DOCSLIB.ORG

Mammalian Metallopeptidase Inhibition at the Defense Barrier of Ascaris Parasite

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mammalian Metallopeptidase Inhibition at the Defense Barrier of Ascaris Parasite Mammalian metallopeptidase inhibition at the defense barrier of Ascaris parasite Laura Sanglasa, Francesc X. Avilesa, Robert Huberb,c,d,1, F. Xavier Gomis-Ru¨ the,1, and Joan L. Arolasa,e,1 aInstitut de Biotecnologia i de Biomedicina and Departament de Bioquímica i Biologia Molecular, Facultat de Cie`ncies, Universitat Auto`noma de Barcelona, E-08193 Bellaterra, Barcelona, Spain; bMax-Planck-Institut fu¨r Biochemie, Am Klopferspitz 18a, D-82152 Martinsried, Germany; cSchool of Biosciences, Cardiff University, Cardiff CF10 3US, United Kingdom; dCentre for Medical Biotechnology, Fachbereich Biology and Geography, University Duisburg-Essen, Universita¨tsstrasse, D-45117 Essen, Germany; and eDepartment of Structural Biology, Proteolysis Laboratory, Molecular Biology Institute of Barcelona, Consejo Superior de Investigaciones Cientificas, Barcelona Science Park, Helix Building, c/Baldiri Reixac 15-21, E-08028 Barcelona, Spain Contributed by Robert Huber, December 12, 2008 (sent for review November 17, 2008) Roundworms of the genus Ascaris are common parasites of the catalyze the hydrolysis of C-terminal amino acids from proteins human gastrointestinal tract. A battery of selective inhibitors and peptides. They perform a large variety of physiologically protects them from host enzymes and the immune system. Here, a relevant functions in organisms of different phyla (17). These metallocarboxypeptidase (MCP) inhibitor, ACI, was identified in enzymes have been grouped into the funnelin tribe of proteases protein extracts from Ascaris by intensity-fading MALDI-TOF mass and are subdivided into A/B- and N/E-type MCPs (18). Human spectrometry. The 67-residue amino acid sequence of ACI showed A/B-type funnelins include the digestive enzymes CPA1, CPA2, no significant homology with any known protein. Heterologous and CPB1, and mast cell CPA3, which is related to inflammatory overexpression and purification of ACI rendered a functional mol- processes (19, 20). The biological action of MCPs is specifically ecule with nanomolar equilibrium dissociation constants against modulated through protein inhibitors. To date, seven such MCP MCPs, which denoted a preference for digestive and mast cell inhibitors have been described from potato and tomato (PCI and A/B-type MCPs. Western blotting and immunohistochemistry lo- MCPI; 38 and 39 residues, respectively) (21, 22), medical leech cated ACI in the body wall, intestine, female reproductive tract, and Hirudo medicinalis (LCI; 66 residues) (23), the ticks Rhipiceph- fertilized eggs of Ascaris, in accordance with its target specificity. alus bursa and Haemaphysalis longicornis (TCI and HlTCI; 75 The crystal structure of the complex of ACI with human car- and 77 residues, respectively) (24, 25), rat and human latexin boxypeptidase A1, one of its potential targets in vivo, revealed a (alias ECI; 222 and 223 residues, respectively) (26, 27), and the protein with a fold consisting of two tandem homologous do- intestinal parasites A. lumbricoides and A. suum (ACI) (12, 13). mains, each containing a ␤-ribbon and two disulfide bonds. These Although the former inhibitors have been studied extensively in domains are connected by an ␣-helical segment and a fifth disul- terms of activity and structure, ACI has hitherto only been fide bond. Binding and inhibition are exerted by the C-terminal tail, studied for its amino acid sequence. We present here its cloning, which enters the funnel-like active-site cavity of the enzyme and heterologous expression, purification, and three-dimensional approaches the catalytic zinc ion. The findings reported provide a structure in complex with a MCP, unveiling its mechanism of basis for the biological function of ACI, which may be essential for inhibition. We also report its target specificity and in vivo BIOCHEMISTRY parasitic survival during infection. localization in Ascaris worms, which lead to a deeper under- standing of the life-threatening disease ascariasis and may pave ascariasis ͉ crystal structure ͉ host resistance ͉ immunolocalization ͉ the way for drug and vaccine development. metallocarboxypeptidase inhibitor Results and Discussion ore than a quarter of the human population is affected by Identification, Sequencing, and Cloning of ACI from Ascaris. Initial Msoil-transmitted helminthes, which impair nutrition and recombinant overexpression trials of ACI on the basis of the the immune response toward widespread pandemics such as reported amino acid sequence (12) produced only minute yields AIDS and tuberculosis (1, 2). The roundworm Ascaris lumbri- and two distinct forms (termed A and B; see Fig. S2) of identical coides is the most common human parasite of the gastrointestinal molecular mass (7,502.5 Da) and 8 cysteine residues forming tract. It causes ascariasis (3), which has a worldwide distribution four disulfide bonds. Of these two, only form B inhibited bovine with highest prevalence in tropical and subtropical regions and carboxypeptidase A1 (bCPA1), albeit weakly (Ki ϭ 5.9 Ϯ 0.2 in areas with inadequate sanitation. Ascariasis is triggered by the ␮M) compared with other reported MCP inhibitors (17). We ingestion of parasite eggs. These evolve to larvae that migrate thus attempted to analyze ACI directly from a crude homoge- through different tissues and return to the small intestine, where nate of Ascaris worms. After assessing the presence of inhibitory they mature to adult male and female worms. At this stage, activity against bCPA1 (see SI Materials and Methods), the females deposit thousands of eggs daily, which are secreted with extract was subjected to intensity fading MALDI-TOF mass the feces, thus contributing to soil contamination and spreading spectrometry (28). This procedure rendered a molecular mass of of the infection [for details, see supporting information (SI) Fig. 7,724.8 Da for the Ascaris MCPI (Fig. 1 A and B), which did not S1]. During its life cycle, Ascaris threatens human health with nonspecific abdominal symptoms, intestinal obstruction and perforation, biliary colic, gallstone formation, liver abscesses, Author contributions: L.S., F.X.A., F.X.G.-R., and J.L.A. designed research; L.S., F.X.G.-R., and J.L.A. performed research; L.S., F.X.A., R.H., F.X.G.-R., and J.L.A. analyzed data; and F.X.G.-R. pancreatitis, and pulmonary eosinophilia (4, 5). A nearly iden- and J.L.A. wrote the paper. tical nematode species, Ascaris suum, is found in the pig. It has The authors declare no conflict of interest. a tremendous impact on livestock farming and can also infect Data deposition: The atomic coordinates and structure factors have been deposited in the primates and humans, giving rise to a similar disease pattern to Protein Data Bank, www.pdb.org (PDB ID code 2FJU). The nucleotide sequence reported in A. lumbricoides (6–8). this paper has been deposited in the GenBank database (accession number EU057973). As part of the parasite defense strategy, Ascaris roundworms 1To whom correspondence may be addressed. E-mail: [email protected], secrete a series of inhibitors to target digestive and immune- [email protected], or [email protected]. related host proteases, among others pepsin, trypsin, chymo- This article contains supporting information online at www.pnas.org/cgi/content/full/ trypsin/elastase, cathepsins, and metallocarboxypeptidases 0812623106/DCSupplemental. (MCPs) (9–16). MCPs are zinc-containing exoproteases that © 2009 by The National Academy of Sciences of the USA www.pnas.org͞cgi͞doi͞10.1073͞pnas.0812623106 PNAS ͉ February 10, 2009 ͉ vol. 106 ͉ no. 6 ͉ 1743–1747 Downloaded by guest on September 27, 2021 Table 1. Inhibition constants (Ki) of ACI against MCPs of the A/B and N/E type of funnelins Carboxypeptidase Ki ,nM Bovine CPA1 2.4 Ϯ 0.3 Human CPA1 1.6 Ϯ 0.2 Human CPA2 2.5 Ϯ 0.2 Human CPA3 2.1 Ϯ 0.3 Human CPA4 23.9 Ϯ 3.1 Human CPB1 3.4 Ϯ 0.3 Human CPB2/TAFIa 42.0 Ϯ 1.7 Human CPN NI Drosophila CPD-I NI Data are shown as mean Ϯ SD. NI, no inhibition at 100 ␮M inhibitor concentration. sequence reported (12). However, the protein had 10 rather than 8 cysteine residues, and subsequent analysis of peptides obtained by digestion with endoproteinase Lys-C revealed that the C terminus (-GCCWDLL67) had been erroneously determined (-LPWGL65) (12). Therefore, the cDNA of ACI was cloned (Fig. 1C), and it was found to consist of 467 nucleotides, with a deduced protein sequence of 87 residues. The first 20 residues correspond to a signal peptide that precedes the aspartate residue found at the N terminus of the purified inhibitor. The calculated molecular mass of the deduced mature protein was consistent with that of natural ACI determined by MALDI-TOF mass spectrometry, with five disulfide bonds. Sequence similarity searches revealed no homology with any other reported se- quence with the exception of the C terminus, which showed certain resemblance to the C termini of other reported MCPIs (see below and Fig. 3D). Heterologous Expression and Purification of ACI. Recombinant ACI was overexpressed in Escherichia coli as a fusion protein (Fig. S3), whose cleavage left a glycine residue at the N terminus of the inhibitor protein (molecular mass of 7,781.8 Da). A final reversed-phase HPLC step rendered a unique peak with a retention time equivalent to that of natural ACI. The typical yield was Ϸ10 mg of pure recombinant ACI per L of cell culture. Conformational Stability and Activity of ACI. Circular dichroism and NMR spectroscopy experiments showed that the conformations of natural and recombinant ACI were indistinguishable. Both molecules maintained a well-folded conformation in a wide Fig. 1. Identification of natural ACI by intensity-fading MALDI-TOF mass spec- range of chaotropic reagents and temperature and only became trometry and cDNA cloning of ACI. (A) Mass spectra of an Ascaris extract before denatured by the simultaneous presence of denaturing and (Control) and after the addition of CPA–Sepharose resin (ϩ CPA). (Bottom) Mass reducing agents (Figs.
Load more

Recommended publications
  • Expression Analysis and Functional Significance of Chondroitin Sulphate Proteoglycans and Heparan Sulphate Proteoglycans in Prostate Cancer
    EXPRESSION ANALYSIS AND FUNCTIONAL SIGNIFICANCE OF CHONDROITIN SULPHATE PROTEOGLYCANS AND HEPARAN SULPHATE PROTEOGLYCANS IN PROSTATE CANCER TENG HUI FANG, YVONNE (BSc, Hons) NATIONAL UNIVERSITY OF SINGAPORE A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF ANATOMY YONG LOO LIN SCHOOL OF MEDICINE NATIONAL UNIVERSITY OF SINGAPORE 2010 Acknowledgements ACKNOWLEDGEMENTS My PhD candidature would not have been easier, if not for the help, guidance and support from many mentors, family, friends and colleagues. My utmost gratitude goes to my mentor, Associate Professor George Yip Wai Cheong, for his unfailing guidance, patience and trust in me. Through him, I have learnt much, in terms of scientific skills and knowledge acquisition. In addition, I have benefitted from his many interesting stories that have also made my candidature a very enjoyable one indeed. The most important lesson that I have learnt from Dr George Yip would be the importance of thinking critically, a skill that is not only important in the scientific arena, but also one that applies to our everyday life. I would also like to thank my co-supervisor, Associate Professor Chia Sing Joo, for his support and advice. His comments have always added an interesting clinical perspective to the type of scientific research that I have been working on during my candidature. My deepest appreciation goes to Professor Bay Boon Huat for his timely advice and support. Professor Bay never fails to think for our welfare and has always shown genuine concern for us in all aspects of our life. He has taught us the importance of forming great relationships, one that supersedes any material wealth and status.
    [Show full text]
  • Serine Proteases with Altered Sensitivity to Activity-Modulating
    (19) & (11) EP 2 045 321 A2 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 08.04.2009 Bulletin 2009/15 C12N 9/00 (2006.01) C12N 15/00 (2006.01) C12Q 1/37 (2006.01) (21) Application number: 09150549.5 (22) Date of filing: 26.05.2006 (84) Designated Contracting States: • Haupts, Ulrich AT BE BG CH CY CZ DE DK EE ES FI FR GB GR 51519 Odenthal (DE) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • Coco, Wayne SK TR 50737 Köln (DE) •Tebbe, Jan (30) Priority: 27.05.2005 EP 05104543 50733 Köln (DE) • Votsmeier, Christian (62) Document number(s) of the earlier application(s) in 50259 Pulheim (DE) accordance with Art. 76 EPC: • Scheidig, Andreas 06763303.2 / 1 883 696 50823 Köln (DE) (71) Applicant: Direvo Biotech AG (74) Representative: von Kreisler Selting Werner 50829 Köln (DE) Patentanwälte P.O. Box 10 22 41 (72) Inventors: 50462 Köln (DE) • Koltermann, André 82057 Icking (DE) Remarks: • Kettling, Ulrich This application was filed on 14-01-2009 as a 81477 München (DE) divisional application to the application mentioned under INID code 62. (54) Serine proteases with altered sensitivity to activity-modulating substances (57) The present invention provides variants of ser- screening of the library in the presence of one or several ine proteases of the S1 class with altered sensitivity to activity-modulating substances, selection of variants with one or more activity-modulating substances. A method altered sensitivity to one or several activity-modulating for the generation of such proteases is disclosed, com- substances and isolation of those polynucleotide se- prising the provision of a protease library encoding poly- quences that encode for the selected variants.
    [Show full text]
  • Peripheral Regulation of Pain and Itch
    Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1596 Peripheral Regulation of Pain and Itch ELÍN INGIBJÖRG MAGNÚSDÓTTIR ACTA UNIVERSITATIS UPSALIENSIS ISSN 1651-6206 ISBN 978-91-513-0746-6 UPPSALA urn:nbn:se:uu:diva-392709 2019 Dissertation presented at Uppsala University to be publicly examined in A1:107a, BMC, Husargatan 3, Uppsala, Friday, 25 October 2019 at 13:00 for the degree of Doctor of Philosophy (Faculty of Medicine). The examination will be conducted in English. Faculty examiner: Professor emeritus George H. Caughey (University of California, San Francisco). Abstract Magnúsdóttir, E. I. 2019. Peripheral Regulation of Pain and Itch. Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1596. 71 pp. Uppsala: Acta Universitatis Upsaliensis. ISBN 978-91-513-0746-6. Pain and itch are diverse sensory modalities, transmitted by the somatosensory nervous system. Stimuli such as heat, cold, mechanical pain and itch can be transmitted by different neuronal populations, which show considerable overlap with regards to sensory activation. Moreover, the immune and nervous systems can be involved in extensive crosstalk in the periphery when reacting to these stimuli. With recent advances in genetic engineering, we now have the possibility to study the contribution of distinct neuron types, neurotransmitters and other mediators in vivo by using gene knock-out mice. The neuropeptide calcitonin gene-related peptide (CGRP) and the ion channel transient receptor potential cation channel subfamily V member 1 (TRPV1) have both been implicated in pain and itch transmission. In Paper I, the Cre- LoxP system was used to specifically remove CGRPα from the primary afferent population that expresses TRPV1.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • Knockdown of Carboxypeptidase A6 in Zebrafish Larvae Reduces Response to Seizure-Inducing Drugs and Causes Changes in the Level of Mrnas Encoding Signaling Molecules
    RESEARCH ARTICLE Knockdown of Carboxypeptidase A6 in Zebrafish Larvae Reduces Response to Seizure-Inducing Drugs and Causes Changes in the Level of mRNAs Encoding Signaling Molecules Mark William Lopes1, Matthew R. Sapio2, Rodrigo B. Leal1, Lloyd D. Fricker2,3* a11111 1 Programa de Pós-graduação em Bioquímica, Departamento de Bioquímica, Centro de Ciências Biológicas, Universidade Federal de Santa Catarina, Florianópolis, SC, Brazil, 2 Department of Neuroscience, Albert Einstein College of Medicine, Bronx, New York, United States of America, 3 Department of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York, United States of America * [email protected] OPEN ACCESS Citation: Lopes MW, Sapio MR, Leal RB, Fricker LD (2016) Knockdown of Carboxypeptidase A6 in Abstract Zebrafish Larvae Reduces Response to Seizure- Inducing Drugs and Causes Changes in the Level of Carboxypeptidase A6 (CPA6) is an extracellular matrix metallocarboxypeptidase that mod- mRNAs Encoding Signaling Molecules. PLoS ONE ulates peptide and protein function by removal of hydrophobic C-terminal amino acids. 11(4): e0152905. doi:10.1371/journal.pone.0152905 Mutations in the human CPA6 gene that reduce enzymatic activity in the extracellular matrix Editor: Giuseppe Biagini, University of Modena and are associated with febrile seizures, temporal lobe epilepsy, and juvenile myoclonic epi- Reggio Emilia, ITALY lepsy. The characterization of these human mutations suggests a dominant mode of inheri- Received: August 26, 2015 tance by haploinsufficiency through loss of function mutations, however the total number of Accepted: March 21, 2016 humans with pathologic mutations in CPA6 identified to date remains small. To better Published: April 6, 2016 understand the relationship between CPA6 and seizures we investigated the effects of mor- pholino knockdown of cpa6 mRNA in zebrafish (Danio rerio) larvae.
    [Show full text]
  • The Emerging Role of Mast Cell Proteases in Asthma
    REVIEW ASTHMA The emerging role of mast cell proteases in asthma Gunnar Pejler1,2 Affiliations: 1Dept of Medical Biochemistry and Microbiology, Uppsala University, Uppsala, Sweden. 2Dept of Anatomy, Physiology and Biochemistry, Swedish University of Agricultural Sciences, Uppsala, Sweden. Correspondence: Gunnar Pejler, Dept of Medical Biochemistry and Microbiology, BMC, Uppsala University, Box 582, 75123 Uppsala, Sweden. E-mail: [email protected] @ERSpublications Mast cells express large amounts of proteases, including tryptase, chymase and carboxypeptidase A3. An extensive review of how these proteases impact on asthma shows that they can have both protective and detrimental functions. http://bit.ly/2Gu1Qp2 Cite this article as: Pejler G. The emerging role of mast cell proteases in asthma. Eur Respir J 2019; 54: 1900685 [https://doi.org/10.1183/13993003.00685-2019]. ABSTRACT It is now well established that mast cells (MCs) play a crucial role in asthma. This is supported by multiple lines of evidence, including both clinical studies and studies on MC-deficient mice. However, there is still only limited knowledge of the exact effector mechanism(s) by which MCs influence asthma pathology. MCs contain large amounts of secretory granules, which are filled with a variety of bioactive compounds including histamine, cytokines, lysosomal hydrolases, serglycin proteoglycans and a number of MC-restricted proteases. When MCs are activated, e.g. in response to IgE receptor cross- linking, the contents of their granules are released to the exterior and can cause a massive inflammatory reaction. The MC-restricted proteases include tryptases, chymases and carboxypeptidase A3, and these are expressed and stored at remarkably high levels.
    [Show full text]
  • Download PDF File
    CLINICAL CARDIOLOGY Cardiology Journal 2019, Vol. 26, No. 6, 680–686 DOI: 10.5603/CJ.a2018.0018 Copyright © 2019 Via Medica ORIGINAL ARTICLE ISSN 1897–5593 Mast cell derived carboxypeptidase A3 is decreased among patients with advanced coronary artery disease Łukasz Lewicki1, 2, 3, Janusz Siebert1, 4, Tomasz Koliński5, Karolina Piekarska5, Magdalena Reiwer-Gostomska4, Radosław Targoński3, Piotr Trzonkowski6, Natalia Marek-Trzonkowska5 1University Center for Cardiology, Gdansk, Poland 2Department of Machine Design and Automotive Engineering, Faculty of Mechanical Engineering, Gdansk University of Technology, Gdansk, Poland 3Pomeranian Cardiology Centers, Wejherowo, Poland 4Department of Family Medicine, Medical University of Gdansk, Poland 6Department of Family Medicine, Laboratory of Immunoregulation and Cellular Therapies, Medical University of Gdansk, Poland 7Department of Clinical Immunology and Transplantology, Medical University of Gdansk, Poland Abstract Background: Coronary artery disease (CAD) affects milions of people and can result in myocardial infarction (MI). Previously, mast cells (MC) have been extensively investigated in the context of hyper- sensitivity, however as regulators of the local inflammatory response they can potentially contribute to CAD and/or its progression. The aim of the study was to assess if serum concentration of MC proteases: carboxypeptidase A3, cathepsin G and chymase 1 is associated with the extension of CAD and MI. Methods: The 44 patients with angiographically confirmed CAD (23 subjects with non-ST-segment elevation MI [NSTEMI] and 21 with stable CAD) were analyzed. Clinical data were obtained as well serum concentrations of carboxypeptidase A3, cathepsin G and chymase 1 were also measured. Results: Patients with single vessel CAD had higher serum concentration of carboxypeptidase than those with more advanced CAD (3838.6 ± 1083.1 pg/mL vs.
    [Show full text]
  • Substrate Specificity and Structural Modeling of Human
    International Journal of Molecular Sciences Article Substrate Specificity and Structural Modeling of Human Carboxypeptidase Z: A Unique Protease with a Frizzled-Like Domain Javier Garcia-Pardo 1 , Sebastian Tanco 1,2 , Maria C. Garcia-Guerrero 1, Sayani Dasgupta 3, Francesc Xavier Avilés 1 , Julia Lorenzo 1,* and Lloyd D. Fricker 3,* 1 Institut de Biotecnologia i Biomedicina and Departament de Bioquimica i Biologia Molecular, Universitat Autònoma de Barcelona, 08193 Bellaterra, Barcelona, Spain; [email protected] (J.G.-P.); [email protected] (S.T.); [email protected] (M.C.G.-G.); [email protected] (F.X.A.) 2 BiosenSource BV, B-1800 Vilvoorde, Belgium 3 Department of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York, NY 10461, USA; [email protected] * Correspondence: [email protected] (J.L.); [email protected] (L.D.F.); Tel.: +34-93-5868936 (J.L.); +1-718-430-4225 (L.D.F.) Received: 24 October 2020; Accepted: 14 November 2020; Published: 18 November 2020 Abstract: Metallocarboxypeptidase Z (CPZ) is a secreted enzyme that is distinguished from all other members of the M14 metallocarboxypeptidase family by the presence of an N-terminal cysteine-rich Frizzled-like (Fz) domain that binds Wnt proteins. Here, we present a comprehensive analysis of the enzymatic properties and substrate specificity of human CPZ. To investigate the enzymatic properties, we employed dansylated peptide substrates. For substrate specificity profiling, we generated two different large peptide libraries and employed isotopic labeling and quantitative mass spectrometry to study the substrate preference of this enzyme. Our findings revealed that CPZ has a strict requirement for substrates with C-terminal Arg or Lys at the P10 position.
    [Show full text]
  • CPA6 (Center) Rabbit Polyclonal Antibody – AP51046PU-N | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for AP51046PU-N CPA6 (Center) Rabbit Polyclonal Antibody Product data: Product Type: Primary Antibodies Applications: WB Recommended Dilution: ELISA: 1/1000. Western Blot: 1/100-1/500. Reactivity: Human Host: Rabbit Isotype: Ig Clonality: Polyclonal Immunogen: KLH conjugated synthetic peptide between 292-323 amino acids from the Central region of Human CPA6. Specificity: This antibody recognizes Human Carboxypeptidase A6 (Center). Formulation: PBS State: Aff - Purified State: Liquid purified Ig fraction Preservative: 0.09% Sodium Azide Concentration: lot specific Purification: Affinity Chromatography on Protein A Conjugation: Unconjugated Storage: Store undiluted at 2-8°C for one month or (in aliquots) at -20°C for longer. Avoid repeated freezing and thawing. Stability: Shelf life: one year from despatch. Gene Name: Homo sapiens carboxypeptidase A6 (CPA6) Database Link: Entrez Gene 57094 Human Q8N4T0 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 CPA6 (Center) Rabbit Polyclonal Antibody – AP51046PU-N Background: The protein encoded by this gene belongs to the family of carboxypeptidases, which catalyze the release of C-terminal amino acid, and have functions ranging from digestion of food to selective biosynthesis of neuroendocrine peptides. Polymorphic variants and a reciprocal translocation t(6;8)(q26;q13) involving this gene, have been associated with Duane retraction syndrome. Synonyms: CPA6, CPAH, Carboxypeptidase B Note: Molecular Weight: 51008 Da Protein Families: Protease, Secreted Protein Product images: Western blot analysis of Carboxypeptidase A6 Antibody in NCI-H460 cell line lysates (35ug/lane).This demonstrates the CPA6 antibody detected the CPA6 protein (arrow).
    [Show full text]
  • Extracellular Matrix Proteomics Identifies Molecular Signature of Symptomatic Carotid Plaques
    CLINICAL MEDICINE The Journal of Clinical Investigation Extracellular matrix proteomics identifies molecular signature of symptomatic carotid plaques Sarah R. Langley,1,2 Karin Willeit,3 Athanasios Didangelos,1 Ljubica Perisic Matic,4 Philipp Skroblin,1 Javier Barallobre-Barreiro,1 Mariette Lengquist,4 Gregor Rungger,5 Alexander Kapustin,1 Ludmilla Kedenko,6 Chris Molenaar,1,7 Ruifang Lu,1 Temo Barwari,1 Gonca Suna,1 Xiaoke Yin,1 Bernhard Iglseder,8 Bernhard Paulweber,6 Peter Willeit,3,9 Joseph Shalhoub,10 Gerard Pasterkamp,11 Alun H. Davies,10 Claudia Monaco,12 Ulf Hedin,4 Catherine M. Shanahan,1 Johann Willeit,3 Stefan Kiechl,3 and Manuel Mayr1 1King’s British Heart Foundation Centre, King’s College London, London, United Kingdom. 2Duke-NUS Medical School, Singapore. 3Department of Neurology, Medical University Innsbruck, Innsbruck, Austria. 4Department of Molecular Medicine and Surgery, Vascular Surgery, Karolinska Institute, Stockholm, Sweden. 5Department of Neurology, Bruneck Hospital, Bruneck, Italy. 6First Department of Internal Medicine, Paracelsus Medical University, Salzburg, Austria. 7Nikon Imaging Centre, King’s College London, London, United Kingdom. 8Department of Geriatric Medicine, Paracelsus Medical University, Salzburg, Austria. 9Department of Public Health and Primary Care, University of Cambridge, Cambridge, United Kingdom. 10Department of Surgery and Cancer, Imperial College London, London, United Kingdom. 11Laboratory of Clinical Chemistry and Experimental Cardiology, University Medical Center Utrecht, Utrecht, The Netherlands. 12Kennedy Institute, University of Oxford, Oxford, United Kingdom BACKGROUND. The identification of patients with high-risk atherosclerotic plaques prior to the manifestation of clinical events remains challenging. Recent findings question histology- and imaging-based definitions of the “vulnerable plaque,” necessitating an improved approach for predicting onset of symptoms.
    [Show full text]
  • ( 12 ) United States Patent
    US010245229B2 (12 ) United States Patent ( 10 ) Patent No. : US 10 , 245 ,229 B2 Heartlein et al. (45 ) Date of Patent: Apr. 2 , 2019 ( 54 ) PULMONARY DELIVERY OF MRNA TO ( 56 ) References Cited NON -LUNG TARGET CELLS U . S . PATENT DOCUMENTS ( 71 ) Applicants : Shire Human Genetic Therapies, Inc. , 5 ,705 , 385 A 1 / 1998 Bally et al . Lexington , MA (US ) ; Ethris GmbH , 5 , 965, 434 A 10 / 1999 Wolff et al . Martinsried (DE ) 5 , 976 , 567 A 11 / 1999 Wheeler et al. 5 , 981 ,501 A 11/ 1999 Wheeler et al. 6 ,077 ,835 A 6 / 2000 Hanson et al . (72 ) Inventors : Michael Heartlein , Lexington , MA 6 ,534 , 484 B1 3 / 2003 Wheeler et al . (US ) ; Braydon Charles Guild , 6 ,734 , 171 B1 5 /2004 Saravolac et al. Lexington , MA (US ) ; Frank DeRosa , 6 , 815 ,432 B2 11/ 2004 Wheeler et al . Lexington , MA (US ) ; Carsten 7 , 422 , 902 B1 9 / 2008 Wheeler et al . Rudolph , Krailling ( DE ) ; Christian 7 ,745 ,651 B2 6 /2010 Heyes et al. 7 ,799 , 565 B2 9 /2010 MacLachlan et al. Plank , Wessling (DE ) 7 , 803 ,397 B2 9 / 2010 Heyes et al . 7 , 901, 708 B2 3 / 2011 MacLachlan et al. (73 ) Assignees : Translate Bio , Inc . , Lexington , MA 8 , 101 ,741 B2 1 / 2012 MacLachlan et al . (US ) ; Ethris GmbH , Martinsried (DE ) 8 , 188 , 263 B2 5 / 2012 MacLachlan et al . 8 , 236 , 943 B2 8 / 2012 Lee et al. 8 ,329 ,070 B2 12 /2012 MacLachlan et al . ( * ) Notice : Subject to any disclaimer , the term of this 8 ,513 ,403 B2 8 / 2013 MacLachlan et al.
    [Show full text]
  • The Imprinted Region on Human Chromosome 7Q32 Extends to The
    249 ORIGINAL ARTICLE J Med Genet: first published as 10.1136/jmg.40.4.249 on 1 April 2003. Downloaded from The imprinted region on human chromosome 7q32 extends to the carboxypeptidase A gene cluster: an imprinted candidate for Silver-Russell syndrome L Bentley, K Nakabayashi, D Monk, C Beechey, J Peters, Z Birjandi, F E Khayat, M Patel, M A Preece, P Stanier, S W Scherer, G E Moore ............................................................................................................................. J Med Genet 2003;40:249–256 See end of article for authors’ affiliations Imprinted gene(s) on human chromosome 7q32-qter have been postulated to be involved in intrauterine ....................... growth restriction associated with Silver-Russell syndrome (SRS) as 7-10% of patients have mUPD(7). Correspondence to: Three imprinted genes, MEST, MESTIT1, and COPG2IT1 on chromosome 7q32, are unlikely to cause L Bentley, Department of SRS since epigenetic and sequence mutation analyses have not shown any changes. One hundred Fetal and Maternal kilobases proximal to MEST lies a group of four carboxypeptidase A (CPA) genes. Since most imprinted Medicine, Institute of genes are found in clusters, this study focuses on analysing these CPAs for imprinting effects based on Reproductive and Developmental Biology, their proximity to an established imprinted domain. Firstly, a replication timing study across 7q32 Faculty of Medicine, showed that an extensive genomic region including the CPAs, MEST, MESTIT1, and COPG2IT1 repli- Imperial College, cates asynchronously. Subsequently, SNP analysis by sequencing RT-PCR products of CPA1, CPA2, Hammersmith Campus, CPA4, and CPA5 indicated preferential expression of CPA4. Pyrosequencing was used as a quantita- Du Cane Road, London tive approach, which confirmed predominantly preferential expression of the maternal allele and bial- W12 0NN, UK; [email protected] lelic expression in brain.
    [Show full text]