Cloning and Characterization of the Novel Chimeric Gene P53/FXR2 in the Acute Megakaryoblastic Leukemia Cell Line CMK11-5
Total Page：16
File Type：pdf, Size：1020Kb
Tohoku J. Exp. Med., 2006,Expression 209, 169-180 of p53/FXR2 Fusion Protein in Leukemic Cells 169 Cloning and Characterization of the Novel Chimeric Gene p53/FXR2 in the Acute Megakaryoblastic Leukemia Cell Line CMK11-5 1 1 1, 2 3 RIKA KANEZAKI, TSUTOMU TOKI, GANG XU, RAMSWAMY NARAYANAN 1 and ETSURO ITO 1Department of Pediatrics, Hirosaki University School of Medicine, Hirosaki, Japan, 2Department of Pediatrics, 2nd Affiliated Hospital of China Medical University, Shenyang, China, and 3Department of Biological Sciences, Florida Atlantic University, Boca Raton, FL, USA KANEZAKI, R., TOKI, T., XU, G., NARAYANAN, R. and ITO, E. Cloning and Character- ization of the Novel Chimeric Gene p53/FXR2 in the Acute Megakaryoblastic Leukemia Cell Line CMK11-5. Tohoku J. Exp. Med., 2006, 209 (3), 169-180 ── The loss of p53 function is a key event in tumorigenesis. Inactivation of p53 in primary tumors and cell lines is mediated by several molecular mechanisms, including deletions and rearrange- ments. However, generation of a p53 fusion gene has not yet been reported. Here we report a novel p53/an autosomal homolog of the fragile X mental retardation (FXR2) chimeric gene generated by an interstitial deletion. Western blot analyses have shown that the p53/FXR2 protein is indeed expressed in a Down syndrome-related acute megakaryo- blastic leukemia cell line, CMK11-5 cells. To investigate the properties of the p53/FXR2 protein, we observed its subcellular localization. Flag-tagged expression vectors were transfected into COS-7 cells and the proteins were stained with an anti-Flag antibody. The p53/FXR2 protein was expressed at high levels in the cytoplasm, whereas wild-type p53 and FXR2 were localized primarily in the nucleus and in the periphery of the nucleus, respectively. Treatment with a topoisomerase II inhibitor, VP16, failed to induce expres- sion of a p53 target gene, the cyclin-dependent kinase inhibitor p21WAF-1/CIP1, in CMK11-5 cells, and transient transfection analysis showed that the p53/FXR2 protein failed to trans- activate the p21WAF-1/CIP1 promoter. These results suggest that the p53/FXR2 fusion protein lacks the ability of wild-type p53 to function as a transcription factor. The p53/FXR2 gene is the first reported p53 fusion gene. ──── p53; FXR2; acute megakaryoblastic leuke- mia; Down syndrome; fusion protein © 2006 Tohoku University Medical Press Received March 14, 2006; revision accepted for publication April 8, 2006. Correspondence: Etsuro Ito, M.D., Department of Pediatrics, Hirosaki University School of Medicine, Hirosaki 036-8563, Japan. e-mail: [email protected] 169 170 R. Kanezaki et al. Expression of p53/FXR2 Fusion Protein in Leukemic Cells 171 The p53 tumor suppressor gene plays a criti- Recently, acquired mutations of the GATA1 gene cal role in regulating cell proliferation, mainly have been detected in almost all cases of TMD through induction of growth arrest or apoptosis. and Down syndrome-related AMKL (DS-AMKL), p53 is a nuclear phosphoprotein induced in suggesting that other genetic changes contribute response to cellular stress such as DNA damage to the development of AMKL in TMD (Wechsler from radiation or alkylating agents. It binds DNA et al. 2002; Mundschau et al. 2003; Groet et al. in a sequence-specific manner to activate 2003; Hitzler et al. 2003; Rainis et al. 2003; Xu et transcription of a number of genes, including al. 2003). It was reported that p53 mutations p21WAF-1/CIP1, mouse double mitute 2 homolog might be involved in the evolution from TMD to (MDM2), and BCL2-associated X protein (BAX) AMKL, because two out of three AMKL patients (Kirsch and Kastan 1998). The loss of p53 func- harbored p53 mutations, but none of the seven tion is a key event in tumorigenesis and is associ- TMD harbored them (Malkin et al. 2000). ated with various characteristics of tumors, To understand the role of p53 mutations in including deregulation of the cell cycle, genomic the evolution of DS-AMKL, we analyzed p53 instability, and resistance to chemotherapy (Harris mutations in the DS-AMKL cell lines. Previously, 1996; Kirsch and Kastan 1998). The p53 gene is Sugimoto et al. (1992) reported the complete lack frequently mutated in solid tumors (Harris 1996; of p53 gene expression due to gross rearrange- Sakaguchi et al. 2005). p53 mutations are less ments and loss of normal p53 alleles in the DS- frequent in hematological malignancies. AMKL cell line CMK. However, in this study we Nevertheless, in these tumors a strong correlation report that a fusion gene containing p53 and an was found associating p53 mutations with unfa- autosomal homolog of the fragile X mental retar- vorable prognostic factors and resistance to che- dation gene (FXR2) (Zhang et al. 1995) was motherapy (Krug et al. 2002). expressed in CMK11-5 cells. The p53/FXR2 Inactivation of p53 in primary tumors and fusion protein lacks the ability of wild-type p53 to cell lines is mediated by several molecular mecha- function as a transcription factor. The p53/FXR2 nisms. The most frequent mechanisms by which gene is the first reportedp53 fusion gene. the wild-type p53 is inactivated in primary human tumors are point mutations. It has been recently MATERIALS AND METHODS observed that p53 gene alterations often emerge Rapid amplification of cDNA 3´ ends (3´RACE) in cell lines, even though the original tumor cells Poly A+ RNA was extracted from CMK11-5 with a expressed wild-type p53. A relapse specimen car- Quick prep micro mRNA purification kit (Amersham ried an identical mutation to that of the derived Biosciences, Piscataway, NJ, USA). A Marathon cDNA cell line. It was suggested that a p53 alteration in amplification kit (Clontech, Mountain View, CA, USA) a minor clone may confer a survival advantage to was used for the cDNA synthesis. 3´RACE was these malignant cells in vitro and presumably also performed with the following primers, p53 S1 (5´ in vivo (Drexler 2004). Another mechanism of GACACTTTGCGTTCGGGCTGGGAG 3´; for the first p53 inactivation is through deletions and rear- polymerase chair reaction [PCR]) and p53 S (5´ TCTGTCCCCCTTGCCGTCCCA 3´; for the nested rangements in the p53 gene (Sugimoto et al. PCR). 3´RACE products were ligated into pCR2.1 plas- 1992). In cell lines, p53 gene expression was mids (Invitrogen, Carlsbad, CA, USA) and their inserts completely abrogated due to gross rearrangements were sequenced with an ABI PRISM Cycle sequencing and loss of normal p53 alleles. However, genera- kit (Applied Biosystems, Foster City, CA, USA). tion of a p53 fusion gene due to DNA rearrange- ments has not yet been reported. Reverse transcriptase-polymerase chain reaction (RT- Acute megakaryoblastic leukemia (AMKL) PCR) develops in approximately 20 to 30% of Down Total RNA was isolated using the Isogen according syndrome patients with transient myeloprolifera- to the manufacturer’s recommendations (Nippon gene, tive disorder (TMD) (Zipursky et al. 1992). Tokyo). The first-strand cDNA was synthesized from 1 170 R. Kanezaki et al. Expression of p53/FXR2 Fusion Protein in Leukemic Cells 171 μ g of total RNA using M-MLV reverse transcriptase CMV2 (Sigma, St. Louis, MO, USA). Obtained clones (GIBCO BRL, Rockville, MD, USA) with random prim- were confirmed by sequencing. ers. cDNAs were amplified with Ex Taq DNA poly- For the purpose of constructing expression vectors merase (TaKaRa, Ohtsu). The study was approved by without Flag tags, the full coding regions were cut out the Ethics Committee of Hirosaki University School of from the Flag tagged expression vectors with EcoRI and Medicine. All clinical samples were obtained with XbaI, and inserted into the EcoRI-XbaI site of pcDNA3.1 informed consent. (Invitrogen), resulting in p53 pcDNA3.1, FXR2 pcD- NA3.1, and p53/FXR2 pcDNA3.1. Expression vectors PCR with genomic DNA carrying the human T24 or mutated Ha-ras (pHO6T1 and Genomic DNA was extracted from CMK11-5. pHO6N1, respectively) were described previously Amplification of the p53/FXR2 fusion gene was (Spandidos and Wilkie 1984). performed with the primers; p53S (5´- For promoter assays, the luciferase reporter plasmid PICA p21–2.3k was constructed as follows. A fragment TCTGTCCCCCTTGCCGTCCCA-3´) and FXR2 AS1 WAF-1/CIP1 (5´-CTCCCCATAGATGCGGAAAGTGCA-3´) and with containing 2.3 kb of the p21 promoter region was an LA PCR kit (TaKaRa). PCR products were sequenced amplified from CMK11-5 genomic DNA by PCR using and the p53 break point was confirmed. the primers 5´-AGGGTACCAGGAACATGCTTGGGC AGC-3´ and 5´- TGAAGCTTCCGGCTCCACAAGGA ACTGA-3´. The PCR products were digested with KpnI Southern blotting and HindIII, then subcloned into the PICA gene basic Genomic DNA samples from CMK11-5, MGS, and vector (Toyo Ink., Tokyo). normal healthy subjects were digested with BamHI or SacI. The DNA fragments were electrophoresed in a 0.8% Tris-borate-EDTA buffer (TBE) agarose gel and Cell culture transferred to Hybond-N (Amersham Biosciences, The human megakaryoblastic cell lines CMK11-5 Piscataway, NJ, USA). Hybridizations were performed (Sato et al. 1989; Adachi et al. 1991) and MGS were with the 32P-labelled entire p53 coding region or with a 0.4 established from Down syndrome-related acute myeloid kb fragment of the FXR2 gene. The FXR2 fragment was leukemia (AML) patients. CMK11-5 was obtained from prepared as follows. The amplification products of the the Institute for Fermentation (Osaka). MGS was a gift p53/FXR2 genomic DNA (see PCR with genomic DNA) from Dr. Mitsui (Yamagata University School of were digested with HhaI, and the 0.4 kb fragment con- Medicine). The human myeloblastic leukemia cell line taining FXR2 exon 8 and its upstream was extracted from ML-1 was obtained from Hayashibara Biochemical gels and purified. Laboratories (Okayama). These lines were maintained in RPMI1640 with 10% fetal bovine serum (FBS).