DOCSLIB.ORG

Low Cytochrome Oxidase 4I1 Links Mitochondrial Dysfunction to Obesity and Type 2 Diabetes in Humans and Mice

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Low Cytochrome Oxidase 4I1 Links Mitochondrial Dysfunction to Obesity and Type 2 Diabetes in Humans and Mice International Journal of Obesity (2015) 39, 1254–1263 © 2015 Macmillan Publishers Limited All rights reserved 0307-0565/15 www.nature.com/ijo ORIGINAL ARTICLE Low cytochrome oxidase 4I1 links mitochondrial dysfunction to obesity and type 2 diabetes in humans and mice B Van der Schueren1, R Vangoitsenhoven1, B Geeraert2, D De Keyzer2, M Hulsmans2, M Lannoo1, HJ Huber2, C Mathieu1 and P Holvoet2 OBJECTIVES: Cytochrome oxidase (COX) dysfunction is associated with mitochondrial oxidative stress. We determined the association between COX expression, obesity and type 2 diabetes. SUBJECTS/METHODS: COX4I1 and COX10 genes were measured in monocytes of 24 lean controls, 31 glucose-tolerant and 67 diabetic obese patients, and 17 morbidly obese patients before and after bariatric surgery. We investigated the effect of caloric restriction and peroxisome proliferator-activated receptor (PPAR) agonist treatment on Cox in obese diabetic mice, and that of diet-induced insulin resistance in Streptozotocin-treated mice. RESULTS: Low COX4I1 was associated with type 2 diabetes in obese patients, adjusting for age, gender, smoking, interleukin-6 and high-sensitivity C-reactive protein, all related to metabolic syndrome (MetS; odds ratio: 6.1, 95% confidence interval: 2.3–16). In contrast, COX10 was low in glucose-tolerant and diabetic obese patients. In morbidly obese patients, COX4I1 was lower in visceral adipose tissue collected at bariatric surgery. In their monocytes, COX4I1 decreased after bariatric surgery, and low COX4I1 at 4 months was associated with MetS at 7 years. In leptin-deficient obese diabetic mice, Cox4i1 was low in white visceral adipose tissue (n = 13; Po0.001) compared with age-matched lean mice (n = 10). PPARγ-agonist treatment (n = 13), but not caloric restriction (n = 11), increased Cox4i1 (Po0.001). Increase in Cox4i1 depended on the increase in glucose transporter 4 (Glut4) expression and insulin sensitivity, independent of the increase in blood adiponectin. In streptozotocin-treated mice (three groups of seven mice, diet-induced insulin resistance decreased Cox4i1 and Glut4 (Po0.001 for both). CONCLUSION: COX4I1 depression is related to insulin resistance and type 2 diabetes in obesity. In peripheral blood monocytes, it may be a diagnostically useful biomarker. International Journal of Obesity (2015) 39, 1254–1263; doi:10.1038/ijo.2015.58 INTRODUCTION cytochrome oxidase (COX) complex, the terminal node and rate- Obesity is an important risk factor for metabolic syndrome (MetS), limiting step in the mitochondrial electron transport chain, is 17,18 type 2 diabetes and cardiovascular disease.1–3 Low-grade inflam- associated with mitochondrial oxidative stress, acondition 9,10,19,20 mation has been shown to underlie the development of obesity- associated with obesity, MetS and type 2 diabetes. COX4I1 4–6 is suggested to be the most important regulatory subunit related complications. Recent studies have supported the 21,22 contention that increased oxidative stress in adipose tissue is an of COX as it is required for the allosteric feedback inhibition of 7–11 the enzyme by its indirect product ATP. COX10 as this subunit is early instigator of MetS. Oxidative damage of adipose tissues is 23 associated with impaired adipocyte maturation and production of required for COX biogenesis. Hence, the aims of this study were to fl investigate the association of mitochondrial oxidative stress with pro-in ammatory adipocytokines by dysfunctional adipocytes, 24 emphasizing an important role of adiponectin.12,13 Both factors obesity, MetS and type 2 diabetes and to test the potential of increase infiltration of activated monocytes into the adipose COX4I1 and COX10 in peripheral blood monocytes as biomarkers for tissues where they differentiate into macrophages that produce a detrimental metabolic evolution in patients with obesity. To this inflammatory chemokines.14 The existence of specific markers for end, we determined their expressions in adipose tissue and in type 2 diabetes in relation to oxidative stress in adipose tissues is monocytes in representative animal models and patient populations. yet to be determined. Moreover, if these markers would be available with a simple peripheral blood test, they would be a SUBJECTS AND METHODS useful clinical tool to predict the risk of type 2 diabetes. Obesity, MetS, type 2 diabetes and cardiovascular diseases were Subjects found to be associated with systemic oxidative stress, mainly The first patient group consisted of 98 successive obese individuals: 31 evidenced by high levels of oxidized low-density lipoprotein normal glucose-tolerant obese (NGTO) patients and 67 obese patients with (LDL).8–10,15 It has been proposed that mitochondrial decline type 2 diabetes, according to the American Diabetes Association. Inclusion was blinded. The samples were collected at the Division of Endocrinology resulting in mitochondrial oxidative stress contributes to the between 27 September and 20 December 2007. Obese subjects were development of age-related metabolic and cardiovascular compared with 24 lean control persons. All participants were without 16 diseases. However, the relation of mitochondrial oxidative stress symptoms of clinical atherosclerotic cardiovascular disease. This study and those diseases remains to be elucidated. Dysfunction of the complies with the Declaration of Helsinki and the Medical Ethics 1Laboratory for Clinical and Experimental Medicine and Endocrinology, KU Leuven, Leuven, Belgium and 2Division of Atherosclerosis and Metabolism, Department of Cardiovascular Sciences, KU Leuven, Leuven, Belgium. Correspondence: Professor P Holvoet, Division of Atherosclerosis and Metabolism, Department of Cardiovascular Sciences, KU Leuven, Herestraat 49, O&N1, PB 705, B-3000 Leuven, Belgium. E-mail: [email protected] Received 22 January 2015; revised 19 March 2015; accepted 4 April 2015; accepted article preview online 14 April 2015; advance online publication, 19 May 2015 Cytochrome oxidase in obesity and diabetes B Van der Schueren et al 1255 Committee of the KU Leuven approved the study protocol. All human RNA isolation and quantitative real-time PCR analysis participants gave written informed consent. Extraction and purification of RNA and complementary DNA generation The second patient cohort comprised 17 obese individuals. These 17 was performed as described before.29,36,37 qPCR was performed on a 7500 morbidly obese subjects were referred to our hospital for bariatric surgery. Fast Real-Time PCR system using Fast SYBRGreen master mix (Applied After multidisciplinary deliberation, the selected patients received a Biosystems, Ghent, Belgium). Oligonucleotides (Invitrogen, Ghent, Belgium) laparoscopic Roux-en-Y gastric bypass. A 30-ml fully divided gastric pouch used as forward and reverse primers were designed using the ‘Primer was created and the jejunum, 30 cm distal of the ligament of Treitz, was Express’ software (Applied Biosystems; Supplementary Table 1). RNA anastomosed to it with a circular stapler of 25 mm. To restore intestinal expression levels were calculated with the delta-delta-quantification cycle transit, a fully stapled entero–entero anastomose was constructed 120 cm 38 method (ΔΔCq). β-actin for mouse experiments, and HPRT1, SDHA, TBP distal on the alimentary limb. In this way, the food passage was derived and YWHAZ for patient samples were selected as most stable house- away from almost the whole stomach, the duodenum and the proximal 39 25–27 keeping genes using GeNorm. jejunum. Monocytes were isolated from venous blood taken before, In order to test the reproducibility and variance of expression of RNA and at 4 months and 7 years after bariatric surgery. Visceral adipose tissue markers, RNA expression was measured in monocytes of 13 healthy biopsies were collected at the time of surgery. The samples were collected individuals collected at weeks 0, 1 and 2. P-values, determined by repeated between 29 March 2005 and 28 February 2013. measures test, were 0.95 for COX1, 0.96 for COX4I1, 0.92 for glutathione peroxidase (GPX1) and 0.88 for IRAK3. Receiver operating characteristic Plasma analysis (ROC) curves of week 0 and week 1 and week 2 were also compared. Mean Blood samples were centrifuged to prepare plasma samples. Total, high- areas under the curves (AUC) were 0.56 for COX10, 0.54 for COX4I1, 0.53 for density lipoprotein (HDL) cholesterol, triglycerides, adiponectin, oxidized GPX1 and 0.54 for IRAK3, whereby an ROC of around 0.5 indicates no LDL (Ox-LDL), high-sensitivity C-reactive protein (hs-CRP) and interleukin-6 evidence that the data are different according to time of collection. Mean (IL-6) were measured as before.28 LDL cholesterol levels were calculated within-group variability was 14% for COX10, 12% for COX4I1 and 17% for using the Friedewald formula. Plasma glucose was measured using GPX1 and IRAK3. the glucose oxidase method (Johnson & Johnson, Zaventem, Belgium), and insulin with an immunoassay (Biosource Technologies, Fleunes, Statistics 29,30 Belgium). Insulin resistance was calculated by a homeostasis model Two groups were compared using an unpaired Mann–Whitney U-test. More assessment of insulin resistance (HOMA-IR) = fasting plasma insulin − 1 31 than two groups were compared using nonparametric one-way analysis of (mU l ) x fasting blood glucose (mM)/22.5. All laboratory assessments variance (Kruskal–Wallis) followed by comparison by the Dunn’smultiple were performed without the knowledge of clinical data. Blood pressure comparison test
Load more

Recommended publications
  • COX10 (NM 001303) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC119292 COX10 (NM_001303) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: COX10 (NM_001303) Human Untagged Clone Tag: Tag Free Symbol: COX10 Synonyms: MC4DN3 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for NM_001303, the custom clone sequence may differ by one or more nucleotides ATGGCCGCATCTCCGCACACTCTCTCCTCACGCCTCCTGACAGGTTGCGTAGGAGGCTCTGTCTGGTATC TTGAAAGAAGAACTATACAGGACTCCCCTCACAAGTTCTTACATCTTCTCAGGAATGTCAATAAGCAGTG GATTACATTTCAGCACTTTAGCTTCCTCAAACGCATGTATGTCACACAGCTGAACAGAAGCCACAACCAG CAAGTAAGACCCAAGCCAGAACCAGTAGCATCTCCTTTCCTTGAAAAAACATCTTCAGGTCAAGCCAAAG CAGAAATATATGAGATGAGACCTCTCTCACCGCCCAGCCTATCTTTGTCCAGAAAGCCAAATGAAAAGGA ATTGATAGAACTAGAGCCAGACTCAGTAATTGAAGACTCAATAGATGTAGGGAAAGAGACAAAAGAGGAA AAGCGGTGGAAAGAGATGAAGCTGCAAGTGTATGATTTGCCAGGAATTTTGGCTCGACTATCCAAAATCA AACTCACAGCTCTGGTTGTAAGTACCACTGCAGCTGGATTTGCATTGGCTCCGGGCCCTTTTGACTGGCC CTGTTTCCTGCTTACTTCTGTTGGGACAGGCCTTGCATCCTGTGCTGCCAACTCCATCAATCAGTTTTTT GAGGTGCCATTTGACTCAAACATGAATAGGACAAAGAACAGACCGCTGGTTCGTGGACAGATCAGCCCAT TGCTAGCTGTGTCCTTTGCCACTTGTTGTGCTGTTCCGGGAGTTGCCATTCTGACCTTGGGGGTGAATCC ACTCACAGGAGCCCTGGGGCTCTTCAACATTTTCCTGTATACCTGCTGCTACACACCACTGAAAAGGATC AGCATTGCCAACACATGGGTCGGAGCTGTGGTTGGGGCCATCCCGCCTGTCATGGGCTGGACAGCGGCCA CGGGCAGCCTCGATGCTGGCGCATTTCTCCTGGGAGGAATCCTCTACTCCTGGCAGTTTCCTCATTTCAA
    [Show full text]
  • A Small De Novo 16Q24.1 Duplication in a Woman with Severe Clinical Features
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by HAL-Université de Bretagne Occidentale A small de novo 16q24.1 duplication in a woman with severe clinical features. Sylvia Qu´em´ener-Redon,Caroline B´enech, S´everine Audebert-Bellanger, Ga¨elleFriocourt, Marc Planes, Philippe Parent, Claude F´erec To cite this version: Sylvia Qu´em´ener-Redon, Caroline B´enech, S´everine Audebert-Bellanger, Ga¨elle Friocourt, Marc Planes, et al.. A small de novo 16q24.1 duplication in a woman with severe clini- cal features.. European Journal of Medical Genetics, Elsevier, 2013, epub ahead of print. <10.1016/j.ejmg.2013.01.001>. <inserm-00788405> HAL Id: inserm-00788405 http://www.hal.inserm.fr/inserm-00788405 Submitted on 14 Feb 2013 HAL is a multi-disciplinary open access L'archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destin´eeau d´ep^otet `ala diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publi´esou non, lished or not. The documents may come from ´emanant des ´etablissements d'enseignement et de teaching and research institutions in France or recherche fran¸caisou ´etrangers,des laboratoires abroad, or from public or private research centers. publics ou priv´es. A small de novo 16q24.1 duplication in a woman with severe clinical features Sylvia Quéméner-Redon1,2, Caroline Bénech1,3, Séverine Audebert-Bellanger4, Gaëlle Friocourt1, Marc Planes4, Philippe Parent4 and Claude Férec1,2,3 1 Institut National de la Santé et de la Recherche Médicale (INSERM), UMR1078, Brest, France, 2 Laboratoire de Génétique Moléculaire et d’Histocompatibilité, Centre Hospitalier Universitaire (CHU), Hôpital Morvan, Brest, France, 3 Etablissement Français du Sang (EFS) – Bretagne, Brest, France, 4Service de Pédiatrie et de Génétique Médicale, Centre Hospitalier Universitaire de Brest, Brest, France.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • Mutation in the COX4I1 Gene Is Associated with Short Stature, Poor Weight Gain and Increased Chromosomal Breaks, Simulating Fanconi Anemia
    European Journal of Human Genetics (2017) 25, 1142–1146 & 2017 Macmillan Publishers Limited, part of Springer Nature. All rights reserved 1018-4813/17 www.nature.com/ejhg ARTICLE Mutation in the COX4I1 gene is associated with short stature, poor weight gain and increased chromosomal breaks, simulating Fanconi anemia Bassam Abu-Libdeh*,1,4, Liza Douiev2,3,4, Sarah Amro1, Maher Shahrour1, Asaf Ta-Shma2, Chaya Miller2,3, Orly Elpeleg2 and Ann Saada*,2,3 We describe a novel autosomal recessive form of mitochondrial disease in a child with short stature, poor weight gain, and mild dysmorphic features with highly suspected Fanconi anemia due to a mutation in COX4I1 gene. Whole Exome Sequencing was performed then followed by Sanger confirmation, identified a K101N mutation in COX4I1, segregating with the disease. This nuclear gene encodes the common isoform of cytochrome c oxidase (COX) subunit 4 (COX 4-1), an integral regulatory part of COX (respiratory chain complex IV) the terminal electron acceptor of the mitochondrial respiratory chain. The patient’s fibroblasts disclosed decreased COX activity, impaired ATP production, elevated ROS production, decreased expression of COX4I1 mRNA and undetectable (COX4) protein. COX activity and ATP production were restored by lentiviral transfection with the wild-type gene. Our results demonstrate the first human mutation in the COX4I1 gene linked to diseases and confirm its role in the pathogenesis. Thus COX4I1 mutations should be considered in any patient with features suggestive of this diagnosis. European Journal of Human Genetics (2017) 25, 1142–1146; doi:10.1038/ejhg.2017.112; published online 2 August 2017 INTRODUCTION normal vaginal delivery with birth weight of 2.8 kg after an uneventful Mitochondrial cytochrome c oxidase (COX, complex IV) is the terminal pregnancy.
    [Show full text]
  • Loss of COX4I1 Leads to Combined Respiratory Chain Deficiency And
    cells Article Loss of COX4I1 Leads to Combined Respiratory Chain Deficiency and Impaired Mitochondrial Protein Synthesis Kristýna Cunˇ átová 1,2, David Pajuelo Reguera 1 , Marek Vrbacký 1, Erika Fernández-Vizarra 3 , Shujing Ding 3, Ian M. Fearnley 3, Massimo Zeviani 3 , Josef Houštˇek 1 , Tomáš Mráˇcek 1,* and Petr Pecina 1,* 1 Laboratory of Bioenergetics, Institute of Physiology, Czech Academy of Sciences, 142 00 Prague, Czech Republic; [email protected] (K.C.);ˇ [email protected] (D.P.R.); [email protected] (M.V.); [email protected] (J.H.) 2 Department of Cell Biology, Faculty of Science, Charles University, 128 00 Prague, Czech Republic 3 MRC Mitochondrial Biology Unit, University of Cambridge, Cambridge CB2 0XY, UK; [email protected] (E.F.-V.); [email protected] (S.D.); [email protected] (I.M.F.); [email protected] (M.Z.) * Correspondence: [email protected] (T.M.); [email protected] (P.P.) Abstract: The oxidative phosphorylation (OXPHOS) system localized in the inner mitochondrial membrane secures production of the majority of ATP in mammalian organisms. Individual OXPHOS complexes form supramolecular assemblies termed supercomplexes. The complexes are linked not only by their function but also by interdependency of individual complex biogenesis or maintenance. For instance, cytochrome c oxidase (cIV) or cytochrome bc1 complex (cIII) deficiencies affect the level of fully assembled NADH dehydrogenase (cI) in monomeric as well as supercomplex forms. It was hypothesized that cI is affected at the level of enzyme assembly as well as at the level of cI stability and maintenance.
    [Show full text]
  • Hypoxia Inducible Factors Modulate Mitochondrial Oxygen Consumption and Transcriptional Regulation of Nuclear-Encoded Electron T
    Article pubs.acs.org/biochemistry Hypoxia Inducible Factors Modulate Mitochondrial Oxygen Consumption and Transcriptional Regulation of Nuclear-Encoded Electron Transport Chain Genes † § † ‡ ∥ † † ‡ † Hye Jin Hwang, , Scott G. Lynn, , , Ajith Vengellur, Yogesh Saini, , Elizabeth A. Grier, † § † § ‡ Shelagh M. Ferguson-Miller, , and John J. LaPres*, , , † ‡ § Department of Biochemistry and Molecular Biology, Center for Integrative Toxicology, and Center for Mitochondrial Science and Medicine, Michigan State University, East Lansing, Michigan 48824-1319, United States *S Supporting Information ABSTRACT: Hypoxia inducible factor-1 (HIF1) is a stress-responsive nuclear transcription factor that is activated with a decrease in oxygen availability. HIF1 regulates the expression of genes involved in a cell’s adaptation to hypoxic stress, including those with mitochondrial specific function. To gain a more comprehensive understanding of the role of HIF1 in mitochondrial homeostasis, we studied the link between hypoxia, HIF1 transactivation, and electron transport chain (ETC) function. We established immortalized mouse embryonic fibroblasts (MEFs) for HIF1α wild-type (WT) and null cells and tested whether HIF1α regulates mitochondrial respiration by modulating gene expressions of nuclear-encoded ETC components. High- throughput quantitative real-time polymerase chain reaction was performed to screen nuclear- encoded mitochondrial genes related to the ETC to identify those whose regulation was HIF1α- dependent. Our data suggest that HIF1α regulates transcription of cytochrome c oxidase (CcO) heart/muscle isoform 7a1 (Cox7a1) under hypoxia, where it is induced 1.5−2.5-fold, whereas Cox4i2 hypoxic induction was HIF1α-independent. We propose that adaptation to hypoxic stress of CcO as the main cellular oxygen consumer is mediated by induction of hypoxia-sensitive tissue-specific isoforms.
    [Show full text]
  • THE FUNCTIONAL SIGNIFICANCE of MITOCHONDRIAL SUPERCOMPLEXES in C. ELEGANS by WICHIT SUTHAMMARAK Submitted in Partial Fulfillment
    THE FUNCTIONAL SIGNIFICANCE OF MITOCHONDRIAL SUPERCOMPLEXES in C. ELEGANS by WICHIT SUTHAMMARAK Submitted in partial fulfillment of the requirements For the degree of Doctor of Philosophy Dissertation Advisor: Drs. Margaret M. Sedensky & Philip G. Morgan Department of Genetics CASE WESTERN RESERVE UNIVERSITY January, 2011 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of _____________________________________________________ candidate for the ______________________degree *. (signed)_______________________________________________ (chair of the committee) ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. Dedicated to my family, my teachers and all of my beloved ones for their love and support ii ACKNOWLEDGEMENTS My advanced academic journey began 5 years ago on the opposite side of the world. I traveled to the United States from Thailand in search of a better understanding of science so that one day I can return to my homeland and apply the knowledge and experience I have gained to improve the lives of those affected by sickness and disease yet unanswered by science. Ultimately, I hoped to make the academic transition into the scholarly community by proving myself through scientific research and understanding so that I can make a meaningful contribution to both the scientific and medical communities. The following dissertation would not have been possible without the help, support, and guidance of a lot of people both near and far. I wish to thank all who have aided me in one way or another on this long yet rewarding journey. My sincerest thanks and appreciation goes to my advisors Philip Morgan and Margaret Sedensky.
    [Show full text]
  • Upregulation of COX4-2 Via HIF-1Α in Mitochondrial COX4-1Deficiency
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 10 February 2021 Upregulation of COX4-2 via HIF-1α in mitochondrial COX4-1deficiency Liza Douiev1*, Chaya Miller1, Shmuel Ruppo2, Hadar Benyamini2, Bassam Abu-Libdeh3, Ann Saada1,4* Affiliations 1 Department of Genetics, Hadassah Medical Center, Jerusalem 9112001, Israel. 2 Info-CORE, I-CORE Bioinformatics Unit of the Hebrew University of Jerusalem and Hadassah Medical Center 3 Department of Pediatrics, Makassed Hospital and Al-Quds University, Jerusalem 91220, Palestinian Authority 4Faculty of Medicine, Hebrew University of Jerusalem, 9112001, Israel *corresponding authors Prof. Ann Saada (Reisch), Department of Genetics, Hadassah Medical Center, Jerusalem 9112001, Israel. [email protected], [email protected] Liza Douiev, Department of Genetics, Hadassah Medical Center, Jerusalem 9112001, Israel [email protected] Abstract Cytochrome-c-oxidase (COX) subunit 4 (COX4) plays important roles in the function, assembly and regulation of COX (mitochondrial respiratory complex 4), the terminal electron acceptor of the oxidative phosphorylation (OXPHOS) system. The principal COX4 isoform, COX4-1, is expressed in all tissues, whereas COX4-2 is mainly expressed in the lungs, or under hypoxia and other stress conditions. We have previously described a patient with a COX4-1 defect with a relatively mild presentation compared to other primary COX deficiencies, and hypothesized that this could be the result of compensatory upregulation of COX4-2. To this end, COX4-1 was downregulated by shRNAs in human foreskin fibroblasts (HFF), and compared to patient's cells. COX4-1, COX4-2 and HIF-1α were detected by immunocytochemistry. The mRNA transcripts of both COX4 isoforms and HIF-1 target genes were carried out by RT-qPCR.
    [Show full text]
  • Upregulation of COX4-2 Via HIF-1 in Mitochondrial COX4-1 Deficiency
    cells Article Upregulation of COX4-2 via HIF-1α in Mitochondrial COX4-1 Deficiency Liza Douiev 1,*, Chaya Miller 1, Shmuel Ruppo 2 , Hadar Benyamini 2, Bassam Abu-Libdeh 3 and Ann Saada 1,4,* 1 Department of Genetics, Hadassah Medical Center, Jerusalem 9112001, Israel; [email protected] 2 Info-CORE, I-CORE Bioinformatics Unit of the Hebrew, University of Jerusalem and Hadassah Medical Center, Jerusalem 91120011, Israel; [email protected] (S.R.); [email protected] (H.B.) 3 Department of Pediatrics and Genetics, Makassed Hospital and Al-Quds University, East Jerusalem 91220, Palestine; [email protected] 4 Faculty of Medicine, Hebrew University of Jerusalem, Jerusalem 9112001, Israel * Correspondence: [email protected] (L.D.); [email protected] or [email protected] (A.S.) Abstract: Cytochrome-c-oxidase (COX) subunit 4 (COX4) plays important roles in the function, assembly and regulation of COX (mitochondrial respiratory complex 4), the terminal electron acceptor of the oxidative phosphorylation (OXPHOS) system. The principal COX4 isoform, COX4-1, is expressed in all tissues, whereas COX4-2 is mainly expressed in the lungs, or under hypoxia and other stress conditions. We have previously described a patient with a COX4-1 defect with a relatively mild presentation compared to other primary COX deficiencies, and hypothesized that this could be the result of a compensatory upregulation of COX4-2. To this end, COX4-1 was downregulated by shRNAs in human foreskin fibroblasts (HFF) and compared to the patient’s cells. COX4-1, COX4-2 and HIF-1α were detected by immunocytochemistry.
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]
  • Chromosomal Microarray Analysis in Turkish Patients with Unexplained Developmental Delay and Intellectual Developmental Disorders
    177 Arch Neuropsychitry 2020;57:177−191 RESEARCH ARTICLE https://doi.org/10.29399/npa.24890 Chromosomal Microarray Analysis in Turkish Patients with Unexplained Developmental Delay and Intellectual Developmental Disorders Hakan GÜRKAN1 , Emine İkbal ATLI1 , Engin ATLI1 , Leyla BOZATLI2 , Mengühan ARAZ ALTAY2 , Sinem YALÇINTEPE1 , Yasemin ÖZEN1 , Damla EKER1 , Çisem AKURUT1 , Selma DEMİR1 , Işık GÖRKER2 1Faculty of Medicine, Department of Medical Genetics, Edirne, Trakya University, Edirne, Turkey 2Faculty of Medicine, Department of Child and Adolescent Psychiatry, Trakya University, Edirne, Turkey ABSTRACT Introduction: Aneuploids, copy number variations (CNVs), and single in 39 (39/123=31.7%) patients. Twelve CNV variant of unknown nucleotide variants in specific genes are the main genetic causes of significance (VUS) (9.75%) patients and 7 CNV benign (5.69%) patients developmental delay (DD) and intellectual disability disorder (IDD). were reported. In 6 patients, one or more pathogenic CNVs were These genetic changes can be detected using chromosome analysis, determined. Therefore, the diagnostic efficiency of CMA was found to chromosomal microarray (CMA), and next-generation DNA sequencing be 31.7% (39/123). techniques. Therefore; In this study, we aimed to investigate the Conclusion: Today, genetic analysis is still not part of the routine in the importance of CMA in determining the genomic etiology of unexplained evaluation of IDD patients who present to psychiatry clinics. A genetic DD and IDD in 123 patients. diagnosis from CMA can eliminate genetic question marks and thus Method: For 123 patients, chromosome analysis, DNA fragment analysis alter the clinical management of patients. Approximately one-third and microarray were performed. Conventional G-band karyotype of the positive CMA findings are clinically intervenable.
    [Show full text]
  • Human Mitochondrial Pathologies of the Respiratory Chain and ATP Synthase: Contributions from Studies of Saccharomyces Cerevisiae
    life Review Human Mitochondrial Pathologies of the Respiratory Chain and ATP Synthase: Contributions from Studies of Saccharomyces cerevisiae Leticia V. R. Franco 1,2,* , Luca Bremner 1 and Mario H. Barros 2 1 Department of Biological Sciences, Columbia University, New York, NY 10027, USA; [email protected] 2 Department of Microbiology,Institute of Biomedical Sciences, Universidade de Sao Paulo, Sao Paulo 05508-900, Brazil; [email protected] * Correspondence: [email protected] Received: 27 October 2020; Accepted: 19 November 2020; Published: 23 November 2020 Abstract: The ease with which the unicellular yeast Saccharomyces cerevisiae can be manipulated genetically and biochemically has established this organism as a good model for the study of human mitochondrial diseases. The combined use of biochemical and molecular genetic tools has been instrumental in elucidating the functions of numerous yeast nuclear gene products with human homologs that affect a large number of metabolic and biological processes, including those housed in mitochondria. These include structural and catalytic subunits of enzymes and protein factors that impinge on the biogenesis of the respiratory chain. This article will review what is currently known about the genetics and clinical phenotypes of mitochondrial diseases of the respiratory chain and ATP synthase, with special emphasis on the contribution of information gained from pet mutants with mutations in nuclear genes that impair mitochondrial respiration. Our intent is to provide the yeast mitochondrial specialist with basic knowledge of human mitochondrial pathologies and the human specialist with information on how genes that directly and indirectly affect respiration were identified and characterized in yeast. Keywords: mitochondrial diseases; respiratory chain; yeast; Saccharomyces cerevisiae; pet mutants 1.
    [Show full text]