Saccharomyces Cerevisiae

Identification of a New Set of Cell Cycle-Regulatory Genes That Regulate S-Phase Transcription of Histone Genes in Saccharomyces cerevisiae HAIXIN XU, UNG-JIN KIM, TILLMAN SCHUSTER, AND MICHAEL GRUNSTEIN* Molecular Biology Institute and Department ofBiology, University of California, Los Angeles, California 90024-1570 Received 20 April 1992/Returned for modification 9 June 1992/Accepted 11 August 1992

Histone mRNA synthesis is tightly regulated to S phase of the yeast Saccharomyces cerevisiae cell cycle as a result of transcriptional and posttranscriptional controls. Moreover, histone gene transcription decreases rapidly if DNA replication is inhibited by hydroxyurea or if cells are arrested in G1 by the mating pheromone a-factor. To identify the transcriptional controls responsible for cycle-specific histone mRNA synthesis, we have developed a selection for mutations which disrupt this process. Using this approach, we have isolated five mutants (hpcl, hpc2, hpc3, hpc4, and hpc5) in which cell cycle regulation of histone gene transcription is altered. All of these mutations are recessive and belong to separate complementation groups. Of these, only one (hpcl) falls in one of the three complementation groups identified previously by other means (M. A. Osley and D. Lycan, Mol. Cell. Biol. 7:4204-4210, 1987), indicating that at least seven different genes are involved in the cell cycle-specific regulation of histone gene transcription. hpc4 is unique in that derepression occurs only in the presence of hydroxyurea but not a-factor, suggesting that at least one of the regulatory factors is specific to histone gene transcription after DNA replication is blocked. One of the hpc mutations (hpc2) suppresses 8 insertion mutations in the HIS4 and LYS2 loci. This effect allowed the cloning and sequence analysis of HPC2, which encodes a 67.5-kDa, highly charged basic protein.

Histone mRNAs are synthesized and accumulated prefer- transcribed divergently from common regulatory elements entially in S phase of the eukaryotic cell cycle, partly as a (19, 49). cis-acting regulatory elements, including three result of transcriptional controls which cause the rate of upstream activator sequence (UAS) repeats and a negative synthesis of histone mRNAs to increase during S phase. repressor element, have been identified in the region be- Also, posttranscriptional regulation results in the preferen- tween the HTAI and HTB1 genes (34). The UAS elements tial degradation of histone mRNAs outside of S (reviewed in are required for cell cycle-dependent activation of the HTAl- reference 17). These two mechanisms of regulation function HTB1 pair, while the negative element is necessary for to decrease mammalian histone mRNA levels after DNA repressing the transcription of this gene pair during stages synthesis is blocked in the presence of hydroxyurea (HU) other than S phase. Deletion of the negative element has (17). In this report, we focus on cell cycle-specific, transcrip- resulted in the constitutive transcription of histone mRNAs tional control of histone mRNA synthesis. during the yeast cell cycle (29, 34); however, histone mRNA The human histone H4 gene is transcribed more efficiently accumulation is still S phase specific in these cells as a result (3- to 10-fold) in S-phase extracts than in extracts taken from of posttranscriptional degradation of histone mRNAs in cells at other stages of the cell cycle (18). Mammalian stages other than S phase (34, 54). upstream promoter elements responsible for this regulation As an initial step toward unraveling the mechanism of cell have been identified (1, 6, 16, 28, 42). Moreover, fusion of cycle-dependent histone gene transcription, three genes the 5' end of the mouse histone H3 gene to the bacterial (HIR1, HIR2, and HIR3) encoding factors that regulate neomycin resistance (neo) gene causes the bacterial mRNA histone mRNA synthesis have been identified (35, 44). to be in a cell manner (3). cis- synthesized cycle-specific Mutations in these genes were detected by including in a acting regulatory sequences and their trans-acting protein yeast strain an integrated HTA1 promoter-lacZ fusion gene factors are likely responsible for regulating histone mRNA synthesis (7, 10, 11, 14, 50; reviewed in reference 33); and screening for mutants which overexpressed 1-galactosi- however, the molecular details of the regulatory mechanism dase. These mutants, which also lost normal periodic transcription of HTA1 mRNA, did so as a result of a disruption by which this occurs are still under investigation. in function through the repressor element (35). While these The yeast Saccharomyces cerevisiae provides a system which allows the identification genetically of trans-acting mutants altered the degree of repression of several other factors that regulate cycle-specific histone mRNA synthesis. histone gene loci upon treatment of the cells with HU, other Yeast histone genes are organized into four genetically cell cycle-regulated genes such as the HO endonuclease (31), unlinked gene pairs: two copies each for the histone H2A- involved in switching of mating loci, and CDC9 (36), the H2B gene pair (HTA1-HTB1 and HTA2-HTB2) (20, 51) and structural gene for DNA ligase, were expressed normally. two copies for the histone H3-H4 gene pair (HHT1-HHFI Interestingly, these hir mutations all suppress a well- and HHT2-HHF2) (48). Each of the histone gene pairs is characterized yeast mutant in which a solo 8 element, serving as the promoter of a yeast transposon (Ty), has been inserted at HIS4 and LYS2 loci his4-9128 and lys2-1288 (44). 8 insertions at these two loci have previously been shown to * Corresponding author. alter either transcriptional initiation (his4-9128) or termina- 5249 5250 XU ET AL. MOL. CELL. BIOL. tion (lys2-1288), producing a His- or Lys- phenotype (9, 47, TABLE 1. Yeast strains 52). It is noteworthy that among the many loci which have been identified as SPT (suppressor of Ty), two of them, sptll Strain Relevant genotype Source and sptl2, have been characterized as mutations at the YM259 AMTa ade2 his3 tyrl ura3 L. Johnson promoter region of the HTAI-HTBI locus. The wild-type YM214 MA4Ta ade2 his3 iys2 ura3 L. Johnson HTAI-HTBI gene pair on a high-copy-number plasmid can UKY9 MATa ade2 his3 tyrl ura3 hpcl This study also suppress his4-9128 and lys2-1288 (8). Furthermore, HXY100 AMTa ade2 his3 tyrl ura3 hpc2 This study recessive mutations in three known SPT genes (SPT1, HXY1O1 MATTa ade2 his3 lys2 ura3 hpc2 This study UKY24-1 MATa ade2 his3 Iys2 ura3 hpc3 This study SPTIO, and SPT21) have also been found to derepress UKY24-2 MATa ade2 his3 tyrl ura3 hpc3 This study HTAI-HTB1 transcription upon the inhibition of DNA syn- UKY35 MATa ade2 his3 tyrl ura3 hpc4 This study thesis. SPT1 has been shown to be allelic to HIR2, while UKY35-25 MATa ade2 his3 lys2 ura3 hpc4 This study SPTIO and SPT21 are distinct from other histone-regulatory UKY36 AlATa ade2 his3 tyrl ura3 hpcS This study genes (44). Therefore, it seems that S. cerevisiae employs a UKY36-5D MATa ade2 his3 Iys2 ura3 hpcS This study complex system that involves two types of cis-regulatory HXY103 MATa ade2 hpc2 ura3 HIS3 LYS2 This study elements and many trans-acting factors to coordinate his- HXY104 MATa ade2 hpc2 ura3 HIS3 LYS2 This study tone synthesis with the cell division cycle. HXY116 MATa ade2 lys2 HPC2/HPC2::URA3 This study To isolate new regulatory mutants that alter periodic 21-1A MATa his3 his7 leu2 trpl ura3 hirl M. A. Osley 24-SB MATa his7 leu2 trpl ura3 hir2 M. A. Osley transcription of the yeast histone genes, we used a direct 30-9C MATa ade2 leu2 trpl ura3 hir3 M. A. Osley selection. This was done by fusing the HTAI promoter to the FW1237 MATa ura3 his4-9128 lys2-1288 F. Winston bacterial neo gene, which when transcribed at high levels FW1238 MATa ura3 his4-9128 lys2-1288 F. Winston causes yeast cells to become resistant to the neomycin analog G418. It is expected that mutations in the trans-acting factors repressing the HTAI promoter should result in constitutive high levels of neo synthesis. This analysis identified and then digested by SaII to create sticky ends. The recir- five mutations (hpcl, hpc2, hpc3, hpc4, and hpcS [hpc for cularized plasmids were screened by sequencing, and two histone promoter control]), each in a different complemen- deletions that removed HTA1 coding sequences up to 29 and tation group. Four of these mutations belong to different 18 bp upstream of the ATG codon were picked to make the complementation groups from those isolated previously as following two constructs. The XhoI-SaiI fragment from each histone-regulatory mutations (35). In addition, hpc2 shows a of these two plasmids containing the HTA1-HTBI promoter very strong Spt- phenotype, suppressing both his4-9128 and region was subcloned into the SalI site of pSEYC58 plasmid lys2-1288 insertion mutations. This feature was used to clone (13) in such an orientation that the Sall site close to the the HPC2 gene. This gene encodes a 624-amino-acid, highly EcoRI site is conserved and the direction ofHTAI transcrip- charged basic protein which can fully complement the Spt- tion is opposite that of the lacZ gene contained in pSEYC58. phenotype and restores normal cell cycle control of histone These constructs, after partial digestion with BamHI, were HTAJ gene expression in an hpc2 strain. digested with Sal, and the large fragments were ligated to the 922-bp BgiII-SalI fragment of the neo gene from the MATERIALS AND METHODS bacterial transposon TnS (23). Colonies were screened on LB plates containing 10 ,ug of neomycin per ml after trans- Media, chemicals, and strain constructions. All media used formation into Eschenichia coli. Then a HindIII-EcoRI DNA have been described previously (43) except for the following. fragment of pAB120 containing the yeast transcriptional SG is identical to SD except that 2% galactose is used termination sequence of the CYCI gene (obtained from Fred instead of glucose as the sole carbon source, and zinc Sherman's laboratory) was inserted at the 3' end of the neo chloride (20 ,g/ml) was added to the sporulation media to gene. BamHI fragments containing the slightly different increase the ratio of tetrads to triads (4). The strains used in HTA1 promoter-neo gene-CYCI terminator fusions were this study are shown in Table 1. Standard techniques for subcloned into the BamHI site of pTSA (a CEN3 URA3+ yeast genetics were followed (43). Mating-type conversion of plasmid [41]). The two resultant plasmids were designated MATa hpcl cells to MA4Tao was performed by transforming pTS38b and pTS39b, respectively. pTS42b and pTS43b were plasmid pGAL.HO (URA3+) (26) into hpcl cells, and Ura+ constructed as follows. A SacI-BamHI-SacI linker was transformants were selected on SD-Ura plates. After grow- inserted into the unique SacI site located at the center of the ing in SD-Ura, the transformants were switched to YEPG HTAl-HTBJ intergenic region. The approximately 400-bp medium, grown for 6 h, and plated on YEPD for single- BamHI fragment including the repressor element and two colony isolation. Each of the colonies grown on YEPD UASs was removed by partial BamHI digestion and religa- plates was tested for mating type by crossing with D585-4B1 tion. The large BamHI fragments now including the trun- (MATot hisl) and D587-11C (MA4Ta lysl) on YM plates. EMS cated intergenic regions fused to neo-CYCl terminator con- (ethyl methanesulfonate) and HU were purchased from structs were also ligated into the BamHI site of pTSA, Sigma Chemical Co., a-mating pheromone was purchased resulting in plasmids pTS42b and pTS43b. from Peninsula Scientific Biochemicals, and G418 (Geneti- Screening and analysis of regulatory mutants. Yeast strain cine) was purchased from GIBCO. YM259 was transformed with either pTS38b or pTS39b, and Construction of plasmids. Standard procedures for DNA the transformants were mutagenized by EMS. Five millili- manipulation (38) were used for construction of the plasmids ters of the cells in late log phase was pelleted, the cells were described below. An approximately 800-bp HindIII-BamHI resuspended in 1.5 ml of 50 mM phosphate buffer (pH 7.0), fragment including the region between the HTAI and HTBI 50 ,ul of EMS was added, and the cells were shaken at 30°C genes was subcloned into the HindIII-BamHI sites of pUC8 for 1 h. After addition of 8 ml of 5% sodium thiosulfate, the (30). The plasmid was linearized by HindIII digestion, and cells were pelleted by centrifugation, resuspended in 1.5 ml the remaining HTAJ protein-coding region was removed by of YEPD, and shaken at 30°C for 2 h. Aliquots (200 ,ul) of the Bal 31 exonuclease. A SalI linker was added to both ends mutagenized cells were plated on YEPD containing 300 ,ug of VOL. 12, 1992 HISTONE CELL CYCLE-REGULATORY GENES 5251

G418 per ml and incubated at 30°C. The selected colonies neo were picked and grown for further analysis. Of the five SacI BamHI BamHI mutants picked, all but hpc3 were obtained from the trans- CYCl-term SalI formation of YM259 cells with plasmid pTS38b. hpc3 was HTA1 promoter obtained by the use of pTS39b. HU arrest was done as CEN3 described previously (29), with some modifications. Cells pTS39b URA3 were grown to approximately 5 x 10' cells per ml in YEPD. HU was added to a final concentration of 0.3 M, and the HindMif culture was shaken at 30°C for 40 min. Arrest of cells was Bgll ampR examined by microscopy. Synchronization of cells with the arsi EcoRI yeast pheromone a-factor was done as described previously (25). The length of the cell cycle was found to vary some- FIG. 1. Restriction map of plasmid pTS39b. The coding region of what in these experiments, possibly because of variability in the bacterial neo gene from TnS, the HTA1 promoter, and the recovery from a-factor arrest. transcriptional termination sequence from the CYCI gene are fused Northern (RNA) blot analysis. Total yeast RNA was iso- so that neo transcription is under the control of the histone HTAI promoter. The plasmid also contains URA3, CEN3, and ARS1 lated by hot phenol extraction (12), with minor modifica- sequences for stable maintenance in yeast cells. pTS39b and pTS38b tions. About 10 ml ofyeast log-phase culture (optical density are identical except that pTS38b contains HTAI promoter se- at 600 nm of 0.3 to 0.5) was harvested and resuspended in 1 quences up to -29 bp from the ATG codon, while pTS39b has the ml of 100 mM sodium acetate (pH 5.3)-10 mM EDTA-1% same sequences up to -18 bp (see Materials and Methods). sodium dodecyl sulfate. The cell suspension was vortexed and then extracted with an equal volume of phenol at 65°C for 10 min with vigorous shaking. The probes were prepared and Northern blot experiments were performed as described allow resistance to a moderate G418 level, while constitutive previously (12). Films were preflashed and exposed at -70°C synthesis resulting from a mutation in a cycle-specific regu- with intensifying screens (Dupont Cronex Lightning-Plus). latory protein should allow resistance to higher levels of Cloning and sequencing of the HPC2 gene. HXY104 (hpc2 G418. his4-9128 lys2-1288 ura3) was used as the recipient strain for We found that control YM259 yeast cells could not grow transformation of a yeast genomic library in plasmid YCp5O on rich medium (YEPD plates) containing 100 ,ug of G418 per (37). Two plasmids with overlapped inserts which fully ml. In contrast, YM259 cells transformed with plasmid complemented both Spt- and hpc2 mutations were isolated. pTS39b showed resistance to G418 at 100 jig/ml. However, Further subcloning was carried out to limit the DNA frag- these cells could not grow on YEPD plates containing G418 ment that is able to complement the mutations. The restric- at 300 ,ug/ml. To determine whether constitutive synthesis of tion fragment pairs ClaI-ClaI, BamHI-BamHI, SalI-ClaI, aminoglycoside phosphotransferase would allow resistance BamHI-BamHI, and HindIII-EcoRI were subcloned into to the higher level of G418, YM259 cells were transformed shuttle vector pRS316 (46), resulting in plasmids pHX104, with plasmid pTS43b, in which the repressor element pHX105, pHX107, pHX111, and pHX113, respectively. through which cell cycle-specific HTAJ regulation is con- These plasmids were then transformed into HXY104 to trolled was deleted from the promoter construct of pTS39b examine their ability to rescue the mutation. pHX111 was (see Materials and Methods). This procedure results in chosen for sequencing in both directions by the dideoxy- constitutive activity of the HTAJ promoter throughout the chain termination method, using Sequenase (U.S. Biochem- cell cycle (35). We found that at 300 ,ug of G418 per ml, ical Corp.) (39). approximately 30% of the YM259 cells containing pTS43b Primer extension analysis. Total RNA was extracted from survived. In a parallel set of experiments, we also used an the wild-type yeast strain YM259 grown in YEPD as de- analogous plasmid construction which contained the HTAI scribed above. Primer extension procedures used were as promoter sequence deleted up to 29 bp upstream of the ATG described elsewhere (38). The primer used for the reaction initiation codon. This plasmid, pTS38b, and its derivative, was 5'-GCGTTIGCATT-ITGCCACTCG-3', corresponding pTS42b, whose repressor element was also deleted, were to the region from positions 52 to 73. transformed in YM259 cells. The strains containing these Nucleotide sequence accession number. The nucleotide plasmids responded in the same manner to G418 as did those sequence reported in this article has been submitted to the containing pTS39b and its repressor element deletion deriv- GenBank sequence data base under accession number ative pTS43b. Therefore, treatment of yeast cells with 300 M94207. ,ug of G418 per ml should allow for the selection of yeast mutants in which neo activity has become constitutive. RESULTS YM259 cells transformed with pTS38b or pTS39b were mutagenized with EMS, and approximately 200 G418-resis- Selection for mutants that alter cell cycle-specific expression tant colonies were picked. Since normal histone mRNA of histone genes. To select for mutants which cause deregu- synthesis is repressed as a result of blocking DNA synthesis lation of cell cycle-specific histone mRNA synthesis, we or at stages outside of S phase, the only mutant strains of constructed the plasmids shown in Fig. 1. pTS39b contains interest to us were those whose endogenous histone mRNA the bacterial neo gene, which encodes aminoglycoside phos- synthesis was no longer repressed after treatment of the cells photransferase (23), under the control of the histone HTA1 with HU or upon arrest in G1 with yeast a-mating factor. promoter (up to 18 bp upstream of the HTAJ initiation Therefore, mutant strains were arrested by either HU or codon). When active, the fusion gene should allow cell a-mating factor and subjected to Northern blot analysis. growth in the presence of the neomycin analog G418 (21, 27). From this secondary screen, five mutants, hpcl, hpc2, hpc3, Since the HTA1 promoter is normally active only during S hpc4, and hpcS, which showed a reproducible derepression phase (35), we reasoned that neo activity controlled by the of HTA1 mRNA synthesis were chosen (Fig. 2). The DNA HTA1 promoter in a wild-type genetic background should probe used for detecting RNA levels in the Northern blot 5252 XU ET AL. MOL. CELL. BIOL.

HPC' hpc / ,oc/?pC2 hpc3 hpOC4 I. I7OC =_ -r 6 I 6 HU -±+ +-+-+-+ --+-+- X bpcl R2-**T FIG. 2. Identification of histone-regulatory HTAJ mutants. The levels of histone HTA1 transcript in response to the presence of HU PT' and a-factor arrest (a) are shown by Northern blot analysis. After X hpc2 EMS mutagenesis, five G418-resistant mutant strains in different complementation groups were isolated. These mutant and wild-type X/hpc3 HTA1-S ' (HPC+) strains were grown in YEPD medium, and aliquots of the culture were arrested by 0.3 M HU for 40 min or arrested at G1 by a-factor (10 pg/ml) for 3 h. Total RNA was then extracted from X hpcc4 PRT1 -1416w 46 is 0 - * 4** harvested cells, and 7 ,ug was electrophoresed in each lane. A 1.4-kb HindIII fragment of the TRTI region containing HTA1 and PRTI! AKY2 coding sequences (20) was used as a probe. An hpc mutant X /pc5 S 9@-9 ss phenotype is seen as the continuous transcription of the HTA1 gene in the presence of HU and/or a-factor. FIG. 3. hpc mutant complementation tests. hpc and hir haploid mutant strains were crossed in pairwise combinations, and the resultant diploids were tested for the inability to repress the HTA1 transcript level after HU arrest. Successful complementation resulted in a significantly reduced level of HTAI mRNA, comparing analysis contains both HTAJ and AKY2IPRTI DNA se- levels before (-) and after (+) HU treatment. Diploids formed by quences. The latter is a contiguous gene which codes for an mating hpc strains to wild-type cells (HPC+) or to themselves were mRNA that is not cell cycle regulated and serves as an included as controls. All hpc mutations complement hir mutations internal control (32, 35). RNA taken from unarrested wild- except hpcl, which falls in the same complementation group as does type cells (HPC+) produces an HTAI band which is consid- hir3. erably darker than the PRTJ mRNA band (lane 1). However, after either HU or a-factor arrest, the intensity of the HTAI band decreases so that its signal is equal to or less than that genes. Therefore, all hpc mutants appear to have mutations of PRT1. hpcl, hpc2, hpc3, and hpcS all cause a similar in single chromosomal genes. derepression in HTAI mRNA synthesis, since the level of Three different complementation groups (hirl, hir2, and the HTAI mRNA was significantly higher after either HU or hir3) identified previously (35, 44) have mutant phenotypes a-factor arrest compared with that of the HPC+ cells under- similar to those ofhpcl, hpc2, hpc3, and hpcS. To determine going the same treatments. In contrast, hpc4 shows little if whether any of the five hpc and three hir mutants were in the any effect on HTAl derepression after at-factor treatment but same complementation groups, these mutants were crossed strongly derepresses HTAJ transcription after HU arrest. with each other. As shown in Fig. 3, all hpc mutations Identification of four new complementation groups involved complemented hir mutations except for hpcl, which did not in cycle-specific HTAI regulation. To estimate the number of complement hir3. This finding indicates that hpcl and hir3 genes involved in the regulation of HTAJ transcription, belong to the same complementation group. Therefore, we complementation tests were done (Fig. 3). All of the mutants conclude that there are at least seven different gene products were crossed in pairwise combinations, and the resultant involved in the cycle-specific repression of histone HTA1 diploids were tested for the ability to repress HTAI tran- mRNA synthesis (occurring after HU arrest). scription after HU arrest. When crossed to each other, all of hpcl, hpc2, hpc3, and hpc5 alter periodic synthesis ofHTAI the hpc mutants complemented each other's defect in HU- mRNA but not DNA polymerase I mRNA. To examine the mediated repression. However, when mated to form ho- effect of hpc mutations on periodic synthesis of HTAJ mozygous diploids, none of the five hpc mutants comple- mRNA, we compared HTAJ mRNA levels during synchro- mented. Therefore, these mutations comprise five different nous growth after a-factor arrest of hpc mutant strains (Fig. complementation groups. Figure 3 also demonstrates that 4). In HPC+ cells, the expression of HTAJ mRNA peaks diploids generated from the matings between hpc mutants during S phase (35 to 55 min in the first cell cycle and 100 to and YM214 (HPC+) showed wild-type phenotypes with 120 min in the subsequent cell cycle). In contrast, in com- respect to HU-mediated repression of HTA1 transcription. parison with the level of HTAJ mRNA in the wild-type Therefore, hpc mutations are all recessive to their wild-type strain, all hpc strains except hpc4 showed a two- to fourfold homologs and are likely in genes encoding trans-acting increase in the level of accumulation of HTA1 mRNA factors. The trans-acting nature of hpc mutations was further outside of S phase (normalized to the PRTJ control message demonstrated by restoring the G418 resistance of the mu- level) (Fig. 4; data not shown), indicating that the repression tants after plasmid pTS39b was lost and retransformed into of HTAJ mRNA synthesis in G1 and G2 phases has been the same mutant strains. disrupted in these mutant strains. While periodicity in HTAI To determine whether the deregulation of histone gene mRNA levels can still be noticed in these mutant strains, the transcription in the five hpc mutants was the result of peak level of HTA1 mRNA accumulation in hpc3 was mutations in single genes, we sporulated each heterozygous delayed for approximately 25 min compared with the result diploid and monitored the segregation of hpc and HPC genes for the wild-type control strain. Consistent with the results by using the HU-mediated test. We found that while two showing that the hpc4 mutation does not prevent HTAI spore colonies in each tetrad dissected contained the wild- mRNA accumulation after a-factor arrest (Fig. 2), the hpc4 type HPC homologs, each of the other two contained an hpc mutation shows little if any effect on the periodicity of the mutant allele (data not shown). This 2:2 segregation pattern HTAJ message level during the cell cycle (Fig. 4). is the expected outcome for mutations in single nuclear We then wished to determine whether mutations in HPC VOL. 12, 1992 HISTONE CELL CYCLE-REGULATORY GENES 5253

HPC+ hpc3

0 0 00 00 000 0-° u0 r- 0 o- o~ of) Ot o) (O N- LO0O - 0 _ NC LDOIt ca ) W N oft 1s 0 r- _r- ,r POLI -POLl

PRT1 - PRT1 HTA1 HTA1 hpcl hpc4

0 0 0 0 000 0 0 0 0 0-C o o O O 0o 0 0o 0 0 o Nq cs lncD0 coT- O~~~~( N- CO c)LO£rQ N,I- 0lmatWS 'O. POLl POLl

PRT1 ~~~~~~~~~~~PRTI HTA1 *0" HTA1

hpc2 hpc5

0 0 0 0 000000000 0 0000 N0 lq 0 o-0 0 0 0 0 0 0 0 0 0 C0 0t o00T-Nmit C 0N-COC'J0) - ,- -y--(0 cm CO It LO Co r- co em. we, POLl POLl

~PRT1 ^--PRT1 W* _-H TAIH I__ HTAl

FIG. 4. Effects of hpc mutations on the periodic syntheses of HTA1 and POLI mRNAs. HPC+ and hpc cells were synchronized in G1 by a-factor. After release from this block, aliquots of the cultures were removed during the subsequent cycles of synchronous growth. The levels of mRNA were measured in these samples by Northern analysis by probing with a 0.5-kb EcoRI-SaII DNA fragment of pLJ23 containing the POLI coding region and a 1.4-kb HindlIl DNA fragment of the TRTJ region for HTAJ and PRT1 messages (20). Numbers indicate times in minutes after release of the cell cultures from a-factor arrest. None of the hpc mutations prevent cycle-specific synthesis of POLl mRNA compared with the cycling of HTA1 mRNAs. genes disrupt cycle-specific synthesis of a cell cycle-regu- regulatory mechanism distinct from that of the other histone lated nonhistone mRNA. Therefore, we tested the effects of gene pairs. In support of this view, two newly isolated these mutations on the transcription of the DNA polymerase recessive mutations (sptlO and spt2l) appear to have a direct I (POLl) gene, which is cell cycle regulated in yeast cells effect on HTA2-HTB2 transcription only (44). (ii) All of the (22). Our results demonstrate that this gene is generally mutations except hpc3 prevent HU-mediated repression of under normal cell cycle regulation in all hpc mutant strains the HTAJ, HHT1, and HHT2 loci as well as HTB1 (data not when we compare peak accumulation times with that of shown). (iii) The effect of the hpc3 mutation appears to be HTAJ mRNA (Fig. 4). In hpc3, both H7TA and POLl restricted to the HTAI gene and does not affect the re- accumulation peaks lag in a similar manner compared with sponses of two HHT genes to treatment with either HU or their analogous peak in the HPC+ strain. This lag may result from a nonspecific effect of the hpc3 mutation in allowing recovery from a-factor release. Previous studies with hir mutations have suggested that cell cycle regulation of his- HPC+ /Dpcs h?pc2 /ipc3 hpc4 hpc5 _- tone genes is distinct from that of CDC9 and HO genes (35). D o D I U I I I) I I 3 These and our data indicate that histone genes utilize regulatory factors which are distinct from those of other cell 0 41 a -HTB2 cycle-regulated genes. a_ Effect of hpc mutations on the cell cycle regulation of other histone gene loci. All four core histone mRNAs are accumu- m -HHTI lated specifically in S phase, as determined by Northern Alkvd.- analysis (24, 35). hirl, hir2, and hir3, which eliminate HTA1 wF__w,Am& w_ wt_ HHT2 HU-mediated repression, also eliminate repression of genes coding for histones H2B2 (HTB2), H3-1 (HHT1), and H3-2 FIG. 5. Effects of hpc mutations on the periodic synthesis of (HH72) after HU treatment (35). Therefore, we wished to histone mRNA other than HTAI. RNA was isolated from wild-type determine whether hpc mutations affected these histone (HPC+) and hpc mutant cells with or without HU or a-factor (a) gene classes (Fig. 2 and 5). We observed the following. (i) treatment. The levels of histone mRNAs were measured by North- The is not affected of the hpc ern analysis by probing with the following labeled DNA fragments: HTB2 gene by any mutations a 0.7-kb EcoRI fragment from pMH201 (15) containing HTB2, a in strains undergoing HU treatment. In addition, none of the 0.5-kb EcoRV-SmaI fragment of pMS203 containing HHT1, and a mutations appear to cause the accumulation ofHTB2 mRNA 0.45-kb BamHI-EcoRV fragment of pMS191 containing HHT2 (47). during a-factor arrest. This result is similar to that obtained In the case of HHTI and HHT2, the probes cross-hybridized to the previously with the use of hir mutations (35). These data two classes of transcripts because of the strong homology between indicate that the HTA2-HTB2 gene pair utilizes a cell cycle- these two copies, and thus fainter secondary bands were generated. 5254 XU ET AL. MOL. CELL. BIOL. a-factor. Moreover, hpc3 affects the response of the HTBI HPC+ 1A 1B lC 1D 2A 2B 2C 2D gene to both HU and a-factor arrest (data not shown). These A [ _ [ data suggest that the hpc3 mutation affects a trans-acting L.. J- SD complete factor unique to the cycle-specific control of the HTAl- -f1'- HTB1 locus only. (iv) The hpc4 mutation does not cause SD-histidrne accumulation of mRNAs synthesized from the HTA1 and SD-lysine two HHT genes under a-factor arrest. In contrast, the hpc4 mutation derepresses transcription from these loci when + + 4- + + + + + HU treated with HU, suggesting that its role is specific to histone - D PRT1 gene transcription after DNA replication is blocked. 40 a 40 a - HTA1 hpc2 suppresses 8 insertion mutations at the HIS4 and LYS2 loci. To further understand how HPC are involved in FIG. 6. Suppression of 8 insertion mutations by hpc2. Meiotic genes progeny from two tetrads of a cross between FW1237 (HPC2 histone gene regulation, we attempted to isolate HPC genes his4-9128 lys2-1288) and HXY104 (hpc2 his4-9128 lys2-1288) were by complementing the G418 resistance phenotype in hpc tested for suppression of the his4-9128 and lys2-1288 alleles by mutant strains. However, this method did not succeed replica plating onto SD complete (row A), SD-histidine (row B), and because of the presence of a large number of false positives. SD-lysine (row C) media. An Spt- phenotype is manifest as growth Since both changes in histone gene dosage and hir mutations on all three media. The HPC2 phenotype of the same spore colonies suppress 8 insertion mutations his4-9128 and lys2-1288 (8, from the cross described above was determined by the HU-medi- 44), we decided to examine the effects of hpc mutations on ated test as described in Materials and Methods (row D). The first these two 8 insertion alleles. two lanes, included as controls, are wild-type (HPC') cells treated If an hpc mutation suppresses the 8 insertion mutations with (+) or without (-) HU. An hpc2 phenotype is indicated as (his4-9128 and lys2-1288), then we expect that segregation of precisely cosegregating with the Spt- phenotype. His+/His- and Lys+/Lys- phenotypes will deviate from 2:2 when the resultant diploid strain is sporulated. By crossing hpc2, hpc3, hpc4, and hpcS strains which are HIS4 LYS2 Cloning and sequence analysis of the HPC2 gene. To clone with FW1238 (HPC+ his4-9128 lys2-1288), we found that the HPC2 gene, HXY104 (hpc2 his4-9128 lys2-1288 ura3) hpc4 and hpcS do not suppress 8 insertion mutations, as the was transformed with a yeast genomic library constructed in His+/His- and Lys+/Lys- phenotypes segregated 2:2 in 9 of plasmid YCp5O (37). The recipient strain, HXY104, is His' 11 tetrads dissected for hpc4 analysis and 14 of 14 tetrads Lys+ because of the suppression of his4-9128 and lys2-1288 dissected for hpcS analysis. The suppression pattern of hpc3 by hpc2. Since hpc2 is recessive, Ura+ transformants which could not be determined since sporulation of the diploid carry the wild-type HPC2 gene on a plasmid should be His- strain hpc3/FW1238 was extremely poor. In 10 of 14 tetrads Lys-. Therefore, the Ura+ transformants were screened for dissected from a diploid strain generated by crossing hpc2 those that acquired a His- Lys- phenotype. Two candidates and a 8 insertion strain (FW1238), there was an excess of were obtained out of approximately 25,000 transformants His+ and/or Lys+ spore colonies grown in media lacking screened that complemented the Spt- as well as the hpc either histidine or lysine, resulting in a 3:1 ratio of His+/His- mutant phenotype. They contained 9 and 14 kb, respec- and/or Lys+/Lys-. The excess His+ and/or Lys' spore tively, of genomic DNA insert in YCp50. These two clones colonies which grew slowly were anticipated to arise as a were shown to have common restriction fragments (data not result of suppression of the his4-9128 or lys2-1288 allele by shown). The 9-kb insert, named pHXl1Ob, was chosen since hpc2. All of these segregants were found to contain the hpc2 it demonstrated full HPC2 function by the criteria described mutation, as determined by derepression of HTAJ transcrip- above (Fig. 7A). To characterize the HPC2 gene in greater tion in the presence of a chromosome replication block (data detail, several subclones were constructed and tested for not shown). These results suggest that among the hpc strains HPC2 function. pHXlll, which contains a 5-kb BamHI tested, only hpc2 shows a strong Spt- phenotype and may fragment, was found to be sufficient to perform fully both suppress the two 8 insertion mutations. HPC+ and SPT+ functions (Fig. 7B), suggesting that the To confirm that hpc2 does suppress 8 insertions, we HPC2 gene resides in this region. backcrossed a segregant which was hpc2 his4-9128 lys2-1288 We verified that the clones contained the authentic HPC2 (HXY104) to the original HPC2 his4-9128 lys2-1288 strain, gene by demonstrating that the cloned DNA directed inte- FW1237. The hpc phenotype should cosegregate tightly with gration of a plasmid into the HPC2 locus. Plasmid pHX116, His' and Lys+ only if the hpc2 mutation causes the sup- an integrating plasmid which contains the 5-kb HindIII- pression. Ten tetrads were dissected and tested for both hpc EcoRI fragment of cloned DNA, was linearized at a unique and auxotrophic phenotypes. Our results show that the SpeI site within the cloned DNA and introduced into YM259 His+/His-, Lys'/Lys-, and HPC+/hpc phenotypes segre- (HPC2 his3 tyrl ura3). A Ura+ transformant (HXY116) was gated in the ratio of 2:2. In addition, all His+ Lys+ spores crossed to strain HXY104 (hpc2 lys2 ura3). In eight tetrads were hpc and all His- Lys- spores were HPC+, as deter- dissected, the HPC+ and URA+ phenotypes cosegregated in mined by the HU-mediated test (Fig. 6). These results every tetrad, indicating that pHX116 DNA was tightly linked confirm that hpc2 suppresses both the his4-9128 and lys2- to the HPC2 locus. Therefore, we conclude that the hpc2- 1288 alleles. complementing DNA fragment that we have isolated most All spt mutations as well as the three hir mutations that likely contains the HPC2 gene. have been examined suppress 8 insertions at the transcrip- The nucleotide sequence of the 5.0-kb BamHI DNA tional level. To test whether this was also true in the hpc2 fragment that contains the hpc2-complementing activity was strain, we used Northern gel analysis to compare transcrip- determined by dideoxy sequencing in both orientations (38). tion in both hpc2 and HPC2 strains at the HIS4 locus. Our Within this region, two large open reading frames (ORF1 and results demonstrate that hpc2 suppresses the his4-9128 in- ORF2) which are transcribed in opposite directions were sertion by partially restoring HIS4 transcription at its normal found (Fig. 7A). To determine which of the two ORFs is able start site (data not shown). to encode the HPC2 function, we constructed several sub- VOL. 12, 1992 HISTONE CELL CYCLE-REGULATORY GENES 5255 A

cr1 - HPCLSPT Ex 8 E 'a a _ i XX 8 E E ,I .I .1 _ pHX1 OOb + ORFI ORF2 1 kb l-] § i- pHX105

-I pHX104

I- pHX1 11 + pHXI 13 pHX107 I- pHX1 10 +

B in hpc2 HPC2 hpc2 100b 105 104 111 113 107 110

+ -+ + + + + + + - + HU - PRT1 a, * " ss " $ ^ " --HTA1 FIG. 7. Cloning and characterization of the HPC2 gene. (A) Restriction map of the HPC2 locus. The top line (pHX100b) represents the 9-kb insert containing the HPC2 locus and its restriction sites. The thin portion of the line represents vector sequences. DNA fragments that were subcloned to test for HPC/SPT function are shown below. ORFi and ORF2 are represented by filled and hatched boxes, respectively. Directions of transcription are indicated by arrows. (B) Evidence that the HPC2 gene resides in a 5-kb HindIII-EcoRI fragment. The ability to complement the hpc2 mutation by different subclones was determined by HU treatment. Northern analysis was used to measure both HTA1 and PRTI mRNA levels. An hpc2 strain (HXY103) was used as the recipient strain for transformation by all of the subclones as well as the 9-kb insert (pHX100b). Both HPC2 and hpc2 strains were also included as controls.

clones which delete part of either one of these two coding Two minor bands appeared as a result of primer extension, sequences. pHX105, which removes 245 putative amino acid suggesting that two guanine residues at positions -34 and codons from ORFi but leaves ORF2 intact, was no longer -35 may also serve as minor initiation sites. Thus, the capable of rescuing either the Spt- or hpc2 mutant pheno- adenine residue in the first in-frame ATG has been numbered type (Fig. 7B). In contrast, pHX113, which deletes 185 as nucleotide 1. The HPC2 transcript was identified by putative amino acid codons from ORF2 but leaves ORFi probing a Northern blot of total yeast RNA with a ClaI-NheI intact, was fully able to perform SPT+ and HPC+ functions. DNA fragment within the HPC2 coding region (Fig. 8). This Therefore, we conclude that the HPC2 gene resides in analysis revealed a major transcript of about 2.1 kb (Fig. ORF1. 9B). Allowing for the 3' untranslated sequence and a poly(A) Defining the HPC2 transcriptional unit. There are several tail, the mRNA size is consistent with the size of the HPC2 ATGs found in frame which could serve as the translation coding region (1,872 bp) (see below). start codon within the presumed HPC2 ORE (Fig. 8). To Shown in Fig. 8 is the nucleotide sequence of the HPC2- determine which one may be utilized as the start codon to containing DNA fragment. This sequence reveals that ORFi encode the putative HPC2 polypeptide, we mapped the 5' encodes a protein of 624 amino acids with a calculated transcriptional initiation site of the HPC2 gene by primer molecular weight of 67,490. The predicted protein is highly extension analysis. An adenine at position -37 was mapped charged (30% charged amino acid groups) and basic, as the as the major start site of HPC2 gene transcription (Fig. 9A). estimated pI is approximately 10.05. No substantial homol- 5256 XU ET AL. MOL. CELL. BIOL.

GGATOGCAATCC

-480

-360

-240

-120 ATGATATCAATTGTTTCTTGTAC'TGGAAAAAAAGTCAGAAATATGTCAGCAAGCCACA ATCA AAACAGATGTATAATTTGCA&TTCTGAAACGATTTAACAACAGTATTAA

1 M I A I V L D NS K S G S K Q T K 55S G KNMQ T Q T D T N A E V L N T D N S IK 40 121 AAAAAGATATTAGTTTCAAATTAAAAAAGAAGAAACACTGTAGATGGAACGACAGAAGTC KE T GS D SE D LFN KF S NK K TN RK I P N IA E ELA KN RN Y VKG A 80 Clax 241TCCGCCCTAATTTGTCCTACTTCTAGCCCTCCATCACCAGGAACAGAC TAAAAAATTGAA PBSP I II S GS S STS PS G P SS S STN P MG I P TN R FNKXNT V EL 120 361TACGACACTCCGCAGCATAA CTAAAAGAAAGCAAATAATTGTAAAAACCGAGGACTTCTTT Y Q HSP P VMNT TNK T DT E EKRQ N N RNMD N KN T P E RG S SFA 160

481 CTACAAAATTTCTCTACAACCCAGATCAAATTCTT;CACTTGCAAAAATATCCCGATAATA A K QLK IS SL L T I S S NE D SKT LH IN DT N GNK N SNA A SN NI P 200

601 TCCTTCGATCTCGCGATGATATATAAACCCACCCCGATATTTAGCAATACTCACCGAAGA A Y A E L H T E G N I E S L I K P P s S. P R N K S L T P K V I L P TQ N M D 240

721 GAAT;AAGAc ATTCGGAATCCAGAATAACAACATCCCTATTGTTGAGATCCACCCCAATTC G T I A K D P H LG D NT P G I L I AK TBS S P VN L D VE S T A QS L GK F N 280

841 ACTCC~TCTG~GTCCiCAAC~T.A.4CTTTTAc.AcTATCGTCACC;ATTA~TGTC;AAA.C K S T NS L KA A LT KA PAE K VS L KRS IS SBV T NBS D SN ISBBS K K P 320

Nhel 961 AGC1RAACAAATAGTACTACAATCAACACAGCAGCTAAAAC=ACAATGGTCACCAAAACC T E K A K K S A A I L P K P T T T K T K K A A N D T R K K N A 360

1081 TGAAaTCTA,CTAGAGGCATCGCCAATACCGTAAGAATGTTTTTCACAGCCGGAGAAGTA N K T T A I K K E N A G K L N T V K K E N S L I K A T E E K D K 400

1201 GTGATGAGAGAAACCACGACTAAAGACATCAACCAAAGTGACGACAATATCCAAATTCAC G GNBS T EAKNBS TS BN V RKE PTA K SP K R LVA APT V SP PK I LQ T 440

1321 GAAACMCAG.ACTGTTGTGCTCATTTAGTAAAAGCACAAGACGC&-TTTTATACATTAAA A E T K A K E P I L I D V P L YQ A D T N D Y L D E N GQ V I F N L S T L I K 480 1441GAAGAACCAATAAACGCCAT;GATTAA,ATTTATCAATCACTCACGTATGAAGAAGTAGAA E K Y H P K K E L A Q L K D S K R N L L M Q L S D H S N G L E K E K D E E G 520

1561 GTTAAAC GACATCGACACCACCCGAAGATGACTTAAG D V I E L D D D E D M4 E E D E G E I D T E T N T V T T T I P K K K S H P M K G 560

1681 AAATGTGTATTAGTAGTCTCTGTATGATATTGAGAACTCGCCAGAGTTTTTTCTGTCTAT K N LI GK Y DV ED PF I D DBSE LL W EEQRAA T K DG FF V YFGPL I 600

1801GAAAGCCAGATTGAC;AAGTCAGAAAGGTTAAAAAACATTTAAATTCAACCGAGCTAAAA E K G H TYAS LERANGTMKRGMKRG VKNKK K

1921 ATAGGGCAACGAGAAATATTTTAGTTTCACATCTTTTCTTTTTTCAATTGGAGAAAAAAT 2041TCCTAAATTTACTCTTACCGACATTGAGTATTTGTGATAAAATAACTATTTCATAAATATG

2161 AGALTTCGTT;TTTATCCACA&TTTCCTTATACTTCGGAAG;TTTATCAGGTTCGACTGACTTCAAATTACGAATCAATC2%GA& AsuXX

FIG. 8. Nucleotide sequence of the HPC2 gene and predicted amino acid sequence of its gene product. Nucleotides are numbered on the left (the adenine residue of the first ATG codon downstream from the transcription start site was defined as 1); amino acids are numbered on the right. The termination codon is represented by an asterisk. The major transcriptional start site is indicated by a triangle, and minor start sites are marked by carets. The primer (OLIGO) used in primer extension is underlined. The Clal-Nhel fragmnent used in measuring HPC2 mRNA size is also indicated.

ogy was detected when the deduced amino acid sequence of transcription of histone mRNAs during the yeast cell cycle the HPC2 gene product was compared with existing se- (29, 34). Therefore, we have introduced a new selection quences in the GenBank data base or in the extensive private scheme for yeast mutations whose regulation of cell cycle- data base of Mark Goebl (University of Indiana). specific histone mRNA synthesis has been disrupted. This method employs an HTAI promoter-neo reporter gene in strains and that mutations in DISCUSSION mutagenized yeast predicts trans-acting repressor regulatory factors will result in con- Cell cycle-specific histone gene transcription in yeast cells stitutive HTA1 promoter function and therefore resistance to is regulated by cis-acting regulatory elements. In the HTAl- high concentrations of the neomycin analog G418. Using this HTBI gene pair, such sequences include three UAS repeats assay, we have identified five different genes (HPCJ, HPC2, and a negative repressor element (34). The UAS elements HPC3, HPC4, and HPCS) encoding trans-acting factors are utilized for cell cycle-specific activation of the H-TAl- whose mutation causes cell cycle regulation of histone gene HTBI pair, while the negative element is necessary for transcription to be disrupted. All of these genes except repressing its transcription outside of S phase. Deletion of HPCI differ from previously identified HIR (HIRI, HIR2, the negative element or mutations in trans-acting factors and HIR3) and SPT (SPTJO and SPT'21) genes whose muta- functioning through this element results in the constitutive tions also disrupt histone cell cycle regulation (35, 44). HPCJ VOL. 12, 1992 HISTONE CELL CYCLE-REGULATORY GENES 5257

- expression. A number of nonhistone genes are also regulated A A' A B in a cycle-specific manner in yeast cells (2). Among these G .\ \ A GC T are 1 2 genes those encoding proteins involved in DNA replica- C, tion (CDC9 and POLl) or mating-type switching (HO). G I;a 9.49 - Interestingly, the four new HPC genes described here and G -.1E: 7.46 - genes a i three HIR identified previously comprise regulatory A to A 4.40 - mechanism unique the cycle-specific regulation of histone G genes. In support of this conclusion, none of the hpc or hir C X * A 2.37 - mutations affects cell cycle regulation of genes other than A histone genes (35; this study). Conversely, we could not find T 1.35- any evidence suggesting that regulatory mutations of the HO c c gene (swil, swi4, swi5, and sinl) (30) altered cycle-specific c transcription of histone genes (41). In addition, the consen- sus activation sequences found at promoter A the histone c ; 0.24 - region differ from those at the promoter of other cell cycle- Ai controlled genes, such as the HO gene (40). The existence of Ai A j distinct regulatory mechanisms for histone gene expression A !.i may reflect the finding that histone genes appear to be Ao .1 autoregulated and are transcribed later in the yeast cell cycle C (late G1/early S) than are the CDC9, POL1, and HO genes, FIG. 9. Evidence that the HPC2 gene encodes a 2.1-kb tran- which are also expressed in G1 in a cell cycle-dependent script. (A) Mapping of the HPC2 transcription start site by primer manner (2). extension. RNA was extracted from exponentially growing wild- Multiple regulatory pathways are involved in cell cycle- type YM259 cells. The primer extension reactions were monitored specific HTA1 transcription. The hpcl/hir3, hpc2, and hpcS as described previously (38). Products of dideoxy sequencing of mutations display phenotypes similar to those of hirl and plasmid pHX113, using 35S-ATP as the labeling agent, were loaded hir2 mutations reported previously (35). All of them cause next to the primer extension reaction mixture. The same oligonu- cleotide used for both primer extension and sequencing reactions is derepression of histone gene transcription after DNA syn- indicated in Fig. 8. The sequencing lanes and the primer extension thesis is inhibited as well as accumulation of mRNAs at G1 lane were derived from the same gel exposed for different periods of and G2 phases from HTAl-HTB1 and two HHT loci. The time. (B) Northern analysis of HPC2 mRNA. Total RNA was similar phenotypes of mutants defective in HPCJ/HIR3, isolated from YM259 cells, and 20 and 10 pg were run in lanes 1 and HPC2, HPCS, HIR1, and HIR2 gene products could possi- 2, respectively. A ClaI-NheI DNA fragment within the HPC2 bly be explained if such genes regulate the synthesis of coding region was used to probe the Northern blot (see also Fig. 8). others in this group. However, none of the HPC gene Numbers on the left indicate the positions and sizes (in kilobases) of products regulate HPC2 transcription (53). In addition, the molecular size markers. HIRJ and HIR2 do not regulate each other's transcription (45). Therefore, these gene products may contribute to the same pathway regulating cycle-specific transcription (Table and HIR3 are in the same complementation group. One of 2). the HPC genes, HPC2, has been cloned by complementation Mutations in the HPC3 and HPC4 genes reveal that at and shown to encode a highly charged basic protein. Our least two additional pathways may be involved in cycle- work and that published previously (35, 44) describing the specific histone gene regulation. First, unlike the hpc and hir ease in identifying new complementation groups whose mutations described above, hpc3 shows a stringent locus- mutation alters cycle-specific histone mRNA synthesis sug- specific derepression, disrupting only the HTAI-HTB1 lo- gest that more such genes have yet to be identified. There- cus. Moreover, a newly identified dominant mutant (HIR9) fore, it is likely that S. cerevisiae utilizes a complex system also affects the HTAI-HTB1 locus only (33). Second, hpc4 involving a large number of regulatory factors to regulate shows strong derepression ofHTAJ transcription upon treat- histone mRNA synthesis during the cell cycle. ment with HU but not with a-factor. This finding suggests A distinct regulatory mechanism controls histone gene for the first time that certain factors are distinct to the

TABLE 2. Properties of histone-regulatory mutants Histone mRNA expression Suppression Strain(s)r After After HU Cell of 8 Histone genes affected a-factor cycle affest arrest specific msertionsb Wild typec No No Yes No hpcl/hir3, hpc2, hirl, hir2/sptl Yes Yes No Yes HTAl-HTBI, HHTI, HHT2 hpcS Yes Yes No No HTAI-HTBI, HHTI, HHT2 hpc4 No Yes Yes No HTAI-HTBI, HHTI, HHT2 hpc3, HIR9 Yes Yes No NDd HTAI-HTBI sptlO, spt2l ND Yes ND Yes HTA2-HTB2 a Data for hir/spt mutations were derived from references 33, 35, and 44. b Strains FW1237 and FW1238, containing 8 insertion mutations his4-9128 and lys2-128B, were used to cross with hpc/hir/spt mutants. c Strain YM259, from which all hpc mutant strains were obtained. d ND, not determined. 5258 XU ET AL. MOL. CELL. BIOL. regulatory mechanisms functioning in HTA1-HTB1 cycle- binding proteins. Rather, they may play a catalytic role in specific transcription after DNA replication is blocked or the stimulating some other regulatory factor(s) to modulate cell cycle is arrested at GI. It is interesting that hpc4 and histone gene expression during the cell cycle. The hpc hpcS also appear unique in that they do not suppress the 8 mutations described here should help in deciphering these insertion mutations at the HIS4 and LYS2 loci, in contrast to interactions. the effects of hpc2, hirl, hir2, and hpcllhir3 mutations (44). We do not know whether hpc3 has a similar suppression ACKNOWLEDGMENTS function due to its poor sporulation rate when crossed to a We thank Jef Boeke, Lianna Johnson, Mary Ann Osley, and Fred strain containing the 8 insertion mutations. Suppression is Winston for yeast strains and many helpful discussions. We are likely to result from changes in histone stoichiometry which grateful to Mark Goebl for searching his private data base for affect nucleosome structure at the promoter regions of sequence homologies. We are also thankful to Lianna Johnson and his4-9128 and lys2-1288, leading to altered promoter usage at Bo Thomsen for reading the manuscript and for helpful comments. these two loci (8). While it is likely that hpcS causes This work was supported by Public Health Service grant overexpression of histone dimers, judging from its constitu- GM23674 from the National Institutes of Health. tive histone mRNA synthesis throughout the cell cycle (Fig. REFERENCES of imbalanced histone 4), it is possible that the magnitude 1. Alterman, R.-B., S. Ganguly, D. H. Schulze, W. F. Marzluff, and synthesis in hpc4 and hpcS is not sufficient to cause alter- A. I. Skoultchi. 1984. Cell cycle regulation of mouse histone H3 ations of transcription at HIS4 and LYS2 promoter regions. mRNA metabolism. Mol. Cell. Biol. 4:123-132. Alternatively, these HPC genes may have unique functions 2. Andrews, B. J., and I. Herskowitz. 1990. Regulation of cell in the regulation of histone synthesis. For example, the cycle-dependent gene expression in yeast. J. Biol. Chem. 265: HPC4 gene product is required only for replication-depen- 14057-14060. dent transcription of histone genes. The functions altered in 3. Artishevsky, A., A. Grafsky, and A. S. Lee. 1985. Isolation of a hpc4 or hpcS may be intrinsically incapable of suppressing 8 mammalian sequence capable of conferring cell cycle regulation insertion mutations. Why these additional levels of regula- to a heterologous gene. Science 230:1061-1063. 4. Bilinski, C. A., and J. J. Miller. 1980. Induction of normal tion are important when HTAJ and HTBI are already subject ascosporogenesis in two-spored Saccharomyces cerevisiae by to temporal and autogenous regulation (33) remains to be glucose, acetate, and zinc. J. Bacteriol. 143:343-348. determined. It is likely that mutations distinguishing be- 5. Breeden, L. 1988. Cell cycle-regulated promoters in budding tween the various pathways will be useful in determining the yeast. Trends Genet. 4:249-253. nature of these various pathways. 6. Capasso, O., G. C. Bleecker, and N. Heintz. 1987. Sequences HPC/HIR proteins may function not by direct DNA binding controlling histone H4 mRNA abundance. EMBO J. 6:1825- but by assisting a dedicated repressor(s). The repressor ele- 1831. ment present within the HTA1-HTB1 intergenic region and 7. Capasso, O., and N. Heintz. 1985. Regulated expression of probably also in the two HHT-HHF intergenic promoters (5, mammalian human histone H4 genes in vivo requires a trans- acting transcription factor. Proc. Natl. Acad. Sci. USA 82:5622- 33) is necessary to repress transcription in the G1 and G2 5626. phases of the normal cell cycle as well as in S phase after the 8. Clark-Adams, C. D., D. Norris, M. A. Osley, J. Fessler, and F. inhibition of DNA replication (29, 34). It is unclear whether Winston. 1988. Changes in histone gene dosage alter transcrip- all the HPC gene products function through the repressor tion in yeast. Genes Dev. 2:150-159. element; however, several lines of evidence suggest that this 9. Clark-Adams, C. D., and F. Winston. 1987. The SPT6 gene is may be the case. The hpcllhir3 mutation eliminates the essential for growth and is required for b-mediated transcription capability of the repressor element to repress the transcrip- in Saccharomyces cerevisiae. Mol. Cell. Biol. 7:679-686. tion of a construct containing the CYCI promoter fused to 10. Dailey, L., S. M. Hanly, R. G. Roeder, and N. Heintz. 1986. the lacZ reporter gene in G1 and G2 phases (35). In addition, Distinct transcription factors bind specifically to two regions of the human histone H4 promoter. Proc. Natl. Acad. Sci. USA the hpcllhir3, hpc2, hpc3, and hpcS mutants all cause an 83:7241-7245. accumulation of the HTA1 and HTBJ mRNAs in G1 and G2 11. Dailey, L., S. B. Roberts, and N. Heintz. 1988. Purification of the phases of the cell cycle, indicating a deficiency of repression human histone H4 gene-specific transcription factors H4TF-1 of histone gene transcription. The hpc4 mutation disrupts and H4TF-2. Genes Dev. 2:1700-1712. one of the two essential functions of the repressor element, 12. Domdey, H., B. Apostol, R.-J. Lin, A. Newman, E. Brody, and J. demonstrated by derepressing replication-dependent histone Abelson. 1984. Lariat structures are in vivo intermediates in gene transcription. Therefore, all five hpc as well as three hir yeast pre-mRNA splicing. Cell 39:611-621. mutations are likely to affect genes encoding proteins that 13. Emr, S. D., A. Vassorotti, J. Garrett, B. L. Geller, M. Takeda, disrupt repression of the HTA1-HTB1 promoter. Consistent and M. G. Douglas. 1986. The amino terminus of the yeast F1-ATPase-subunit precursor functions as a mitochondrial im- with this view, the HTA2-HTB2 locus whose regulation port signal. J. Cell Biol. 102:523-533. remains intact in all five hpc mutants is the only locus among 14. Fletcher, C., N. Heintz, and R. G. Roeder. 1987. Purification and the four histone gene loci which does not contain the characterization of OTF-1, a transcription factor regulating cell repressive element in its promoter region (5, 33). cycle expression of a human histone H2b gene. Cell 51:773-781. Sequence analysis indicates that none of the known HIRI 15. Han, M., M. Chang, U.-J. Kim, and M. Grunstein. 1987. SPT or HPC genes contain any motifs associated with DNA Histone H2B repression causes cell-cycle-specific arrest in binding, nor do they show significant homology to existing yeast: effects on chromosome segregation, replication, and genes in the GenBank data base, suggesting that they may transcription. Cell 48:589-597. fall into a novel class of genes encoding specific regulatory 16. Hanley, S. M., G. C. Bleecker, and N. Heintz. 1985. Identifica- tion of promoter elements necessary for transcriptional regula- factors. It is possible most of these function through protein- tion of a human histone H4 gene in vitro. Mol. Cell. Biol. protein interactions. By using partially purified yeast ex- 5:380-389. tracts from either hpc mutant or wild-type HPC strains, we 17. Heintz, N. 1991. The regulation of histone gene expression did not detect any difference in the DNA footprint at the during the cell cycle. Biochim. Biophys. Acta 1088:327-339. HTAI-HTB1 promoter region (53). These data suggest that 18. Heintz, N., and R. G. Roeder. 1984. Transcription of human HPC gene products are unlikely to be a group of DNA- histone genes in extracts from synchronized Hela cells. Proc. VOL. 12, 1992 HISTONE CELL CYCLE-REGULATORY GENES 5259

Natl. Acad. Sci. USA 81:1713-1717. encodes DNA ligase. Mol. Cell. Biol. 5:226-235. 19. Hereford, L., S. Bromley, and M. A. Osley. 1982. Periodic 37. Rose, M. D., P. Novick, J. H. Thomas, D. Botstein, and G. R. transcription of yeast histone genes. Cell 30:305-310. Fink. 1987. A Saccharomyces cerevisiae genomic plasmid bank 20. Hereford, L., K. Fahrner, J. W. Woodford, M. Rosbash, and D. based on a centromere-containing shuttle vector. Gene 60:237- Kaback. 1979. Isolation of yeast histone genes H2A and H2B. 243. Cell 18:1261-1271. 38. Sambrook, J., T. Maniatis, and E. F. Fritsch. 1989. Molecular 21. Jiminez, A., and J. Davies. 1980. Expression of transposable cloning: a laboratory manual, 2nd ed. Cold Spring Harbor antibiotics resistance element in Saccharomyces. Nature (Lon- Laboratory, Cold Spring Harbor, N.Y. don) 287:869-871. 39. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc- 22. Johnston, L. H., J. H. M. White, A. L. Johnson, G. Lucchini, ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. and P. Plevani. 1987. The yeast DNA polymerase I transcript is USA 74:5463-5467. regulated in both the mitotic cell cycle and in meiosis and is also 40. Schumperli, D. 1988. Multilevel regulation of replication-depen- induced after DNA damage. Nucleic Acids Res. 15:5017-5030. dent histone genes. Trends Genet. 4:87-191. 23. Jorgensen, R. A., S. J. Rothstein, and W. S. Reznikoff. 1979. A 41. Schuster, T., and M. Grunstein. Unpublished data. restriction enzyme cleavage map of Tn5 and location of a region 42. Seiler-Tuyns, A., and B. M. Paterson. 1987. Cell cycle regulation encoding neomycin resistance. Mol. Gen. Genet. 177:65-72. of a mouse histone H4 gene requires the H4 promoter. Mol. 24. Kim, U.-J., and M. Grunstein. Unpublished data. Cell. Biol. 7:1048-1054. 25. Kim, U.-J., M. Han, P. Kayne, and M. Grunstein. 1988. Effects 43. Sherman, F., G. Fink, and J. B. Hicks. 1986. Methods in yeast of histone H4 depletion on the cell cycle and transcription of genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, Saccharomyces cerevisiae. EMBO J. 7:2211-2219. N.Y. 26. Kolodkin, A. L., A. J. S. Klar, and F. W. Stahl. 1986. Double- 44. Sherwood, P. W., and M. A. Osley. 1991. Histone regulatory stranded breaks can initiate meiotic recombination in S. cerevi- (hir) mutations suppress d insertion alleles in Saccharomyces siae. Cell 46:733-740. cerevisiae. Genetics 128:729-738. 27. Kozak, M. 1987. Effects of intercistronic length on the efficiency 45. Sherwood, P. W., S. V.-M. Tsang, and M. A. Osley. Character- of reinitiation by eucaryotic ribosomes. Mol. Cell. Biol. 7:3438- ization of HIRI and HIR2, two genes required for regulation of 3445. histone gene transcription in Saccharomyces cerevisiae. Sub- 28. Kroeger, P., C. Stewart, T. Schaap, A. van Wjnen, J. Hirshman, mitted for publication. S. Helms, G. Stein, and J. Stein. 1987. Proximal and distal 46. Sikorski, R. S., and P. Hieter. 1989. A system of shuttle vectors regulatory elements that influence in vivo expression of a cell and yeast host strains designed for efficient manipulation of cycle-dependent human H4 histone gene. Proc. Natl. Acad. Sci. DNA in Saccharomyces cerevisiae. Genetics 122:19-27. USA 84:3982-3986. 47. Silverman, S. J., and G. R. Fink 1984. Effects of Ty insertions 29. Lycan, D. E., M. A. Osley, and L. Hereford. 1987. Role of on HIS4 transcription in Saccharomyces cerevisiae. Mol. Cell. transcriptional and posttranscriptional regulation in expression Biol. 4:1246-1251. of histone genes in Saccharomyces cerevisiae. Mol. Cell. Biol. 48. Smith, M. M., and 0. S. Andresson. 1983. DNA sequences of 7:614-621. yeast H3 and H4 histone genes from two non-allelic gene sets 30. Messing, J. 1983. New M13 vectors for cloning. Methods encode identical H3 and H4 proteins. J. Mol. Biol. 169:663-690. Enzymol. 101:20-78. 49. Smith, M. M., and K. Murray. 1983. Yeast H3 and H4 histone 31. Nasmyth, K., and D. Shore. 1987. Transcriptional regulation in messenger RNAs are transcribed from two non-allelic gene sets. yeast cell cycle. Science 237:1162-1170. J. Mol. Biol. 169:641-661. 32. Oechsner, U., V. Magdolen, C. Zoglowek, U. Hacker, and W. 50. Van Wijnen, A. J., K. L. Wright, J. B. Lian, J. L. Stein, and Bandlow. 1988. Yeast adenylate kinase is transcribed constitu- G. S. Stein. 1989. Human H4 histone gene transcription requires tively from a promoter in the short intergenic region to the the proliferation-specific nuclear factor HiNF-D. J. Biol. Chem. histone H2A-1 gene. FEBS Lett. 242:187-193. 264:15034-15042. 33. Osley, M. A. 1991. The regulation of histone synthesis in the cell 51. Wallis, J. W., M. Rykowski, and M. Grunstein. 1983. Yeast cycle. Annu. Rev. Biochem. 60:827-861. histone H2B containing large amino terminus deletions can 34. Osley, M. A., J. Gould, S. Kim, M. Kane, and L. Hereford. 1986. function in vivo. Cell 35:711-719. Identification of sequences in a yeast histone promoter involved 52. Winston, F., D. T. Chaleff, B. Valent, and G. R. Fink 1984. in periodic transcription. Cell 45:537-544. Mutations affecting Ty-mediated expression of the HIS4 gene of 35. Osley, M. A., and D. Lycan. 1987. trans-acting regulatory Saccharomyces cerevisiae. Genetics 107:179-197. mutations that alter transcription of Saccharomyces cerevisiae 53. Xu, H., and M. Grunstein. Unpublished data. histone genes. Mol. Cell. Biol. 7:4204-4210. 54. Xu, H., L. Johnson, and M. Grunstein. 1990. Coding and 36. Peterson, T., L. Prakash, S. Prakash, M. A. Osley, and S. I. noncoding sequences at the 3' end of yeast histone H2B mRNA Reed. 1985. Regulation of CDC9, the Saccharomyces gene that confer cell cycle regulation. Mol. Cell. Biol. 10:2687-2694.