater Crayfish 0(0), pp. 32-50

Austin, C. M. (1996). Systematics of the freshwater crayfish genus Cherax Erichson

(Decapoda: Parastacidae) in northern and eastern Australia: electrophoretic and

morphological variation. Australian Journal of Zoology 44, 259-296.

Austin, C. M. and Knott, B. (1996). Systematics of the freshwater crayfish genus

Cherax Erichson (Decapoda: Parastacidae) in south-western Australia:

electrophoretic, morphological and habitat variation. Australian Journal of

Zoology 44, 223-258.

Austin, C. M. and Ryan, S. G. (2002). Allozyme evidence for a new species of

freshwater crayfish of the genus Cherax Erichson (Decapoda: Parastacidae)

from the south-west of Western Australia. Invertebrate Systematics 16, 357-367.

Austin, C. M., Nguyen, T. T. T., Meewan, M. M. and Jerry, D. R. (2003). The

taxonomy and phylogeny of the 'Cherax destructor' complex (Decapoda:

Parastacidae) examined using mitochondrial 16S sequences. Australian Journal

of Zoology 51, 99-110.

Babcock, L. E., Miller, M. F., Isbel, J. L., Collinson, J. W. and Hasiotis, S. T. (1998).

Paleozoic-Mesozoic crayfish from Antarctica: earliest evidence of freshwater

decapod crustaceans. Geology 26, 539-542.

Baer, J.G. (1945). Un Temnocéphale nouveau, Temnocephala handshini n. sp. de la

Nouvelle Guinée. Rev. Suisse Zool. 52, 505-512. 108

Baker, N., De Bruyn, M. and Mather, P. B. (2008). Patterns of molecular diversity in

wild stocks of the redclaw crayfish (Cherax quadricarinatus) from northern

Australia and Papua New Guinea: impacts of Plio-Pleistocene landscape

evolution. Freshwater Biology 53, 1592–1605. doi:10.1111/j.1365-

2427.2008.01996.x

Baldwin, S.L., Fitzgerald, P.G., & Webb, L.E. (2012). Tectonics of the New Guinea

region. The Annual Reviewof Earth and Planetary Sciences 40, 495-520.

Barton, N.H., Briggs, D.E.G., Eisen, J.A., Goldstein, D.B., Patel, N.H. (2007).

Phylogenetic Reconstruction. Chapter 27 In „Evolution‟. (Cold Spring Harbor

Laboratory Press.). 833pp.

Beehler, B. ,Pratt, T., Zimmerman, D. , Bell, H. , Finch, B. , Diamond, J. M. and Coe,

J. (1986). „Birds of New Guinea‟. (Princeton University Press, Princeton.)

Bensasson, D. Zhang, D.X., Hart, D.L. Hewitt, G.M. (2001). Mitochondrial

pseudogenes: evolution‟s misplaced witnesses. Trends in Ecology and Evolution

16, 314-321.

Boeseman, M., (1963). Notes on the fishes of Western New Guinea. Zoologische

Mededelingen Leiden 38(14), 221-242.

Bowler, J.M., Hope, G.L., Jennings, J.N., Singh, G. and Walker, D. (1976). Late

Quaternary climates of Australia and New Guinea. Quaternary Research 6,

359-394.

Bowman, D. M. J. S., Brown, G. K., Braby, M. F., Brown, J.R., Cook, L.G., Crisp, M.

D., Ford, F., Haberle, S., Hughes, J., Isagi, Y., Joseph, L., McBride, J., Nelson,

109

G., and Ladiges, P.Y. (2010). Biogeography of the Australian monsoon tropics.

Journal of Biogeography 37(2), 201-216.

Braband, A., Kawai, T. and Scholtz, G. (2006). The phylogenetic position of the East

Asian freshwater crayfish Cambaroides within the Northern Hemisphere

Astacoidea (Crustacea, Decapoda, Astacida) based on molecular data. Journal of

Zoological Systematics and Evolutionary Research 44, 17–24,

doi:10.1111/j.1439-0469.2005.00338.x

Bryant, D. and Papas, P. (2007) Marron Cherax cainii (Austin) in Victoria - a literature

review. Arthur Rylah Institute for Environmental Research Technical Report

Series No. 167. (Department of Sustainability and Environment, Melbourne.)

Bucklin, A., Guarnieri, M., Hill, R. S., Bentley, A. M. and Kaartvedt., S. (1999).

Taxonomy and systematic assessment of planktonic copepods using

mitochondrial COI sequence variation and competitive, species-specific PVR.

Hydrobiologia 401, 239–254.

Buhay, J.E., Moni, G., Mann, N., Crandall, K.A., (2007). Molecular taxonomy in the

dark: Evolutionary history, phylogeography, and diversity of cave crayfish in the

subgenus Aviticambarus, genus Cambarus. Mol. Phylogenet. Evol. 42, 435–448.

Calman, W. T. (1911). Note on a crayfish from New Guinea. Ann. Mag. nut. Hist. (8) 8,

366-8.

Chivas A. R., Garcia A., van der Kaars S., Couapel M. J.J., Holt S., Reeves J. M.,

Wheeler D. J., Switzer A. D., Murray-Wallace C. V., Banerjee D., Price D. M.,

Wang S. X., Pearson G., Edgar N. T., Beaufort L., de Deckker P.,Lawson E., 110

and Cecil C. B. (2001) Sea-level and environmental changes since the last

interglacial in the Gulf of Carpentaria, Australia: an overview. Quaternary

International 83-5, 19-46

Chen, Y., and Meltzer, P.S. (2005). Gene expression analysis via multidimensional

scaling. Curr. Protoc. Bioinformatics, Chapter. 7, Unit 7.11. doi:

10.1002/0471250953.bi0711s10.

Clark, E. (1936). Notes on the habits of land crayfishes. Victorian Naturalist LIII, 65-

68.

Clark, E. (1936b). The freshwater and land crayfishes of Australia. Memoirs of the

National Museum of Victoria 10, 5-58.

Clark, E. (1939). Tasmanian Parastacidae. Papers and Proceedings of the Royal Society

of Tasmania 1939, 117-128.

Clark, E. (1941a). New species of Australian freshwater and land crayfishes (Family

Parastacidae). Memoirs of the National Museum of Victoria 12, 31-40.

Clark, E. (1941b). Revision of the genus Euastacus (Crayfishes, Family Parastacidae),

with notes on the distribution of certain species. Memoirs of the National

Museum of Victoria 12, 31-40.

Clark, E. and Burnet, E. M. (1942). The application of serological methods to the study

of the Crustacea. Australian Journal of Experimental Biology and Medicine 20,

89-95. 111

Clement, M., Posada, D. and Crandall, K. A. (2000). TCS: a computer program to

estimate gene genealogies. Molecular Ecology 9, 1657-1659.

Conservation International. (2000). Megadiversity data tables, Washington, USA

Available: http://www.conservation.org/xp/CIWEB/home. [26 June 2010].

Coughran, J. (2005a). Cherax leckii n. sp. (Decapoda: Parastacidae): a new crayfish

from coastal, northeastern New South Wales. Journal of the Australian New

Guinea Fishes Association 19, 191-196.

Coughran, J. (2005b). New crayfishes (Decapoda: Parastacidae: Euastacus) from

northeastern New South Wales, Australia. Records of the Australian Museum

57, 361-374.

Coughran, J. and McCormack, R. B. (2011). Euastacus morgani sp. n., a new spiny

crayfish (Crustacea, Decapoda, Parastacidae) from the highland rainforests of

eastern New South Wales, Australia. ZooKeys 85, 17–26.

doi:10.3897/zookeys.85.1237. PMC 3082992. PMID 21594095.

Crandall, K. A., Lawler, S. H. and Austin, C. M. (1995). A preliminary examination of

the molecular phylogenetic relationships of some crayfish genera from Australia

(Decapoda: Parastacidae). Freshwater Crayfish 10, 18-30.

Crandall, K. A. (1996). Multiple interspecies transmissions of human and simian T-cell

leukemia/lymphoma virus type I sequences. Molecular Biology and Evolution

13, 115-131.

Crandall, K. A. and Fitzpatrick, J. F. (1996). Crayfish molecular systematics: using a

combination of procedures to estimate phylogeny. Systematic Biology 45, 1-26. 112

Crandall, K. A., Fetzner, J. W., Lawler, S. H., Kinnersley, M. and Austin, C. M. (1999).

Phylogenetic relationships among the Australian and New Zealand genera of

freshwater crayfishes (Decapoda: Parastacidae). Australian Journal of Zoology

47, 199-214.

Crandall, K. A., Harris, D. J. and Fetzner, J. W. (2000a). The monophyletic origin of

freshwater crayfish estimated from nuclear and mitochondrial DNA sequences.

Proceedings of the Royal Society of London Series B-Biological Sciences 267,

1679-1686.

Crandall, K. A., Fetzner, J. W. Jr., Jara, C G. and Buckup, L. (2000b). On the

Phylogenetic Positioning of the South American Freshwater Crayfish Genera

(Decapoda: Parastacidae). Journal of Crustacean Biology, 20(3), 530-540.

Crandall, K. A. (2006). Applications of phylogenetics to issues in freshwater crayfish

biology. Bulletin Français de la Pêche et de la Pisciculture, 953-963.

Crandall, K. and Buhay, J. (2008). Global diversity of crayfish (Astacidae, Cambaridae,

and Parastacidae–Decapoda) in freshwater. Hydrobiologia 595, 295-301.

Crandall, K. A., Robison, H. W. and Buhay, J. E. (2008). Avoidance of extinction

through nonexistence: the use of museum specimens and molecular genetics to

determine the taxonomic status of an endangered freshwater crayfish.

Conservation Genetics 10, 177-189. DOI 10.1007/s10592-008-9546-9

Crisp, M.D., Linder, H.P. and Weston, P.H. 1995. Cladistic biogeography of plants in

Australia and New Guinea: congruent pattern reveals two endemic tropical

tracks. Systematic Biology 44, 457-473.

113

De Deckker, P., Chivas, A.R., Shelley, M.G. and Torgersen, T. (1988). Ostracod shell

chemistry: A new palaeoenvironmental indicator applied to a regressive/

transgressive record from the gulf of carpentaria, Australia. Palaeogeography,

Palaeoclimatology, Palaeoecology 66, 231-241.

De Queiroz, K. and Gauthier, J. (1990). Phylogeny as a central principle in taxonomy:

Phylogenetic definitions of taxon names. Systematic Zoology 39(4), 307-322.

Diamond, J. M. (1972). Avifauna of the Eastern Highlands of New Guinea.

Publications of the Nuttall Ornithological Club, No. 12. (Cambridge, Mass.)

pp. 438.[1]

Diamond, J. M. and LeCroy. M. (1979). Birds of Karkar and Bagabag Islands, New

Guinea. Bull. Amer. Mus. Nat. Hist. 164, 469–531.

Driskell, A.C., Norman J.A., Pruett-Jones S, Mangall E, Sonstagen S, Christidis L.

(2011). A multigene phylogeny examining evolutionary and ecological

relationships in the Australo-papuan wrens of the subfamily Malurinae (Aves).

Molecular Phylogenetics and Evolution 60, 480-485.

Erichson, W. F. (1846). Uebersicht der Arten der Gattung Astacus. Archiv fuer

Naturgeschichte 12, 86-103

Felsenstein, J. (2004). „Inferring Phylogenies‟. (Sinauer Associates, Sunderland,

Massachusetts. USA.)

Filipova, L., Holdich, D.M., Lesobre, J., Grandjean, F. And Petrusek, A. (2010). Cryptic

diversity within the invasive virile crayfish Orconectes virilis (Hagen, 1870)

114

species complex: new lineages recorded in both native and introduced range.

Biological Invasion 12, 983-989.

Flannery, T. F. (1995). „Mammals of New Guinea‟. (Rev. Upd. Edition. Cornell

University Press.)

Flannery, T. F. (1987). A new species of Phalanger (Phalangeridae: Marsupialia) from

montane western Papua New Guinea. Records of the Australian Museum 39(4),

183–193.

Fratini, S., Zaccara, S., Barbaresi, S, Grandjean, F., Souty-Grosset, C, Crosa, G and

Gherardi, F. (2005). Phylogeography of the threatened crayfish (genus

Austropotamobius) in Italy: implications for its taxonomy and conservation

Heredity 94, 108–118.

Gan, H. M., Tan, M.H., Eprilurahman, R., and Austin, C. M. (2014). The complete

mitogenome of Cherax monticola (Crustacea: Decapoda: Parastacidae), a large

highland crayfish from New Guinea. Mitochondrial DNA (0), 1-2.

Georges, A., Zhang, X., Unmack, P., Reid, B.N., Le, M. and McCord, W.P. (2014).

Contemporary genetic structure of an endemic freshwater turtle reflects Miocene

orogenesis of New Guinea. Biological Journal of the Linnean Society 111, 192-

208

Grandjean, F., Harris, D.J., Souty-Groset, C., and Crandall, K.A., (2000). Systematics

of the European endangered crayfish species Austropotamobius pallipes

(Decapoda: Astacidae). J. Crustacean Biol. 20, 522–529. 115

Grandjean, F., Bouchon, D., and Souty-Grosset, C. (2002a). Systematics of the

European endangered crayfish species Austropotamobius pallipes pallipes

(Decapoda: Astacidae) with a re-examination of Austropotamobius berndhauseri

status. Journal of Crustacean Biology 22(3), 677–681.

Grandjean, F., Frelon-Raimond, M., and Souty-Grosset, C. (2002b). Compilation of

molecular and morphological data for the phylogeny of in the genus

Austropotamobius: one species or several? Bulletin Francais de la Peche et de

la Pisciculture 367, 671–680. doi:10.1051/kmae:2002058

Grandjean, F., Gouin, N., Keith, P., Noël, P., Persat, H., Reynolds, J., Schulz, H.,

Smietana, P., and Souty-Grosset, C. (2006). Systematics and phylogeny of

freshwater crayfish, with particular reference to historical biogeography of

Europe. In „Atlas of Crayfish in Europe‟. (Eds C. Souty-Grosset, D. M. Holdich,

P. Y. Noël, J. D. Reynolds and P. Haffner.) pp. 11–23. (Museum national

d‟Histoire naturelle: Paris, France.).

Graur, D., Duret, L., Gouy, M. (1996). Phylogenetic position of the order Lagomorpha

(rabbits,hares, and allies). Nature 379, 333-335.

Gray, J.E. (1845). Description of some New Australian animals. In „Edward John Eyre,

Journals of Expeditions of Discovery into Central Australia 1.‟.pp. 405-411

(appendix).

Graybeal, A. (1998). Is it better to add taxa or characters to a difficult phylogenetic

problem?. Systematic Biology 47, 9–17.

Gressitt, J. L. (ed.). 1981. Biogeography and Ecology of New Guinea. Monographiae

Biologicae, volume 42. vii + 903 pp. (Dr. W. Junk, The Hague.)

116

Griffiths, A.M., Machado-Schiaffino, G., Dillane, E., Coughlan, J., Horreo, J.L.,

Bowkett, A.E., Minting, P., Tom, S., Roche, W., Gargan, P, McGinnity, P.,

Cross, T., Bright, D., Garcia-Vazquez, E., and Stevens, J.R. Genetic stock

identification of Atlantic salmon (Salmo salar) populations in the southern part

of the European range. BMC Genetics 11 (31), 1-27.

http://www.biomedcentral.com/1471-2156/11/31

Hall, R. (2001). Cenozoic reconstructions of SE Asia and the SW Pacific: Changing

patterns of land and sea. Faunal and floral migrations and evolution in SE Asia-

Australasia, 35-56.

Hall, R. (2002). Cenozoic geological and plate tectonic evolution of SE Asia and the

SW Pacific: computer-based reconstruction, model and animations. Journal of

Asian Earth Sciences 20, 253-431.

Hall, B.G. (2011). „Phylogenetic trees made easy – A how-to manual. Fourth edition.‟

(Sinaues Associates. Inc.). 282pp.

Hamr, P. (1992). A revision of the Tasmanian freshwater crayfish genus Astacopsis

Huxley (Decapoda: Parastacidae). Papers in the Proceedings of the Royal

Society of Tasmania 126, 91-94.

Hansen, B. and Richardson, A. M. M. (2002). Geographic ranges, sympatry and the

influence of environmental factors on the distribution of species of an endemic

Tasmanian freshwater crayfish. Invertebrate Systematics 16, 621-629.

117

Hansen, B. and Richardson, A. M. M. (2006). A revision of the Tasmanian endemic

freshwater crayfish genus Parastacoides (Crustacea: Decapoda: Parastacidae).

Invertebrate Systematics 20, 713-769.

Hasiotis, S.T. and Mitchell, C. E. (1993). A comparison of crayfish burrow

morphologies: Triassic and Holocene fossil, paleo and neo-ichnological

evidence, and the identification of their burrowing signatures. Ichnos 2, 291-

314.

Haswell, W.A. (1882). „Catalogue of the Australian stalk- and sessile-eyed Crustacea.‟

(The Australian Museum, Sidney.). Pp. 1-324.

Hayashi, R., Chan, B.K.K, Simon-Blecher N, Watanabe H, Guy-Haim T, Yonezawa T,

Levy Y, Shuto T, Achituv Y. (2013). Phylogenetic position and evolutionary

history of the turtle and whale barnacles (Cirripedia: Balanomorpha:

Coronuloidea). Molecular Phylogenetics and Evolution 67, 9-14.

Hedtke, S. M., Townsend, T.M. and Hillis, D.M. (2006). Resolution of phylogenetic

conflict in large data sets by increased taxon sampling. Systematic Biology

55(3), 522-529.

Hehanussa, P. E., G. S. Haryani, and Tjiptasmara (2005). Two ancient lake in Paniai

and Tage, the central central mountains range, Papua, Indonesia. Proceeding of

11th World Lake Conference. Vol. II. Nairobi, Kenya. 353-358.

Heinsohn, R. (2011). „Cape York peninsula ornithological story. The evolutionary

ecology of birds on Cape York peninsula: national and international

significance‟. (Queensland Department of Environment and Resource

Management. ANU Enterprise Pty Ltd. Canberra.). pp 1-17.

118

Heinsohn, T. and Hope G. (2006). The Torresian connections: Zoogeography of New

Guinea. In „Evolution and Biogeography of Australasian Vertebrates.‟ (Eds. J.R.

Merrick, M. Archer, G.M. Hickey, M.S.Y. Lee). Pp.71-93. (Auscipub, Sydney).

Helgen, K. M. (2005). Systematics of the Pacific monkey-faced bats (Chiroptera:

Pteropodidae), with a new species of Pteraloplex and a new Fijian

genus. Systematics and Biodiversity 3(4), 433–453.

Hess, W. (1865). Beiträge zur Kenntniss der Decapoden-Krebse Ost-Australiens. Arch.

Naturgesch 31, 127-172.

Hill, K.C., and Gleadow, A.J.W., (1989). Uplift and thermal history of the Papuan fold

belt, Papua New Guinea: Apatite fission track analysis. Australian Journal of

Earth Sciences, 36, p. 515–539.

Hill, K.C. and Hall, R. 2002. Mesozoic-Cenozoic evolution of Australia‟s New Guinea

margin in a west Pacific context. In „Defining Australia: The Australian Plate as

part of Planet Earth.‟.(Eds. R. Hillis and R.D. Muller). Pp.256-290. (Geological

Society of America Special Paper/ Geological Society of Australia Special

Publication 22).

Hillis, D. M., Moritz, C. and Mable, B. K. (1996). 'Molecular systematics.' (Sinauer

Associates: Sunderland, Massachusetts, United States of America.)

Hillis, D. M. (1998). Taxonomic sampling, phylogenetic accuracy and investigator bias.

Systematic Biology 47(1), 3-8.

119

Hillis, D.M., Pollock, D.D., McGuire, J. A., and Zwickl, D.J. (2003). Is sparse taxon

sampling a problem for phylogenetic inference?. Systematic Biology 52(1), 124-

126.

Hobbs, H. H. Jr. (1942a). A generic revision of the crayfishes of the subfamily

Cambarinae (Decapoda, Astacidae) with the description of a new genus and

species. American Midland Naturalist 28, 334-357.

Hobbs, H. H. Jr. (1942b). The crayfishes of Florida. University of Florida Publications,

Biological Science Series 3, 1-79.

Hobbs, H. H. Jr. (1969). On the distribution and phylogeny of the crayfish genus

Cambarus. In 'The distributional history of the biota of the Southern

Appalachians, Part I: invertebrates.' (Eds P. C. Holt, R. L. Hoffman and C. W.

J. Hart). pp. 93-178. (Virginia Polytechnic Institute: Virginia.)

Hobbs, H. H. Jr. (1974). Synopsis of the families and genera of crayfishes (Crustacea:

Decapoda). Smithsonian Contributions to Zoology 164, 1-32.

Hobbs, H. H. Jr. (1981). The crayfishes of Georgia. Smithsonian Contributions to

Zoology 318, 1-549.

Hobbs, H. H. Jr. (1987). A review of the crayfish genus Astacoides (Decapoda:

Parastacidae). Smithsonian Contributions to Zoology 443, 1-50.

Hobbs, H. H. Jr. (1988). Chapter 3: crayfish distribution, adaptive radiation and

evolution. In 'Freshwater crayfish: biology, management and exploitation.' (Eds

D. M. Holdich and R. S. Lowery). pp. 52-82. (Croom Helm Ltd: London,

England.). 120

Hobbs, H. H. Jr. (1989). An Illustrated checklist of the American crayfishes

(Decapoda:Astacidae, Cambaridae, and Parastacidea). Smithsonian

Contributions to Zoology 480, 1-236.

Hobbs, H.H., Jr. (1991). A new generic assignment for a South American crayfish

(Decapoda: Parastacidae) with revised diagnoses of the South American

genera and comments on the Parastacid mandible. Proceedings of the

Biological Society of Washington 104, 800-811.

Holthuis, L. B. (1949). Decapoda Macrura with a revision of the New Guinea

Parastacidae. Zoological Results of the Dutch New Guinea Expedition 1939.

Number 3. Nova Guinea 5, 289-328.

Holthuis, L. B. (1950). The Crustacea Decapoda Macrura collected by the Archbold

New Guinea expeditions. American Museum Novittates 1461, 1-17.

Holthuis, L. B. (1958). Freshwater crayfish in Netherlands New Guinea Mountains.

South Pacific Commission Quarterly Bulletin 8(2), 36-39.

Holthuis, L.B., (1974). Notes on the localities, habitats, biology, colour and vernacular

names of New Guinea freshwater crabs (Crustacea Decapoda,

Sundathelphusidae). Zool. Verh. Leiden 137, 3-47.

Holthuis, L. B. (1982). Freshwater Crustacea Decapoda of New Guinea. In J. L. Gressit

(ed.), Biogeography and ecology of New Guinea. Vol. 2. Monographiae

Biologicae 42, 603-619.

Holthuis, L. B. (1986). The freshwater crayfish of New Guinea. Freshwater Crayfish 6,

48-58.

121

Holthuis, L. B. (1996). Cherax (Astaconephrops) minor new species, a parastacid from

the mountains of Irian Jaya (W. New Guinea), Indonesia (Crustacea: Decapoda:

Parastacidae). Zoologische Medelingen Leiden 70, 361-366.

Hope, G. S. (1976). The vegetational history of Mt. Wilhem, Papua New Guinea.

Journal of Ecology 64, 627-664

Hope, G. S. (2007). Montane and alpine peatlands of New Guinea. In „Proceedings of

The International Symposium and Workshop on Tropical Peatland‟. Pp. 51-58.

(Eu Carbopeat and Restorpeat Partnership, Gadjah Mada University, Indonesia

and University of Leicester, United Kingdom).

http://www.geog.le.ac.uk/carbopeat/media/pdf/yogyapapers/p4.pdf

Hopkins, C.L. (1970). Systematics of the New Zealand freshwater crayfish

Paranephrops (Crustacea: Decapoda: Parastacidae). New Zealand Journal of

Marine and Freshwater Research 4(3), 278-291.

Horwitz, P. and Richardson, A. M. M. (1986). An ecological classification of the

burrows of Australian freshwater crayfish. Australian Journal of Marine and

Freshwater Research 37, 237-242.

Horwitz, P. (1988). Sea-level fluctuations and the distributions of some freshwater

crayfishes of the genus Engaeus (Decapoda; Parastacidae) in the Bass Strait

Area. Australian Journal of Marine and Freshwater Research 39, 497-502.

Horwitz, P. (1990a). A taxonomic revision of species in the freshwater crayfish genus

Engaeus Erichson (Decapoda: Parastacidae). Invertebrate Taxonomy 4, 427-614.

122

Horwitz, P. (1990b). The translocation of freshwater crayfish in Australia: potential

impact, the need for control and global relevance. Biological Conservation 54,

291-305.

Horwitz, P. (1994). Distribution and conservation status of the Tasmanian giant

freshwater lobster Astacopsis gouldi (Decapoda: Parastacidae). Biological

Conservation 69, 199-206.

Horwitz, P. (1995). „A preliminary key to the species of Decapoda (Crustacea:

Malacostraca) found in Australian inland waters.‟ (Co-operative Research

Centre for Freshwater Ecology, Albury, Australia.).

Horwitz, P. and Adams, M. (2000). The systematics, biogeography and conservation

status of species in the freshwater crayfish genus Engaewa Riek (Decapoda:

Parastacidae) from south-western Australia. Invertebrate Taxonomy 14, 655-

680.

Horwitz, P. and Austin, C.M. (1995). A preliminary key to the species of Australian

freshwater crayfish (Parastacidae). In 'A Preliminary Key to the Species of

Inland Aquatic Decapods found in Australia'. (Ed. P. Horwitz.) Cooperative

Research Centre for Freshwater Ecology Identification Guide No. 4. pp. 7-50.

(Murray Darling Freshwater Research Centre: Albury.)

Huxley, T. H. (1878). On the Classification and the Distribution of the Crayfishes.

Proceedings of the Zoological Society of London 1878, 751-788

Huxley, T. H. (1880). 'The crayfish: an introduction to the study of zoology.' (D.

Appleton and Company: New York.) 123

Jamieson, B. G. (1991). Ultrastructure and phylogeny of crustacean spermatozoa. Mem.

Queensland Mus. 31, 109-142.

Jennings, J. N. (1972). Some attributes of Torres Strait. In „Bridge and Barrier: the

Natural and Cultural History of Torres Strait‟ (Ed. D. Walker).pp.29-38.

(Australian National University of Canberra, Canberra.).

Johns., R. J., Shea, G.A., and Puradyatmika, P. (2007). Subalpine and alpine vegetation

of Papua. In The Ecology of Indonesia Series Volume VI - The Ecology of Papua

Part two. (Eds. A.J. Marshall and B.M. Beehler). pp.1025-1053. (Periplus

Edition (HK) Ltd.).

Kearns, A.M., Joseph L., Cook L.G. (2013). A multilocus coalescent analysis of the

speciational history of the Australo-Papuan butcherbirds and their allies.

Molecular Phylogenetics and Evolution 66(3), 941-52. doi:

10.1016/j.ympev.2012.11.020. Epub 2012 Dec 5.

Knott, B. (1975). Systematic studies on the Phreatoicoidea (Order Isopoda) with a

discussion on the phylogeny and zoogeography of other freshwater

malacostracan crustaceans from Australia and Tasmania. (Ph.D. Thesis,

University of Tasmania.).

Kuch, U., J.S. Keogh, J. Weigel, L.A. Smith & D. Mebs (2005). Phylogeography of

Australia's king brown snake (Pseudechis australis) reveals Pliocene divergence

and Pleistocene dispersal of a top predator. Naturwissenschaften 92, 121–127.

Larson, E. R., Abbott, C. L., Usio, N., Azuma, N., Wood, K. A., Herborg, L.-M. and

Olden, J. D. (2012). The signal crayfish is not a single species: cryptic diversity

124

and invasions in the Pacific Northwest range of Pacifastacus leniusculus.

Freshwater Biology, 57, 1823–1838. doi: 10.1111/j.1365-2427.2012.02841.x

Lawler, S. H. and Crandall, K. A. (1998). The relationship of the Australian freshwater

genera Euastacus and Astacopsis. Papers and Proceedings of the Linnean

Society of New South Wales 119, 1–8.

Le, M., Reid, B., McCord, W., Naro-Maciel, E., Raxworthy, C., Amato, G., Georges, A.

(2013). Resolving the phylogenetic history of the short-necked turtles, genera

Elseya and Myuchelys (Testudines: Chelidae) from Australia and New Guinea.

Molecular Phylogenetics and Evolution 68, 251-258

Leichhardt, L. (1847). „Journal of an overland expedition in Australia: from Moreton

Bay to Port Essington, a distance of upwards of 3000 miles, during the years

1844-1845.‟ (London.).

Licona-Vera, Y. And Ornelas, J.F. (2014). Genetic, Ecological and Morphological

Divergencebetween Populations of the Endangered MexicanSheartail

Hummingbird (Doricha eliza). PLoS ONE 9(7), e101870.

doi:10.1371/journal.pone.0101870

Löffler, E. (1977). „Geomorphology of Papua New Guinea‟. (Australian National

University Press. Canberra.)

Lukhaup, C. and Pekny, R. (2006). Cherax (Cherax) holthuisi, a new species of crayfish

(Crustacea: Decapoda: Parastacidae) from the centre of the Vogelkop Peninsula

in Irian Jaya (West New Guinea), Indonesia. Zool. Med. Leiden 80, 101-107. 125

Lukhaup, C. and Pekny, R. (2008). Cherax (Astaconephrops) boesemani, a new species

of crayfish (Crustacea: Decapoda: Parastacidae) from the centre of the Vogelkop

Peninsula in Irian Jaya (West New Guinea), Indonesia. Zool. Med. Leiden 82, 1-

10.

Lukhaup, C. and Herbert, B. (2008). A new species of crayfish (Crustacea: Decapoda:

Parastacidae) from the Fly River Drainage, Western Province, Papua New

Guinea. Memoirs of the Queensland Museum 52(2), 213–219.

Macdonald III, K. S., Yampolsky, L., and Duffy, J. E. (2005). Molecular and

morphological evolution of the amphipod radiation of Lake Baikal. Molecular

Phylogenetics and Evolution 35(2), 323-343

Maddison, W.P. (1997). Gene tree in species tree. Systematic Biology 46(3), 523-536

Maguire, I., Podnar, M., Jelić, S., Štambuk, A., Schrimpf, A.,Schulz, H. and Klobučar,

G. (2014). Two distinct evolutionary lineages of the Astacus leptodactylus

species-complex (Decapoda : Astacidae) inferred by phylogenetic analyses.

Invertebrate Systematics 28, 117–123. http://dx.doi.org/10.1071/IS13030

Malekian, M., Cooper, S.J.B., Norman, J.A, Les Christidis, Carthew S.M. (2010).

Molecular systematics and evolutionary origins of the genus Petaurus

(Marsupialia: Petauridae) in Australia and New Guinea. Molecular

Phylogenetics and Evolution 54, 122–135

Martin, A. J., Rich, T. H., Poore, G. C. B., Schultz, M. B., Austin, C. M., Kool, L. and

Vickers-Rich, P. (2008). Fossil evidence in Australia for oldest known

freshwater crayfish of Gondwana. Gondwana Research 14, 287-296.

126

Mayr, E. (1942). 'Systematics and the origin of the species from the viewpoint of a

zoologist.' (Columbia University Press: New York.)

Mayr, E. (1963). 'Animal species and evolution.' (Belknap Press of Harvard University

Press: Cambridge.)

Mayr, E. (1969). 'Principles of systematic zoology.' (McGraw-Hill, Inc.: United States

of America.)

Mayr, E. (2000). The biological species concept. In „Species Concepts and Phylogenetic

Theory’. (Eds. Q.D. Wheeler and R. Meier). pp. 17-29. (Columbia University

Press, New York.).

Mayr, E and Diamond J. (2001). „The Birds of Northern Melanesia: Speciation,

Ecology, & Biogeography‟. (Oxford University Press.).

Mayr, E. and Bock, W. J. (2002). Classification and other ordering systems. Journal of

Zoological Systematics and Evolutionary Research 40, 169-194

McGuigan, K.L., Zhu, D., Allen, G.R. and Moritz, C. (2000). Phylogenetic relationships

and historical biogeography of melanotaeniid fishes in Australia and New

Guinea. Marine and Freshwater Research 51, 713-723.

Menzies, J. I. (2006). „The frogs of New Guinea and the Solomon Islands‟. (Pensoft

Series Faunistica No. 48. Pensoft Publisher. Sofia-Moscow.)

Meredith, R.W., Mendoza, M.A., Roberts, K.K., Westerman, M., Springer, M.S. (2010).

A Phylogeny and Timescale for the Evolution of Pseudocheiridae (Marsupialia:

Diprotodontia) in Australia and New Guinea. J. Mammal Evol 17, 75–99

127

Mills, B.J. and M.C. Geddes. (1980). Salinity tolerance and osmoregulation of the

Australian freshwater crayfish Cherax destructor Clark (Decapoda:

Parastacidae). Australian Journal of Marine and Freshwater Research, 31, 667-

676.

Ministry of Environment. (1998 ). „National report on the implementation of the

Convention on Biological Diversity. The first national Report: Implementation

of asrticle 6, General Measures for conservation and sustainable use.‟

(Government of Indonesia. Ministry of Environment.) p.4.

http://bk.menlh.go.id/files/CBD 1st Natrep.pdf.

Mittermeier, R. A, Robles-Gil, P. and Mittermeier, C. G. (1997). „Megadiversity:

Earth‟s Biologically Wealthiest Nations.‟ (CEMEX, México.)

Morgan, G.J. (1986). Freshwater crayfish of the genus Euastacus Clark (Decapoda,

Parastacidae) from Victoria. Memoirs of the Museum of Victoria 47, 1-57.

Morgan, G.J. (1988). Freshwater crayfish of the genus Euastacus Clark (Decapoda:

Parastacidae) from Queensland. Memoirs of the Museum of Victoria 49, 1-49.

Morgan GJ. (1989). Two new species of the freshwater crayfish Euastacus Clark

(Decapoda: Parastacidae) from isolated high country of Queensland. Memoirs of

the Queensland Museum 27(2), 368-388.

Morgan GJ. (1991). The spiny freshwater crayfish of Queensland. Queensland

Naturalist 31(1–2), 29-36.

128

Morgan, G.J. (1997). Freshwater crayfish of the genus Euastacus Clark (Decapoda:

Parastacidae) from New South Wales, with a key to all species of the genus.

Records of the Australian Museum. Supplement 23, 110 p.

Moritz, C. and Hillis, D. M. (1996). Molecular Systematics: Context and Controversies.

In „Molecular Systematics. Second edition‟ (Eds. D. M. Hillis, B. Mable, and C.

Moritz). Pp. 1–13. (Sinauer, Sunderland, Massachusetts.).

Morrissey, N.M. 1978. The past and present distribution of marron, Cherax tenuimanus

(Smith), in Western Australia. Fisheries research bulletin of Western

Australia 22, 1-38.

Munasinghe, D. H. N., Murphy, N. P. and Austin, C. M. (2003). Utility of

mitochondrial DNA sequences from four gene regions for systematic studies of

Australian freshwater crayfish of the genus Cherax (Decapoda: Parastacidae).

Journal of Crustacean Biology 23, 402-417.

Munasinghe, D. H. N., Burridge, C. P. and Austin, C. M. (2004a). The systematics of

freshwater crayfish of the genus Cherax Erichson (Decapoda: Parastacidae) in

eastern Australia re-examined using nucleotide sequences from 12S rRNA and

16S rRNA genes. Invertebrate Systematics 18, 215-225.

Munasinghe, D. H. N., Burridge, C. P. and Austin, C. M. (2004b). Molecular phylogeny

and zoogeography of the freshwater crayfish genus Cherax Erichson (Decapoda:

Parastacidae) in Australia. Biological Journal of the Linnean Society 81, 553-

563.

129

Nagel, B.C, and Somons A.M. (2012). Rapid diversification in the North American

minnow genus Nocomis. Molecular Phylogenetics and Evolution 63, 639-649

Nguyen, T. T. T., Burridge, C.P. and Austin, C. (2005). Population genetic studies on

Australian freshwater crayfish, Cherax destructor (Crustacea: Parastacidae)

using allozyme and RAPD markers, Aquatic living resources 18(1), 55-64.

Nguyen, T.T.T. and Austin, C. M. (2005). Phylogeny of the Australian freshwater crayfish Cherax destructor-complex (Decapoda: Parastacidae) inferred from four mitochondrial gene regions. Invertebrate Systematics 19, 209-216.

Nguyen, T. T. T. (2005). A genetic investigation on translocation of Australian

commercial freshwater crayfish, Cherax destructor. Aquatic Living Resources

18, 319-323.

Nguyen, T. T. T., Austin, C. M., Meewan, M. M., Schultz, M. B. and Jerry, D. R.

(2004). Phylogeography of the freshwater crayfish Cherax destructor Clark

(Parastacidae) in inland Australia: historical fragmentation and recent range

expansion. Biological Journal of the Linnean Society 83, 539-550.

Nguyen, T. T. T., Meewan, M., Ryan, S. and Austin, C. M. (2002a). Genetic diversity

and translocation in the marron, Cherax tenuimanus (Smith): implications for

management and conservation. Fisheries Management and Ecology 9, 163-173.

Nguyen, T. T. T., Murphy, N. P. and Austin, C. M. (2002b). Amplification of multiple

copies of Cytochrome b gene fragments in the Australian freshwater crayfish,

Cherax destructor Clark (Parastacidae: Decapoda). Animal Genetics 33, 304–

308. 130

Nobili, Di Guiseppe. (1899). Contribuzioni alia conoscenza della fauna carcinologica

della Papuasia. delle Molucche e dell' Australia. Annali del Museo Civico di

Genova, serie 2. 20(40), 230-282.

Norman, J. A., Rheindt, F. E,, Rowe, D. L. and Christidis, L. (2007). Speciation

dynamics in the Australo-Papuan Meliphaga honeyeaters. Molecular

Phylogenetics & Evolution 42, 80-91.

Østbye, K., Næsje, T. F., Bernatchez, L., Sandlund, O. T. and Hindar, K. (2005).

Morphological divergence and origin of sympatric populations ofEuropean

whitefish (Coregonus lavaretus L.) in Lake Femund, Norway. J. Evol. Biol.

18(3), 683-702. doi:10.1111/j.1420-9101.2004.00844.x

Olson, D.M. and Dinerstein, E. (2002). The global 200: Priority ecoregions for global

conservation. Ann. Missouri. Bot. Gard. 89, 199-224.

Ortman, A.E. (1902). The geographical distribution of freshwater decapods and its

bearing upon ancient geography. Proc. Am. Philos. Soc. 41, 267-400.

Páez-Moscoso, D., and Guayasamin, J.M. (2012). Species limits in the Andean toad

genus Osornophryne (Bufonidae). Molecular Phylogenetics and Evolution 65,

805-822.

Page, R. D. M. and Holmes, E. C. (1998). 'Molecular evolution, a phylogenetic

approach.' (Blackwell Science: Oxford ; Malden, MA.).

Pavan, A.C., Martins F.M., and Morgante J.S. (2013). Evolutionary history of buldog

bats (genus Noctilio): recent diversification and the role of the Carribean in

131

Neotropical biogeography. Biological Journal of the Linnean Society 108, 210-

224

Petocz, R. G. (1987). „Konservasi alam dan pembangunan di Irian Jaya: Strategi

pemanfaatan sumber daya alam secara rasional‟. (Translated by Slamet Soeseno.

Pustaka Grafitipers. Jakarta.).

Polhemus, D. A., and Polhemus, J.T. (1998). Assembling New Guinea - 40 million

years of island arc accretion as indicated by the distribution of aquatic

Heteroptera (Insecta). In „Biogeographical and Geological Evolution of SE

Asia.‟.(Eds. R. Hall and J. Holloway). pp. 327–340. (Backhus Publishers,

Leiden.).

Polhemus, D.A., Englund, R.A., Allen, G.A. (2004). Freshwater biotas of new guinea

and nearby islands: analysis of endemism, richness, and threats. Final Report

Prepared For Conservation International. (Washington, D.C., Bishop Museum).

Pollock, D. D., Zwickl, D.J., McGuire, J.A., Hillis, D.M. (2002). Increased taxon

sampling is advantageous for phylogenetic inference. Systematic Biology 51(4),

664-671.doi: 10.1080/10635150290102357

Ponniah, M and Hughes, J. M. (1998). Evolution of Queensland spiny mountain

crayfish of the genus Euastacus (Clark) (Decapoda: Parastacidae): preliminary

16S mtDNA phylogeny. Proceedings of the Linnean Society of New South

Wales 119, 9–19.

132

Ponniah, M and Hughes, J. M. (2006). The evolution of Queensland spiny mountain

crayfish of the genus Euastacus. II. Investigating simultaneous vicariance with

intraspecific genetic data. Mar. Freshw. Res. 57, 349–362.

Porter, M. L., Perez-Losada, M. and Crandall, K. A. (2005). Model-based multi-locus

estimation of decapod phylogeny and divergence times. Molecular

Phylogenetics and Evolution 37, 355-369.

Prentice, M.L and Hope, G. S. (2007). Climate of Papua. In „The Ecology of Indonesia

Series Volume VI The Ecology of Papua Part one.‟ (Eds. A.J. Marshall and B.M.

Beehler).pp. 177-195. (Periplus Edition (HK) Ltd.)

Pusey B.J. and Kennard M.J. (2009). Chapter 3: Aquatic ecosystems in northern

Australia. In „Northern Australia Land and Water Science Review„ (Ed. P.

Stone). (Final Report to the Northern Australia Land and Water Taskforce,

CSIRO, Canberra, Australia.).

Pusey, B. J. (2011). „Aquatic Biodiversity in Northern Australia: Patterns, threats and

futures‟. (CDU press. Darwin).

Rawlings, L.H. and Donnellan, S.C. (2003). Phylogeographic analysis of the green

python, Morelia viridis, reveals cryptic diversity. Molecular Phylogenetics and

Evolution 27, 36–44

Reeves, J. M., Chivas, A. R., García, A., and De Deckker, P. (2007).

Palaeoenvironmental change in the Gulf of Carpentaria (Australia) since the last

interglacial based on Ostracoda. Palaeogeography, Palaeoclimatology,

Palaeoecology 246, 163-187.

133

Richardson, A., Doran, N. and Hansen, B. (2006). The geographic ranges of Tasmanian

crayfish: extent and pattern. Freshwater Crayfish 15, 347-364.

Riek, E. F. (1951). The freshwater crayfish (family Parastacidae) of Queensland. With

an appendix describing other Australian species. Records of the Australian

Museum 22, 368-388.

Riek, E. F. (1956). Additions to the Australian freshwater crayfish. Rec. Aust. Mus. 24,

1-6.

Riek, E. F. (1959). The Australian freshwater Crustacea. In 'Biogeography and ecology

in Australia. Monographiae Biologicae.' (Eds. A. Keast, R. L. Crocker and C. S.

Christian). pp. 246-258. (Dr W Junk bv Publishers: The Hague.).

Riek, E.F. (1967). The Freshwater crayfish of Western Australia (Decapoda:

Parastacidae). Australian Journal of Zoology 15, 103-121.

Riek, E.F. (1969). The Australian freshwater crayfish (Crustacea: Decapoda:

Parastacidae), with descriptions of new species. Australian Journal of Zoology

17, 855-918.

Riek, E. F. (1971). The freshwater crayfishes of South America. Proceeding of the

Biological Society of Washington 84, 129-136.

Riek, E. F. (1972). The phylogeny of the Parastacidae (Crustacea: Astacoidea), and

description of a new genus of Australian freshwater crayfishes. Australian

Journal of Zoology 20, 369-389. 134

Rittmeyer, E. N., Allison, A., Gründler, M. C, Thompson, D. K., Austin C. C.

(2012). Ecological Guild Evolution and the Discovery of the World's Smallest

Vertebrate. PLoS ONE 7(1), e29797. doi:10.1371/journal.pone.0029797

Roux, J. (1911). Nouvelles espèces de Décapodes d‟eau douce provenant de Papouasie.

Notes Leyden Museum 33, 81-106.

Rosenberg, M.S. and Kumar, S. (2001). Incomplete taxon sampling is not a problem for

phylogenetic inference. Proceedings of the National Academy of Sciences

USA 98, 10751–10756.

Rosenberg, M.S. and Kumar, S. (2003). Taxon sampling, bioinformatics, and

phylogenomics. Systematic Biology 52(1), 119–124.

Rudolph, E. H. and Crandall, K. A. (2007). A New Species of Burrowing Crayfish

Virilastacus Retamali (Decapoda: Parastacidae) From The Southern Chile

Peatland. Journal of Crustacean Biology 27(3), 502–512.

Salzburger, W.and Meyer, A. (2004). The species flocks of East African cichlid fishes:

recent advances in molecular phylogenetics and population genetics.

Naturwissenschaften 91, 277–290. DOI 10.1007/s00114-004-0528-6

Schizas, N. V. (2012). Misconceptions regarding nuclear mitochondrial pseudogenes

(Numts) may obscure detection of mitochondrial evolutionary novelties. Aquatic

Biology 17, 91–96. doi: 10.3354/ab00478.

Scholtz, G. (1993). Teloblasts in decapod embryos – an embryonic character reveals the

monophyletic origin of fresh-water crayfishes (Crustacea, Decapoda).

Zoologischer Anzeiger 230, 45-54. 135

Schuh, R. T. (2000). „Biological systematics: principles and applications‟. (Cornell

University Press, Ithaca, New York).

Schultz, M. B., Smith, S. A., Richardson, A. M. M., Horwitz, P., Crandall, K. A. and

Austin, C. M. (2007). Cryptic diversity in Engaeus Erichson, Geocharax Clark

and Gramastacus Riek (Decapoda: Parastacidae) revealed by mitochondrial 16S

rDNA sequences. Invertebrate Systematics 21, 569-587. doi: 10.1071/IS07019.

Schultz, M. B., Ierodiaconou, D. A., Smith, S. A., Horwitz, P., Richardson, A. M. M.,

Crandall, K. A. and Austin, C. M. (2008). Sea-level changes and palaeo-ranges:

reconstruction of ancient shorelines and river drainages and the phylogeography

of the Australian land crayfish Engaeus sericatus Clark (Decapoda:

Parastacidae). Molecular Ecology 17, 5291-5314. doi: 10.1111/j.1365-

294X.2008.03996.x.

Schultz, M. B., Smith, S. A., Horwitz, P., Richardson, A. M. M., Crandall, K. A. and

Austin, C. M. (2009). Evolution underground: a molecular phylogenetic

investigation of Australian burrowing freshwater crayfish (Decapoda:

Parastacidae) with particular focus on Engaeus Erichson. Molecular

Phylogenetics and Evolution 50, 580-598. doi: 10.1016/j.ympev.2008.11.025

Shapiro, B., Rambaut, A. & Drummond, A. J. (2006). Choosing appropriate substitution

models for the phylogenetic analysis of protein-coding sequences. Molecular

biology and evolution 23, 7-9.

Shaw, P.W., Turner, G.F., Idid, M.R., Robinson, R.L., and Carvalho, G.R. (2000).

Genetic population structure indicates sympatric speciation of Lake Malawi

136

pelagic cichlids. Proc. R. Soc.Lond. B 267, 2273-2280. doi

10.1098/rspb.2000.1279.

Short, J. W. (1991). Cherax nucifraga, a new species of freshwater crayfish (Crustacea:

Decapoda: Parastacidae) from the Northern Territory, Australia. The Beagle,

Records of the Northern Territory Museum of Arts and Science 8, 115-120.

Short, J. W. (1993). Cherax cartalacoolah, a new species of freshwater crayfish

(Decapoda: Parastacidae) from northeast Australia. Memoirs of the Queensland

Museum 33, 55-59.

Short, J. W. and Davie, P. J. F. (1993). Two species of freshwater crayfish (Crustacea:

Decapoda: Parastacidae) from northeastern Queensland rainforest. Memoirs of

the Queensland Museum 33, 69-80.

Shull, H. C., Pérez-Losada, M., Blair, D., Sewell, K., Sinclair, E. A., Lawler, S.,

Ponniah, M. and Crandall, K. A. (2005). Phylogeny and biogeography of the

freshwater crayfish Euastacus (Decapoda: Parastacidae) based on nuclear and

mitochondrial DNA. Molecular Phylogenetics and Evolution 37, 249-263.

Sinclair, E. A., Fetzner, J. W. Jr, Buhay, J., and Crandall, K. A. (2004). Proposal to

complete a phylogenetic taxonomy and systematic revision for freshwater

crayﬁsh (Astacidea). Freshwater Crayﬁsh 14, 21–29.

Sinclair, E.A., Madson A., Walsh, T., Nelson, J., and Crandall, K.A. (2011). Cryptic

genetic divergence in the giant Tasmanian freshwater crayfish, Astacopsis

gouldi (Decapoda: Parastacidae); implications for conservation. Animal

Conservation 14, 87-97.

137

Smith, G. (1912). The freshwater crayfishes of Australia. Proc. Zool. Soc. Lond. Pp.

144-171.

Song, H., Buhay, J. E., Whiting, M.F, Crandall, K. A. (2008). Many species in one:

DNA barcoding overestimates the number of species when nuclear

mitochondrial pseudogenes are coamplified. Proc Natl Acad Sci USA 105(36),

13486−13491. www.pnas.org/cgi/doi/10.1073/pnas.0803076105.

Steffen, W., Burbidge A.A, Hughes, L., Kitching, R, Lindenmayer, D., Musgrave, W.,

Stafford, S. M. and Werner, P.A. (2009). „Australia‟s biodiversity and climate

change: a strategic assessment of the vulnerability of Australian biodiversity to

climate change.‟ (A report to the natural resource Management Ministerial

Council commissioned by The Australian Government. CSIRO publishing.)

Suter, P.J. (1977a). The biology of two species of Engaeus (Decapoda: Parastacidae) in

Tasmania. I. Species description of Engaeus cisternarius, sp. nov. Mar. Freshw.

Res. 28, 77–84.

Suter, P.J., (1977b). The biology of two species of Engaeus (Decapoda: Parastacidae) in

Tasmania. II. Life history and larval development, with particular reference to E.

cisternarius. Mar. Freshw. Res. 28, 85–93.

Swofford, D.L., Olsen, G.J., Waddell, P.J. and Hillis, D.H. (1996). Phylogenetic

inference. In „Molecular systematics’. (Eds. D.H. Hillis, C. Moritz, B.K.

Mable).pp. 407–514. (Sunderland, MA: Sinauer Associates, Inc.,).

Takeuchi, W. (2007). Introduction to the flora of Papua. In „The Ecology of Indonesia

Series, Vol. 6. The Ecology of Papua’. (Eds. A.J. Marshall and B.M.

Beehler).pp. 269–302. (Periplus Editions (HK) Ltd., Hong Kong.).

138

Thai, B.T., Pham, T.A., and Austin, C.M. (2006). Genetic diversity of common carp in

Vietnam using direct sequencing and SSCP analysis of the mitochondrial control

region. Aquaculture 258, 228-240.

Toon, A., Pérez-Losada, M., Schweitzer, C. E., Feldmann, R. M., Carlson, M. and

Crandall, K. A. (2010). Gondwanan radiation of the Southern Hemisphere

crayfishes (Decapoda: Parastacidae): evidence from fossils and molecules.

Journal of Biogeography 37, 2275–2290.

Torgersen, T., Hutchinson, M.F., Searle, D.E. and Nix, H. A., (1983). General

bathymetry of the Gulf of Carpentaria and the Quaternary physiography of Lake

Carpentaria. Palaeogeography, Palaeoclimatology, Palaeoecology 41, 207-225.

Torgersen, T., Jones, M. R., Stephens, A. W., Searle, D. E. and Ullman, W. J. (1985).

Late Quaternary hydrological changes in the Gulf of Carpentaria. Nature,

London 313, 785–787.

Torgersen, T., Luly, J., De Deckker, P., Jones, M. R., Searle, D. E., Chivas, A. R., and

Ullman, W.J. (1988). Late quartenary environments of Lake Carpentaria basin,

Australia. Palaeogeography, Palaeoclimatology, Palaeoecology 67 (3-4), 245-

261.

Trontelj, P., Machino, Y, and Sket, B. (2005). Phylogenetic and phylogeographic

relationships in the crayfish genus Austropotamobius inferred from

mitochondrial COI gene sequences. Molecular Phylogenetics and Evolution 34,

212–226. doi:10.1016/j.ympev.2004.09.010

Umbgrove, J. H. F. (1949). „Structural History of the East Indies‟. (Cambridge

University Press, Cambridge.). xi–63 pp.

139

Unmack, P. J., Allen G.R., and Johnson J.B. (2013). Phylogeny and biogeography of

rainbowfishes (Melanotaeniidae) from Australia and New Guinea. Molecular

Phylogenetics and Evolution 67, 15-27.

Warfe, D. M., Pettit, N. E., Davies, P. M., Pusey, B. J., Hamilton, S. K., Kennard, M. J.,

Townsend, S. A., Bayliss, P., Ward, D. P., Douglas, M. M., Burford, M. A.,

Finn, M., Bunn, S. E. and Halliday, I. A. (2011). The „wet–dry‟ in the wet–dry

tropics drives river ecosystem structure and processes in northern Australia.

Freshwater Biology 56, 2169–2195.

Vences, M., Köhler, J., Crottini, A., and Glaw, F. (2010). High mitochondrial sequence

divergence meets morphological andbioacoustic conservatism: Boophis

quasiboehmei sp. n.,a new cryptic treefrog species from south-eastern

Madagascar. Bonn zoological bulletin 57(2), 241-255.

Vlach, P., Fischer, D., and Hulec, L. (2010). Microhabitat preferences of the stone

crayfish Austropotamobius torrentium (Schrank, 1803). Knowledge and

Management of Aquatic Ecosystems 394-395(15), 1-13. von Martens, E. (1868). Ueber einige neue Crustaceen und uber die neuholländischen

Süsswasserkrebse. Monatsberichte Akademie Wissenschaften Berlin 1868, 608-

619. von Rintelen, K., von Rintelen, T., and Glaubrecht, M. (2007). Molecular phylogeny

and diversification of freshwater shrimps (Decapoda, Atyidae, Caridina) from

ancient Lake Poso (Sulawesi, Indonesia) - The importance of being colourful.

Molecular Phylogenetics and Evolution 45(3), 1033-1041.

http://dx.doi.org/10.1016/j.ympev.2007.07.002 140

Voris, H. K. (2000). Maps of Pleistocene sea levels in Southeast Asia: shorelines, river

systems and time durations. Journal of Biogeography 27,1153–1167.

Wallace, A. R. (1863). On the physical geography of the Malay Archipelago. Journal of

the Royal Geographical Society 33, 217–234.

Wallace, A.R. (1869). „The Malay Archipelago‟. (Standford Travel Classics.).

Westerman, M., Kear, B.P., Aplin, K., Meredith, R. W., Emerling, C. and Springer, M.

S. (2012). Phylogenetic relationships of living and recently extinct bandicoots

based on nuclear and mitochondrial DNA sequences. Molecular Phylogenetics

and Evolution 62, 97–108

Wiens, J.J. (2005). Can incomplete taxa rescue phylogenetic analyses from long-branch

attraction?. Systematic Biology 54(5), 731-742.

Williams, W.D. (1981). The Crustacea of Australian inland waters. In „Ecological

biogeography of Australia‟. (Ed. A. Keast).pp. 1101-1138. (The Hague: W.

Junk).

Williams, W.D. and Allen, G.R. (1987). Fauna of Australia. In „Fauna of Australia‟

(Eds. G.R. Dyne and D.W. Walton).pp.185-201. (Canberra: Australian

Government Publishing Service.).

Williams, J., Read, C., Norton, A., Dovers, S., Burgman, M., Proctor, W. and Anderson,

H. (2001). „Biodiversity‟. (Australia State of the Environment Report 2001

(Theme Report), CSIRO Publishing on behalf of the Department of the

Environment and Heritage, Canberra.)

141

Williams, S. T. and Knowton, N. (2001). Mitochondrial pseudogenes are pervasive and

often insidious in the snapping shrimp genus Alpheus. Molecular Biology and

Evolution 18, 1484–1493.

Woinarski J., Mackey, B., Nix, H. and Traille, B. (2007). „The Nature of Northern

Australia: Natural Values, Ecological Processes and Future Prospects.‟. (ANU E

Press, Canberra, Australia.).

Wood Jr., P. L., Heinicke, M.P., Jackman, T.R., Bauer, A.M. (2012). Phylogeny of

bent-toed geckos (Cyrtodactylus) reveals a west to east pattern of diversification.

Molecular Phylogenetics and Evolution 65, 992-1003.

Wood, S. A., Kuhajek, J. M., de Winton, M. and Phillips, N. R. (2012), Species

composition and cyanotoxin production in periphyton mats from three lakes of

varying trophic status. FEMS Microbiology Ecology 79, 312–326.

doi: 10.1111/j.1574-6941.2011.01217.x

Wüster, W., Dumbrella, A.J., Hayc, C., Pooka, C.E., Williams, D.J., and Fryc, B.G.

(2005). Snakes across the Strait: trans-Torresianphylogeographic relationships

in three genera of Australasiansnakes (Serpentes: Elapidae: Acanthophis,

Oxyuranus, and Pseudechis). Molecular Phylogenetics and Evolution 34, 1–14

Yogi, N., Rantetasak, E., Haryani, G. S. and Hehanussa, P.E. (2008). „Muna Duma, The

goddes guard of Lake Paniai, Papua, Indonesia‟. Proceeding of Taal 2007: 12th

World Lake Conference. Sengupta, M and Dalwani R. (ed.). Jaipur. India. 1229-

1231

142

Yogi, N., Rantetasak, E., Haryani, G. S. and Hehanussa, P.E. (2009). A Pristine High-

Elevated Ancient Lake Complex, Lake Paniai, Papua, Indonesia. Paper

presented In Wuhan 2009: 13th World Lake Conference. Wuhan. China.

Available at: http://wldb.ilec.or.jp/data/ilec/WLC13_Papers/S17/s17-8.pdf. [Last

accesed on 07 February 2012].

Zaccara, S., Stefani, F., Galli, P., Nardi, P. A., and Crosa, G. (2004). Taxonomic

implications in conservation management of white-clawed crayfish

(Austropotamobius pallipes) (Decapoda, Astacidae) in Northern Italy. Biological

Conservation 120, 1–10. doi:10.1016/j.biocon.2004.01.020

Zeidler, W. and Adams, M. (1990). Revision of the Australian Crustacean Genus of

Freshwater Crayfish Gramastacus Riek (Decapoda: Parastacidae). Invertebr.

Taxon 3, 913-24.

Zhang, D.X. and Hewitt, G.M. (1996). Nuclear integrations: Challenges for

mitochondrial DNA markers. Trends in Ecology and Evolution 11, 247-251.

Zwickl, D.J. and Hillis, D.M. (2002). Increased Taxon Sampling Greatly Reduces Phylogenetic Error. Systematic Biology 51(4), 588-598.